Готові списки джерел за темами / Wyandra / Статті в журналах

Статті в журналах з теми "Wyandra"

Щоб переглянути інші типи публікацій з цієї теми, перейдіть за посиланням: Wyandra.
Автор: Grafiati
Опубліковано: 10 грудня 2022
Оновлено: 28 січня 2023

Оформте джерело за APA, MLA, Chicago, Harvard та іншими стилями

Оберіть тип джерела:

Ознайомтеся з топ-38 статей у журналах для дослідження на тему "Wyandra".

Біля кожної праці в переліку літератури доступна кнопка «Додати до бібліографії». Скористайтеся нею – і ми автоматично оформимо бібліографічне посилання на обрану працю в потрібному вам стилі цитування: APA, MLA, «Гарвард», «Чикаго», «Ванкувер» тощо.

Також ви можете завантажити повний текст наукової публікації у форматі «.pdf» та прочитати онлайн анотацію до роботи, якщо відповідні параметри наявні в метаданих.

Переглядайте статті в журналах для різних дисциплін та оформлюйте правильно вашу бібліографію.

1

Lonergan, T. P., P. G. Ryles, S. T. McClure, and D. W. McMillan. "THE TARBAT-IPUNDU OIL FIELD, A CASE STUDY IN IDENTIFYING BYPASSED OIL." APPEA Journal 38, no. 1 (1998): 36. http://dx.doi.org/10.1071/aj97002.

Повний текст джерела
Анотація:
Since 1995 the Tarbat-Ipundu Field has developed from a marginal 200 BOPD (31.8 kL/d) field with perceived limited growth potential to a developing resource with production up to 3,000 BOPD (476.9 kL/d). This increase was achieved through the efforts of a dedicated multidisciplinary team and an aggressive 'fit for purpose' drilling and evaluation program.The Tarbat-Ipundu Field is located in PL 52 of ATP 299P in southwestern Queensland, approximately 115 km to the northeast of the Jackson Oil Field. The field was discovered by Hartogen Energy Ltd in 1986 with the drilling of Ipundu 1 which came on-line at 100 BOPD (15.9 kL/d) from the Wyandra Sandstone and the Murta Member. The discovery well was followed by the drilling of Tarbat-1 in 1988 on a subculmination to the north. Tarbat-1 encountered oil in the Wyandra Sandstone but watered out after producing 17 KSTB (2,702 kL) of oil. During 1991 a further four wells were drilled in the Ipundu Field by the then operator, Ampolex Pty Ltd. Two of these wells were plugged and abandoned. In January 1994 the field was producing at 220 BOPD (34.9 kL/d) after a total production of 350 KSTB.The Santos Group acquired a majority interest and Operatorship of the Tarbat-Ipundu Field in 1994. An integrated geological and engineering evaluation of Tarbat-1, incorporating experience gained in other parts of the Eromanga Basin, indicated the potential for bypassed oil in the Hutton Sandstone. Similarly, additional potential was recognised in the Wyandra Sandstone and Murta Member in the Tarbat-Ipundu wells. To evaluate this potential Tarbat-2 was drilled in August 1995 at a location 315 m to the northwest of Tarbat-1. Drill stem tests in Tarbat-2 resulted in flows of 2,037 BOPD (323.8 kL/d) from a 26 m gross hydrocarbon column in the Hutton Sandstone and 770 BOPD (122.4 kL/d) from a 14 m gross hydrocarbon column in the Wyandra Sandstone.An aggressive appraisal and development program followed the drilling of Tarbat-2 which has resulted in the drilling of an additional 25 wells. Proved and Probable Oil in Place estimates have increased from 5.2 MMSTB (0.826 ML) in 1994 to 44.2 MMSTB (7.02 ML) in 1997. As at June 1997 the field produces oil from the WyandraSandstone, Murta Member and Hutton Sandstone of the Eromanga Basin. A combined oil offtake of up to 3,000 BOPD (476.9 kL/d) has been achieved from the field. Continued field development is planned for 1998.The successful 're-discovery' of the Tarbat-Ipundu Field illustrates the potential benefit of a systematic review and integration of all existing data via a multidisciplinary team. The increasing cost of new data acquisition makes it imperative that the existing data is thoroughly evaluated prior to the investment of further exploration capital. The Tarbat-Ipundu Field demonstrates the potential to add significant new reserves from focussed targeting and evaluation of potential bypassed hydrocarbon accumulations.
Стилі APA, Harvard, Vancouver, ISO та ін.
2

Newton, C. B. "THE TINTABURRA OILFIELD." APPEA Journal 26, no. 1 (1986): 334. http://dx.doi.org/10.1071/aj85029.

