Статті в журналах: "Local-position coding"

1

Gao, Guangwei, Jian Yang, Zhihui Lai, Pu Huang, Jielin Jiang, Hao Gao, and Dong Yue. "Nuclear norm regularized coding with local position-patch and nonlocal similarity for face hallucination." Digital Signal Processing 64 (May 2017): 107–20. http://dx.doi.org/10.1016/j.dsp.2017.02.009.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

2

Howard, Michael J., Nisha A. Cavanaugh, Vinod K. Batra, David D. Shock, William A. Beard та Samuel H. Wilson. "DNA polymerase β nucleotide-stabilized template misalignment fidelity depends on local sequence context". Journal of Biological Chemistry 295, № 2 (4 грудня 2019): 529–38. http://dx.doi.org/10.1074/jbc.ra119.010594.

Повний текст джерела

Анотація:

DNA polymerase β has two DNA-binding domains that interact with the opposite sides of short DNA gaps. These domains contribute two activities that modify the 5′ and 3′ margins of gapped DNA during base excision repair. DNA gaps greater than 1 nucleotide (nt) pose an architectural and logistical problem for the two domains to interact with their respective DNA termini. Here, crystallographic and kinetic analyses of 2-nt gap-filling DNA synthesis revealed that the fidelity of DNA synthesis depends on local sequence context. This was due to template dynamics that altered which of the two template nucleotides in the gap served as the coding nucleotide. We observed that, when a purine nucleotide was in the first coding position, DNA synthesis fidelity was similar to that observed with a 1-nt gap. However, when the initial templating nucleotide was a pyrimidine, fidelity was decreased. If the first templating nucleotide was a cytidine, there was a significantly higher probability that the downstream template nucleotide coded for the incoming nucleotide. This dNTP-stabilized misalignment reduced base substitution and frameshift deletion fidelities. A crystal structure of a binary DNA product complex revealed that the cytidine in the first templating site was in an extrahelical position, permitting the downstream template nucleotide to occupy the coding position. These results indicate that DNA polymerase β can induce a strain in the DNA that modulates the position of the coding nucleotide and thereby impacts the identity of the incoming nucleotide. Our findings demonstrate that “correct” DNA synthesis can result in errors when template dynamics induce coding ambiguity.

Стилі APA, Harvard, Vancouver, ISO та ін.

3

Wang, Bin, Yu Liu, Wei Wang, Wei Xu, and Maojun Zhang. "Multi-Scale Locality-Constrained Spatiotemporal Coding for Local Feature Based Human Action Recognition." Scientific World Journal 2013 (2013): 1–11. http://dx.doi.org/10.1155/2013/405645.

Повний текст джерела

Анотація:

We propose a Multiscale Locality-Constrained Spatiotemporal Coding (MLSC) method to improve the traditional bag of features (BoF) algorithm which ignores the spatiotemporal relationship of local features for human action recognition in video. To model this spatiotemporal relationship, MLSC involves the spatiotemporal position of local feature into feature coding processing. It projects local features into a sub space-time-volume (sub-STV) and encodes them with a locality-constrained linear coding. A group of sub-STV features obtained from one video with MLSC and max-pooling are used to classify this video. In classification stage, the Locality-Constrained Group Sparse Representation (LGSR) is adopted to utilize the intrinsic group information of these sub-STV features. The experimental results on KTH, Weizmann, and UCF sports datasets show that our method achieves better performance than the competing local spatiotemporal feature-based human action recognition methods.

Стилі APA, Harvard, Vancouver, ISO та ін.

4

Nguyen Thi, Hong, Yoshikazu Tanaka, Tuyen Vo Thi Minh, and Ham Le Huy. "Identification of some nucleotide mutations in Waxy gene (BGIOSGA022241) of a mutant rice line." Nuclear Science and Technology 8, no. 3 (September 1, 2021): 36–52. http://dx.doi.org/10.53747/jnst.v8i3.72.

Повний текст джерела

Анотація:

Waxy genes of the original variety and its mutant type were sequenced by Sanger method and compared through Nucleotide Basic Local Alignment Search Tool (BLASTN) to clarify differences. BLASTN result showed four nucleotide mutations in coding regions and 59 nucleotide mutations in noncoding regions. Four point mutations in coding regions were: the deletion of T/- at position 34 and the insertion of -/T between positions 70 and 71 in exon 3; the substitution of C/T at position 14 in exon 4 and the substitution of T/C at position 115 in exon 9. In 59 mutant nucleotides in non-coding regions, somesignificant alterations were list: the deletion of nucleotide G at the first of intron 6 and the addition of 32 nucleotides “GGGCCTGCGAAGAACTGGGAGAATGTGCTCCT” at the end of intron 12. For the first trial, a new DNA marker was developed based on the mutation C/T at at position 14 in exon 4 and the substitution of T/C at position 115 in exon 9 to improve efficiency of rice breeding relevant to Waxy gene.

Стилі APA, Harvard, Vancouver, ISO та ін.

5

Dai, Yongpeng, Tian Jin, Yongkun Song, Shilong Sun, and Chen Wu. "Convolutional Neural Network with Spatial-Variant Convolution Kernel." Remote Sensing 12, no. 17 (August 30, 2020): 2811. http://dx.doi.org/10.3390/rs12172811.

Повний текст джерела

Анотація:

Radar images suffer from the impact of sidelobes. Several sidelobe-suppressing methods including the convolutional neural network (CNN)-based one has been proposed. However, the point spread function (PSF) in the radar images is sometimes spatially variant and affects the performance of the CNN. We propose the spatial-variant convolutional neural network (SV-CNN) aimed at this problem. It will also perform well in other conditions when there are spatially variant features. The convolutional kernels of the CNN can detect motifs with some distinctive features and are invariant to the local position of the motifs. This makes the convolutional neural networks widely used in image processing fields such as image recognition, handwriting recognition, image super-resolution, and semantic segmentation. They also perform well in radar image enhancement. However, the local position invariant character might not be good for radar image enhancement, when features of motifs (also known as the point spread function in the radar imaging field) vary with the positions. In this paper, we proposed an SV-CNN with spatial-variant convolution kernels (SV-CK). Its function is illustrated through a special application of enhancing the radar images. After being trained using radar images with position-codings as the samples, the SV-CNN can enhance the radar images. Because the SV-CNN reads information of the local position contained in the position-coding, it performs better than the conventional CNN. The advance of the proposed SV-CNN is tested using both simulated and real radar images.

Стилі APA, Harvard, Vancouver, ISO та ін.

6

Li, Shuyi, Haigang Zhang, Yihua Shi, and Jinfeng Yang. "Novel Local Coding Algorithm for Finger Multimodal Feature Description and Recognition." Sensors 19, no. 9 (May 13, 2019): 2213. http://dx.doi.org/10.3390/s19092213.

Повний текст джерела

Анотація:

Recently, finger-based biometrics, including fingerprint (FP), finger-vein (FV) and finger-knuckle-print (FKP) with high convenience and user friendliness, have attracted much attention for personal identification. The features expression which is insensitive to illumination and pose variation are beneficial for finger trimodal recognition performance improvement. Therefore, exploring suitable method of reliable feature description is of great significance for developing finger-based biometric recognition system. In this paper, we first propose a correction approach for dealing with the pose inconsistency among the finger trimodal images, and then introduce a novel local coding-based feature expression method to further implement feature fusion of FP, FV, and FKP traits. First, for the coding scheme a bank of oriented Gabor filters is used for direction feature enhancement in finger images. Then, a generalized symmetric local graph structure (GSLGS) is developed to fully express the position and orientation relationships among neighborhood pixels. Experimental results on our own-built finger trimodal database show that the proposed coding-based approach achieves excellent performance in improving the matching accuracy and recognition efficiency.

Стилі APA, Harvard, Vancouver, ISO та ін.

7

Ostwald, Dirk, Judith M. Lam, Sheng Li, and Zoe Kourtzi. "Neural Coding of Global Form in the Human Visual Cortex." Journal of Neurophysiology 99, no. 5 (May 2008): 2456–69. http://dx.doi.org/10.1152/jn.01307.2007.

Повний текст джерела

Анотація:

Extensive psychophysical and computational work proposes that the perception of coherent and meaningful structures in natural images relies on neural processes that convert information about local edges in primary visual cortex to complex object features represented in the temporal cortex. However, the neural basis of these mid-level vision mechanisms in the human brain remains largely unknown. Here, we examine functional MRI (fMRI) selectivity for global forms in the human visual pathways using sensitive multivariate analysis methods that take advantage of information across brain activation patterns. We use Glass patterns, parametrically varying the perceived global form (concentric, radial, translational) while ensuring that the local statistics remain similar. Our findings show a continuum of integration processes that convert selectivity for local signals (orientation, position) in early visual areas to selectivity for global form structure in higher occipitotemporal areas. Interestingly, higher occipitotemporal areas discern differences in global form structure rather than low-level stimulus properties with higher accuracy than early visual areas while relying on information from smaller but more selective neural populations (smaller voxel pattern size), consistent with global pooling mechanisms of local orientation signals. These findings suggest that the human visual system uses a code of increasing efficiency across stages of analysis that is critical for the successful detection and recognition of objects in complex environments.

Стилі APA, Harvard, Vancouver, ISO та ін.

8

Shi, Jianli, Jin Zhang, Kun Wang, and Xin Fang. "Particle Swarm Optimization for Split Delivery Vehicle Routing Problem." Asia-Pacific Journal of Operational Research 35, no. 02 (April 2018): 1840006. http://dx.doi.org/10.1142/s0217595918400067.

Повний текст джерела

Анотація:

The split delivery vehicle routing problem (SDVRP) is a variation of the capacitated vehicle routing problem in which some customers may be served by more than one vehicle. We have proposed a particle swarm optimization approach that incorporates a local search to solve the SDVRP. An integer coding method was presented, and a decoding method based on Bellman’s equation was modified for the SDVRP. A way to address the differences in the length of the velocity vector, the position vector, the personal best position vector, the local best position vector and the global best position vector was designed. Two groups of local searches for top solutions were incorporated into the algorithm, with the ability to control whether they are executed on a given solution. The algorithm was initially tested using the modified Solomon’s instances to verify the parameters used, including the local search probability, the size of the swarm, the velocity equation and the length of the vectors. Extensive computational experiments were carried out on 131 benchmark instances available in the literature. The results obtained were competitive. More precisely, equally good solutions were found in 32 instances, and improved solutions were found in 35 instances, with an average improvement of 0.02% and a maximum improvement of 1.12%.

Стилі APA, Harvard, Vancouver, ISO та ін.

9

Buonomano, Dean V., and Michael Merzenich. "A Neural Network Model of Temporal Code Generation and Position-Invariant Pattern Recognition." Neural Computation 11, no. 1 (January 1, 1999): 103–16. http://dx.doi.org/10.1162/089976699300016836.

Повний текст джерела

Анотація:

Numerous studies have suggested that the brain may encode information in the temporal firing pattern of neurons. However, little is known regarding how information may come to be temporally encoded and about the potential computational advantages of temporal coding. Here, it is shown that local inhibition may underlie the temporal encoding of spatial images. As a result of inhibition, the response of a given cell can be significantly modulated by stimulus features outside its own receptive field. Feedforward and lateral inhibition can modulate both the firing rate and temporal features, such as latency. In this article, it is shown that a simple neural network model can use local inhibition to generate temporal codes of handwritten numbers. The temporal encoding of a spatial patterns has the interesting and computationally beneficial feature of exhibiting position invariance. This work demonstrates a manner by which the nervous system may generate temporal codes and shows that temporal encoding can be used to create position-invariant codes.

Стилі APA, Harvard, Vancouver, ISO та ін.

