Добірка наукової літератури з теми "Transformation du cacao"

L’Accord international sur le cacao qui a initialement visé la régulation des prix a été modifié en 1993 et tend maintenant à l’harmonisation des politiques de production. En effet, le contexte a beaucoup changé : désengagement des Etats et complexification des rapports entre les Etats producteurs et les firmes de transformation, déplacement (relatif) des zones de production d’Amérique latine vers l’Afrique de l’ouest puis l’Asie, transformation accrue des fèves dans les pays producteurs, intégration verticale et concentration des firmes, disparition progressive de l’origine nationale de la qualité, globalisation des marques. Pour l’avenir, il faudrait de nouveaux instruments de couverture des risques et les changements dans les jeux d’acteurs devraient être davantage pris en compte.

ABSTRACT Transformation of Ri T-DNA Plasmid Agrobacterium rhizogenese to varieties Theobroma cacao variety TSH which is growing in west Sumatra and induction of hairy roots in order to produce bioflavonoid antioxidant compounds such as, catechin, polyfenol, or monomer and oligomer flavones was successfully obtained. Three spesies of A.rhizogenese (A4,LBA 9457 and ATTCC 15834) originaly from LIPI was used to transform Ri T-DNA plasmid in MS medium via cacao embryo culture. The aim of this paper is to determine the affectivity and ability of the three species of bacterial above to produce hairy roots in cacao invitro culture. The statistical methods RAL was uses with 4 time treatments and 6 time repeated experiments. As treatment was bacterial inoculation and without inoculation as a control. The transformation result shows 2 of 3 of bacterial species have ability to induce hairy roots of.T cacao embryos counting by percentages of explants with producing hairy roots 16.66% for A4, 83.33% for LBA 9547 spesies.qualitative test of polyfenol from hairy roots transformants give (+4) as compared to non transform only (+1). Cathechin compound was determined by spectrophotometer as much as 0.1% for non transform and 0.87 % for hairy roots transformants by LBA 9547. Conformation of plasmid Ri T-DNA hairy roots from two transformants was analysis by PCR methods. The two primers rol B1 (52ATGGATCCCAAATTGCTTCCCCCACGA32) dan rol B2 (53 TTAGG CTTTCATTCGGGTTTACTGCAGC 33) was used. For TR-DNA the primes used is TRI (53 GGAAATTGTGGCGTTGTTGTGGAC 3’) and TR2 (5’ AATCGTTCAGAGAGCGTCCGA AGTT 3’) . PCR analysis of DNA electrophoresis founded the band of TL region at 780 bp and TR at 1600 bp using DNA Ledder as DNA standard. Keywords : transformation A.rhizogenese, PCR, Theobroma cacao, kultur embrio, kultur akar rambut, metabolit sekunder, cathechin

Cacao (Theobroma cacao) beans are among the most important ingredients in food and beverage industries. They are mainly produced in tropical and subtropical forests. Africa is the biggest producer of cacao bean providers in the world and the Ivory Coast remains the world leader with an estimated yearly production of 3 million tonnes. Cacao beans are used in many food items such as chocolate products, cocoa butter, confectionary products, iced drinks, cocoa powder, etc. The quality and organoleptic characteristics of these food products are strongly related to those of the cocoa beans obtained from different processing treatments. The pulps surrounding the cacao beans are rich in water, sugars, pectins, proteins, minerals, vitamins, citric acid, and phenolic compounds. Many different processing methods are utilized and fermentation is a crucial postharvest treatment having a great influence on the quality of cacao beans and their related products. Spontaneous fermentation is a common practice carried out by the cacao farmers in Ivory Coast. The microorganisms involved in this process are primarily the yeasts (anaerobic phase), which convert the pulps containing sugars into alcohol with a sporicidal temperature increase and then the lactic and acetic acid bacteria (aerobic phase) that produce lactic and acetic acids, respectively. The degradation of the substrates inside the cacao pulps results in the generation of aroma precursors and compounds. The goal of this review was to elucidate the factors affecting the spontaneous fermentation of Ivorian cacao beans and clarify the transformation of the raw material during fermentation.

