Статті в журналах з теми "Least Recently Sent"
Щоб переглянути інші типи публікацій з цієї теми, перейдіть за посиланням: Least Recently Sent.
Оформте джерело за APA, MLA, Chicago, Harvard та іншими стилями
Ознайомтеся з топ-50 статей у журналах для дослідження на тему "Least Recently Sent".
Біля кожної праці в переліку літератури доступна кнопка «Додати до бібліографії». Скористайтеся нею – і ми автоматично оформимо бібліографічне посилання на обрану працю в потрібному вам стилі цитування: APA, MLA, «Гарвард», «Чикаго», «Ванкувер» тощо.
Також ви можете завантажити повний текст наукової публікації у форматі «.pdf» та прочитати онлайн анотацію до роботи, якщо відповідні параметри наявні в метаданих.
Переглядайте статті в журналах для різних дисциплін та оформлюйте правильно вашу бібліографію.
1
Shoemaker, Candice A., and P. Diane Relf. "Attitudes of Consumers and Recently Bereaved Toward Sympathy Flowers." HortScience 29, no. 8 (August 1994): 914–15. http://dx.doi.org/10.21273/hortsci.29.8.914.
Повний текст джерелаАнотація:
Surveys of consumers and the recently bereaved were conducted to determine who sends flowers as a sympathy gift and when and why sympathy flowers are sent. Of consumers, 85% sent flowers as a sympathy gift at least once; similarly, 84% of the recently bereaved had sent sympathy flowers. Most sympathy flowers are sent to close friends (63%) and close family members (62%), and sympathy flowers are most often received from close friends (56%) and close family members (43%). Ninety-three percent send flowers as a sympathy gift immediately after notification of a death. According to our survey, sympathy flowers serve two roles in the bereavement process—an emotional and a functional role. Except contact of family and friends, participants indicated that receiving sympathy flowers to help deal with grief was equally or more valuable than all rituals associated with funerals.
2
Kareem Salim, Sarah, Mohammed Majid Msallam, and Huda Ismail Olewi. "Hide text in an image using Blowfish algorithm and development of least significant bit technique." Indonesian Journal of Electrical Engineering and Computer Science 29, no. 1 (January 1, 2022): 339. http://dx.doi.org/10.11591/ijeecs.v29.i1.pp339-347.
Повний текст джерелаАнотація:
Recently, there is increasing interest in data transfer between many different devices. Data must be encrypted before being sent so that the intended receiver can only read it to prevent unauthorized access and processing of a secret message. This paper suggests two levels of security to secure import messages that are sent via the internet. A secret text is encrypted by a Blowfish algorithm, then the secret text is hidden in an image by the least significant bit (LSB) technique. The LSB method of concealing important information was developed to conceal at least the first of at least two bits, depending on the cover data. The resolution of an image is raised in our work where the sender selects a stego image with a high peak signal to noise ratio (PSNR). The receiver knows all the necessary information for decoding by the first nine pixels. The PSNR is used for evaluating the resolution of the image to check robustness at sending. The number of PSNR illustrates in our proposal that the resolution of the image is near the original LSB technique, but the embedding is more randomly robust in steganography.
3
Wolf, Thomas M., Howard M. Randall, and John M. Faucett. "A Survey of Health Promotion Programs in U.S. and Canadian Medical Schools." American Journal of Health Promotion 3, no. 1 (June 1988): 33–36. http://dx.doi.org/10.4278/0890-1171-3.1.33.
Повний текст джерелаАнотація:
A health promotion and wellness survey questionnaire was sent to all 143 accredited medical schools in the United States, Canada, and Puerto Rico. Of the 120 responding schools, 29 (24.2%) offer health promotion programs and 91 (75.8%) do not; most programs began only recently (average 5.42 years). Nineteen schools plan to begin programs soon. Most emphasized in the programs is physical well-being and least emphasized is spiritual well-being. Over 50% of the schools offer these components: study skills (62.1%), support groups (62.1%), time management (58.6%), aerobics (55.2%), intramural sports (55.2%), and financial planning (51.7%). Most programs are administered by the Dean of Student Affairs, 48.3% have a budget, and 51.7% have an evaluation component. All schools with programs expressed an interest in developing a network to share information. Emphasizing health promotion and disease prevention throughout medical education is important, particularly as an approach to enhancing the doctor-patient relationship.
4
MURAO, SATOSHI, FUMITAKA NISHIYAMA, and SOTHAM SIENG. "PRELIMINARY STUDY OF RIVER WATER IN GOLD MINING AREAS OF CAMBODIA." International Journal of PIXE 14, no. 03n04 (January 2004): 109–14. http://dx.doi.org/10.1142/s0129083504000161.
Повний текст джерелаАнотація:
In Cambodia, artisanal mining has recently come to a social concern because of the possibility to cause environmental degradation and human health problems. The General Department of Mineral Resources of Cambodia is collecting environmental specimens in mining sites to watch the situation. This time, four water samples from Sampov Loon and one from Memong mining site were sent from the Department to Hiroshima University, Japan, and the samples were analyzed by means of PIXE at the University. A volume of 10 μl from each sample was separated and dropped onto 4 μm polypropylene backing foil. The measurement was carried out by using 2.5 MV single-ended Van de Graaff accelerator. A Si(Li) detector (active area, 80mm2; sensitive depth, 5mm; Be -window's thickness, 25 μm; resolution, 167 eV fwhm at 5.9 keV) was used for both of in vacuo PIXE and non-vacuum external beam PIXE measurement. A computer code PIXS was used for the quantification. The result indicates that there are at least two kinds of water in Sampov Loon and one of them possibly represents polluted condition.
5
VELDE, FRANÇOIS R. "THE LIFE AND TIMES OF NICOLAS DUTOT." Journal of the History of Economic Thought 34, no. 1 (March 2012): 67–107. http://dx.doi.org/10.1017/s1053837212000065.
Повний текст джерелаАнотація:
Nicolas Dutot (1684–1741) is an important figure for the history of economic thought, as a pioneer in monetary theory and price statistics, and for economic history, as a chronicler of John Law’s System. Yet, until recently, very little information about him was known, some of it incorrect. I present extensive research that reveals a remarkable career rising from humble origins and full of surprises. He spent his formative years in the ranks of the “ancienne finance” he was thought to despise, and then worked for the Chamber of Justice that he so decried in his writings, only to be sent to the Bastille for corruption. After working for Law’s Bank and then retiring quite comfortably, he continued to socialize with his pre-System financier and banker friends, at least for a while. He also joined a short-lived learned society and accumulated a substantial library that reveals much about his tastes and affinities. The portrait that emerges is at odds with the image of an honest accountant he tried to project, but also richer and more engaging.