Повний текст джерела
Анотація:
The Tintaburra oilfield, discovered in December 1983 with the drilling of Tintaburra 1, is situated within Petroleum Lease 29 (previously within Authority to Prospect 299P Part 2) on the southeast margin of the Eromanga Basin, Queensland.Tintaburra 1 recorded the first flow of oil from the Cretaceous Wyandra Sandstone Member of the Cadnaowie Formation in the Eromanga Basin and established the presence of oil columns in the Murta Member and Hutton Sandstone. The Hutton Sandstone produced 1750 barrels of 44° API gravity oil per day on drill stem test.The results of six successful appraisal wells show the field to be a simple structural accumulation at the top Hutton level. The top Hutton accumulation is believed to be full to fault-independent closure. The hydrocarbons are trapped on the western upthrown side of the Tertiary reverse faulted Tintaburra Anticline. Approximately 80 per cent of reserves are reservoired in the top Hutton.The discovery extended the productive limits of the Eromanga Basin 100 km to the north and east from theJackson oilfield, and highlighted the potential of Tertiary structures, previously thought by many to be non-prospective.Channelling at the 'C' horizon (base Wallumbilla Formation) extends across the southern part of the field, complicating depth mapping by virtue of the large velocity contrasts between channel and host sediments. Velocity and raypath distortion below the channel are major geophysical complexities that have been successfully overcome, allowing more accurate location of appraisal wells.Appraisal drilling, combined with high quality seismic data, has identified the nature of the Early Cretaceous submarine channelling, and has identified new channel-related plays. 'C' horizon channelling imparts a strong stratigraphic component to the Murta and Wyandra accumulations. Integrated core and log studies indicate that every reservoir within fault-independent closure, and overlain by a laterally continuous effective seal, contains oil. Facies variations within the top Hutton/base Birkhead interval have important implications for trap integrity and are generally not resolvable seismically.The high API gravity, low pour point Wyandra and Murta crudes are distinct from the waxy, paraffinic Hutton crudes, and geochemical analysis of the oils and source rocks indicates a probable Eromanga-sequence origin for all the crudes.
Стилі APA, Harvard, Vancouver, ISO та ін.
3

Torkington, J., and M. I. Micenko. "A STRATIGRAPHIC ANALYSIS OF THE TALGEBERRY OILFIELD." APPEA Journal 28, no. 1 (1988): 113. http://dx.doi.org/10.1071/aj87011.

Повний текст джерела
Анотація:
ATP 299P(2) is located in the south-west Queensland portion of the Jurassic Cretaceous Eromanga Basin. Exploration drilling within the permit has resulted in the discovery of several oil pools which are stratigraphically controlled. Appraisal drilling at the Talgeberry Oilfield demonstrated this point when Talgeberry-2, drilled at a structurally higher location, failed to encounter either of the producing sands in Talgeberry-1. Oil is currently being produced from the Wyandra Sandstone and Birkhead Formation in Talgeberry-1 and from the Murta Member in Talgeberry-2.Depositional models are presented for each of the producing reservoirs at the Talgeberry Field, based upon dipmeter interpretation. An integrated seismic stratigraphic study was also undertaken on the Birkhead Formation reservoir.Oil production at Talgeberry is currently confined to distributary channel sands or near-shore distributary mouth bar sands. Distal facies of the distributary mouth bar have been intersected and, while containing oil, have been found to be generally tight.Dipmeter interpretation has proven valuable in determining depositional environment but is limited in defining the a real extent of the reservoir. Seismic-stratigraphic studies are able to define the reservoir geometry better and lead to a more comprehensive understanding of the depositonal environment.
Стилі APA, Harvard, Vancouver, ISO та ін.
4

Healy, Donald T. "Wyandot of Kansas." Raven: A Journal of Vexillology 3 (1996): 230. http://dx.doi.org/10.5840/raven1996/19973/4136.

Повний текст джерела
Стилі APA, Harvard, Vancouver, ISO та ін.
5

St-Onge, N., and K. M. Labelle. "Wyandot Nation of Kansas." Journal of American History 98, no. 4 (February 19, 2012): 1230–31. http://dx.doi.org/10.1093/jahist/jar646.

Повний текст джерела
Стилі APA, Harvard, Vancouver, ISO та ін.
6

Steckley, John. "En Ascensione Domini: Jesus triomphant le jour de son ascension comparé a un capitaine victorieux (à patre pierson) [On Ascension Day: Jesus triumphant the day of his ascension compared to a victorious captain]." Ethnohistory 69, no. 2 (April 1, 2022): 223–32. http://dx.doi.org/10.1215/00141801-9522207.