<p>ABSTRACT<br />One of the main constraints on cacao cultivation is disease and insect pest attacks causing significant yield loss. The main insect pests and diseases on cacao plantation are cacao pod borer, cacao<br />fruit rot, vascular streak dieback and cacao mirids (Helopeltis spp.). Conventional breeding method to obtain new cacao clones resistant to insect pests and diseases is a slow process. It may take 1520 years to obtain a new superior clone. Applying DNA technology should expedite cacao breeding program. The article described the application of DNA technology currently available to expedite cacao breeding program for disease and insect resistance. Many genes and quantitative trait loci (QTLs) of important traits have been discovered related to cacao plant productivity and yield quality, disease and insect pest resistance traits. Modern genomic technologies as well as DNA marker have also been applied in cacao breeding program. Genetic transformation technology has been explored its application for cacao improvement. With the development of modern genomic technology, important gene/QTL discoveries would be faster to accelerate insect pest and disease resistant cultivar development. All these new DNA technologies have been assessed their potential applications for coping important pest and disease and for yield improvement. DNA technologies, mainly MAS and genomic-data based breeding technologies are ready to be applied to support breeding programs for main pest and disease resistance to enhance Indonesian cacao productivity and quality.<br />Keywords: Cacao, disease and insect resistance, genomics, DNA markers, genetic transformation, marker-assisted breeding<br /><br /></p><p>Abstrak</p><p>Salah satu kendala utama dalam budi daya kakao ialah serangan hama dan penyakit. Hama dan penyakit utama kakao adalah penggerek buah kakao (PBK), busuk buah kakao (BBK), vascular streak dieback (VSD), dan cacao mirids (Helopeltis spp.). Kegiatan pemuliaan tanaman kakao secara konvensional berjalan lambat dan perlu waktu panjang. Untuk menghasilkan satu varietas unggul diperlukan waktu 15-20 tahun. Aplikasi teknologi DNA (genomika melalui pemuliaan berbantuan marka dan rekayasa genetik) dapat mempercepat program pemuliaan tanaman kakao. Tulisan ini mengulas teknologi DNA yang tersedia saat ini dan potensi aplikasinya untuk mempercepat pemuliaan kakao tahan hama dan penyakit. Penemuan marka DNA dan gen/quantitative trait loci (QTL) kakao berkembang cukup pesat. Banyak gen dan QTL karakter penting telah diidentifikasi yang terkait ketahanan hama dan penyakit serta produktivitas tanaman. Teknologi genomika dan pemanfaatan teknik marker-assisted selection (MAS) juga telah diaplikasikan untuk pemuliaan kakao termasuk untuk karakter ketahanan terhadap hama dan penyakit. Teknologi rekayasa genetik telah diteliti untuk menganalisis potensi pemanfaatannya dalam perbaikan bahan tanam kakao. Dengan berkembangnya teknologi genomika modern, penemuan gen/QTL unggul dapat dipercepat, lebih efisien dan komprehensif untuk mempercepat perakitan varietas unggul kakao tahan hama dan penyakit. Teknologi DNA khususnya MAS dan pemuliaan berbasis data genom siap diaplikasikan untuk mendukung program perbaikan ketahanan tanaman kakao terhadap hama dan penyakit utama dalam rangka peningkatan produktivitas dan mutu kakao nasional. <br /><br /></p>

Polyphenols have increasingly been studied for their influence on cardiometabolic health. Since cacao and chocolate can be a rich source of polyphenols, they too have been investigated for their supposed health benefits. In the first part of this paper the history of the food and medicinal uses of the cacao plant was briefly examined. A particular emphasis has been placed on the analysis of the process of transformation of the cacao seed into chocolate, since many of the processing steps involved have important consequences on the final product’s content in polyphenols and flavanols, and hence on the purported beneficial activity of chocolate. This evaluation is also of great importance in interpreting the results of the epidemiological and clinical studies. The relevant literature was surveyed in the second part of the paper, and the results for the consumption of polyphenol-rich chocolate are that it is well correlated to a reduction of the overall cardiovascular risk, and of arterial blood pressure in hypertensive subjects. Less corroborated are the positive effects on vascular endothelial health, on blood lipids and on lipid peroxidation. There are also preliminary but promising results for a positive action on insulin sensitivity, platelet function and inflammation. It remains to be seen whether and how these results can be translated into pragmatic guidelines on the health benefits of the consumption of commercial chocolate bars or products.