6
Xiao, Di, Min Li, and Hongying Zheng. "Smart Privacy Protection for Big Video Data Storage Based on Hierarchical Edge Computing." Sensors 20, no. 5 (March 10, 2020): 1517. http://dx.doi.org/10.3390/s20051517.
Повний текст джерелаАнотація:
Recently, the rapid development of the Internet of Things (IoT) has led to an increasing exponential growth of non-scalar data (e.g., images, videos). Local services are far from satisfying storage requirements, and the cloud computing fails to effectively support heterogeneous distributed IoT environments, such as wireless sensor network. To effectively provide smart privacy protection for video data storage, we take full advantage of three patterns (multi-access edge computing, cloudlets and fog computing) of edge computing to design the hierarchical edge computing architecture, and propose a low-complexity and high-secure scheme based on it. The video is divided into three parts and stored in completely different facilities. Specifically, the most significant bits of key frames are directly stored in local sensor devices while the least significant bits of key frames are encrypted and sent to the semi-trusted cloudlets. The non-key frame is compressed with the two-layer parallel compressive sensing and encrypted by the 2D logistic-skew tent map and then transmitted to the cloud. Simulation experiments and theoretical analysis demonstrate that our proposed scheme can not only provide smart privacy protection for big video data storage based on the hierarchical edge computing, but also avoid increasing additional computation burden and storage pressure.
7
Talbot, Jean-Noël. "The clinical impact of [18F]-FDG Pet during the opening year of a Pet centre." Brazilian Archives of Biology and Technology 45, spe (September 2002): 61–67. http://dx.doi.org/10.1590/s1516-89132002000500009.
Повний текст джерелаАнотація:
We have evaluated the clinical impact of FDG-PET on patient staging and management during the opening year of our PET centre in France. A questionnaire, translation in French of the questionnaire used recently in California, was sent to the referring physician of each of the 476 patients who had at least one routine FDG-PET examination during the year 2000. Of 348 responses (response rate = 73%), the disease was upstaged in 26% of the cases and downstaged in 9%. Inter-modality management changes (change from a scheduled therapeutic modality for a different one) were reported in 37% of the cases and intra-modality changes in 9%. Those modification rates were respectively 38% and 7% in recurrence of colorectal cancer (153 patients), 47% and 7% in lung cancer (118 patients), 16% and 23% in lymphoma (43 patients), 25% and 6% in the staging of head and neck cancers (32 patients).When comparing with the similar studies performed in California, there were no significant differences between the rates of inter-modality management changes. In contrast, intra-modality management changes were less frequent in our survey, except for lymphoma. Globally, the clinical impact of FDG PET was similar, with a higher response rate to our survey (73% versus 35%); it was above the mean 31% rate of therapeutic modification derived from a recent tabulated summary in over 3400 patients.
8
Isah, M. B., M. Abdulsalam, A. Bello, M. I. Ibrahim, A. Usman, A. Nasir, B. Abdulkadir, et al. "Coronavirus Disease 2019 (COVID-19): A Cross-Sectional Survey of the Knowledge, Attitudes, Practices (KAP) and Misconceptions in the General Population of Katsina State, Nigeria." UMYU Journal of Microbiology Research (UJMR) 6, no. 1 (June 30, 2021): 24–37. http://dx.doi.org/10.47430/ujmr.2161.004.
Повний текст джерелаАнотація:
Over six million cases of Coronavirus Disease 2019 (COVID-19) were reported globally by the second quarter of 2020. This study assessed the COVID-19 related knowledge, attitudes, practices and misconceptions in Katsina state, Nigeria. The study is across-sectional survey of 722 respondents using an electronic questionnaire through the WhatsApp media platform. One thousand five hundred questionnaires were sent to the general public with a response rate of 48%. Among the respondents, 60% were men, and 56% held bachelor’s degree and above. The respondents have good knowledge of COVID-19 (80% correct rate on questions related to knowledge). Being more educated is associated with both higher average COVID-19 knowledge score and positive COVID-19 related practices. Overall, >70% of the respondents have a positive attitude towards successful COVID-19 control. Male were more likely than female (Fisher’s exact test P value < 0.05) to have recently attended a crowded place. Among the respondents, 83% held at least one misconception related to COVID-19. Respondents at all levels of education frequently chose to trust health unit and health care workers for relevant COVID-19 information. In conclusion, although there is high COVID-19 related knowledge among the respondents, misconceptions are widespread among them. These misconceptions have consequences on the short- and long-term control efforts against the disease and hence should be incorporated in targeted campaigns. Healthcare related personnel should be at the forefront of the campaign. Keywords: COVID-19; knowledge; attitude; practices; misconceptions; Nigeria
9
Ejdys, Joanna. "Factors Influencing Satisfaction and Future Intention to Use E-Learning at the University Level." Foresight and STI Governance 16, no. 2 (June 20, 2022): 52–64. http://dx.doi.org/10.17323/2500-2597.2022.2.52.64.
Повний текст джерелаАнотація:
With the growing interest in e-education, particularly in the context of the pandemic, more scientific studies have been undertaken recently to analyze and identify factors influencing e-learning acceptance. Indeed, e-learning acceptance depends on many different factors, but no consensus has been reached on factors that contribute most to the acceptance of e-learning solutions. Consequently, this article ascertains the factors and their relationships behind the satisfaction and the future intention to use e-learning among Polish university students. From among the factors analyzed in the literature, the author examined the relationship between computer self-efficacy (CSE), facilitating conditions (FC), satisfaction (S) and the future intention to use e-learning (FI). Data were gathered using structured questionnaires and computer-assisted web interviewing (CAWI). Students at Bialystok University of Technology (Poland) were sent an electronic link to the questionnaires using the internal e-mail system. Eight hundred three forms were returned fully filled out. Aiming to ascertain the extent to which measured variables describe the number of constructs, the author made the Confirmatory Factor Analysis (CFA). The Generalized Least Squares (GLS) estimator was used to calculate the values of model parameters.The results confirmed that higher computer self-efficacy and better facilitation conditions result in greater user satisfaction with e-learning. However, facilitating conditions impact user satisfaction more than computer self-efficacy construct variables. Based on the findings, user satisfaction is a strong anticedents of the future intention to use e-learning.