Повний текст джерела
Анотація:
Context This text was written in Wendat by Belgian Jesuit Father Philippe Pierson (1642–1688), who came to North America in 1666. From 1673 to 1683, he lived and worked with the Wyandot community in what is now the city of St. Ignace near the tip of the Upper Peninsula, Michigan, on the shores of Lake Huron. It is the first part (Potier 1920:539) of a four-page text incorporated into the voluminous collection of copying, editing, and writing of another Belgian Jesuit, Father Pierre Potier (1708–1781), who worked with the Wyandot in the Detroit area from 1744 until his death in 1781. His collection was eventually published as an Ontario Archive Report, which represents the culmination of the Jesuits more than century and a half work with the Wendat/Wyandot people and their language. Although Pierson lived with the Wyandot, he had been trained in the Wendat dialect among those people in their community Wendake, then referred to as Lorette, a little outside of what is now the city of Quebec. The Wyandot are a closely related people, whose communities at the time of first contact with the French were west of the territory of the Wendat, and close to the southern shores of Georgian Bay, Lake Huron. The French labelled them Petun because of their involvement in the tobacco trade. The Wendat called them Etionnontateronnon ‘people where there is a mountain or hill,’ owing to their proximity to Blue Mountain and other hills of the Niagara Escarpment. Both peoples were driven out of their homeland mid-17th century through European-allied struggles with the English-connected Haudenosaunee ‘they extend a house,’ known to English and French then as the Iroquois. The translation into English and linguistic analysis are my own, based on what I have learned about the language for over 45 years of work. The inspiration to dedicate my research to the study of an Indigenous language came from Fred Wheatley, an Anishinaabe elder. He ‘lost his tongue’ through his experience in residential schools but regained it from his grandmother. He then dedicated his life to passing on that teaching to others, including me. When I learned that the Wendat people had ‘lost their tongue,’ but that the language was well-recorded and analysed in Jesuit writing, I knew what my life’s work would be.
Стилі APA, Harvard, Vancouver, ISO та ін.
7

Kelly, Mckelvey. "Forty Narratives in the Wyandot Language." Ethnohistory 69, no. 1 (January 1, 2022): 123–24. http://dx.doi.org/10.1215/00141801-9404283.

Повний текст джерела
Стилі APA, Harvard, Vancouver, ISO та ін.
8

Garrad, Charles. "The Route and Purpose of Champlain’s Journey to the Petun in 1616." Ontario History 107, no. 2 (July 24, 2018): 159–78. http://dx.doi.org/10.7202/1050633ar.

Повний текст джерела
Анотація:
The route taken by Samuel de Champlain and party in 1616, during which he encountered Cheveux-relevés-Odawa and Petun-Wyandot peoples, and also some visiting Neutrals, is again considered. Previous conclusions are confirmed. That Champlain’s purpose was to proceed to the Neutrals, and possibly further to China, and his reasons for not doing so, are suggested.
Стилі APA, Harvard, Vancouver, ISO та ін.
9

Kenneth C. Carstens. "The Eighteenth-Century Wyandot: A Clan-Based Study." Michigan Historical Review 40, no. 2 (2014): 133–34. http://dx.doi.org/10.1353/mhr.2014.0042.

Повний текст джерела
Стилі APA, Harvard, Vancouver, ISO та ін.
10

Walsh, Martin W. "The "Heathen Party": Methodist Observation of the Ohio Wyandot." American Indian Quarterly 16, no. 2 (1992): 189. http://dx.doi.org/10.2307/1185429.

Повний текст джерела
Стилі APA, Harvard, Vancouver, ISO та ін.
11

Lee, Sungwoo, Tae-Hwan Jun, Leah K. McHale, Andrew P. Michel, Anne E. Dorrance, Qijian Song, and M. A. Rouf Mian. "Registration of Wyandot × PI 567301B Soybean Recombinant Inbred Line Population." Journal of Plant Registrations 11, no. 3 (May 18, 2017): 324–27. http://dx.doi.org/10.3198/jpr2016.09.0042crmp.

Повний текст джерела
Стилі APA, Harvard, Vancouver, ISO та ін.
12

Warrick, Gary. "The Eighteenth-Century Wyandot: A Clan-Based Study by John Steckley." Ontario History 106, no. 2 (2014): 275. http://dx.doi.org/10.7202/1050701ar.

Повний текст джерела
Стилі APA, Harvard, Vancouver, ISO та ін.
13

Tucker, Patrick M. "The mysterious ruins: Rescuing the Spafford farmstead from the forgotten war of 1812." North American Archaeologist 39, no. 2 (April 2018): 87–130. http://dx.doi.org/10.1177/0197693118772593.

Повний текст джерела
Анотація:
The Amos Spafford farmstead (33Wo50) of Port Miami in northwest Ohio disappeared from the historical record after the War of 1812. Port Miami, a Franco-American village, was the first U.S. federal customs facility established in Ohio in 1805. It was destroyed in 1812 by a British and Native American detachment led by Captain Peter Latouche Chambers (British 41st Regiment of Foot), the Shawnee leader Tecumseh, and the Wyandot leader Roundhead. Port Miami’s destruction became lost over the years to the historical memory and consciousness of Ohio. Salvage excavations of the Spafford farmstead (1810–1823) in 1977 and its history provide an archaeological window within which to view Port Miami’s obliteration and its recovery to the community heritage of the state.
Стилі APA, Harvard, Vancouver, ISO та ін.
14

Mian, M. A. Rouf, Leah K. McHale, Andy P. Michel, and Anne E. Dorrance. "Registration of ‘Wyandot-14’ Soybean with Resistance to Soybean Aphid and Powdery Mildew." Journal of Plant Registrations 10, no. 3 (May 31, 2016): 246–50. http://dx.doi.org/10.3198/jpr2015.09.0059crc.

Повний текст джерела
Стилі APA, Harvard, Vancouver, ISO та ін.
15

Hawkins, Alicia L., and Louis Lesage. "HURON-WENDAT ARCHAEOLOGICAL HERITAGE: BUILDING RELATIONSHIPS TOWARDS COLLABORATION." História: Questões & Debates 66, no. 2 (August 2, 2018): 111. http://dx.doi.org/10.5380/his.v66i2.60816.