The presence of restriction enzymes in the transformation mixture improved the efficiency of transformation in Moniliophthora perniciosa. The influence of the vector shape (linear or circular), the patterns of plasmid integration in genomic sites and the influence of the promoter used to express the gene marker were also analyzed. The addition of BamHI or NotI increased the number of transformants by 3-10-fold and 3-fold, respectively, over the control without added enzyme. The use of pre-linearized plasmid did not increase the transformation efficiency in comparison with the circular plasmid. However, the frequency of multi-copy transformants increased significantly. The transformation procedure here reported resulted in better production of protoplasts and transformation efficiency. In addition, the time necessary for the detection of the first transformants and the number of insertions were reduced.

As current technology cannot cure cancer completely, prevention becomes the main choice. To prevent the development of cell transformation into cancer cells, polyphenols that are widely found in cocoa beans (Theobroma cacao) can be used. IFNγ plays an important role in immunity against cancer. This study aims to see the ability of cocoa beans ethanol extract to increase the number of IFNγ expression in Balb/c mice undergoing cell transformation. This study used three groups Balb/c (n=4), namely K1 (normal control), K2 (negative control: injected with benzopyrene without ethanol extract of cocoa beans), and K3 (treatment: injected with benzopyrene, given 4mg/30gBW/po/day ethanol extract of cocoa beans). The mice were biopsied, and IFNγ expression was examined by immune histochemical method. The results showed that IFNγ expression increased significantly in K3. It can be concluded that ethanol extract of cocoa beans could increase IFNγ expression in Balb/c mice undergoing cell transformation.

Theobroma cacao l. Est une espece ligneuse tres sensible aux contraintes phytosanitaires. La transformation genetique du cacaoyer permettrait de lui conferer rapidement des nouveaux caracteres, par exemple, de resistance a des pathogenes ou de qualite. Des essais de transformation genetique par agrobacterium tumefaciens ont ete tentes sur des embryons somatiques blesses et des cals embryogenes. Le protocole de transformation a ete etudie par etapes successives en se basant sur l'expression transitoire du gene uida puis, en associant les conditions les plus efficaces pour chacune des etapes prealablement etudiees. Un protocole de transformation genetique a pu etre ainsi propose et un pourcentage eleve d'embryons exprimant le gene uida de facon transitoire a ete observe. Une methode de decontamination originale a ete mise au point en associant l'immersion temporaire dans des unites de filtration sartorius a l'utilisation d'antibiotiques. Un agent selectif a egalement ete recherche afin de selectionner les eventuelles cellules transgeniques. Le protocole, ainsi defini n'a pas abouti a la regeneration de tissus transformes de facon stable. Par contre, l'association originale d'un protocole de cryocotraitement et de transformation genetique a permis l'obtention de cals resistants a la kanamycine et exprimants le gene uida de facon stable. La regeneration de ces cals est en cours d'etude.