10

File-Muriel, Richard J., and Earl K. Brown. "The gradient nature ofs-lenition in Caleño Spanish." Language Variation and Change 23, no. 2 (June 10, 2011): 223–43. http://dx.doi.org/10.1017/s0954394511000056.

Повний текст джерела

Анотація:

AbstractWhereas previous studies of Spanishs-weakening have relied on impressionistic coding, the present study examines temporal and gradient acoustic details in the production of /s/ by eight females from Cali, Colombia, during sociolinguistic interviews. We propose a metric for quantifyings-realization by employing three scalar-dependent variables:s-duration, centroid, and voicelessness. The results of linear regressions indicate that the dependent variables are significantly conditioned by local speaking rate, word position, following and preceding phonological context, stress, and lexical frequency. This study sheds light on how each independent variable influencess-realization acoustically. For example, as local speaking rate increases, duration, centroid, and voicelessness decrease, which is indicative of lenition, and the same weakening tendency is observed when /s/ occurs in word-final position or is followed by a nonhigh vowel, whereas frequency contributes only tos-duration. We discuss the advantages of opting for instrumental measurements over symbolic representation.

Стилі APA, Harvard, Vancouver, ISO та ін.

11

Wong, Mathew Y. H. "PARTY COMPETITION AND IDEOLOGY IN HONG KONG: A NEW MANIFESTO CODING DATASET." Journal of East Asian Studies 20, no. 2 (April 15, 2020): 207–30. http://dx.doi.org/10.1017/jea.2020.3.

Повний текст джерела

Анотація:

AbstractThis study provides a new dataset on the ideological positions of political parties in Hong Kong, which is a hybrid regime with electoral elements. Using this dataset, the study challenges the non-ideological view of party competition in Hong Kong by identifying an ideological dimension to the elections held between 1998 and 2016. It is shown that parties do position themselves along an identifiable left–right spectrum, with shifts that can be meaningfully interpreted, and that the aggregate ideology of the electorate appears to be linked to the level of economic growth. The ideological dimension provides a novel perspective on local politics that looks beyond the dominant pro-democracy versus pro-Beijing divide while also shedding light on the recent changes underlying the latter. This study provides valuable objective data for analyzing political competition dynamics and contributes to the comparative literature by incorporating Hong Kong into the framework of the manifesto coding project.

Стилі APA, Harvard, Vancouver, ISO та ін.

12

Vidal-Gadea, A. G., X. J. Jing, D. Simpson, O. P. Dewhirst, Y. Kondoh, R. Allen, and P. L. Newland. "Coding Characteristics of Spiking Local Interneurons During Imposed Limb Movements in the Locust." Journal of Neurophysiology 103, no. 2 (February 2010): 603–15. http://dx.doi.org/10.1152/jn.00510.2009.

Повний текст джерела

Анотація:

The performance of adaptive behavior relies on continuous sensory feedback to produce relevant modifications to central motor patterns. The femoral chordotonal organ (FeCO) of the legs of the desert locust monitors the movements of the tibia about the femoro-tibial joint. A ventral midline population of spiking local interneurons in the metathoracic ganglia integrates inputs from the FeCO. We used a Wiener kernel cross-correlation method combined with a Gaussian white noise stimulation of the FeCO to completely characterize and model the output dynamics of the ventral midline population of interneurons. A wide range of responses were observed, and interneurons could be classified into three broad groups that received excitatory and inhibitory or principally inhibitory or excitatory synaptic inputs from the FeCO. Interneurons that received mixed inputs also had the greatest linear responses but primarily responded to extension of the tibia and were mostly sensitive to stimulus velocity. Interneurons that received principally inhibitory inputs were sensitive to extension and to joint position. A small group of interneurons received purely excitatory synaptic inputs and were also sensitive to tibial extension. In addition to capturing the linear and nonlinear dynamics of this population of interneurons, first- and second-order Wiener kernels revealed that the dynamics of the interneurons in the population were graded and formed a spectrum of responses whereby the activity of many cells appeared to be required to adequately describe a particular stimulus characteristic, typical of population coding.

Стилі APA, Harvard, Vancouver, ISO та ін.

13

Weiß, Marcel, and Sebastian E. Ahnert. "Phenotypes can be robust and evolvable if mutations have non-local effects on sequence constraints." Journal of The Royal Society Interface 15, no. 138 (January 2018): 20170618. http://dx.doi.org/10.1098/rsif.2017.0618.

Повний текст джерела

Анотація:

The mapping between biological genotypes and phenotypes plays an important role in evolution, and understanding the properties of this mapping is crucial to determine the outcome of evolutionary processes. One of the most striking properties observed in several genotype–phenotype (GP) maps is the positive correlation between the robustness and evolvability of phenotypes. This implies that a phenotype can be strongly robust against mutations and at the same time evolvable to a diverse range of alternative phenotypes. Here, we examine the causes for this positive correlation by introducing two analytically tractable GP map models that follow the principles of real biological GP maps. The first model is based on gene-like GP maps, reflecting the way in which genetic sequences are organized into protein-coding genes, and the second one is based on the GP map of RNA secondary structure. For both models, we find that a positive correlation between phenotype robustness and evolvability only emerges if mutations at one sequence position can have non-local effects on the sequence constraints at another position. This highlights that non-local effects of mutations are closely related to the coexistence of robustness and evolvability in phenotypes, and are likely to be an important feature of many biological GP maps.

Стилі APA, Harvard, Vancouver, ISO та ін.

14

An, Ji-Yong, Yong Zhou, Yu-Jun Zhao, and Zi-Ji Yan. "An Efficient Feature Extraction Technique Based on Local Coding PSSM and Multifeatures Fusion for Predicting Protein-Protein Interactions." Evolutionary Bioinformatics 15 (January 2019): 117693431987992. http://dx.doi.org/10.1177/1176934319879920.

Повний текст джерела

Анотація:

Background: Increasing evidence has indicated that protein-protein interactions (PPIs) play important roles in various aspects of the structural and functional organization of a cell. Thus, continuing to uncover potential PPIs is an important topic in the biomedical domain. Although various feature extraction methods with machine learning approaches have enhanced the prediction of PPIs. There remains room for improvement by developing novel and effective feature extraction methods and classifier approaches to identify PPIs. Method: In this study, we proposed a sequence-based feature extraction method called LCPSSMMF, which combined local coding position-specific scoring matrix (PSSM) with multifeatures fusion. First, we used a novel local coding method based on PSSM to build a new PSSM (CPSSM); the advantage of this method is that it incorporated global and local feature extraction, which can account for the interactions between residues in both continuous and discontinuous regions of amino acid sequences. Second, we adopted 2 different feature extraction methods (Local Average Group [LAG] and Bigram Probability [BP]) to capture multiple key feature information by employing the evolutionary information embedded in the CPSSM matrix. Finally, feature vectors were acquired by using multifeatures fusion method. Result: To evaluate the performance of the proposed feature extraction approach, we employed support vector machine (SVM) as a prediction classifier and applied this method to yeast and human PPI datasets. The prediction accuracies of LCPSSMMF were 93.43% and 90.41% on the yeast and human datasets, respectively. Moreover, we also compared the proposed method with the previous sequence-based approaches on the yeast datasets by using the same SVM classifier. The experimental results indicated that the performance of LCPSSMMF significantly exceeded that of several other state-of-the-art methods. It is proven that the LCPSSMMF approach can capture more local and global discriminatory information than almost all previous methods and can function remarkably well in identifying PPIs. To facilitate extensive research in future proteomics studies, we developed a LCPSSMMFSVM server, which is freely available for academic use at http://219.219.62.123:8888/LCPSSMMFSVM .

Стилі APA, Harvard, Vancouver, ISO та ін.

15

Irvine, Ryan A., Iping G. Lin, and Chih-Lin Hsieh. "DNA Methylation Has a Local Effect on Transcription and Histone Acetylation." Molecular and Cellular Biology 22, no. 19 (October 1, 2002): 6689–96. http://dx.doi.org/10.1128/mcb.22.19.6689-6696.2002.

Повний текст джерела

Анотація:

ABSTRACT DNA methylation is commonly associated with gene silencing, and a link between histone deacetylation and DNA methylation has been established. However, the transcriptional impact of the position and length of methylated zones relative to the promoter and the coding region of a gene remains quite unclear. This study investigates the impact of regional methylation on transcription and the relationship between DNA methylation and histone acetylation. Using patch-methylated stable episomes in human cells, we establish the pivotal importance of the location of DNA methylation in the regulation of transcription. We further demonstrate that the size of the methylated patch is not a key determinant for transcriptional suppression. The impact of DNA methylation on transcription is greater when it is in the transcription unit, and it is primarily a local effect. However, methylation outside of the transcription unit may potentiate the effect of methylation within the transcription unit. Acetylated histones are associated with unmethylated DNA and are nearly absent from methylated DNA regions. This association appears to be local and does not propagate along the DNA.

Стилі APA, Harvard, Vancouver, ISO та ін.

16

Malik, Rainer, Therese Dau, Maria Gonik, Anirudh Sivakumar, Daniel J. Deredge, Evgeniia V. Edeleva, Jessica Götzfried, et al. "Common coding variant in SERPINA1 increases the risk for large artery stroke." Proceedings of the National Academy of Sciences 114, no. 14 (March 6, 2017): 3613–18. http://dx.doi.org/10.1073/pnas.1616301114.

Повний текст джерела

Анотація:

Large artery atherosclerotic stroke (LAS) shows substantial heritability not explained by previous genome-wide association studies. Here, we explore the role of coding variation in LAS by analyzing variants on the HumanExome BeadChip in a total of 3,127 cases and 9,778 controls from Europe, Australia, and South Asia. We report on a nonsynonymous single-nucleotide variant in serpin family A member 1 (SERPINA1) encoding alpha-1 antitrypsin [AAT; p.V213A; P = 5.99E-9, odds ratio (OR) = 1.22] and confirm histone deacetylase 9 (HDAC9) as a major risk gene for LAS with an association in the 3′-UTR (rs2023938; P = 7.76E-7, OR = 1.28). Using quantitative microscale thermophoresis, we show that M1 (A213) exhibits an almost twofold lower dissociation constant with its primary target human neutrophil elastase (NE) in lipoprotein-containing plasma, but not in lipid-free plasma. Hydrogen/deuterium exchange combined with mass spectrometry further revealed a significant difference in the global flexibility of the two variants. The observed stronger interaction with lipoproteins in plasma and reduced global flexibility of the Val-213 variant most likely improve its local availability and reduce the extent of proteolytic inactivation by other proteases in atherosclerotic plaques. Our results indicate that the interplay between AAT, NE, and lipoprotein particles is modulated by the gate region around position 213 in AAT, far away from the unaltered reactive center loop (357–360). Collectively, our findings point to a functionally relevant balance between lipoproteins, proteases, and AAT in atherosclerosis.

Стилі APA, Harvard, Vancouver, ISO та ін.

17

Thủy, Vì Thị Xuân, Lò Thị Mai Thu, Hồ Mạnh Tường, Lê Văn Sơn, Nguyễn Vũ Thanh Thanh, and Chu Hoàng Mậu. "Characteristics of defensin1 gene and designing structure to create resistant transgenic corn lines to weevils." Vietnam Journal of Biotechnology 14, no. 2 (June 30, 2016): 279–86. http://dx.doi.org/10.15625/1811-4989/14/2/9353.