10
Morris, Bonny, Umit Topaloglu, Glenn Jay Lesser, Roy E. Strowd, Kathryn E. Weaver, Derek Sean Falk, and Ronny A. Bell. "Rural disparities in oncology patient portal enrollment and use." Journal of Clinical Oncology 40, no. 16_suppl (June 1, 2022): 6557. http://dx.doi.org/10.1200/jco.2022.40.16_suppl.6557.
Повний текст джерелаАнотація:
6557 Background: Patient portals support patient access, engagement, and care coordination, yet could also widen the digital divide and exacerbate disparities among vulnerable populations. There is emerging evidence that racial/ethnic minority patients are less likely to use portals, yet prior research has not examined potential rural differences. We identified sociodemographic factors associated with portal enrollment and use among a racially and geographically diverse population of cancer patients. Methods: We retrospectively examined portal enrollment and use at an NCI-designated comprehensive cancer center from January 2015 until February 2022 among patients 18+ years old with a neoplastic disease diagnosis (ICD-10-CM C00-D49). Potential predictors included gender, race/ethnicity, marital status, age, rural (Rural-Urban Continuum Codes [RUCC] 4-9) vs nonrural (RUCC 1-3) residence, residential distance from the cancer center, and time since diagnosis. We used multivariable logistic regression to generate odds ratios (ORs) for portal enrollment and having ever sent a portal message, and Poisson regression to determine incidence rate ratios (IRRs) for number of logins and number of healthcare team interactions (portal messages or appointment requests), controlling for ICD-10 diagnosis (SAS 9.4). Results: We identified 11,333 patients (average age 67 years, 59% female, 24% rural, 10% Non-Hispanic Black, 1% Hispanic, 20% non-melanoma skin cancer, 14% breast cancer, 9% lung cancer). 36% of patients had enrolled in the portal, and of these, 80% had sent at least one message. Patients logged in a median of 203.5 times and had a median of 19 portal interactions. Rural residents were less likely to enroll in the portal than urban patients (28% vs 38%, p < 0.0001). Non-Hispanic Black patients and Hispanic/Latinx patients were less likely to enroll in the portal compared with non-Hispanic White patients (22% and 27%, respectively, vs 38.5%, p < 0.0001). Women, younger patients, more recently diagnosed cancer patients, and patients who were married/ partnered were significantly more likely to enroll. In multivariable analysis controlling for cancer type, rural patients were half as likely to enroll in the portal (OR: 0.48 [0.43-0.54]). Among those enrolled, rural residents were 25% less likely to have ever sent a portal message (OR: 0.75 [(0.62-0.92]), and had nearly half the login and interaction rates (IRR: 0.66 [0.66-0.67]; IRR: 0.58 [0.58-0.59], respectively). Patients who were Non-Hispanic Black, Hispanic, or unmarried were also significantly less likely to enroll or engage in the portal. Conclusions: Patient portals remain underutilized among cancer patients, despite an increased reliance on virtual communications in the COVID era. Interventions to support portal engagement among rural residents and racial/ethnic minority patients are needed to avoid potentially exacerbating health disparities.
11
Morris, Bonny, Umit Topaloglu, Glenn Jay Lesser, Roy E. Strowd, Kathryn E. Weaver, Derek Sean Falk, and Ronny A. Bell. "Rural disparities in oncology patient portal enrollment and use." Journal of Clinical Oncology 40, no. 16_suppl (June 1, 2022): 6557. http://dx.doi.org/10.1200/jco.2022.40.16_suppl.6557.
Повний текст джерелаАнотація:
6557 Background: Patient portals support patient access, engagement, and care coordination, yet could also widen the digital divide and exacerbate disparities among vulnerable populations. There is emerging evidence that racial/ethnic minority patients are less likely to use portals, yet prior research has not examined potential rural differences. We identified sociodemographic factors associated with portal enrollment and use among a racially and geographically diverse population of cancer patients. Methods: We retrospectively examined portal enrollment and use at an NCI-designated comprehensive cancer center from January 2015 until February 2022 among patients 18+ years old with a neoplastic disease diagnosis (ICD-10-CM C00-D49). Potential predictors included gender, race/ethnicity, marital status, age, rural (Rural-Urban Continuum Codes [RUCC] 4-9) vs nonrural (RUCC 1-3) residence, residential distance from the cancer center, and time since diagnosis. We used multivariable logistic regression to generate odds ratios (ORs) for portal enrollment and having ever sent a portal message, and Poisson regression to determine incidence rate ratios (IRRs) for number of logins and number of healthcare team interactions (portal messages or appointment requests), controlling for ICD-10 diagnosis (SAS 9.4). Results: We identified 11,333 patients (average age 67 years, 59% female, 24% rural, 10% Non-Hispanic Black, 1% Hispanic, 20% non-melanoma skin cancer, 14% breast cancer, 9% lung cancer). 36% of patients had enrolled in the portal, and of these, 80% had sent at least one message. Patients logged in a median of 203.5 times and had a median of 19 portal interactions. Rural residents were less likely to enroll in the portal than urban patients (28% vs 38%, p < 0.0001). Non-Hispanic Black patients and Hispanic/Latinx patients were less likely to enroll in the portal compared with non-Hispanic White patients (22% and 27%, respectively, vs 38.5%, p < 0.0001). Women, younger patients, more recently diagnosed cancer patients, and patients who were married/ partnered were significantly more likely to enroll. In multivariable analysis controlling for cancer type, rural patients were half as likely to enroll in the portal (OR: 0.48 [0.43-0.54]). Among those enrolled, rural residents were 25% less likely to have ever sent a portal message (OR: 0.75 [(0.62-0.92]), and had nearly half the login and interaction rates (IRR: 0.66 [0.66-0.67]; IRR: 0.58 [0.58-0.59], respectively). Patients who were Non-Hispanic Black, Hispanic, or unmarried were also significantly less likely to enroll or engage in the portal. Conclusions: Patient portals remain underutilized among cancer patients, despite an increased reliance on virtual communications in the COVID era. Interventions to support portal engagement among rural residents and racial/ethnic minority patients are needed to avoid potentially exacerbating health disparities.
12
Sousa, Cátia, Manuela Ferreira Almeida, Catarina Sousa Barbosa, Esmeralda Martins, Patrícia Janeiro, Isabel Tavares de Almeida, Anita MacDonald, and Júlio César Rocha. "The European Phenylketonuria Guidelines and the challenges on management practices in Portugal." Journal of Pediatric Endocrinology and Metabolism 32, no. 6 (June 26, 2019): 623–29. http://dx.doi.org/10.1515/jpem-2018-0527.