Le cacao et le café sont les produits agricoles les plus échangés dans le monde. Ils subissent de nombreuses transformations post-récolte au niveau des pays producteurs (tropicaux) avant d'être exportés. Les procédés de traitements post-récolte diffèrent d'un pays à l'autre voire d'un agriculteur à l'autre. La transformation technologique du cacao en fèves marchandes et des grains de café en café vert nécessite un processus primaire de manutention. Ces pratiques participent et influencent, en général, la qualité marchande et organoleptique des produits destinés à la transformation. Notre hypothèse de travail est que les différents procédés de transformation post-récolte appliqués sur le café et le cacao ont une influence sur la structure des communautés microbiennes. L'objectif principal était de pouvoir mesurer cet effet en réalisant l'analyse globale des communautés microbienne en utilisant un outil de biologie moléculaire, la PCR-DGGE (Amplification par PCR couplée à l'électrophorèse sur gel en gradient dénaturant). Cette technique a été associée au séquençage afin d'identifier les espèces microbiennes majoritaires. Cette étude a montré que les communautés microbiennes associées aux grains de café et aux fèves de cacao varient au cours des différentes étapes pour chaque type de traitement post-récolte appliqué.Notre approche a permis de discriminer les voies de traitements, et l'origine géographique du café Camerounais et Indonésien. Notamment, nous avons montré que l'origine géographique et l'espèce de café utilisée ont un impact sur l'écologie microbienne du café moins important par rapport à celui du procédé. L'application au cacao nous a permis de relier l'analyse globale de l'écologie microbienne (DGGE) à l'analyse des composés volatils (SPME-GC-MS) afin de discriminer les différents traitements post-récolte. Des micro-fermentations ont été réalisées avec des souches microbiennes isolées du cacao (L. fermentum, A. pasteurianus, P. kudriavzevii et P. mashurica) dans le but d‘identifier l'origine des composés volatils détectés sur le cacao fermenté. Notre étude a contribué à montrer que la fermentation combinée à une courte durée de stockage avant fermentation est le procédé qui permet d'obtenir des fèves contenant plus de composés aromatiques désirables sur le cacao. Une analyse statistique a permis de combiner les résultats des deux types d'analyses (écologie microbienne et composés aromatiques) et de créer des relations entre les espèces détectées et les composés volatils présents. Les profils aromatiques identifiés ont permis d'envisager l'utilisation des souches testées comme starters de culture pour la fermentation du cacao
Cocoa and coffee are the most traded agricultural commodities in the world. They undergo many post-harvest transformations in producing countries (tropical) before being exported. Post-harvest processes differ from one country to another and from one production site to another. The technological transformation of cocoa on commercial beans and of coffee to green coffee requires a primary process handling. These practices play a crucial role in global and organoleptic quality of the products that will be processed. Our work hypothesis isthat different post-harvest processing applied to coffee and cocoa have an influence on the structure of microbial communities. The main objective was to measure this effect by performing a global analysis of microbial ecology using a molecular biology tool (PCR-DGGE, PCR amplification coupled to denaturing gradient gel electrophoresis). This technique allows variations in microbial communities to be detected and the main microbial species to be identified by sequencing.Our approach permitted to discriminate treatments, and the geographical origin of Cameroonian and Indonesian coffees. Notably, we showed that geographical origin and coffee species have a minor impact on the structure of the microbial communities when compared to the type of process used (wet or dry).By applying the approach to cocoa, we could link the global analysis of microbial ecology (PCR-DGGE) to the analysis of volatile compounds (SPME-GC-MS) to discriminate the different post-harvest treatments. Micro-fermentation were carried out with strains isolated from cocoa (L. fermentum, A. pasteurianus, P. kudriavzevii and P. mashurica) in order to identify the origin of the volatile compounds detected in the fermented cocoa. This study contributed to to show that fermentation combined with a short storage duration before fermentation is the best method to obtain cocoa beans with more desirable aromatic compounds. The statistical analysis was used to combine the results of the two types of analyzes (microbial ecology and aromatic compounds) and get relations between the detected microbial species and volatile compounds. The identified aromatic profiles prompted us to consider the use of the tested microbial strains as starter culture for cocoa fermentation