Повний текст джерела

Анотація:

Plant defensins are multifunctional proteins, inhibiting the growth of fungal, anti-bacterial, altering membrane channels, inhibiting activity of trypsin and α-amylase. Plant defensin consists of 18 groups in which the group 1 includes defensins to inhibit either α-amylase enzyme or trypsin. Defensins bind to the active site of α-amylase in the weevil gut, thus inhibit starch digestion in weevils. In this report, we present the results of cloning and determining the ZmDEF1 gene sequence isolated from mRNA and DNA of Sonla province local maize and LVN99 hybrid maize cultivar. The coding region of ZmDEF1 gene isolated from some maize samples had the size of 243 nucleotides, encoding 80 amino acids. Gen ZmDEF1 isolated from DNA had the size 345bp consists of two exons and one in tron (102 bp). The nucleotide sequences of ZmDEF1 gene (DNA) of the samples have 6 positions nucleotide difference, on exon 1 has two points difference (position 43, 53), on intron has a difference (position 150), on exon 2 has 3 nucleotide site difference (203, 263 and 297 position). Deduced amino acid sequences of defensin of the Sonla local maize sample has 8 cysteines to make 4 disulfide bridges, while LVN99 hybrid maize has 7 cysteines, which can formed only 3 disulfide bridges. Transformation vector pBetaPhaso-ZmDEF1 has been designed successfully, in which ZmDEF1 is controlled by seed specific Phasoline promoter. The correct insertion and expression of ZmDEF1 was examinated in transgenic tobacco plants throught PCR and RT-PCR, respectively. These results provide an firm evident for using the designed transformation vector to produce transgenic maỉze lines with an improved resistant ability to weevils.

Стилі APA, Harvard, Vancouver, ISO та ін.

18

Müller, Teresa, Milad Miladi, Frank Hutter, Ivo Hofacker, Sebastian Will, and Rolf Backofen. "The locality dilemma of Sankoff-like RNA alignments." Bioinformatics 36, Supplement_1 (July 1, 2020): i242—i250. http://dx.doi.org/10.1093/bioinformatics/btaa431.

Повний текст джерела

Анотація:

Abstract Motivation Elucidating the functions of non-coding RNAs by homology has been strongly limited due to fundamental computational and modeling issues. While existing simultaneous alignment and folding (SA&F) algorithms successfully align homologous RNAs with precisely known boundaries (global SA&F), the more pressing problem of identifying new classes of homologous RNAs in the genome (local SA&F) is intrinsically more difficult and much less understood. Typically, the length of local alignments is strongly overestimated and alignment boundaries are dramatically mispredicted. We hypothesize that local SA&F approaches are compromised this way due to a score bias, which is caused by the contribution of RNA structure similarity to their overall alignment score. Results In the light of this hypothesis, we study pairwise local SA&F for the first time systematically—based on a novel local RNA alignment benchmark set and quality measure. First, we vary the relative influence of structure similarity compared to sequence similarity. Putting more emphasis on the structure component leads to overestimating the length of local alignments. This clearly shows the bias of current scores and strongly hints at the structure component as its origin. Second, we study the interplay of several important scoring parameters by learning parameters for local and global SA&F. The divergence of these optimized parameter sets underlines the fundamental obstacles for local SA&F. Third, by introducing a position-wise correction term in local SA&F, we constructively solve its principal issues. Availability and implementation The benchmark data, detailed results and scripts are available at https://github.com/BackofenLab/local_alignment. The RNA alignment tool LocARNA, including the modifications proposed in this work, is available at https://github.com/s-will/LocARNA/releases/tag/v2.0.0RC6. Supplementary information Supplementary data are available at Bioinformatics online.

Стилі APA, Harvard, Vancouver, ISO та ін.

19

ZHANG, WEI, ALLISON HUGHES, GRIER WILT, and STEPHEN J. KNABEL. "The BAX PCR Assay for Screening Listeria monocytogenes Targets a Partial Putative Gene lmo2234." Journal of Food Protection 67, no. 7 (July 1, 2004): 1507–11. http://dx.doi.org/10.4315/0362-028x-67.7.1507.

Повний текст джерела

Анотація:

The BAX PCR for screening Listeria monocytogenes is a commercial PCR assay for specifically targeting L. monocytogenes, a foodborne pathogen that can contaminate a variety of foods and cause a potentially fatal disease, listeriosis, among high-risk populations. The high specificity (>98%) of this PCR assay is achieved by targeting a species-specific genomic region (∼400 bp) presumably found only in L. monocytogenes. In this study, the identity of the BAX PCR–targeted genomic region was determined by using PCR cloning, DNA sequencing, and basic local alignment search tool (BLAST) analysis of the amplicon sequences of an L. monocytogenes serotype 1/2a strain. BLAST analysis identified the BAX PCR amplicon (GenBank accession no. AY364605) as a 423-bp genomic region between nucleotides 224,409 and 224,831 in the genome of L. monocytogenes (serotype 1/2a strain EGD-e), including a 145-bp noncoding region and a 278-bp partial coding sequence of a putative gene, lmo2234. The translated amino acid sequence (92 amino acids) of this partial coding region is highly conserved between L. monocytogenes and Listeria innocua (93% homology). Reverse-position-specific BLAST analysis identified a conserved domain in Lmo2234 that was similar (95.3% aligned, E value = 9E−18) to the consensus amino acid sequence of sugar phosphate isomerases/epimerases (National Center for Biotechnology Information conserved domain database accession no. COG 1082.1, IolE), indicating that Lmo2234 might be involved in bacterial carbohydrate transport and metabolism.

Стилі APA, Harvard, Vancouver, ISO та ін.

20

Eggermont, Jos J., and Jennifer E. Mossop. "Azimuth Coding in Primary Auditory Cortex of the Cat. I. Spike Synchrony Versus Spike Count Representations." Journal of Neurophysiology 80, no. 4 (October 1, 1998): 2133–50. http://dx.doi.org/10.1152/jn.1998.80.4.2133.

Повний текст джерела

Анотація:

Eggermont, Jos J. and Jennifer E. Mossop. Azimuth coding in primary auditory cortex of the cat. I. Spike synchrony versus spike count representations. J. Neurophysiol. 80: 2133–2150, 1998. The neural representation of sound azimuth in auditory cortex most often is considered to be average firing rate, and azimuth tuning curves based thereupon appear to be rather broad. Coincident firings of simultaneously recorded neurons could provide an improved representation of sound azimuth compared with that contained in the firing rate in either of the units. In the present study, a comparison was made between local field potentials and several measures based on unit firing rate and coincident firing with respect to their azimuth-tuning curve bandwidth. Noise bursts, covering a 60-dB intensity range, were presented from nine speakers arranged in a semicircular array with a radius of 55 cm in the animal's frontal half field. At threshold intensities, all local field potential (LFP) recordings showed preferences for contralateral azimuths. Multiunit recordings showed in 74% a threshold for contralateral azimuths, in 16% for frontal azimuths, and in only 5% showed an ipsilateral threshold. The remaining 5% were not spatially tuned. Representations for directionally sensitive units based on coincident firings provided significantly sharper tuning (50–60° bandwidth at 25 dB above the lowest threshold) than those based on firing rate (bandwidths of 80–90°). The ability to predict sound azimuth from the directional information contained in the neural population activity was simulated by combining the responses of the 102 single units. Peak firing rates and coincident firings with LFPs at the preferred azimuth for each unit were used to construct a population vector. At stimulus levels of ≥40 dB SPL, the prediction function was sigmoidal with the predicted frontal azimuth coinciding with the frontal speaker position. Sound azimuths >45° from the midline all resulted in predicted values of −90 or 90°, respectively. No differences were observed in the performance of the prediction based on firing rate or coincident firings for these intensities. This suggests that although coincident firings produce narrower azimuth tuning curves, the information contained in the overall neural population does not increase compared with that contained in a firing rate representation. The relatively poor performance of the population vector further suggests that primary auditory cortex does not code sound azimuth by a globally distributed measure of peak firing rate or coincident firing.

Стилі APA, Harvard, Vancouver, ISO та ін.

21

Gabius, Hans-Joachim. "Glycans: bioactive signals decoded by lectins." Biochemical Society Transactions 36, no. 6 (November 19, 2008): 1491–96. http://dx.doi.org/10.1042/bst0361491.

Повний текст джерела

Анотація:

The glycan part of cellular glycoconjugates affords a versatile means to build biochemical signals. These oligosaccharides have an exceptional talent in this respect. They surpass any other class of biomolecule in coding capacity within an oligomer (code word). Four structural factors account for this property: the potential for variability of linkage points, anomeric position and ring size as well as the aptitude for branching (first and second dimensions of the sugar code). Specific intermolecular recognition is favoured by abundant potential for hydrogen/co-ordination bonds and for C–H/π-interactions. Fittingly, an array of protein folds has developed in evolution with the ability to select certain glycans from the natural diversity. The thermodynamics of this reaction profits from the occurrence of these ligands in only a few energetically favoured conformers, comparing favourably with highly flexible peptides (third dimension of the sugar code). Sequence, shape and local aspects of glycan presentation (e.g. multivalency) are key factors to regulate the avidity of lectin binding. At the level of cells, distinct glycan determinants, a result of enzymatic synthesis and dynamic remodelling, are being defined as biomarkers. Their presence gains a functional perspective by co-regulation of the cognate lectin as effector, for example in growth regulation. The way to tie sugar signal and lectin together is illustrated herein for two tumour model systems. In this sense, orchestration of glycan and lectin expression is an efficient means, with far-reaching relevance, to exploit the coding potential of oligosaccharides physiologically and medically.

Стилі APA, Harvard, Vancouver, ISO та ін.

22

Wydall, Sarah, and Rebecca Zerk. "Domestic abuse and older people: factors influencing help-seeking." Journal of Adult Protection 19, no. 5 (October 9, 2017): 247–60. http://dx.doi.org/10.1108/jap-03-2017-0010.

Повний текст джерела

Анотація:

Purpose The purpose of this paper is to explore professionals’ perceptions of the barriers to help-seeking for victim-survivors of domestic abuse aged 60 years and over. Help-seeking as defined by Anderson and Saunders (2003) is not a single act or decision, but a complex and continuous process, victims engage in when seeking support. Design/methodology/approach A total of 50 qualitative semi-structured interviews were conducted with statutory practitioners and managers from 21 out of 22 local authorities in Wales. The research team worked collaboratively to produce a coding scheme which was subjected to a systematic coding exercise using the software package NVivo. Findings Professionals believed that older people’s “interconnectedness” with family, social embeddedness in the community and “meanings of the home” influenced help-seeking. The research suggests that for older victim-survivors of domestic abuse, age discrimination by practitioners, compounds older people’s experiences of help-seeking, restricting the range, quality and type of support provided. The paper demonstrates that a significant shift is required in practice to ensure that older people are in a position to make informed choices and their wishes are central in the decision-making process. Research limitations/implications Further qualitative research is needed to explore what older people themselves believe are the factors that impact on statutory service engagement. Originality/value This study is the first in the UK to conduct Pan-Wales research on professionals’ views on help-seeking behaviours of older people. One of the key findings from the study is that professionals from the statutory sector feel that connections to the home and social networks strongly influence help-seeking for older victim-survivors of domestic abuse.

Стилі APA, Harvard, Vancouver, ISO та ін.

23

Yang, Shiqi, Yang Liu, Peili Xi, Chunsheng Li, Wei Yang, and Hongcheng Zeng. "Accurate detection method of moving target based on sequential SAR images with multiple azimuth squint angles." Journal of Physics: Conference Series 2083, no. 3 (November 1, 2021): 032051. http://dx.doi.org/10.1088/1742-6596/2083/3/032051.