Повний текст джерела
Анотація:
Existe uma história longa de estudo acadêmico do povo Huron-Wendat no século dezessete no Ontario. Apesar disso, é muito recente o engajamento dos arqueólogos e de outros acadêmicos com a comunidade Huron-Wendat em relação às escavações de sítios Huron-Wendat no Ontario. Este engajamento constitui um primeiro passo, porém não representa uma verdadeira colaboração considerando que na maioria dos casos as investigações não são parcerias e não se baseiam em perguntas diretamente formuladas pelos membros da Nação. Em 2015, para marcar o aniversario de quatrocentos anos da chegada de Champlain no Ontario, membros da Nação Huron-Wendat e arqueólogos co-organizaram um colóquio sobre temas de grande interesse para a Nação, incluindo a relação com os “St. Lawrence Iroquoians,” os Wendat e a história dos Wyandot depois de 1650, assim como análises bio-arqueológicas. Este artigo apresenta uma breve história da pesquisa arqueológica sobre o passado dos Huron-Wendat e revela alguns novos, e mais colaborativos, caminhos de pesquisas presentes e futuras.
Стилі APA, Harvard, Vancouver, ISO та ін.
16

Sturtevant, Andrew. "The Eighteenth-Century Wyandot: A Clan-Based Study, by John L. SteckleyThe Eighteenth-Century Wyandot: A Clan-Based Study, by John L. Steckley. Waterloo, Wilfrid Laurier University Press, 2014. 305 pp. $85.00 Cdn (cloth)." Canadian Journal of History 50, no. 1 (April 2015): 160–62. http://dx.doi.org/10.3138/cjh.50.1.160.

Повний текст джерела
Стилі APA, Harvard, Vancouver, ISO та ін.
17

Toups. "More Than Just a Missionary: The Jesuits, the Wyandot, and Colonial Crises in French Detroit, 1728-1751." Michigan Historical Review 46, no. 1 (2020): 1. http://dx.doi.org/10.5342/michhistrevi.46.1.0001.

Повний текст джерела
Стилі APA, Harvard, Vancouver, ISO та ін.
18

Redmond, Brian G., and Kenneth B. Tankersley. "Evidence of Early Paleoindian Bone Modification and Use at the Sheriden Cave Site (33WY252), Wyandot County, Ohio." American Antiquity 70, no. 3 (July 2005): 503–26. http://dx.doi.org/10.2307/40035311.

Повний текст джерела
Анотація:
The analysis of osseous (bone, antler, or ivory) beveled shafts or “rods” has become an important focus in the study of early Paleoindian tool technology. Since 1995 two carved and beveled bone rods have been recovered from Sheriden Cave in northwest Ohio in depositional strata that are radiocarbon dated to between 11,060 and 10,400 radiocarbon years B.P. These strata also contained a small, reworked, Gainey-style fluted point; cut and burned animal bone; and the remains of flat-headed peccary, caribou, giant beaver, and other taxa. The tapered tips and overall morphology of the bone rods demonstrate that they served as projectile points as opposed to other functional types such as foreshafts. Microscopic and radiographic examinations of the bone points reveal that they were manufactured from split sections of mega-mammal bone. These artifacts resemble bone and ivory points found at early Paleoindian sites in western North America and northern Florida but also bear significant morphological similarities to bone sagaie or javelin tips known from Upper Paleolithic sites in Europe. The close spatial and temporal associations between the Sheriden Cave artifacts suggest that they represent the remains of an early Paleoindian tool cache within a small resource extraction campsite.
Стилі APA, Harvard, Vancouver, ISO та ін.
19

Toups, Eric. "More Than Just a Missionary: The Jesuits, the Wyandot, and Colonial Crises in French Detroit, 1728-1751." Michigan Historical Review 46, no. 1 (2020): 1–28. http://dx.doi.org/10.1353/mhr.2020.0031.

Повний текст джерела
Стилі APA, Harvard, Vancouver, ISO та ін.
20

Lozier, Jean-François. "The Eighteenth-Century Wyandot: A Clan-Based Study, John L. Steckley. Wilfrid Laurier University Press, Waterloo, 2013, 305 p." Recherches amérindiennes au Québec 44, no. 2-3 (2014): 180. http://dx.doi.org/10.7202/1030986ar.

Повний текст джерела
Стилі APA, Harvard, Vancouver, ISO та ін.
21

Ings, S. J. "Diagenesis and porosity reduction in the Late Cretaceous Wyandot Formation, Offshore Nova Scotia: a comparison with Norwegian North Sea chalks." Bulletin of Canadian Petroleum Geology 53, no. 3 (September 1, 2005): 237–49. http://dx.doi.org/10.2113/53.3.237.

Повний текст джерела
Стилі APA, Harvard, Vancouver, ISO та ін.
22

Haefner, Ralph J., Joseph J. Mancuso, Joseph P. Frizado, Kevin L. Shelton, and Jay M. Gregg. "Crystallization temperatures and stable isotope compositions of mississippi valley-type carbonates and sulfides of the Trenton Limestone, Wyandot County, Ohio." Economic Geology 83, no. 5 (August 1, 1988): 1061–69. http://dx.doi.org/10.2113/gsecongeo.83.5.1061.