A cultura do cacaueiro (Theobroma cacao L.) na região sul da Bahia foi dizimada com a introdução do fungo Moniliophthora perniciosa. Novas fontes de resistência têm sido buscadas e alternativas são necessárias para assegurar a produção de cultivares considerando a variabilidade genética do patógeno. A descoberta de genes de resistência e de defesa presumíveis a partir de abordagens genômicas impõe a necessidade de estabelecimento de uma plataforma de análise funcional para comprovar a função dos genes identificados e/ou esclarecimento dos mecanismos envolvidos; isto requer o desenvolvimento de métodos de manipulação e/ou inserção de genes, permitindo a superexpressão ou silenciamento de genes de interesse. Os primeiros cacaueiros transgênicos só foram desenvolvidos a poucos anos, e a eficiência do processo ainda é limitada. Há grande influência genotípica na capacidade embriogênica, que reduz a eficiência de obtenção de transgênicos. Micro-Tom tem sido considerado um modelo para pesquisas em tomateiro, sendo uma cultivar miniatura, ciclo de vida curto, porte reduzido e de fácil transformação. MT pode ser usada no estudo da interação com o fungo M. perniciosa, visto a disponibilidade de isolados do biótipo-S que infectam o tomateiro, assim disponibilizando informações dos mecanismos de defesa do T. cacao a M. perniciosa em um menor tempo, suprindo alguns obstáculos encontrados nas características biológicas do cacaueiro. Considerando que durante a patogênese do cacaueiro, M. perniciosa é capaz de desencadear a morte celular programada no tecido infectado, foi analisada a hipótese de que a expressão de genes anti-apoptóticos diminuiria ou minimizaria os efeitos da infecção, permitindo uma menor susceptibilidade. Para tal, foi clonado o gene da proteína Bax-inhibitor-1, que atua como atenuador basal para a progressão da morte celular, e desenvolvida uma construção. Esse gene havia sido detectado numa biblioteca da interação M. perniciosa x T. cacao e identificado com sequência completa, e foi re-introduzido em tomateiro e cacaueiro sob controle de promotor constitutivo. Para o modelo genético MT, plantas transgênicas contendo Bax-inhibitor-1, SKP1 e Cafeína sintase foram obtidas. Plantas transgênicas de tomateiro contendo o gene Bax-inhibitor-1 foram inoculadas com M. perniciosa e demonstraram redução no número de plantas sintomáticas (40%), quando comparadas as plantas de MT inoculadas com o mesmo patógeno (83%). Esses dados corroboram com resultados das inoculações com os fungos necrotróficos B. cinerea, S. sclerotium e S. rolfsii, sendo que as plantas transgênicas inoculadas também apresentaram contenção dos sintomas dessas doenças, uma redução de 40% da área de infecção em comparação as plantas de MT infectadas. Desse modo, pode-se concluir que o gene Bax-inhibitor-1 em MT agiu de forma basal na atenuação da progressão da morte celular, reduzindo os sintomas da vassoura-de-bruxa, da mesma forma que esse transgene contribuiu na redução dos sintomas do mofo cinza, mofo branco e murcha-de-esclerócio, por conter o crescimento e desenvolvimento dos fungos inoculados em tomateiro. Foi possível otimizar o protocolo de embriogênese somática e de transformação genética de cacaueiro, o que levou a obtenção de plantas transgênicas contendo a construção Bax-inhibitor-1, confirmadas por RTqPCR. Indicando que a abordagem de transformação de cacaueiro está implementada no laboratório, porém a baixa eficiência do processo e o tempo necessário ainda impedem seu uso em larga escala para análise funcional
The cultivation of cocoa (Theobroma cacao L.) in south Bahia was decimated by the introduction of the fungus Moniliophthora perniciosa. New sources of resistance have been sought and alternatives are needed to ensure the production of cultivars considering the genetic variability of the pathogen. The discovery of genes for resistance and defense presumed from genomic approaches makes it necessary the establishment of a platform to verify the function of identified genes and/or the elucidation of the mechanisms involved; this requires the development of methods for manipulating and/or insertion of genes, allowing overexpressing or silencing of genes of interest. The first transgenic cocoa were only developed a few years ago, and the efficiency of the process is still limited. There is an expressive influence of the embryogenic capacity, which reduces the efficiency of obtaining transgenic plants. The cultivar Micro-Tom (MT) is considered a model for research on tomato, since it has a miniature size, short life cycle, and facile genetic transformation. MT can be used to study the interaction with the fungus M. perniciosa, since isolates of biotype-S are able to infect tomato, thus provinding inferences about defense mechanisms of T. cacao to M. perniciosa in a short time, providing some obstacles encountered in biological characteristics of cocoa. Since during the pathogenesis of cocoa, M. perniciosa is able to trigger programmed cell death in infected tissue, it was analyzed the hypothesis that the expression of anti-apoptotic genes diminish or minimize the effects of infection, allowing less susceptibility. To this end, was cloned the protein Bax-inhibitor-1, which acts as a basal attenuator for the progression of cell death, was cloned engineered in a vector for genetic transformation. This gene was detected in a library of interaction M. perniciosa x T. cacao and identified with the complete sequence, and was re-introduced into tomato and cocoa under the control of a constitutive promoter. For the genetic model MT, transgenic plants containing Bax-inhibitor-1, SKP1 and Caffeine synthase were obtained. Transgenic tomato plants containing the gene Bax-inhibitor-1 were inoculated with M. perniciosa and demonstrated a reduction in the number of symptomatic plants (40%) compared MT plants inoculated with the same pathogen (83%). These data corroborate results of inoculations with the necrotroph fungi B. cinerea, S. sclerotium e S. rolfsii. Thus, when transgenic plants were inoculated, it was observed a reduction of 40% in the area of infection, compared to infected MT plants. Taken together, the results indicate that the gene Bax-inhibitor-1 acted in the basal attenuation of progression of cell death in MT, reducing the symptoms of the witches\' broom disease, as well as the symptoms of gray mold, white mold and wilt esclerotia. Moreover it was possible to optimize the protocol for somatic embryogenesis and genetic transformation of cocoa, which led to the production of transgenic plants containing the construct Baxinhibitor- 1, confirmed by RT-qPCR. Although, a protocol for cocoa transformation was implemented in the laboratory, its the low efficiency and the time required still prevent its widespread use for functional analysis