Повний текст джерела

Анотація:

Abstract In this paper, a novel moving target detection method for sequential Synthetic Aperture Radar (SAR) images with different azimuth-squint angles is proposed. In sequential SAR images, due to the movement of the target, the imaging position of moving targets among different frames differs. The method proposed in this paper uses this kind of motion characteristics to achieve the detection of moving targets in multi-frame SAR images. This algorithm can be divided into two parts: block-level detection and pixel-level detection. Block-level detection is achieved by stacked denoising autoencoders to extract the high-dimensional features of the moving target. Pixel-level detection consists of Local Binary Similarity Patterns (LBSP) coding as well as grayscale background subtraction. Pixel-level detection only needs to consider the pixels of foreground image pieces which contain moving targets. This method can not only increase the detection speed, but also suppress the false alarm problem caused by clutter. Experiments are carried out for verifying the validation of the method and the comparison are made between the proposed method and the traditional Constant False Alarm Rate (CFAR) algorithm.

Стилі APA, Harvard, Vancouver, ISO та ін.

24

Sok, Agnieszka J., Kamila Czajewska, Andrzej Ożyhar, and Marian Kochman. "The structure of the juvenile hormone binding protein gene from Galleria mellonella." Biological Chemistry 386, no. 1 (January 1, 2005): 1–10. http://dx.doi.org/10.1515/bc.2005.001.

Повний текст джерела

Анотація:

AbstractJuvenile hormone (JH) and ecdysone are the key hormones controlling insect growth and development. The juvenile hormone binding protein (JHBP) is the first member in the array of proteins participating in JH signal transmission. In the present report a wholejhbpgene sequence (9790 bp) is described. Thejhbpgene contains four introns (A–D). All the introns have common flanking sequences: GT at the 5′ and AG at the 3′ end. The first intron is in phase 1, the second in phase 2, and the third and fourth in phase 1. An analysis of these sequences suggests that U2-class spliceosomes are involved in intron excision from pre-mRNA. Several horizontally transmitted elements from other genes were found in the introns. Alljhbpexons are positioned in local AT-reach regions of the gene. A search for core promoter regulatory elements revealed that the TATA box starts 29 bp preceding the start of transcription; the sequence TCAGTA representing a putative initiator sequence (Inr) starts at position +14. Eight characteristic sequences for bindingBroad-Complexgene products, which coordinate the ecdysone temporal response, are present in the non-coding sequence of thejhbpgene. An analysis of exon locations and intron phases indicates thatjhbpgene organization is related to theretinol binding proteingene, a member of the lipocalin family.

Стилі APA, Harvard, Vancouver, ISO та ін.

25

Moškrič, Ajda, Andraž Marinč, Polonca Ferk, Brane Leskošek, Mai-Britt Mosbech, Ignas Bunikis, Olga Vinnere Pettersson, Lucile Soler, and Janez Prešern. "The Carniolan Honeybee from Slovenia—A Complete and Annotated Mitochondrial Genome with Comparisons to Closely Related Apis mellifera Subspecies." Insects 13, no. 5 (April 22, 2022): 403. http://dx.doi.org/10.3390/insects13050403.

Повний текст джерела

Анотація:

The complete mitochondrial genome of the Carniolan honeybee (Apis mellifera carnica) from Slovenia, a homeland of this subspecies, was acquired in two contigs from WGS data and annotated. The newly obtained mitochondrial genome is a circular closed loop of 16,447 bp. It comprises 37 genes (13 protein coding genes, 22 tRNA genes, and 2 rRNA genes) and an AT-rich control region. The order of the tRNA genes resembles the order characteristic of A. mellifera. The mitogenomic sequence of A. m. carnica from Slovenia contains 44 uniquely coded sites in comparison to the closely related subspecies A. m. ligustica and to A. m. carnica from Austria. Furthermore, 24 differences were recognised in comparison between A. m. carnica and A. m. ligustica subspecies. Among them, there are three SNPs that affect translation in the nd2, nd4, and cox2 genes, respectively. The phylogenetic placement of A. m. carnica from Slovenia within C lineage deviates from the expected position and changes the perspective on relationship between C and O lineages. The results of this study represent a valuable addition to the information available in the phylogenomic studies of A. mellifera—a pollinator species of worldwide importance. Such genomic information is essential for this local subspecies’ conservation and preservation as well as its breeding and selection.

Стилі APA, Harvard, Vancouver, ISO та ін.

26

Nagasaki, Keizo, Yoko Shirai, Yuji Tomaru, Kensho Nishida, and Shmuel Pietrokovski. "Algal Viruses with Distinct Intraspecies Host Specificities Include Identical Intein Elements." Applied and Environmental Microbiology 71, no. 7 (July 2005): 3599–607. http://dx.doi.org/10.1128/aem.71.7.3599-3607.2005.

Повний текст джерела

Анотація:

ABSTRACT Heterosigma akashiwo virus (HaV) is a large double-stranded DNA virus infecting the single-cell bloom-forming raphidophyte (golden brown alga) H. akashiwo. A molecular phylogenetic sequence analysis of HaV DNA polymerase showed that it forms a sister group with Phycodnaviridae algal viruses. All 10 examined HaV strains, which had distinct intraspecies host specificities, included an intein (protein intron) in their DNA polymerase genes. The 232-amino-acid inteins differed from each other by no more than a single nucleotide change. All inteins were present at the same conserved position, coding for an active-site motif, which also includes inteins in mimivirus (a very large double-stranded DNA virus of amoebae) and in several archaeal DNA polymerase genes. The HaV intein is closely related to the mimivirus intein, and both are apparently monophyletic to the archaeal inteins. These observations suggest the occurrence of horizontal transfers of inteins between viruses of different families and between archaea and viruses and reveal that viruses might be reservoirs and intermediates in horizontal transmissions of inteins. The homing endonuclease domain of the HaV intein alleles is mostly deleted. The mechanism keeping their sequences basically identical in HaV strains specific for different hosts is yet unknown. One possibility is that rapid and local changes in the HaV genome change its host specificity. This is the first report of inteins found in viruses infecting eukaryotic algae.

Стилі APA, Harvard, Vancouver, ISO та ін.

27

Santos, Marcilene F. A., Vanessa S. Mattos, Ana Cristina M. M. Gomes, Jessica M. S. Monteiro, Daniela A. Souza, Caio A. R. Torres, Sônia Maria L. Salgado, Philippe Castagnone Sereno, and Regina M. D. G. Carneiro. "Integrative taxonomy of Meloidogyne paranaensis populations belonging to different esterase phenotypes." Nematology 22, no. 4 (April 28, 2020): 453–68. http://dx.doi.org/10.1163/15685411-00003316.

Повний текст джерела

Анотація:

Summary Meloidogyne paranaensis is one of the most destructive root-knot nematode species affecting coffee cultivation. This species presents different esterase phenotypes (Est): P1, P2 and P2a, previous studies showing that Est P2 and P2a populations were more aggressive to susceptible coffee cultivars than populations with Est P1, and local producers have even asked if they may be described as other species. The objective of this study was to characterise M. paranaensis populations of different esterase phenotypes (Est P1, P2 and P2a), regarding morphological, morphometric and phylogenetic relationships in distinct regions of ribosomal DNA (rDNA), mitochondrial gene cytochrome c oxidase II (COII) and nuclear protein coding gene HSP90. All populations were identified by esterase phenotype and SCAR-specific markers. Regarding morphology/morphometrics, the three populations were very similar to the description of the species, differing only in the morphology of the male stylet and second-stage juvenile hyaline tail length. Based on the phylogenetic analysis, a low intraspecific variability was detected among M. paranaensis Est P1 and Est P2 populations from Brazil; the Guatemalan population Est P2a, however, showed a genetic differentiation from the Brazilian populations, confirming the geographic genetic distance of this aggressive population. According to this multi-source approach study, in spite of the intraspecific variation, the phylogenetic position of M. paranaensis is absolute, regardless of the enzymatic phenotype and SCAR markers.

Стилі APA, Harvard, Vancouver, ISO та ін.

28

Miladi, Milad, Martin Raden, Sven Diederichs, and Rolf Backofen. "MutaRNA: analysis and visualization of mutation-induced changes in RNA structure." Nucleic Acids Research 48, W1 (May 11, 2020): W287—W291. http://dx.doi.org/10.1093/nar/gkaa331.

Повний текст джерела

Анотація:

Abstract RNA molecules fold into complex structures as a result of intramolecular interactions between their nucleotides. The function of many non-coding RNAs and some cis-regulatory elements of messenger RNAs highly depends on their fold. Single-nucleotide variants (SNVs) and other types of mutations can disrupt the native function of an RNA element by altering its base pairing pattern. Identifying the effect of a mutation on an RNA’s structure is, therefore, a crucial step in evaluating the impact of mutations on the post-transcriptional regulation and function of RNAs within the cell. Even though a single nucleotide variation can have striking impacts on the structure formation, interpreting and comparing the impact usually needs expertise and meticulous efforts. Here, we present MutaRNA, a web server for visualization and interpretation of mutation-induced changes on the RNA structure in an intuitive and integrative fashion. To this end, probabilities of base pairing and position-wise unpaired probabilities of wildtype and mutated RNA sequences are computed and compared. Differential heatmap-like dot plot representations in combination with circular plots and arc diagrams help to identify local structure abberations, which are otherwise hidden in standard outputs. Eventually, MutaRNA provides a comprehensive and comparative overview of the mutation-induced changes in base pairing potentials and accessibility. The MutaRNA web server is freely available at http://rna.informatik.uni-freiburg.de/MutaRNA.

Стилі APA, Harvard, Vancouver, ISO та ін.

29

Li, Xinfei, Zhongyu Jin, and Lihui Wang. "A Systematic Pipelaying Control Method Based on the Sliding Matrix for Dynamically Positioned Surface Vessels." Journal of Sensors 2022 (January 25, 2022): 1–16. http://dx.doi.org/10.1155/2022/9702532.

Повний текст джерела

Анотація:

A pipelaying control method is presented in this paper which includes path planning, path guidance, and path tracking controller for dynamically positioned (DP) surface vessels based on the characteristics of the predefined path in marine pipelaying operation. The pipelaying control method depends on path coding, path selection logic system, and a sliding matrix. The sliding matrix contains a vessel local path and its specified control requirements, which can be updated by sliding down the waypoint table line by line as the vessel is traveling from one path to the next. A line of sight (LOS) algorithm is developed to calculate the desired vessel position and heading on a circular arc path. The motion controller, which can simultaneously control the vessel speed at the directions of surge and sway, is designed by decomposing the desired inertial resulting velocity into the desired body velocity components. A DP simulator for pipelaying operation is developed, and in order to verify the proposed method, a pipelaying simulation is carried out. The simulation results show that the proposed method enables the vessel to move along the desired path while maintaining a set crab angle, a specified speed, and a turning radius. The pipeline can be laid onto the specified waypoints even when the vessel is subjected to drift forces caused by ocean currents, wind, and waves.

Стилі APA, Harvard, Vancouver, ISO та ін.

30

Bista, Bishnu. "Lived Experience of Infertility among Community Dwelling Infertile Women." Journal of Nobel Medical College 4, no. 1 (September 1, 2015): 46–56. http://dx.doi.org/10.3126/jonmc.v4i1.13303.

Повний текст джерела

Анотація:

Objective: The aim of this study was to investigate the lived experiences of infertility among infertile women in Jhapa.Methods: A descriptive phenomenological research design was utilized that is supported by philosophy of Edmund Husserl. Seven informants, who were having infertility problems selected for in-depth interviews, utilized purposive sampling technique. Information gathered from two Focused Group Discussions that included 20 participants and five key informants’ interviews were conducted to triangulate data source which obtained from study informants. Data were recorded and transcribed verbatim later. Transcribes were deducted to extract actual meanings through coding, categorizing and organized into theme clusters.Results: Informants experienced any one or all form of abuse like physical, emotional, psychological, societal or marital. Severity of torture depend on who had fertility related problems and infertile woman’s position in husband’s house. They believed their infertility problems are deeply rooted with social and cultural stigma of the society. Women, who were young and less than 15years of marriage duration, had more hope to become mother. Due to economic hardship and limited family support, they could not access to utilize Assisted Reproductive technologies.Conclusion: though the up lift of education, media and local non-governmental organizations support and changing concepts of society, infertile women experienced risk of being isolated in social activities, threaten to divorce and remarry by husband. Accepting the realities, supporting and understanding of each other’s’ limitations are core factor of husband wife relationship. Journal of Nobel College of Medicine Vol.4(1) 2015: 46-56

Стилі APA, Harvard, Vancouver, ISO та ін.