Повний текст джерела
Стилі APA, Harvard, Vancouver, ISO та ін.
23

Kang, Sung-Taeg, and M. A. Rouf Mian. "Genetic map of the powdery mildew resistance gene in soybean PI 243540." Genome 53, no. 5 (May 2010): 400–405. http://dx.doi.org/10.1139/g10-015.

Повний текст джерела
Анотація:
Powdery mildew (caused by Microsphaera diffusa Cooke & Peck) is a common disease of soybean in many soybean-growing regions of the world and under greenhouse conditions. The previously reported Rmd locus of soybean for resistance to powdery mildew was mapped on soybean molecular linkage group J (chromosome 16). We have discovered a single dominant gene in PI 243540 that provides season-long resistance to powdery mildew. The objective of this study was to map the powdery mildew resistance gene in PI 243540 with PCR-based molecular markers. One hundred eighty-four F2 plants and their F2:3 families from a cross between the powdery mildew susceptible cultivar ‘Wyandot’ and PI 243540 were screened with M. diffusa in greenhouses. Bulked segregant analysis (BSA) with SSR markers was used to identify the tentative genomic location of the gene. The BSA localized the gene to a genomic region in soybean chromosome 16. A linkage map with seven SSR and six SNP markers flanking the gene was constructed. We positioned the gene between SSR marker Sat_224 and SNP marker BARC-021875-04228 at distances of 9.6 and 1.3 cM from the markers, respectively. The map position of the gene was slightly different from previously reported map positions of the only known Rmd locus. We have mapped a single dominant gene, tentatively called Rmd_PI243540, near the previously known Rmd locus on chromosome 16. The molecular markers flanking the gene will be useful for marker-assisted selection of this gene.
Стилі APA, Harvard, Vancouver, ISO та ін.
24

Shaler, Andrew. "The Cherokee and Wyandot Companies on the Overland Trails to California: Histories of Indigenous Migration and the Settler Gaze, 1849–1856." Journal of the Civil War Era 11, no. 1 (2021): 9–35. http://dx.doi.org/10.1353/cwe.2021.0002.

Повний текст джерела
Стилі APA, Harvard, Vancouver, ISO та ін.
25

Warrick, Gary. "Petun to Wyandot: The Ontario Petun from the Sixteenth Century by Charles Garrad, edited by Jean-Luc Pilon and William Fox." Ontario History 107, no. 1 (2015): 139. http://dx.doi.org/10.7202/1050686ar.

Повний текст джерела
Стилі APA, Harvard, Vancouver, ISO та ін.
26

Bontrager, Shannon. "“From a Nation of Drunkards, We Have Become a Sober People”: The Wyandot Experience in the Ohio Valley during the Early Republic." Journal of the Early Republic 32, no. 4 (2012): 603–32. http://dx.doi.org/10.1353/jer.2012.0090.

Повний текст джерела
Стилі APA, Harvard, Vancouver, ISO та ін.
27

Verma, Sumit, Satinder Chopra, Thang Ha, and Fangyu Li. "A review of some amplitude-based seismic geometric attributes and their applications." Interpretation 10, no. 1 (January 12, 2022): B1—B12. http://dx.doi.org/10.1190/int-2021-0136.1.

Повний текст джерела
Анотація:
Seismic interpreters frequently use seismic geometric attributes, such as coherence, dip, curvature, and aberrancy for defining geologic features, including faults, channels, angular unconformities, etc. Some of the commonly used coherence attributes, such as cross correlation or energy-ratio similarity, are sensitive to only waveform shape changes, whereas the dip, curvature, and aberrancy attributes are based on changes in reflector dips. There is another category of seismic attributes, which includes attributes that are sensitive to amplitude values. Root-mean-square amplitude is one of the better-known amplitude-based attributes, whereas coherent energy, Sobel-filter similarity, normalized amplitude gradients, and amplitude curvature are among lesser-known amplitude-based attributes. We have computed not-so-common amplitude-based attributes on the Penobscot seismic survey from the Nova Scotia continental shelf consisting of the east coast of Canada, to bring out their interpretive value. We analyze seismic attributes at the level of the top of the Wyandot Formation that exhibits different geologic features, including a synthetic transfer zone with two primary faults and several secondary faults, polygonal faults associated with differential compaction, as well as fixtures related to basement-related faults. The application of the amplitude-based seismic attributes defines such features accurately. We take these applications forward by describing a situation in which some geologic features do not display any bending of reflectors but only exhibit changes in amplitude. One such example is the Cretaceous Cree Sand channels present in the same 3D seismic survey used for the previous applications. We compute amplitude curvature attributes and identify the channels, whereas these channels are not visible on the structural curvature display. In both of the applications, we observe that appropriate corendering not-so-common amplitude-based seismic attributes lead to convincing displays, which can be of immense aid in seismic interpretation and help define the different subsurface features with more clarity.
Стилі APA, Harvard, Vancouver, ISO та ін.
28

Kang, S. T., and M. A. Rouf Mian. "Powdery mildew resistance in soybean PI 243540 is controlled by a single dominant gene." Canadian Journal of Plant Science 90, no. 6 (December 1, 2010): 939–42. http://dx.doi.org/10.4141/cjps09070.