Повний текст джерелаАнотація:
Abstract Background Phenylketonuria (PKU) management practices differ between and within countries. In 2007, the Portuguese Society for Metabolic Disorders (SPDM) approved the Portuguese Consensus (PC) for the nutritional treatment of PKU. The recently published European PKU Guidelines (EPG, 2017) systematically reviewed recent evidence and aimed to harmonise treatment protocols in Europe. The objective of this study was to appraise the EPG acceptance and implementation in Portuguese treatment centres. Methods An electronic questionnaire was prepared and the link was sent to 135 SPDM members. It outlined the 10 EPG key recommendations and compared each statement with the consensus recommendations published by SPDM. Responses were recorded and descriptive analyses were performed. Results Twenty-five professionals completed the questionnaire, and over half (56%) were nutritionists/dieticians. At least one questionnaire from each of the 10 national treatment centres was returned. In general, responders accepted most of the recommendations. However, only the recommendation about target phenylalanine (Phe) concentrations between 120 and 360 μmol/L for patients <12 years received 100% consensus with a further seven recommendations gaining over 70% consensus. Almost half of the professionals (48%, n = 12) required further discussion about the EPG-safe upper target blood Phe concentration (600 μmol/L) suggested for patients aged ≥12 years. Almost one third (32%, n = 8) failed to agree with the recommendation in the EPG-proposed classification of Phe hydroxylase (PAH) deficiency. Conclusions The EPG received overall good acceptance, but there was divided opinion about some recommendations which require further discussion before implementation by the Portuguese treatment centres.
13
Horan, Martin Patrick, Sze Yee Chai, Nalishia Munusamy, Kwang Hong Tay, Louise Wienholt, Jason A. Tye-Din, James Daveson, Michael Varney, and Tony Badrick. "High rates of variation in HLA-DQ2/DQ8 testing for coeliac disease: results from an RCPAQAP pilot program." Journal of Clinical Pathology 71, no. 10 (May 15, 2018): 900–905. http://dx.doi.org/10.1136/jclinpath-2018-205209.
Повний текст джерелаАнотація:
AimCoeliac disease(CD) is a highly prevalent, gluten-dependent, autoimmune enteropathy. While the diagnosis is based on serological and histological criteria, genotyping of the human leucocyte antigens (HLA) DQ2 and DQ8 has been shown to have substantial clinical utility, especially in excluding the diagnosis in patients who do not carry either antigen. As a result, HLA genotyping is now being performed by more laboratories and has recently become one of the most frequently requested genetic tests in Australia. To date, there has been little scrutiny on the accuracy and reporting of results by laboratories new to HLA typing. In response to clinician feedback that identified potentially clinically significant discrepancies in HLA typing results, the Royal College of Pathologists of Australasia Quality Assurance Programs (RCPAQAP) undertook a pilot study to assess laboratory performance in the detection of HLA-DQ2/DQ8 and their associated HLA-DQA1 and HLA-DQB1 alleles.MethodsDNA was extracted from 5 patients and sent to 10 laboratories for external quality assurance (EQA) testing. Laboratories were assessed for reporting in genotyping, interpretation and methodology.ResultsOur findings showed that at least 80% of laboratories underperform with respect to recommended guidelines for HLA typing and reporting for CD, with 40% of laboratories failing to provide any clinical interpretation or full genotyping data. This suboptimal level of reporting may lead to ambiguities for downstream clinical interpretation that may compromise patient management.ConclusionsThese findings highlight the importance of adherence to standardised guidelines for optimal performance and reporting of HLA results and substantiate the need for EQA and proficiency testing for laboratories providing this service.
14
Sanglard, Leticia P., Larry A. Kuehn, Warren M. Snelling, and Matthew L. Spangler. "31 Genotype Concordance between SNP Chip and Imputed Low-Pass Whole-Genome Sequence in Beef Cattle." Journal of Animal Science 100, Supplement_3 (September 21, 2022): 7–8. http://dx.doi.org/10.1093/jas/skac247.012.
Повний текст джерелаАнотація:
Abstract Genotypes generated from common single nucleotide polymorphisms (SNP) chips have been the sole source of genomic information for current beef cattle genetic evaluations. More recently, the development of low-pass whole-genome sequencing (LPS) followed by imputation to full sequence and variant calls has provided an alternative option to generate genotypes for inclusion into genetic evaluations. The objective of this study was to estimate the genotype concordance between SNP chip and LPS genotypes. Ear samples, via tissue sampling units, were obtained from 226 individuals. A subset of 109 individuals also had blood samples collected. Samples were sent to GeneSeek (Neogen company, Lincoln, NE) for genotyping (100K or 50K) and LPS and imputation was performed by Gencove. A total of 33,451 and 78,032 SNP overlapping between SNP panel and LPS for ear and blood samples, respectively, were used for further analyses. Genotype concordance was performed by counting the number of matching genotypes per SNP between (1) SNP chip vs. LPS in ear and blood samples, and (2) LPS in blood vs. LPS in ear samples. The average concordances between SNP chip vs. LPS in ear and blood samples were 0.97±0.04 and 0.98±0.06, respectively. The average concordance between LPS in blood vs. ear samples was 0.97±0.03. In conclusion, the concordance was high regardless of the tissue type, and, at least in these data, differences in resulting genetic predictions would not be expected between the use of genotypes derived from SNP chips or LPS. Additional work is warranted to determine sensitivity to relationships between target animals and the reference set used for imputation. The USDA is an equal opportunity provider and employer.
15
Andersen, Brian, Michael Wheeler, Zhaorong Li, E. Antonio Chiocca, David Reardon, and Francisco Quintana. "TAMI-35. DETECTING SINGLE-CELL INTERACTIONS IN ORGANOTYPIC CULTURES OF GLIOBLASTOMA USING BARCODED RABIES VIRUS." Neuro-Oncology 23, Supplement_6 (November 2, 2021): vi205. http://dx.doi.org/10.1093/neuonc/noab196.819.