31

Li, Xianguo, Zongpeng Liu, Bin Li, Xinxin Feng, Xiao Liu, and Debao Zhou. "A Novel Attentive Generative Adversarial Network for Waterdrop Detection and Removal of Rubber Conveyor Belt Image." Mathematical Problems in Engineering 2020 (February 22, 2020): 1–11. http://dx.doi.org/10.1155/2020/1037021.

Повний текст джерела

Анотація:

The lens for monitoring the rubber conveyor belt is easy to adhere to a large number of water droplets, which seriously affects the image quality and then affects the effect of fault monitoring. In this paper, a new method for detecting and removing water droplets on rubber conveyor belts based on the attentive generative adversarial network is proposed to solve this problem. First, the water droplet image of the rubber conveyor belt is input into the generative network composed of a cyclic visual attentive network and an autoencoder with skip connections, and an image of removing water droplets and an attention map for detecting the position of the water droplet are generated. Then, the generated image of removing water droplets is evaluated by the attentive discriminant network to assess the local consistency of the water droplet recovery area. In order to better learn the water droplet regions and the surrounding structures during the training, the image morphology is added to the precise water droplet regions. A dewatered rubber conveyor belt image is generated by increasing the number of circular visual attention network layers and the number of skip connection layers of the autoencoder. Finally, a large number of comparative experiments prove the effectiveness of the water droplet image removal algorithm proposed in this paper, which outperforms of Convolutional Neural Network (CNN), Discriminative Sparse Coding (DSC), Layer Prior (LP), and Attention Generative Adversarial Network (ATTGAN).

Стилі APA, Harvard, Vancouver, ISO та ін.

32

SESTRAS, Radu E. "Introduction pages." Notulae Botanicae Horti Agrobotanici Cluj-Napoca 49, no. 1 (March 26, 2021): 12318. http://dx.doi.org/10.15835/nbha49112318.

Повний текст джерела

Анотація:

Notulae Botanicae Horti Agrobotanici Cluj-Napoca (NBHA): The papers published in Issue 1, Volume 49, 2021 represent new exciting researches in different topics of life science, respectively in plant science, horticulture, agronomy and crop science. Among the interesting articles we invite you to find news about: Comparative transcriptome analysis reveals gene network regulation of TGase-induced thermotolerance in tomato; Characterization the coding and non-coding RNA components in the transcriptome of invasion weed Alternanthera philoxeroides; Morphometric analysis and sequence related amplified polymorphism determine genetic diversity in Salvia species; Viral diagnosis in cultivars of Ipomoea batatas (L.) Lam.; Influence of fertilizer and salicylic acid treatments on growth, physiological, and antioxidant characteristics in green and red Perilla frutescens varieties; In-vitro evaluation of antioxidant and antiradical potential of successive extracts, semi-purified fractions and biosynthesized silver nanoparticles of Rumex vesicarius; Zoophagous entomofauna and entomopathogenic agents reported on Cydalima perspectalis (Walker, 1859) in north-western of Romania; Vegetative propagation and ex-situ conservation of Acantholimon androsaceum and Limonium chersonesum, two promising local endemics of Crete (Greece) available for floricultural and pharmaceutical sustainable exploitation; Quality attributes during maturation of ‘Golden Delicious’ and ‘Red Delicious’ apples grown in two geographical regions with different environmental conditions, etc. The Impact Factor communicated by ISI Clarivate, June 29, 2020, is IF 2019 = 1.168 (position 149 of 234 journals, Q3 in Plant Sciences). The metrics in Scopus – Elsevier (June 22, 2020): CiteScore 1.40 (#43/84 in Horticulture); SJR 0.35 - Q2, #41/90 in Horticulture (SJR Scimago Journal). ---------------------------------------------------------------------------------- Announcement From Volume 49, Issue 1, 2021, Notulae Botanicae Horti Agrobotanici Cluj-Napoca journal will use article numbers in place of the traditional method of continuous pagination through the volume. This step helps us to maintain a rapid, efficient production process by being able to define pagination as soon as a paper is accepted. For papers that use article numbers, the page number of full-text articles will start from 1 to the last page and the citation needs only to list the article number. The journal will continue to appear quarterly, as before, with four annual numbers (see Publication Frequency).

Стилі APA, Harvard, Vancouver, ISO та ін.

33

Sodhi, Monika, R. S. Kataria, Saket K. Niranjan, Parvesh K., Preeti Verma, Shelesh K. Swami, Ankita Sharma, et al. "Sequence Characterisation and Genotyping of Allelic Variants of Beta Casein Gene Establishes Native Cattle of Ladakh to be a Natural Resource for A2 Milk." Defence Life Science Journal 3, no. 2 (March 23, 2018): 177. http://dx.doi.org/10.14429/dlsj.3.12574.

Повний текст джерела

Анотація:

Bovine milk is regarded as nature's perfect food due to presence of vital nutrients. However some peptides are generated after proteolytic digestion of β-casein that have opioid properties and may increase the risk of chronic diseases. There are 13 genetic variants of bovine beta-casein; out of these A1 and A2 are the most common in dairy cattle breeds. The A1 and A2 variants differ only at position 67, which is histidine in A1 or proline in A2 milk. Earlier published reports have indicated that A1 β casein could be responsible for several health disorders like diabetes, coronary heart disease etc. while A2 β-casein is generally considered safe for human consumption. In the present study, an effort was made to sequence characterize β casein gene and identify allelic distribution of A1A2 alleles in native cattle of Ladakh region adapted to high altitude and low oxygen condition. The data showed 2 non-synonymous variations in coding region, while 5’UTR was completely conserved. The 3’UTR showed 2 more variations in Ladakhi samples. Further, the genotyping in 85 Ladakhi cattle for A1A2 alleles revealed that in Ladakhi cattle, A2 allele is predominantly present as reported for some of the other Indian breeds. The frequency of A2 allele was 0.90 and frequency of A2A2 genotype was found to be 0.79 in Ladakhi cattle. The present data strongly indicate that local cattle of Ladakh with higher frequency of A2 allele and A2A2 genotype is natural resource for A2 milk. Systematic efforts should be made for long term conservation and genetic improvement of this invaluable genetic resource of Ladakh.

Стилі APA, Harvard, Vancouver, ISO та ін.

34

Hull, Glynda A., and Emily A. Hellmich. "Locating the Global: Schooling in an Interconnected World." Teachers College Record: The Voice of Scholarship in Education 120, no. 3 (March 2018): 1–36. http://dx.doi.org/10.1177/016146811812000303.

Повний текст джерела

Анотація:

Background Educators in the United States and internationally have become increasingly interested in incorporating international perspectives into curricula, programs, and policy. Rooted in a long history of international education, these efforts have been described variously as “multicultural,” “democratic,” and “international.” In this article and our work, we use the term global education for this phenomenon in order to signal, along with others, an important shift in conceptualizing how to prepare students for a globalized world. Objective This article is an initial exploration of current global education efforts in the United States and internationally. The study asks, “How do schools instantiate the global?” and considers how particular schools incorporated global concerns into their mission, curriculum, pedagogy, and structure. Research Design The research design consisted of a qualitative case study of thirteen schools located in the United States and Asia. Data Collection and Analysis Data consisted of online document collection, semi-structured interviews with administrators, teachers, and students, and observations. Data analysis consisted of iterative rounds of open-ended as well as thematic coding. Findings Findings revealed seven strategies used by schools to integrate a global orientation. Two detailed case studies showcased the complexities inherent in implementing these strategies. Conclusions This article underscores the challenges that schools in the United States and internationally face in instantiating a global education, particularly the meaningful integration of technology, second/foreign languages, and service learning as well as making a global education available across socioeconomic groups. It calls for additional research on how to foster global orientations that position all young people to become cosmopolitan members of local, national, and worldwide communities.

Стилі APA, Harvard, Vancouver, ISO та ін.

35

Otto, Isabelle, Philippe Grandguillaume, Latifa Boutkhil, Yves Burnod, and Emmanuel GuigonBurnod. "Direct and Indirect Cooperation between Temporal and Parietal Networks for Invariant Visual Recognition." Journal of Cognitive Neuroscience 4, no. 1 (January 1992): 35–57. http://dx.doi.org/10.1162/jocn.1992.4.1.35.

Повний текст джерела

Анотація:

A new type of biologically inspired multilayered network is proposed to model the properties of the primate visual system with respect to invariant visual recognition (IVR). This model is based on 10 major neurobiological and psychological constraints. The first five constraints shape the architecture and properties of the network. 1. The network model has a Y-like double-branched multilayered architecture, with one input (the retina) and two parallel outputs, the “What” and the “Where,” which model, respectively, the temporal pathway, specialized for “object” identification, and the parietal pathway specialized for “spatial” localization. 2. Four processing layers are sufficient to model the main functional steps of primate visual system that transform the retinal information into prototypes (object-centered reference frame) in the “What” branch and into an oculomotor command in the “Where” branch. 3. The distribution of receptive field sizes within and between the two functional pathways provides an appropriate tradeoff between discrimination and invariant recognition capabilities. 4. The two outputs are represented by a population coding: the ocular command is computed as a population vector in the “Where” branch and the prototypes are coded in a “semidistributed” way in the “What” branch. In the intermediate associative steps, processing units learn to associate prototypes (through feedback connections) to component features (through feedforward ones). 5. The basic processing units of the network do not model single cells but model the local neuronal circuits that combine different information flows organized in separate cortical layers. Such a biologically constrained model shows shift-invariant and size-invariant capabilities that resemble those of humans (psychological constraints): 6. During the Learning session, a set of patterns (26 capital letters and 2 geometric figures) are presented to the network: a single presentation of each pattern in one position (at the center) and with one size is sufficient to learn the corresponding prototypes (internal representations). These patterns are thus presented in widely varying new sizes and positions during the Recognition session: 7. The “What” branch of the network succeeds in immediate recognition for patterns presented in the central zone of the retina with the learned size. 8. The recognition by the “What” branch is resistant to changes in size within a limited range of variation related to the distribution of receptive field (RF) sizes in the successive processing steps of this pathway. 9. Even when ocular movements are not allowed, the recognition capabilities of the “What” branch are unaffected by changing positions around the learned one. This significant shift-invariance of the “What” branch is also related to the distribution of RF sizes. 10. When varying both sizes and locations, the “What” and the “Where” branches cooperate for recognition: the location coding in the “Where” branch can command, under the control of the “What” branch, an ocular movement efficient to reset peripheral patterns toward the central zone of the retina until successful recognition. This model results in predictions about anatomical connections and physiological interactions between temporal and parietal cortices.

Стилі APA, Harvard, Vancouver, ISO та ін.

36

Stoeckelhuber, M., A. A. Noegel, C. Eckerskorn, J. Kohler, D. Rieger, and M. Schleicher. "Structure/function studies on the pH-dependent actin-binding protein hisactophilin in Dictyostelium mutants." Journal of Cell Science 109, no. 7 (July 1, 1996): 1825–35. http://dx.doi.org/10.1242/jcs.109.7.1825.