Повний текст джерела
Анотація:
Powdery mildew (Microsphaera diffusa Cooke & Peck) is a common disease of soybean in many countries of the world, including the northern United States of America and parts of Canada. The genetic resistance of soybean to M. diffusa is known to be controlled by a single locus with three alleles designated as Rmd, Rmd-c and rmd. Identification and characterization of sources of resistance is a prerequisite for the development of resistant cultivars. The objective of this study was to determine the inheritance of powdery mildew resistance in a plant introduction (PI) from Japan, PI 243540. The inheritance of powdery mildew was determined in a segregating population from a cross between powdery mildew susceptible Ohio cultivar Wyandot and PI 243540. The parents and the progeny showed a consistent response to powdery mildew for all growth stages of plants. The two parents, the F1, F2, and F2:3 families from the cross were screened in a greenhouse and field following inoculation with M. diffusa. All F1 plants were resistant to M. diffusa and χ2 analysis for segregation in the population of 343 F2 plants indicated a tight fit for a 3:1 (P = 0.78) ratio, indicative of a single dominant gene. In the next generation, the 334 F2-derived families fit an expected 1 resistant:2 segregating:1 susceptible segregation ratio (P =0.88), which confirmed the results obtained in the F2 generation. Our results indicate that the powdery mildew resistance derived from PI 243540 is controlled by a single dominant gene linked to the Rmd/ Rmd-c/rmd locus. The simple inheritance of this gene should make it relatively easy to find linked DNA markers and transfer the gene to susceptible elite cultivars using the backcross breeding approach.
Стилі APA, Harvard, Vancouver, ISO та ін.
29

Barber, John C. K. "Atlas of human chromosome heteromorphisms, by Wyandt HE, Tonk VS (eds), 2004, Kluwer, Dordrecht, ISBN 1-4020-1303-5, £97.00, $154.00, hardcover." Human Genetics 117, no. 4 (May 24, 2005): 404–5. http://dx.doi.org/10.1007/s00439-005-1293-0.

Повний текст джерела
Стилі APA, Harvard, Vancouver, ISO та ін.
30

Phillips, C., and D. McIlroy. "Ichnofabrics and biologically mediated changes in clay mineral assemblages from a deep-water, fine-grained, calcareous sedimentary succession: an example from the Upper Cretaceous Wyandot Formation, offshore Nova Scotia." Bulletin of Canadian Petroleum Geology 58, no. 3 (September 1, 2010): 203–18. http://dx.doi.org/10.2113/gscpgbull.58.3.203.

Повний текст джерела
Стилі APA, Harvard, Vancouver, ISO та ін.
31

Langlois, Alphonse J., Ronald C. Desrosiers, Mark G. Lewis, Vineet N. KewalRamani, Dan R. Littman, Ji Ying Zhou, Kelledy Manson, Michael S. Wyand, Dani P. Bolognesi, and David C. Montefiori. "Neutralizing Antibodies in Sera from Macaques Immunized with Attenuated Simian Immunodeficiency Virus." Journal of Virology 72, no. 8 (August 1, 1998): 6950–55. http://dx.doi.org/10.1128/jvi.72.8.6950-6955.1998.

Повний текст джерела
Анотація:
ABSTRACT Infection with attenuated simian immunodeficiency virus (SIV) in rhesus macaques has been shown to raise antibodies capable of neutralizing an animal challenge stock of primary SIVmac251 in CEMx174 cells that correlate with resistance to infection after experimental challenge with this virulent virus (M. S. Wyand, K. H. Manson, M. Garcia-Moll, D. C. Montefiori, and R. C. Desrosiers, J. Virol. 70:3724–3733, 1996). Here we show that these neutralizing antibodies are not detected in human and rhesus peripheral blood mononuclear cells (PBMC). In addition, neutralization of primary SIVmac251 in human and rhesus PBMC was rarely detected with plasma samples from a similar group of animals that had been infected either with SIVmac239Δnef for 1.5 years or with SIVmac239Δ3 for 3.2 years, although low-level neutralization was detected in CEMx174 cells. Potent neutralization was detected in CEMx174 cells when the latter plasma samples were assessed with laboratory-adapted SIVmac251. In contrast to primary SIVmac251, laboratory-adapted SIVmac251 did not replicate in human and rhesus PBMC despite its ability to utilize CCR5, Bonzo/STRL33, and BOB/gpr15 as coreceptors for virus entry. These results illustrate the importance of virus passage history and the choice of indicator cells for making assessments of neutralizing antibodies to lentiviruses such as SIV. They also demonstrate that primary SIVmac251 is less sensitive to neutralization in human and rhesus PBMC than it is in established cell lines. Results obtained in PBMC did not support a role for neutralizing antibodies as a mechanism of protection in animals immunized with attenuated SIV and challenged with primary SIVmac251.
Стилі APA, Harvard, Vancouver, ISO та ін.
32

Han, J., L. L. Domier, A. E. Dorrance, and F. Qu. "First Report of Soybean vein necrosis-associated virus in Ohio Soybean Fields." Plant Disease 97, no. 5 (May 2013): 693. http://dx.doi.org/10.1094/pdis-11-12-1050-pdn.