Повний текст джерелаАнотація:
Abstract Cell-cell interactions are thought to drive tumor-promoting signals in the microenvironment of glioblastoma, but standard approaches for single cell analysis do not directly identify cell interactions and the mechanisms that mediate them. We recently developed a novel method to analyze cell-cell interactions—rabies barcode interaction detection followed by sequencing (RABID-seq), which combines barcoded viral tracing and single-cell RNA sequencing (scRNAseq). RABID-seq was first implemented in transgenic mice to investigate the interactions of astrocytes with other cells in the CNS enabling the study of astrocyte connectome perturbations and candidate therapeutic targets in multiple sclerosis and its pre-clinical model, experimental autoimmune encephalomyelitis (EAE). Here, we report the first use of RABID-seq in human tissues in organotypic cultures established from three IDH-wildtype glioblastoma (GBM) patients. In organotypic GBM cultures, initial infection by pseudotyped barcoded rabies virus deficient for viral glycoprotein was achieved after previous culture transduction with a lentivirus containing the avian TVA receptor and rabies glycoprotein under the human EF1a promoter. We employed this system to initially infect approximately 1,000 malignant or non malignant cells in the tumor microenvironment. After five days, infected cells were isolated from cultures and processed for single cell analysis using SMART seq. We were able to capture at least 6,000 interacting cells per tumor specimen, from which barcodes were recovered and cDNA was sent for sequencing. Here we present connectomic data from our initial cohort of three glioblastoma patients as an introduction to RABID-seq, with a focus on astrocyte-tumor interactions. Candidate mechanisms of cellular interactions will undergo functional validation in murine models of glioblastoma.
16
D'Ancona, F., V. Alfonsi, M. R. Caporali, A. Ranghiasci, and M. L. Ciofi Degli Atti. "Pneumococcal conjugate, meningococcal C and varicella vaccination in Italy." Eurosurveillance 12, no. 2 (February 1, 2007): 9–10. http://dx.doi.org/10.2807/esm.12.02.00685-en.
Повний текст джерелаАнотація:
The 7-valent anti-pneumococcal conjugate vaccine (PCV), anti-meningococcal C-conjugate vaccine (MenC) and varicella vaccine have been recently introduced in EU. In Italy, these vaccines have so far been recommended for use in specific groups. Since the health system is decentralised, the Regional Health Authorities (RHAs) can decide to recommend vaccination for other target populations. We conducted a survey to describe the recommendations on these vaccines currently in place in the 21 Italian regions. In November 2005, a standardised questionnaire was sent to RHAs, including information on the existence of regional recommendations, vaccination target population, and whether vaccines were provided free of charge, or at a reduced cost compared to pharmacies. Information reported in the questionnaires were followed up in May 2006. All 21 regions completed and returned the questionnaire and were contacted for follow-up. Recommendations about at least one of the three vaccines were present in 20 out of 21 regions. All included free of charge PCV offering to specific groups, while MenC and varicella immunisations were recommended in 17 and 19 regions, respectively. Recommendations for other individuals varied greatly by area: free of charge PCV and MenC vaccinations targeting all infants have been recommended in nine regions, and varicella vaccination targeting children in the second year of life in three regions. These different recommendations can lead to marked variation in vaccination coverage rates observed through the country, with a consequent different level of disease control. It is thus crucial to properly monitor vaccination coverage rates for PCV, MenC and varicella, as these are not routinely collected at the national level.
17
Groot, Peter C., and Jim van Os. "Outcome of antidepressant drug discontinuation with taperingstrips after 1–5 years." Therapeutic Advances in Psychopharmacology 10 (January 2020): 204512532095460. http://dx.doi.org/10.1177/2045125320954609.
Повний текст джерелаАнотація:
Background: Stopping antidepressants is often difficult due to withdrawal. Taperingstrips were developed to facilitate antidepressant discontinuation according to the recently described Horowitz-Taylor method, allowing for personalised titration of discontinuation to the intensity of withdrawal. A taperingstrip consists of antidepressant or other medication, packaged in a 28-day roll of small daily pouches, each with the same or slightly lower dose than the one before it. We previously reported that the short-term success rate of antidepressant taperingstrips was 71%. Here, we examine longer-term outcome after 1–5 years. Methods: Patients whose doctor had ordered taperingstrips between January 2015 and December 2019 were sent a questionnaire for participation in anonymised research in January 2020. Of 1012, 483 participated, of whom 408 (85%) had attempted antidepressant tapering. Results: Of the 408 patients included, 192 (47%) had used strips for tapering venlafaxine, 142 (35%) for paroxetine and 74 (18%) for other antidepressants. Median length of antidepressant use was 4 years, and most (61%) had tried to come off without taperingstrips at least once. After 1–5 years, 270 patients (66%) remained off antidepressants after tapering their antidepressant, 6 (2%) had successfully reduced their medication, 87 (21%) had restarted due to (self-reported) relapse, 35 had restarted for another indication (9%), and 10 (3%) reported another outcome. People with more severe experience of withdrawal prior to tapering, and people who had been on antidepressants for a shorter period of time, were more likely to remain off medication after 1–5 years. Conclusion: The previously reported 71% short-term success rate of taperingstrips in the most severely affected group, was matched by a 68% rate after 1–5 years. The evidence-based approach of personal tapering to counter withdrawal, as used for drugs causing withdrawal, for example, benzodiazepines, may represent a simple solution for an important antidepressant-related public health problem, without extra costs.
18
Koslowski, Jutta. "Details from the Life of the Bonhoeffer Family: New Insights about the Biography and Theology of Dietrich Bonhoeffer in the Memoirs of his Youngest Sister Susanne." Theology Today 77, no. 1 (April 2020): 9–32. http://dx.doi.org/10.1177/0040573620916732.
Повний текст джерелаАнотація:
Just recently, the autobiography of Susanne Bonhoeffer, the younger sister of Dietrich Bonhoeffer, has been rediscovered. She has bequeathed an excellent and extensive description of her family’s life and reveals new insights about the Bonhoeffer family and the history of her time. Her work will be a substantial contribution to further research. As the editor of this challenging project, I would like to investigate how this text may affect our perception of Dietrich Bonhoeffer’s biography and theology. A lot of information about Dietrich Bonhoeffer is offered in the autobiography of his sister Susanne – last but not least about his time in prison, when Susanne was sent by her family to visit him every week and support him as far as possible. Besides, her biographical accounts often contain theological insights – e.g. when Susanne relates how Dietrich supported her on the occasion of her confirmation. Most of this confirms the image which has been established by earlier publications, especially those of Eberhard Bethge. This is not surprising, since Bethge extensively made use of the manuscript of Susanne. However, even if our perception of Dietrich Bonhoeffer is hardly altered by the material of Susanne, it is deepened in many ways. It helps us to understand more fully the personality and character of Dietrich Bonhoeffer – and indirectly, it sometimes also allows to draw conclusions regarding his theology. In this article, I investigate the most relevant passages with reference to Dietrich Bonhoeffer and show what conclusions we can draw from this about his life and faith. The new primary source material of Dietrich’s sister Susanne was made available to the public in October 2018; it is here for the first time presented to an English speaking audience.