Повний текст джерела

Анотація:

Our previous studies have shown that the actin-binding protein hisactophilin from Dictyostelium discoideum is a candidate for organizing the actin cytoskeleton at the plasma membrane in a pH-dependent manner. To further characterize this interaction we isolated hisactophilin overexpression (hisII+) and hisactophilin minus (his-) mutants. D. discoideum contains two hisactophilin isoforms; both genes are independently transcribed and carry a short intron at the same position of the coding region. The deduced amino acid sequence of hisactophilin II showed a characteristic high content of 35 histidine residues out of a total 118 amino acids. After transformation of Dictyostelium AX2 wild-type cells with a genomic fragment designed to inactivate the hisactophilin I gene we obtained hisactophilin II overexpressing mutants (hisII+). Multiple integration of the vector led to strong overexpression of hisactophilin II which even outnumbered the actin concentration by a factor of two. Hisactophilin II protein showed the same biochemical properties as hisactophilin I during purification and in its pH-dependent binding to F-actin; as shown by mass spectrometry the hisactophilin II fraction was almost completely myristoylated despite of this high overexpression. The inactivation of both hisactophilin genes was achieved by gene replacement with a vector construct encompassing parts of gene I and gene II connected by a geneticin cassette. The properties of the hisII+ and his- cells with regard to growth in shaking culture and on Klebsiella plates, development, chemotaxis and morphology were not affected under normal conditions. However, the hisII+ transformants revealed a significant difference to wild-type cells and his- cells when the cytoplasmic pH was lowered by diethylstilbestrol (DES), a proton pump inhibitor. HisII+ cells were more resistant to the acidification; in contrast to AX2 wild-type cells and his- cells they did not form plasma membrane protrusions, showed an increase in F-actin content, and contained large clusters of F-actin. Lowering the internal pH caused an accumulation of hisactophilin below the plasma membrane. The fact that cells deficient in hisactophilin again lose resistance to acidification is in good agreement with the hypothesis that hisactophilin functions as a pH sensor at the plasma membrane by reversibly connecting the membrane with the actin cortical network upon local changes of the proton concentration.

Стилі APA, Harvard, Vancouver, ISO та ін.

37

Ben Rejeb, Helmi, and Benoit Roussel. "Perspectives on the evolution of a fabrication laboratory in an emerging country: a comparative lexicometric study of European FabLabs." Journal of Manufacturing Technology Management 33, no. 2 (October 22, 2021): 399–422. http://dx.doi.org/10.1108/jmtm-01-2021-0007.

Повний текст джерела

Анотація:

PurposeThe purpose of this paper is to help in the establishment of the first fabrication laboratory (FabLab) in Tunisia. The FabLab movement offers many interesting opportunities through value creation, innovation, training and access to digital manufacturing technologies. A newly created FabLab should be well-positioned in terms of business model, purpose and management. The aim of this paper is to conduct a comparative analysis of FabLabs in developed countries (mainly in France and Luxembourg) and to provide recommendations on the possible development of a FabLab in Tunisia (FabLabENIT).Design/methodology/approachTwelve FabLabs were visited and experts from the makers movement were interviewed. Data from the visits and interviews were analysed using lexicometric tools. This methodology is based on three main steps: first, the identification and selection of panel of studied FabLabs interviews; second transcribing and coding for IRaMuTeQ software; and third, correspondence analysis.FindingsThe correspondence analysis determined five main factors of analysis that were interpreted using the most correlated words. The analysis of the correlation of the FabLabs and these five factors showed that FabLabENIT was strongly correlated with the third factor (interpreted as the organisation and structure factor). Recommendations for the purpose, local impact and methods were derived using the position of FabLabENIT in relation to the other factors.Practical implicationsThis study highlighted five main topics that characterise FabLabs in developing countries before and after their creation. A second practical contribution of this paper is that it provides a framework for FabLab managers and founders to anticipate possible trajectories of evolution for their organisations, especially in an emerging country. Another contribution, both practical and methodological, is the demonstration of the use of textual interview analysis tools (mainly correspondence analysis) to determine the main practices and characteristics of a creative organisation, such as a FabLab.Originality/valueOne original feature of this paper is the topic of the study, especially in the current context of the COVID-19 outbreak, in which the FabLab movement provided interesting solutions that were designed and manufactured using digital manufacturing technologies. A second originality resides in the use of lexicometric techniques to analyse the information that was discussed during the interviews.

Стилі APA, Harvard, Vancouver, ISO та ін.

38

Cron, Alan H. "From legislation to implementation." Journal of Educational Administration 54, no. 1 (February 1, 2016): 75–91. http://dx.doi.org/10.1108/jea-06-2014-0065.

Повний текст джерела

Анотація:

Purpose – The purpose of this paper is to examine the leadership practice of an 11-member district team of educators assembled to respond to one of the most comprehensive bullying laws in the nation – the Massachusetts Anti-Bullying Law of 2010. This three-year case study provides school leaders and legislators with an in-depth, fine-grained analysis of how leadership was practiced by a district team of de facto leaders charged with implementing mandatory legislative policy throughout a six-school, 5,000-student, K-12 public school district. Design/methodology/approach – This three-year case study employed an analytical, distributed leadership framework to identify, categorize, and analyze key artifacts used by a team to design and implement system-wide the comprehensive requirements of legislation. Using Weft qualitative data analysis software and the open, axial, and selective coding guidelines of Strauss and Corbin, data from semi-structured interviews and document analysis revealed a number of hidden structural considerations exerting significant influence on the leadership practice of the team. Findings – Findings from this study suggest that leadership is perhaps more fluid than previously theorized. Defining leadership as a force that moves between and among organizational stakeholders (as opposed to a person or position), this study identified a number of structural considerations exerting influence on the leadership practice of a team. Furthermore, this study suggests that foreknowledge of these structural considerations may help to foster organizational learning, to leverage preexisting social and intellectual capital, and to more successfully navigate the requirements of complex organizational change such as legislative mandates and standards-based reform. Research limitations/implications – Because of the chosen research approach, the research results may lack generalizability. Therefore, researchers are encouraged to replicate this study in other school districts or large organizations who are responding to state or federal legislation. Practical implications – The paper includes implications for state and local educational leaders as they struggle with the increased demands of standards-based educational reform. Social implications – This study has implications for those seeking to understand how legislation is received and assimilated by schools as well as those seeking a greater understanding of formal and informal leadership. Originality/value – This paper fulfills an identified need to study how leadership is practiced in response to standards-based state and federal legislation.

Стилі APA, Harvard, Vancouver, ISO та ін.

39

Opuda, Eugenia. "Academic Health Sciences Librarian Job Descriptions Do Not Frequently Reflect Emerging Skillsets and Changing Research Needs." Evidence Based Library and Information Practice 16, no. 1 (March 15, 2021): 91–94. http://dx.doi.org/10.18438/eblip29898.

Повний текст джерела

Анотація:

A Review of: Reed, J. B., & Carroll, A. J. (2020). Roles for health sciences librarians at college and university libraries. Issues in Science and Technology Librarianship, (94). https://doi.org/10.29173/istl42 Abstract Objective – To examine job postings for academic health sciences libraries to determine if they reflect the changing research needs of institutions of higher education and to compare these postings to similar, existing positions. Design – Mixed methods data analysis of job advertisements collected through relevant job boards and mailing lists. The authors conducted qualitative content analysis using a modified grounded theory approach, completed two cycles of coding using NVivo 12, and calculated statistical significance using Fisher’s exact test. Setting – College and university library and Association of Academic Health Sciences Libraries job boards and mailing lists between September 1, 2018 and March 1, 2019. Subjects – 104 unique posted job descriptions. Methods – The authors conducted a thorough search of posted position descriptions (PPDs) for academic health sciences librarians across a number of job boards and mailing lists between September 1, 2018 and March 1, 2019. In addition to searching ALA JobLIST, MLA Find a Job, Association of College & Research Libraries Health Sciences Interest Group (ACRL HSIG), MEDLIB-L, and ACRL Science and Technology Section (STS), the authors also hand searched alumni and general library job electronic mailing lists using relevant keyword searching. Inclusion criteria for PPDs included research support and other research-related responsibilities for the health sciences. The authors excluded any PPDs describing administrative or non-professional positions. Following review, the IRB determined that the research design did not qualify as human subjects research. After data collection, the authors categorized the PPDs using the National Network of Libraries of Medicine (NNLM) geographic regions and by the type of institution—college and university libraries (C&UL) or Association of Academic Health Sciences Libraries (AAHSL). Using modified grounded theory, the authors identified emergent themes from the PPDs and applied descriptive coding. Then, the authors merged categories to create overall themes. Using NVivo 12 to facilitate the mixed methods content analysis, the authors ran text queries to identify major themes in the position roles and responsibilities, required and preferred education, and required and preferred qualifications sections. They also noted themes they expected to see that did not emerge in the PPDs, as well as emerging roles for health sciences libraries that are identified in the literature but did not appear as major themes in the included PPDs. Finally, the authors utilized Fisher’s exact test to calculate statistical significance. Main Results – In the quantitative analysis, the authors identified 60 AAHSL and 44 C&UL PPDs out of the 104 total job postings. Positions were available from all 8 NNLM Regions and across 32 states, though they were not all equally distributed. Most of the positions (64 of the 104) were located in the NNLM Middle Atlantic, Southeastern/Atlantic, and Greater Midwest regions. The Southeastern/Atlantic and Greater Midwest regions made up nearly half of the included PPDs. However, the New England region had the most postings per capita. In the qualitative analysis, an ALA-accredited MLIS or equivalent degree emerged as a near-universal requirement across all PPDs. The authors noted that the few PPDs that did not require this degree typically referenced it in the preferred education section or described a proxy to the MLIS. Furthermore, 57% of C&UL positions compared to 27% of AAHSL positions listed preferred education (p=0.0004) that was usually related to health and science disciplines that the position supported. There was significant overlap of required qualifications for AAHSL and C&UL postings. The authors also identified a list of hard and soft skills noted in the PPDs’ required qualifications sections, including experience with specific tools, expertise in library services, and interpersonal skills. However, reportedly emerging skills in data sciences, open science, grant experience, and research impact assessment were absent in many PPDs. The authors found statistically significant differences between two themes in the PPD roles and responsibilities including collection management (p=0.0004) and systematic reviews (p=0.03). Additionally, the authors found no statistically significant differences for required qualifications between AAHLS and C&UL PPDs. They did find statistically significant differences for two preferred qualifications including the Academic of Health Information Professionals (AHIP) credential (p=0.0042) and experience with systematic reviews (p=0.0009). The AHIP credential and experience with systematic reviews were absent in the C&UL PPDs and referenced rarely in AAHSL postings. Though diversity, equity, and inclusion (DEI) qualifications were frequently referenced in C&UL PPD requirements, the authors noted that research libraries have failed to make meaningful change in diverse candidate hiring and retention, but also pointed to the rapid adoption of DEI qualifications in PPDs within a short period of time. The authors highlighted that the roles and responsibilities reflected traditional librarian duties and referenced more emerging skills and research needs than any other section of the PPD. Assessment and systematic reviews appeared more often in the roles and responsibilities sections of AAHSL and C&UL PPDs in comparison to the combined required and preferred qualifications sections of all the PPDs. A more traditional responsibility, collection management, also appeared more frequently in the roles and responsibilities section of PPDs than in the experience section, suggesting that most hiring committees feel confident that librarians who fill positions will be successful in performing collection management tasks despite experience. The authors noted that collection management, one of the most common themes that emerged from the data analysis, appeared more frequently in C&UL PPDs and theorize that AAHLS may have dedicated collection management departments. Conclusions – While the research literature documents new roles and emerging skills for academic health sciences librarian positions, the authors noted that PPDs do not frequently reflect those emerging roles and skills, and maintain traditional health sciences librarian skillsets. The authors concluded that library administrators should design position descriptions that are user centred and match the changing research needs of the local community. PPDs should reflect changing priorities by including less weight towards the MLIS degree, shifting traditional skillsets from required experience sections to preferred experience sections, adapting the language of PPDs to be more inclusive and welcoming for a diverse pool of candidates, and adding an emphasis on DEI responsibilities. By creating position descriptions that are user focused, library administrators and hiring committees make meaningful investments for their communities and their strategic priorities.