Повний текст джерела
Анотація:
Soybean vein necrosis-associated virus (SVNaV), a newly discovered tospovirus that infects soybean, was first described as widespread in a number of southern and midwestern states, but so far has not been reported in Ohio (1). Here we describe its occurrence in six different soybean leaf samples collected from five Ohio counties: Champaign, Hardin, Sandusky, Seneca, and Wyandot. Specifically, SVNaV was initially identified through a comprehensive survey during the summer of 2011 that used high throughput sequencing to detect genome sequences of viruses present in a pool of 110 field samples collected from 24 Ohio counties. Three assembled contigs, with sizes of 7,551, 4,937, and 1,554 nucleotides (nt) respectively, share 99% nt identity with the three SVNaV genomic RNAs (L, M, and S), and thus constitute partial sequences of the SVNaV Ohio (OH) isolate. The distribution of this virus was further delineated using reverse transcription (RT)-PCR with primers SVNaV-1734F (5′ CCATCTTTCTTTCCAGGCATTTCA 3′) and SVNaV-S-2421R (5′ GATTCAAGTTCAGCGAGTTCTACAA 3′). All plants from which the SVNaV-positive samples were collected showed typical virus symptoms, including systemic mosaic accompanied by leaf deformation, chlorosis, vein necrosis, and rusty spots on mature leaves. These symptoms are largely consistent with the previous report by Zhou and colleagues (1). Intriguingly, further analysis with RT-PCR revealed that five out of the six SVNaV-positive samples also contained a second virus, with Bean pod mottle virus found in four of the samples, and Tobacco ringspot virus in the fifth. Since it is not yet possible to initiate SVNaV infection mechanically, it is difficult to determine whether the co-infecting viruses contribute to the disease symptoms and yield losses. It should be noted that SVNaV may have been in Ohio for some time since symptoms similar to those reported by Zhou and colleagues (1) have been observed in soybean fields of this state since at least 2009. Furthermore, while in 2011 these symptoms were observed in only a few fields, as reflected by the detection of SVNaV in six of the 110 samples, the 2012 growing season has seen a big jump of symptomatic plants and fields. The current report confirms its presence with molecular evidence and lays the groundwork for further assessment of its impact on soybean production. Reference: (1) J. Zhou et al. Virus Genes 43:289, 2011.
Стилі APA, Harvard, Vancouver, ISO та ін.
33

Dorrance, A. E., D. T. Gordon, A. F. Schmitthenner, and C. R. Grau. "First Report of Bean pod mottle virus in Soybean in Ohio." Plant Disease 85, no. 9 (September 2001): 1029. http://dx.doi.org/10.1094/pdis.2001.85.9.1029a.

Повний текст джерела
Анотація:
Soybean has been increasing in importance and acreage over wheat and corn for the past decade in Ohio and is now planted on 4.5 million acres. Previous surveys in Ohio of viruses infecting soybean failed to identify Bean pod mottle virus (BPMV) and soybean virus diseases have rarely caused economic losses (1). During 1999, producers in Ohio noticed virus-like symptoms in soybeans in a few isolated locations. Soybeans with green stems, undersized and “turned up pods” were collected from Union, Wood and Wyandot Counties during October 1999 and soybeans with crinkled, mottled leaves were collected in Henry, Licking and Sandusky during August 2000. Five to six plants were collected from a single field from each county each year. In 1999, samples were sent to the University of Wisconsin-Madison, where one symptomatic leaflet/sample was ground in 3 ml of chilled phosphate buffered saline (pH 7.2). Leaf sap was placed in 1.5-ml centrifuge tubes and stored at 4°C for 24 h. Sap was assayed for the presence of BPMV using an alkaline phosphatase-labeled double-antibody sandwich enzyme-linked immunosorbent assay (DAS ELISA) for BPMV (AgDia Inc., Elkhart, IN). All samples tested were positive for BPMV. Samples collected in 1999 were also maintained at The Ohio State University in Harosoy soybean and in 2000 assayed serologically along with samples collected in 2000 for BPMV and Soybean mosaic virus (SMV) by ELISA and for Tobacco ringspot virus (TRSV) and Bean yellow mosaic virus (BYMV) by a host-range symptom assay; SMV, BYMV and TRSV had been identified from soybean in previous Ohio surveys. Soybean leaf samples were assayed using F(ab′)2-Protein A ELISA with antiserum prepared in 1968 to a southern U.S. isolate of BPMV and to an Ohio isolate of Soybean mosaic virus (SMV) prepared in 1967, both stored at −20°C. Diseased and non-symptomatic soybean leaf samples were ground in 4 ml 0.025M Tris pH 8.0, 0.015M NaCl and 0.05% Tween 20. Extracts were tested for BPMV and SMV by ELISA following a protocol described elsewhere (2). All of the samples collected during 1999 and maintained in the greenhouse tested positive for both BPMV and SMV while all of those samples collected during 2000 tested positive for BPMV and negative for SMV. Host-range symptom assays were conducted with leaf extracts prepared by grinding 1 g tissue:10 ml potassium phosphate buffer, pH 7.0. Extracts were inoculated by leaf rub method to Harosoy soybean, Phaseolus vulgaris cvs. Red Kidney and Bountiful, cowpea, and cucumber. The host-range symptom assays of both the 1999 and 2000 samples were negative for TRSV and BYMV; cowpea failed to express local lesions and cucumber systemic mosaic characteristic of TRSV infection and the two Phaseolus cultivars the yellow mosaic characteristic of BYMV infection. These results indicate that both BPMV and SMV were present in the samples in 1999 but only BPMV in 2000. The distribution of BPMV within Ohio and economic impact of this virus have yet to be determined. This is the first report of BPMV in Ohio. References: (1) A. F. Schmitthenner and D. T. Gordon. Phytopathology 59:1048, 1969. (2) R. Louie et al. Plant Dis. 84:1133–1139, 2000.
Стилі APA, Harvard, Vancouver, ISO та ін.
34