19
Brand, Paul. "Irish law students and lawyers in late medieval England." Irish Historical Studies 32, no. 126 (November 2000): 161–73. http://dx.doi.org/10.1017/s0021121400014826.
Повний текст джерелаАнотація:
In April 1421 the Irish parliament, meeting at Dublin, chose the archbishop of Armagh and Sir Christopher Preston as its messengers to convey to the king in England a long list of complaints. Among these was the following: Also, your said lieges show that whereas they are ruled and governed by your laws as used in your realm of England, to learn which laws and to be informed therein your said lieges have sent to certain inns of court (hostelles de court) able men of good and gentle birth, your English subjects born in your said land, who have been received there from the time of the conquest of your said land until recently, when the governors and fellows of the said inns would not receive the said persons into the said inns, as is customary. Wherefore may it please your most gracious lordship to consider this and ordain due remedy thereof, that your laws may be perpetuated and not forgotten in your said land.This was, of course, something of an exaggeration. The Inns of Court certainly did not exist at the time of the English ‘conquest’ of Ireland; indeed, it is now fairly certain that the inns only came into existence around 1340. It is also clear, however, that some kind of organised legal education was taking place in London before the inns were created, certainly as early as the 1270s and quite possibly as early as 1260, though definitely not in the twelfth century. We also know that as early as 1287 Irishmen (or at least one specific Irishman, Robert de St Michael) were crossing the channel ‘causa addiscendi in Banco regis apud Westm’’, that is, specifically for the purpose of legal education at Westminster through attendance at the king’s court there.
20
Joeris, Alexander, Anahí Hurtado-Chong, Michael Blauth, Joerg Goldhahn, Nicolas S. Bodmer, and Lucas M. Bachmann. "Expert Consensus on Predictive Parameters for the Occurrence of a Fall and a Contralateral Hip Fracture 1 and 3 Years After Hip Fracture: A Delphi Survey." Geriatric Orthopaedic Surgery & Rehabilitation 8, no. 2 (March 1, 2017): 94–98. http://dx.doi.org/10.1177/2151458516687811.
Повний текст джерелаАнотація:
Background: Early identification of people at risk for a contralateral hip fracture would be desirable to favorably influence patients’ prognosis. A recent systematic review failed to depict stringent patterns of risk parameters to be used for decision-making in clinical practice. Objective: To perform a consensus study using the Delphi method to reach an expert consensus on predictive parameters for the occurrence of a fall and a contralateral hip fracture 1 and 3 years after hip fracture. Methods: A list of potential members of the expert panel was identified based on the authors’ list of a recently conducted systematic review. Participating experts were asked to name parameters determining the probability for a fall and a contralateral hip fracture 1 and 3 years after an occurred hip fracture, separately. Additionally, we asked how those stated parameters should be measured. All mentioned parameters were compiled and sent back to the experts asking them to weight each single parameter by assigning a number between 1 (not important) and 10 (very important). The survey was conducted online using the REDCap software package. We defined expert agreement if the interquartile range of attributed weights for a parameter was ≤2. A relevant parameter had at least a median weight of 8. Results: Twelve experts from 7 countries completed the survey. Presence of fall history and mental and general health status were considered relevant irrespective of the outcome. For falling within 1 and 3 years, the number of medications and residential status were considered relevant, while for fractures within 1 and 3 years, osteoporosis management was considered important. Conclusion: Using the insights gained in this consensus study, empiric studies need to be set up assessing the prognostic value of the selected parameters.
21
Meier, Emily Riehm, Kisha Hampton, Ellen Bloom, Natalie Duncan, Chris Roberson, and Angeli Rampersad. "Evaluation of a Novel Newborn Screening Follow-up Program for Infants with Sickle Cell Disease." Blood 128, no. 22 (December 2, 2016): 2344. http://dx.doi.org/10.1182/blood.v128.22.2344.2344.
Повний текст джерелаАнотація:
Abstract While newborn screening for sickle cell disease (SCD) has improved survival of affected infants through early prescription of prophylactic penicillin and SCD education for the parents, newborn screening follow-up programs are highly variable among states. The novel statewide newborn screening program in Indiana, Sickle SAFE (Screening, Assessment, Follow-up, Education), was started in 2009 and followed infants through the first year of life until 2013 when the program expanded to provide follow-up for the first 5 years of life. Sickle SAFE ensures timely notification and education of families of affected patients and links them to a hematologist. An initial home visit is scheduled and coordinated by the Sickle SAFE Program Coordinator within one month of receipt of abnormal screening results. After the initial home visit, coordinators maintain phone contact with families regularly throughout the enrollment period. An analysis of Georgia Medicaid claims published in 2016 reported that 47.2% of children between 2 and 3 years of age had screening transcranial Doppler (TCD) and 73.6% received PPSV23 (Pneumovax). The current study aims to assess the rates of attainment for recently published quality indicators of pediatric SCD care for children enrolled in Sickle SAFE. A retrospective study was initiated to determine the proportion of children enrolled in Sickle SAFE who received TCD screening between 2 and 3 years of age (HbFS only) and influenza and pneumococcus [PCV (Prevnar) and PPSV23] vaccination. The mean age at confirmatory testing and receipt of penicillin prophylaxis (goal ≤ 2 months) as well as the mean age of the affected infant when families were offered genetic counseling (goal ≤ 6 months) were calculated. From 2009-2012, all positive newborn screens for any sickle hemoglobinopathy were reflexively sent for confirmatory DNA testing. From 2013 onward, only HbFS newborn screens were sent for confirmatory DNA testing. Children who were enrolled in Sickle SAFE less than two years of age were excluded from the PPSV23 and TCD analyses. A total of 141 children were born with SCD and enrolled in Sickle SAFE for at least one year between July 1 2009 and June 30 2015. The majority (56.7%) had HbSS, 32.6% had HbSC, 9.9% were compound heterozygotes for HbS and beta thalassemia and the remaining 0.7% had another sickle hemoglobinopathy. The mean length of follow-up was 2.7 ± 1.0 years. 55.3% were female and 78.7% were African American. 87.2% were publicly insured. Mean age for all patients born with SCD to have confirmatory testing was significantly shorter when confirmatory DNA testing was sent for all affected infants compared to when it was limited to only infants with HbFS [40.3 ±14.1 days (2009-2012) vs. 127.8 ± 173.1 days (2013-2015), p= 1.5E-6]. While the age at confirmatory testing did not differ for infants with HbFS results between the two periods [45.9 ± 14.1 days (2009-2012) vs. 45.8 ± 14.0 days (2013-2015), p=0.98], infants with results other than HbFS were significantly older when confirmatory testing was performed after the process change in 2013 [40.3 ± 14.1 days (2009-2012) vs. 225.3 ± 221.4 days (2013-2015), p=2.6E-6]. Mean age at which genetic counseling was offered to all families with affected children was 26.8 ± 9.9 (range 9-60) days. Mean age at receipt of first dose of penicillin was 28.6 ± 15.0 (range 5-62) days for infants with HbFS, and 29.5 ± 20.1 (range 5-142) days for those with other sickle hemoglobinopathies (p=0.78). 86.5% of enrollees received at least one influenza vaccine while 95.0% had received at least one dose of PCV. Over two-thirds (69.1%) of children with HbFS had TCD screening between the ages of two and three years. 77.3% of Sickle SAFE enrollees who were followed for more than 2 years received PPSV23. Newborn screening for SCD allows for supportive care aimed at reducing morbidity and mortality. Reflex DNA confirmatory testing is an important part of this quality care, regardless of sickle genotype, and our data shows that confirmatory testing is delayed when it is not reflexively performed for all affected infants. The intensive follow-up provided through the Sickle SAFE program increases adherence to quality standards for comprehensive care, as evidenced by a higher rate of TCD screening compared to published data. Education of state departments of health for improved funding and support of programs like Sickle SAFE may help to improve outcomes for affected children. Disclosures No relevant conflicts of interest to declare.