Cette étude examine les implications de la responsabilité sociale des entreprises (RSE) des entreprises transnationales (ETN) appliquée à leurs chaînes de valeur. Prenant le cas d'un projet de certification de la durabilité du cacao UTZ au Ghana, l'étude analyse le processus de mise en œuvre d’un projet de la RSE et ses résultats localement. La chaîne mondiale du cacao et du chocolat (GCCC) est un cas particulièrement intéressant pour cette étude car elle est confrontée à des défis complexes en matière de durabilité, notamment l'extrême pauvreté des planteurs de cacao et la dégradation de l'environnement dans les zones de production. Par conséquent, des multiples projets de RSE se sont généralisés au cours des dernières décennies. L'étude interroge comment les stratégies de RSE affectent les conditions de durabilité et qui en bénéficie finalement. Ainsi, elle met l'accent sur les changements dans l'organisation du secteur cacao au niveau local au Ghana et sur les perspectives futures des planteurs de cacao. L'étude révèle que la RSE aide plutôt les ETN à accroître leur influence sur la production locale de cacao au lieu de surmonter les principaux défis de durabilité dans la GCCC
This study engages with the implications of a Corporate Social Responsibility (CSR) of Transnational Corporations (TNCs) in their supply chains. Taking the case of an UTZ cocoa sustainability certification project in Ghana, the study examines the implementation process of a transnational CSR intervention and its local outcomes. The Global Cocoa-Chocolate Chain (GCCC) is a particular interesting case for this study because the GCCC is facing complex sustainability challenges, most notably the extreme poverty of millions of cocoa farmers and environmental degradation in production areas, and therefore, CSR projects became widespread over the past decades. The study explores how CSR strategies affect sustainability conditions in a supply chain and who is finally benefitting from it. Thereby, it puts a particular emphasis on changes in the organization of the local level Ghana’s cocoa sector linked to CSR and in farmers perspectives. The study reveals that CSR rather helps TNCs to increase their influence over local cocoa production instead of overcoming key sustainability challenges in the GCCC

Moniliophthora perniciosa is a phytopathogenic basidiomycosis that affects cacao; alternatives for its control and resistance for its development have not given significant results. A new control alternative is the use of enzyme inhibitors from the chitin synthesis route. Therefore, this work aims to characterize and clone the enzymatic portion of Moniliophthora perniciosa chitin synthase as a tool to enable in vitro tests of the potential inhibitors of this phytopathogen. The complete chitin synthase sequence was analyzed; the transmembrane region, introns and UTRs were removed to design specific primers. PCR, sequencing, plasmid linearization (pET28a and pET42a) and their digestion of inserts for ligation were performed. The transformation was carried out by electroporation and thermal shock into E.coli DH5α and BL21 strains. Colony PCR, plasmid extraction and PCR were performed to confirm the transformed ones. There was positive amplification of the interest region with the designed primers, confirmed by sequencing and alignment with the chitin synthase sequence from GenBank. Digestion and binding to the pET42a vector were efficient. Despite the success in amplification, digestion and ligation, the colonies grown and transformed only contained empty vectors. Testing new vectors and new proportions with the already validated protocols for amplification, digestion and binding of the nucleotide sequence of M. perniciosa chitin synthase will allow an efficient transformation.

Since the early nineteenth century, cacao has been an important export earner for Ecuador. Today the importance of this sector remains, as Ecuador is the main producer and exporter of Fine and Flavor cacao worldwide. Motivated by the main transformations of the global food systems and the increasing demand for multidimensional credence attributes, this study examines the present state of Ecuador's cacao industry, identifies areas of opportunity, and discusses how the private and public sectors can work together to meet existing and emerging challenges. Findings are supported by interviews conducted with the principal actors in the Ecuadorian cacao industry and two case studies. The first case study focuses on how associativity can help cacao farmers producing high-quality beans to differentiate themselves and succeed in modern agri-food markets. The second case study explores the success of a local chocolate firm and its links with local cacao farmers. Findings suggest that market trends have created new business opportunities for cacao producers and chocolate processors. These opportunities are most open to firms who can personalize and differentiate their products, for example, through the use of quality certifications such as organic, fair trade, reduced carbon load, etc. More importantly, market developments are driving exporters to enhance the performance of cacao value chains in the country, but the sector requires coordination to capture reputation and credence-based demands for the local cacao.