Стилі APA, Harvard, Vancouver, ISO та ін.

40

K. Dash, Debendra, and Dipti R. Pattanaik. "Missionary Position: The Irony of Translational Activism in Colonial Orissa." TTR : traduction, terminologie, rédaction 18, no. 2 (May 17, 2007): 89–113. http://dx.doi.org/10.7202/015766ar.

Повний текст джерела

Анотація:

Translating was crucial to the missionary project everywhere, especially after the Protestant Reformation. In their competition to expand their reach, various denominations of missionaries not only translated the Scriptures into the various local languages where they went, but also mediated various modern institutions like the school system, health-care and print-technology in those traditional societies. These institutions and the activity of translation were often the means to achieve the ultimate goal of proselytization. Their rate of success in achieving their goal in different places varied for several reasons. In places like Orissa where there was a deep-rooted cultural and religious tradition, their rate of success was very low. Even the forces of modernity they tried to mediate were regarded with suspicion for a long time on account of the peculiar political condition prevalent in Orissa at that time. Their activism in Orissa during the early part of 19th century was conflated with colonial hegemony. Moreover, the racial and cultural pride of missionaries prevented them from respecting the local condition and culture. Therefore, the translations they undertook were perceived as ridiculous and were summarily rejected. Orissa already had a long literary-cultural and translatory practice. The missionary challenge, however, helped in reorienting and galvanizing this tradition in a specific way. Although the missionaries largely failed in achieving their primary goal, their activism ironically helped in the growth of a new synthetic translational and literary culture in Orissa, long after their influence had waned. Keywords: sub colonialism, cultural coding, translational activism, bhāsā language, oral culture.

Стилі APA, Harvard, Vancouver, ISO та ін.

41

Lillebuen, Lisa, Kara Schick-Makaroff, Stephanie Thompson, and Anita Molzahn. "Facilitators and Barriers to Care in Rural Emergency Departments in Alberta for Patients on Peritoneal Dialysis (PD): An Interpretive Descriptive Study." Canadian Journal of Kidney Health and Disease 7 (January 2020): 205435812097009. http://dx.doi.org/10.1177/2054358120970098.

Повний текст джерела

Анотація:

Background: Home dialysis offers many advantages to patients, but they require support to manage a home-based therapy such as peritoneal dialysis (PD). A rural emergency department provides an important safety net for patients requiring medical care, including managing complications of PD, such as peritonitis. Patients living in northern Alberta are spread out geographically and can be far from a PD training center, yet anecdotally, many rural sites do not provide care for these patients. Objective: Our aim was to identify the facilitators and barriers to nursing care in rural emergency departments in northern Alberta for patients receiving PD. Design: A qualitative interpretive descriptive approach was used. Setting: Rural emergency departments across northern Alberta. Participants: Purposeful sampling was used to seek participants from 1 of 4 rural acute care hospital emergency departments in northern Alberta. Six registered nurses and 1 licensed practical nurse agreed to participate in the study. They ranged in experience from 2 to 18 years. Two of the participants were unit managers, 2 were clinical nurse educators (CNEs), and the other 3 were staff nurses with 1 of them in a leadership position. Methods: Individual semistructured interview were conducted over the telephone. The interview guide was developed based on a review of the literature. Interviews continued until no new information was obtained, that is, data were saturated. Interviews were audio recorded and transcribed verbatim. Field notes were recorded. A constant comparative approach was used for analysis. The coding process was both deductive (drawing from the literature) and inductive. Results: Seven participants were interviewed, and there were 4 main themes and 1 subtheme that emerged from the analysis: education (along with the subtheme of resources) was seen as both facilitators and barriers; patient/family ability to perform PD; infrequent exposure; and physician supports. Continuing education about PD was a facilitator, and the lack of education was a barrier to provision of PD care. Similarly, availability of resource materials about PD and access to a CNE were facilitators, while lack of these resources was a barrier to offering PD care. As PD was not always seen regularly, infrequent exposure was a barrier to offering PD care. Lack of physician supports, both from the locum physicians who were sometimes reluctant to care for these patients and the delays in reaching nephrologists were barriers. Limitations: The findings represent the perceptions of the emergency department nurses who participated. These perceptions may differ from those of nurses who work in other regions of the country. Furthermore, most participants were in a leadership role, and it may be that their perspectives differ from those of front-line nurses. Conclusions: The findings from our study highlight the need for availability of education and resource materials/persons to care for these patients. There is also a need for greater physician support from both local physicians as well as nephrologists to offer high-quality PD care. Trial registration: Not applicable. This study is not a clinical trial. It did not involve prospective assignment of participants to a treatment group.

Стилі APA, Harvard, Vancouver, ISO та ін.

42

Singh, Rama S., and Lorenz R. Rhomberg. "A Comprehensive Study of Genic Variation in Natural Populations of Drosophila melanogaster. II. Estimates of Heterozygosity and Patterns of Geographic Differentiation." Genetics 117, no. 2 (October 1, 1987): 255–71. http://dx.doi.org/10.1093/genetics/117.2.255.

Повний текст джерела

Анотація:

ABSTRACT A study of genic variation in natural population of D. melanogaster was undertaken (1) to obtain a better estimate of heterozygosity by sampling a relatively large number of gene loci and (2) to identify different groups of polymorphic loci whose variation patterns might suggest different kinds of selection forces. A total of 117 gene loci (coding for 79 enzymes and 38 abundant proteins) were studied in 15 geographically distant populations originating from different continents. The findings of this study are as follows: (1) of the 117 gene loci studied, 61 are polymorphic and 56 are uniformly monomorphic everywhere. (2) An average population is polymorphic for 43% of its gene loci and an average individual is heterozygous for 10% of its gene loci. These estimates are remarkably similar among populations. (3) The average within-locality heterozygosity (HS) for polymorphic loci is uniformly distributed over the range of heterozygosity observed; i.e., given that a locus has any local variation, it is nearly as likely to have a lot as a little. (4) The distribution of FST (fixation index) is strongly skewed, with a prominent mode at 8–10% and a long tail of high values reaching a maximum of 58%. Two-thirds of all loci fall within the bell-shaped distribution centered on an FST of 8–10%, a result compatible with the notion that they are experiencing a common tendency toward small interlocality differences owing to extensive gene flow among populations. (5) The distribution of total heterozygosity (HT) has a prominent bimodal distribution. The lower mode consists of loci with single prominent allele and a few uncommon ones and the upper mode consists of clinally varying loci with a high FST(e.g., Adh and G6-pd), loci with many alleles in high frequency (e.g., Ao and Xdh) and loci with two alleles in high frequency in all populations but, with little interpopulational differentiation (e.g., Est-6 and α-Fuc). The loci in the lower mode are probably under purifying selection; a large proportion of those in the latter mode may be under balancing selection. (6) Comparison of genic variation for loci located inside vs. outside inversions, comparison of FST for inversions and their associated genes, and comparison of FST and map position for pairs of loci all suggest that, while linkage has some influence, it does not seem to constrain the pattern of variation that a locus may develop. (7) Eighteen polymorphic loci show latitudinal variation in allele frequencies which are consistent in populations from different continents. (8) Estimates of Nei genetic distance between population pairs are generally low between populations on the same continent and high between populations on different continents. There are two important exceptions: population pairs for which both localities are in the temperate zone show no relationship to distance, and in cases where both populations are tropical or subtropical, the genetic distance is higher than for the temperate-tropical comparisons and seem even higher than one would expect from the geographic distance separating them. The latter observation suggests that either geographic separation outweighs differences in environment in determining the genetic composition of a population or that all tropical populations are not experiencing the same environment.—The results are discussed in relation to the neutralist-selectionist controversy of genic variation and two important conclusions are drawn: First, there is a negative correlation between the number of loci sampled and the resulting heterozygosity. This means that available estimates of heterozygosity, 85% of which are based on 30 or fewer loci, are high and hence not appropriate for making between-taxa comparisons. Secondly, there is a group of loci, comprising one-third of polymorphic loci (or about 15% of all loci studied), that is distinguishable by different patterns of variation within and among populations. Most of these loci have clinal variation which is consistent with the hypothesis that their genetic variation is maintained by balancing selection.

Стилі APA, Harvard, Vancouver, ISO та ін.

43

Asmann, Yan W., Vivekananda Sarangi, Bruce W. Eckloff, Julie M. Cunningham, Samantha J. McDonough, Yeon K. Lee, Eric D. Wieben, et al. "Comparison Of Single Nucleotide Mutations (SNVs) and Copy Number Variants (CNVs) Detection In Formalin Fixed Paraffin Embedded (FFPE) and Paired Frozen Tumor Tissues Using Target Capture and Sequencing Approach." Blood 122, no. 21 (November 15, 2013): 1784. http://dx.doi.org/10.1182/blood.v122.21.1784.1784.

Повний текст джерела

Анотація:

Abstract Background Next Generation sequencing (NGS) is a powerful tool to identify somatic mutations associated with tumor onset and drug response. While it is well suited for high quality fresh/frozen samples, NGS is not proven for FFPE tissue which is the most common type of clinical specimen. Since the nucleic acids can be readily extracted from FFPE samples for a variety of genomic analyses, a comparative mutational analysis of paired frozen and FFPE tissues is urgently needed. Our long term goal is to establish a lab protocol to detect mutations in FFPE tumors using a targeted capture and sequencing approach for genes of interest. This pilot study focuses on the comparison of FFPE and frozen samples to test the validity of using FFPE tissues in such application. Methods Gene Selection: 128 genes associated with known pathogenic mutations in lymphoma Sample Selection: 9 diffuse large B-cell lymphoma (DLBCL) cases with FFPE, frozen and germline samples, as well as 10 frozen normal lymphatic tissues as references for CNV detections Capture Probe Design: We targeted coding exons and UTR, as well as the evolutionarily conserved intronic regions. The capture probes were designed using the Agilent eArray tool. The titling density of the probes was set to 3 probes overlapping with every base in the target region to improve the capture efficiency in FFPE samples. The least stringent masking of the repeat regions was allowed to include regions with small repeats that are shorter than the length of the sequencing reads (100-bp). In addition, boosting parameters were picked to set various levels of probe replication in different regions in order to minimize the local coverage differences (e.g. between regions of different GC contents) Sequencing and Bioinformatics: The target capture and sequencing were performed by the Mayo Clinic Medical Genome Facility. The reads were mapped to Human Reference Genome Build 37 using Novalign, and SNVs were called using GATK. The CNVs were identified using an in-house developed algorithm, patternCNV. Results The designed probes covered 99.65937% of the target regions. We generated 2.2-6.7 Gbp of reads per sample, 57.4-71.5% of which were on target. This equalled an average coverage of 2100-6700 folds which is 10-30 times higher than the minimal coverage recommended by Agilent. Due to this high coverage, we observed duplicate reads that accounted for 7.7-73.5% of the total reads. When we analysed the data with and without the duplicated reads, the concordance of the called SNVs was between 84-93% out of 207-249 mutated positions per trio-sample. There were 7.8-8.9% and 1.1-2.2% unique SNVs per sample by excluding or including duplicate reads, respectively. The dis-concordances were mostly missed calls, where a SNV was observed in only 1 or 2 of the trio samples. The missed calls from frozen samples ranged from 0-10.4% compared to 1.4-10.4% from the FFPE tissues, with 0.88-2.4% more SNVs missed in FFPE. Further analyses showed that all of the missing calls came from the lack of or low coverage of the corresponding positions. There were also differences of the called SNVs between the trio samples. However, this was extremely rare. Only 2 out of the 9 trio samples at a total of 3 positions had disagreements in called SNVs between FFPE and frozen tissues, all due to the allelic imbalance where the percentage of reads supporting the alternative alleles were below 20%. Therefore, this dis-concordance can be removed by back-filling of the read-level information for each position. Unfortunately only 11.9-47.4% of the CNVs called in frozen tissues were identified in FFPE samples, due to the widely various coverage in FFPE samples. The consequent large noises of the log ratio values between the FFPEs and normal references significantly reduced the sensitivity for CNV calling. Conclusions This pilot study compared the performance of SNV and CNV detection in FFPE and paired frozen tissues using a target capture and sequencing approach. With a capture probe design strategized to benefit FFPE samples, we observed SNV detection rates in FFPE that were only slightly lower (0.88-2.4%) than those of frozen tissues due to poor coverage of some positions in FFPE samples. With a proper back-filling step, there was no dis-concordance of the called SNVs between FFPE and frozen samples. However, CNV detections in FFPE were more problematic due to the un-predictable regional coverage in FFPE samples. Disclosures: No relevant conflicts of interest to declare.