22
Herron, David, and Lotta Haglund. "Mismatch Between the Demands for Tenure and Those of Public Services is Creating a Crossroads in Academic Librarianship." Evidence Based Library and Information Practice 2, no. 4 (December 7, 2007): 73. http://dx.doi.org/10.18438/b8n30p.
Повний текст джерелаАнотація:
Objective – To explore how public services librarians in academic libraries perceive their duties and experience job satisfaction especially in relation to faculty status (tenure track or non-tenure).
Design – A multi-site study.
Setting – Academic libraries in the United States.
Subjects – Academic public service librarians.
Methods – In March 2004, an online survey containing 25 questions was sent out to 1,510 academic librarians across the United States. The survey included demographic and professional work-related questions, but mainly focused on retrieving information about librarian feelings, thoughts, and perceptions in relation to six aspects of the role of the public service librarian, namely: reference, collections, publishing, teaching, committee, and management activities. The survey data was stored in an SQL database and analyzed in various ways to try to see if there were correlations in the replies. In some cases, Chi-square was used to test for statistical significance.
Main results – 328 (22%) out of 1,510 potential replies were received. 74% came from public universities and 26% from private institutions. 23% of the respondent librarians had received their MLA before 1980, 34% between 1980 and 1994, and 43% 1995 or later. About 50% had worked as an academic librarian fewer than 10 years and 50% for 10 or more years. About 50% had worked at their current institution five years or fewer and the other 50% for six years or more. 49% had job descriptions which clearly indicated the relative emphasis of each of the main areas of their job. 50% came from tenure-track and non-tenure-track institutions alike.
The librarians were asked to reply to “most” and “least” questions. The following lists show the most chosen responses (in %) to the questions.
“Most” questions:
80% felt that they were most prepared for reference activities by their library school training.
50% felt most satisfied with doing reference activities.
25% felt that administrators viewed reference activities as being most important.
41% thought that reference activities had most service impact on users.
24% found teaching activities the most challenging aspect of their job.
49% had attended most training in the area of reference activities.
31% thought that reference activities would be most important for them 5 years later on (that is, at the date of publication of this review, 2009).
For those with a position description, 49% had descriptions that most emphasized reference activity.
For those in tenure-track positions, 78 % replied that publishing activities were most important for tenure.
“Least” questions:
28% felt that they were least prepared for teaching activities by their library school training.
44% felt that committee activities were the least satisfactory part of their job.
33% felt that administrators regarded publishing as the least important aspect of the job.
49% thought that publishing activities would have the least service impact on users.
46% thought that committee activities were the least challenging.
31% had attended least training in publishing activities.
35% thought that publishing activities would be least important to them 5 years later.
For those with a position description, 33% had descriptions that least emphasized publishing activities.
For those in tenure-track positions, 31 % replied that management activities were least important for tenure.
There was a correlation at an individual level between reference activities considered as having the most service impact on users and giving the most job satisfaction; and what the librarian thought was the most important to administrators.
There was an overall correlation between what librarians found most challenging and the type of in-service training they had attended, with the notable exception of publishing.
The area of scholarly publishing was perceived generally as the second most challenging area (18%) after teaching. However, very few (2%) replied that they had (recently) attended in-service training in this area.
Librarians with publishing as a clear component of their job description were more likely to find publishing challenging and to say that it was an important component for their administrators. Publishing was clearly considered important for tenure.
There were some statistically significant differences between more- and less-experienced librarians and more- and less-recently qualified librarians. In general (according to the authors), less experienced librarians tended to place more emphasis on teaching and committee activities, whereas more experienced librarians tended to emphasize collection development and management.
Conclusions – Generally, the authors conclude that “librarians feel that they are in tune with their library administrators” (360). The authors found a clear link between in-service training opportunities chosen by librarians and the areas that the librarians thought that the administration regarded as important.
However, there seems to be discord between the requirements for tenure (the majority ranked publishing as most important for tenure) and the service needs of users, librarian job satisfaction, and the perceived demands of administrators. The authors conclude that academic librarianship is at a “crossroads” where “librarians need to decide how and if publishing activities can be successfully balanced with other job components that are arguably more central to the library’s mission” (363).
23
Petrovski, Boban. "St. Clement of Ohrid, Khan/kniaz Boris-Mikhail and Kniaz/tsar Simeon: Historical Aspects." Slovene 5, no. 2 (2016): 10–53. http://dx.doi.org/10.31168/2305-6754.2016.5.2.1.