Cheboyina, Sreekhar, John O'Haver, and Christy M. Wyandt. "A mathematical model to predict the size of the pellets formed in freeze pelletization techniques: Parameters affecting pellet size**Sreekhar Cheboyina is a PhD student; John O'Haver is an Associate Professor, and Christy M. Wyandt is a Professor." Journal of Pharmaceutical Sciences 95, no. 1 (January 2006): 167–80. http://dx.doi.org/10.1002/jps.20524.

Повний текст джерела
Стилі APA, Harvard, Vancouver, ISO та ін.
35

Quandt, Richard E. "JAMES LAWTHER: The Finest Wines of Bordeaux: A Regional Guide to the Best Châteaux and Their Wines. Photography by Jon Wyand. University of California Press, Berkeley and Los Angeles, 2010, 320 pp., ISBN 978-0520266575, $39.95 (paperback)." Journal of Wine Economics 9, no. 3 (December 2014): 346–47. http://dx.doi.org/10.1017/jwe.2014.32.

Повний текст джерела
Стилі APA, Harvard, Vancouver, ISO та ін.
36

"The eighteenth-century Wyandot: a clan-based study." Choice Reviews Online 52, no. 02 (September 22, 2014): 52–1039. http://dx.doi.org/10.5860/choice.52-1039.

Повний текст джерела
Стилі APA, Harvard, Vancouver, ISO та ін.
37

Bhatnagar, Paritosh, Pierre Karam, and Sumit Verma. "Faults resembling channel-like features." Interpretation, August 17, 2021, 1–19. http://dx.doi.org/10.1190/int-2021-0074.1.

Повний текст джерела
Анотація:
We analyzed a synthetic transfer zone and its associated fault planes and relay ramp in Penobscot, a potential offshore field in the Scotian Basin. Transfer zones are structural areas where one fault dies out and another fault begins, forming a relay ramp in the middle. They can be categorized as divergent, convergent, and synthetic transfer zones depending on the relative location and dipping directions of the faults. These zones not only play an important role in fluid migration but also help interpreters delineate secondary features such as fractures, splay shears, and Riedel faults. Commonly those faults would branch into smaller splays and the relay ramp can get “breached” with connecting faults with the increase of slip. The study area in the Scotian basin is characterized by two major listric normal faults dipping in the same direction giving rise to a synthetic transfer zone. These faults are clearly visible on seismic attributes, including curvature and coherence slices extracted along the top of the Cretaceous Petrel Formation. However, when analyzing the seismic attributes along the overlying Wyandot Formation’s top, we observe channel-like features, which run parallel as well as at an angle to these faults. However, when we performed further analysis using seismic amplitude’s vertical slices, interpreted horizons, and seismic attributes, we found that these features are not channels. We divided the features into two types, the first is parallel to the main faults and can be associated with the grabens formed by synthetic and antithetic secondary faults (NE-SW). The second type is related to the polygonal faulting associated with differential compaction and gravitational loading of the Wyandot Chalk Formation. Apart from the two lineations, there are NNE-SSW oriented lineations which are an impression of basement faulting, and NNW-SSE oriented lineations representing acquisition footprint.
Стилі APA, Harvard, Vancouver, ISO та ін.
38

Ralph J. Haefner, Joseph J. Mancuso. "Mississippi Valley-Type Mineralization and Dolomitization in Trenton Formation, Wyandot County, Ohio: ABSTRACT." AAPG Bulletin 70 (1986). http://dx.doi.org/10.1306/94886a06-1704-11d7-8645000102c1865d.

Повний текст джерела
Стилі APA, Harvard, Vancouver, ISO та ін.
Також вас можуть зацікавити добірки на тему "Wyandra" для інших типів джерел:
Книги
Ми пропонуємо знижки на всі преміум-плани для авторів, чиї праці увійшли до тематичних добірок літератури. Зв'яжіться з нами, щоб отримати унікальний промокод!

До бібліографії