Стилі APA, Harvard, Vancouver, ISO та ін.

44

VanGilder, Paul, Ying Shi, Gregory Apker, and Christopher A. Buneo. "Sensory feedback-dependent coding of arm position in local field potentials of the posterior parietal cortex." Scientific Reports 11, no. 1 (April 27, 2021). http://dx.doi.org/10.1038/s41598-021-88278-5.

Повний текст джерела

Анотація:

AbstractAlthough multisensory integration is crucial for sensorimotor function, it is unclear how visual and proprioceptive sensory cues are combined in the brain during motor behaviors. Here we characterized the effects of multisensory interactions on local field potential (LFP) activity obtained from the superior parietal lobule (SPL) as non-human primates performed a reaching task with either unimodal (proprioceptive) or bimodal (visual-proprioceptive) sensory feedback. Based on previous analyses of spiking activity, we hypothesized that evoked LFP responses would be tuned to arm location but would be suppressed on bimodal trials, relative to unimodal trials. We also expected to see a substantial number of recording sites with enhanced beta band spectral power for only one set of feedback conditions (e.g. unimodal or bimodal), as was previously observed for spiking activity. We found that evoked activity and beta band power were tuned to arm location at many individual sites, though this tuning often differed between unimodal and bimodal trials. Across the population, both evoked and beta activity were consistent with feedback-dependent tuning to arm location, while beta band activity also showed evidence of response suppression on bimodal trials. The results suggest that multisensory interactions can alter the tuning and gain of arm position-related LFP activity in the SPL.

Стилі APA, Harvard, Vancouver, ISO та ін.

45

Nadasdy, Zoltan, Daniel H. P. Howell, Ágoston Török, T. Peter Nguyen, Jason Y. Shen, Deborah E. Briggs, Pradeep N. Modur, and Robert J. Buchanan. "Phase coding of spatial representations in the human entorhinal cortex." Science Advances 8, no. 18 (May 6, 2022). http://dx.doi.org/10.1126/sciadv.abm6081.

Повний текст джерела

Анотація:

The grid-like activity pattern of cells in the mammalian entorhinal cortex provides an internal reference frame for allocentric self-localization. The same neurons maintain robust phase couplings with local field oscillations. We found that neurons of the human entorhinal cortex display consistent spatial and temporal phase locking between spikes and slow gamma band local field potentials (LFPs) during virtual navigation. The phase locking maintained an environment-specific map over time. The phase tuning of spikes to the slow gamma band LFP revealed spatially periodic phase grids with environment-dependent scaling and consistent alignment with the environment. Using a Bayesian decoding model, we could predict the avatar’s position with near perfect accuracy and, to a lesser extent, that of heading direction as well. These results imply that the phase of spikes relative to spatially modulated gamma oscillations encode allocentric spatial positions. We posit that a joint spatiotemporal phase code can implement the combined neural representation of space and time in the human entorhinal cortex.

Стилі APA, Harvard, Vancouver, ISO та ін.

46

Karaman, Nuray. "Coding Whiteness and Racialization: Living in the Space as an Insider-Outsider." Journal of International Students 13, no. 1 (April 15, 2022). http://dx.doi.org/10.32674/jis.v13i1.4336.

Повний текст джерела

Анотація:

This study analyzes whiteness from the perspectives of “politic of location” to understand how it has changed and applied across the globe, rather than ignoring the relevancy of white supremacy for some geographies that have a racially homogenous population. The first part of the article interrogates my personal experiences of whiteness in Turkey which has a racially homogenous population. In Turkey, my experiences with whiteness were not as a result of directly having white bodies, but rather by being a part of the dominant culture, nation, religion, and language. The second part of this study discusses my experiences of whiteness in the United States. I highlight the different ways in which I experienced whiteness that had to do with my position as a Muslim Turkish woman in racially diverse America. In this autoethnography, by showing my relations and experiences within the discourse of whiteness and racialization of Muslims, I show how whiteness has significantly different meanings in different locations, and how whiteness’s ideology affects people’s experiences through local and global power relations.

Стилі APA, Harvard, Vancouver, ISO та ін.

47

Moyse-Faurie, Claire. "Linguistic expressions of Goal, Source and Place in Polynesian languages." Studies in Language, December 14, 2020. http://dx.doi.org/10.1075/sl.00017.moy.

Повний текст джерела

Анотація:

Abstract In Polynesian languages, as in many other Oceanic languages, the linguistic expression of Source and Goal is mainly express by (i) demonstratives and directional modifiers, which combine deictic and spatial information (toward speaker, addressee or third person, upwards, downwards, transverse axe), (ii) locative static and dynamic prepositions which may combine with body-part terms to introduce local and landmark nouns, or place names, and (iii) posture and motion verbs. We examine the occurrences of the Source and Goal prepositions on the one hand, and the directional modifiers on the other, taking into account their compatibilities, the spatial coding they convey, the position of the participants, and the verb meaning. In Polynesian languages, Goal and Source are of similar complexity, though in different ways, and a variety of resources can express fine-grained distinctions for Source vs. Goal depending on the position of the figure.

Стилі APA, Harvard, Vancouver, ISO та ін.

48

Han, Axiang, Baochang Sun, Zhewei Sun, Xuelian Xu, Qiongying Yang, Danli Xie, Wanchun Guan, and Yongliang Lou. "Molecular Characterization and Phylogenetic Analysis of the 2019 Dengue Outbreak in Wenzhou, China." Frontiers in Cellular and Infection Microbiology 12 (May 19, 2022). http://dx.doi.org/10.3389/fcimb.2022.829380.

Повний текст джерела

Анотація:

In 2019, a dengue outbreak occurred with 290 confirmed cases in Wenzhou, a coastal city in southeast China. To identify the origin of the dengue virus (DENV) from this outbreak, viral RNA was extracted from four serum samples and sequenced for whole genome analysis. Then, phylogenetic analysis, gene mutation, secondary structure prediction, selection pressure analysis, and recombination analysis were performed. DENV strains Cam-03 and Cam-11 were isolated from patients traveling from Cambodia, while ZJWZ-18 and ZJWZ-62 strains were isolated from local patients without a record of traveling abroad. The whole genome sequence of all four strains was 10,735 nucleotides long. Phylogenetic tree analysis showed that the four strains belonged to genotype 1 of DENV-1, but the local Wenzhou strains and imported strains clustered in different branches. ZJWZ-18 and ZJWZ-62 were closely related to strain MF033254-Singapore-2016, and Cam-03 and Cam-11 were closely related to strain AB608788-China : Taiwan-1994. A comparison of the coding regions between the local strains and the DENV-1 standard strain (EU848545-Hawaii-1944) showed 82 amino acid mutations between the two strains. A total of 55 amino acid mutations were found between the coding regions of the local and imported strains. The overall secondary structure of the 3′ UTR of the local strains had changed: apparent changes in the head and tail position were observed when compared to DENV-1 standard strain. Furthermore, selection pressure analysis and recombination detection using the 4 isolates and 41 reference strains showed two credible positive selection sites and eight credible recombination events, which warrant further studies. This study may enhance the understanding of viral replication, infection, evolution, virulence, and pathogenicity of DENV.

Стилі APA, Harvard, Vancouver, ISO та ін.

49

Rule, Michael E., Adrianna R. Loback, Dhruva V. Raman, Laura N. Driscoll, Christopher D. Harvey, and Timothy O'Leary. "Stable task information from an unstable neural population." eLife 9 (July 14, 2020). http://dx.doi.org/10.7554/elife.51121.

Повний текст джерела

Анотація:

Over days and weeks, neural activity representing an animal’s position and movement in sensorimotor cortex has been found to continually reconfigure or ‘drift’ during repeated trials of learned tasks, with no obvious change in behavior. This challenges classical theories, which assume stable engrams underlie stable behavior. However, it is not known whether this drift occurs systematically, allowing downstream circuits to extract consistent information. Analyzing long-term calcium imaging recordings from posterior parietal cortex in mice (Mus musculus), we show that drift is systematically constrained far above chance, facilitating a linear weighted readout of behavioral variables. However, a significant component of drift continually degrades a fixed readout, implying that drift is not confined to a null coding space. We calculate the amount of plasticity required to compensate drift independently of any learning rule, and find that this is within physiologically achievable bounds. We demonstrate that a simple, biologically plausible local learning rule can achieve these bounds, accurately decoding behavior over many days.

Стилі APA, Harvard, Vancouver, ISO та ін.

50

Havdal, Hanne Hennig, Elisabeth Fosse, MEkdes Kebede Gebremariam, Karien Stronks, Oddbjørn Klomsten Andersen, and Nanna Lien. "Does the socioeconomic positioned neighbourhood matter? Norwegian adolescents’ perceptions of barriers and facilitators for physical activity." Scandinavian Journal of Public Health, January 10, 2022, 140349482110666. http://dx.doi.org/10.1177/14034948211066673.

Повний текст джерела

Анотація:

Background and aims: A higher proportion of adolescents from lower socioeconomic position families tend to be less physically active than their counterparts from higher socioeconomic position families. More research is needed to understand the causes of these differences, particularly the influence of the neighbourhood environment. This qualitative study aims to explore how adolescents and their parents from higher and lower socioeconomic neighbourhoods perceive the social, organisational and physical environment influencing adolescents’ physical activity behaviours. Method: We conducted six semi-structured focus groups with 35 13–14-year-olds and eight interviews with some of their parents. The interviewees were recruited from one higher and two lower socioeconomic neighbourhoods in Oslo, Norway. Theme-based coding was used for analysis, and the results discussed in light of an ecological framework. Results: The results indicate that factors like social norms in a neighbourhood could shape adolescents’ physical activity behaviour, and a social norm of an active lifestyle seemed to be an essential facilitator in the higher socioeconomic neighbourhood. Higher availability of physical activity and high parental engagement seemed to facilitate higher physical activity in this neighbourhood. In the lower socioeconomic neighbourhoods, the availability of local organised physical activity and volunteer engagement from parents varied. Programmes from the municipality and volunteer organisations seemed to influence and be essential for adolescents’ physical activity behaviour in these neighbourhoods. Conclusions: The results illustrate the complexity of behaviour and environment interaction, and a limitation in explaining the phenomenon by focusing primarily on the individual level rather than an ecological perspective.

Стилі APA, Harvard, Vancouver, ISO та ін.

Статті в журналах з теми "Local-position coding"

Оформте джерело за APA, MLA, Chicago, Harvard та іншими стилями