Повний текст джерелаАнотація:
Eastern and southwestern Macedonia, as well as southern Albania, became parts of Bulgaria in the first decade of the rule of Khan Boris. After his baptism (864/865) and the establishment of an archbishopric (870; 880), the renewal of the former Byzantine church organization on Bulgaria’s territory began. In the eastern parts, the process unfolded slowly because of the strength of the ruling ethnic Bulgarian class, which was pagan; in the western parts, however, the organization of church eparchies went more easily because the local, predominantly Slavic, population had accepted Christianity centuries earlier. This was exactly the reason why Boris-Mikhail sent the disciples of Cyril and Methodius, who had just arrived (885/886) and were well versed in holding religious services in the Slavonic language, to the remote southwest of the country to carry out the so-called “Slavonic Project.” These disciples (including Clement and his associates—Naum, Konstantin, and other unnamed companions) started training local people to serve as clergymen and formed a church structure in Kutmičevica in order to introduce religious services in the Slavonic language in those regions. When Kniaz Simeon came to power, he continued Boris’s “Slavonic Project,” which thus continued to be focused in the southwestern regions of Bulgaria. On being ordained the first Slavonic bishop, Clement organized his eparchy by ethnic (Slavonic) rather than territorial principles. It was Naum who continued his mission to educate people. Konstantin, for his part, was assigned bishop of Bregalnica when Bulgaria expanded close to Thessaloniki (904) in the early 10th century. Sources suggest that the fourth Slavonic bishop was Marko of Devol, one of Clement’s students, and therefore the question of the existence of a third Slavonic bishop has inevitably been raised. As of recently, scholars have been arguing that this third bishop is to be located in Pelagonija. The existence of these four Slavonic bishops and the location of the territories in which they served undoubtedly suggests that Boris’s “Slavonic Project” had chronological continuity and that it spread during Simeon’s rule to the neighboring Slavonic regions, along the Bregalnica and the surrounding area, and perhaps to Pelagonija as well. Their activities in the aforementioned regions continued at least until the middle of the 10th century.
24
von Auer, Ch, M. Krause, W. Miesbach, I. Scharrer, G. Asmelash, and I. Stier-Brueck. "F VIII Inhibitors in Haemophilia A Patients who Are Considered as Previously Treated Patients." Blood 104, no. 11 (November 16, 2004): 4022. http://dx.doi.org/10.1182/blood.v104.11.4022.4022.
Повний текст джерелаАнотація:
Abstract Previously treated patients (PTP), who have not developed an inhibitor (inh) so far, are considered to be tolerant to factor VIII and at low risk for inh development. Therefore inh detection in a PTP should raise concerns about the concomitant variables such as product neo-antigenicity or way of application. In our own center we recently detected the new development of a high responding inh to factor VIII in a 58 year old patient with severe haemophilia A. To find out about the current situation regarding inh development in PTP in Germany, we conducted a retrospective study. A questionnaire was sent to 99 haemophilia treating physicians, so far 46 of them answered. 24 PTP-inh were registered during the last 5 years. Patients had at least 20 ED and/or one change of factor concentrate. Age (9 months to 70 years, median 35), severity of haemophilia A (16 severe, 2 moderate, 6 mild), exposure days (ED 6 to >1500, median 37) and genotype (4 intron-22-inversions, 3 large deletions, 2 missense mutations, 1 stop mutation, 1 insertion, 1 small deletion, 11 unknown) were recorded. 8 different factor VIII concentrates were given during inh development (5 plasma derived, 3 recombinant). Way of application (16 bolus infusion, 3 continuous infusion, 5 times both), infused amount until inh development (3000 IU to >1 mio IU), inh characteristic (15 HR, 9 LR), concomitant diseases and medication were registered. In conclusion it became obvious that inh in PTP are still a serious and underestimated problem in haemophilia treatment today. Our patient numbers are still too small to draw conclusions concerning given F VIII products or way of application. Secondly data showed that there is a variety of PTP definitions in Germany, referring to age of pat, number of ED and former change of product. A definition from the SSC of the ISTH for PTP would be helpful. The continuous use of the German register for drug side effects would make it easier to evaluate data in the future. A prospective, not product related study should be conducted.
25
Bozzini, Claudia, Natascia Campostrini, Paola Trombini, Elizabetha Nemeth, Annalisa Castagna, Ilaria Tenuti, Roberto Corrocher, et al. "Measurement of Urinary Hepcidin Levels by SELDI-TOF-MS in HFE-Hemochromatosis." Blood 110, no. 11 (November 16, 2007): 2668. http://dx.doi.org/10.1182/blood.v110.11.2668.2668.
Повний текст джерелаАнотація:
Abstract Introduction: An insufficient production of hepcidin, the master regulator of iron metabolism, is recognized as the key pathogenetic feature of HFE-related hereditary hemochromatosis (HH). There is a growing interest in measuring the hepcidin levels, which may improve diagnosis, prognostic evaluation and clinical management of HH. Nevertheless, few investigative tools are available: an immunodot method for urinary hepcidin developed by a single centre (UCLA), not yet ready for large-scale diffusion, and mass spectrometry (MS) based assays, such as surface-enhanced laser desorption/ionization time-of-flight (SELDI-TOF-MS). The latter is well suited to small peptides like hepcidin, and can rapidly analyze crude samples with high throughput. Until now, urinary hepcidin has been measured by SELDI-TOF-MS only in small groups of C282Y homozygous patients, the majority of them under phlebotomy treatment. No data are available on C282Y/H63D compound heterozygotes, that can develop a milder clinical form of HH. This study was aimed to measure urinary hepcidin levels by SELDI-TOF-MS in a large group of HH patients. Methods: We used a protocol based on PBSIIc mass spectromer and Normal Phase chips similar to that recently proven successful for semi-quantitative detection of urinary hepcidin. Urinary samples from 30 control subjects were compared to those obtained from 80 HH patients (57 C282Y homozygotes, 23 C282Y/H63D compound heterozygotes). Eighteen C282Y homozygotes and 11 C282Y/H63D compound heterozygotes were analyzed at diagnosis, the remainder during maintenance phlebotomy (at least 30 days from last phlebotomy). Results: C282Y homozygotes had significantly lower urinary hepcidin levels vs. controls either at diagnosis, or after phlebotomy (P < 0.05). C282Y/H63D compound heterozygotes had hepcidin levels at diagnosis similar to controls, while the hepcidin:ferritin ratio was significantly decreased (P < 0.001) suggesting a relatively inappropriate hepcidin production. Moreover, also in this group means hepcidin levels after phlebotomy were significantly lower than in controls (P < 0.001). Samples from 12 randomly selected control subjects were sent to UCLA for duplicate measurement by the immunodot method, yielding a good correlation (r= 0.77; P<0.0001). Conclusions: SELDI-TOF-MS assay is confirmed to be a potentially useful tool for measuring hepcidin levels in HH. The very low hepcidin levels observed in both genotypes after phlebotomy, may suggest that iron depletion as currently achieved by standard protocols may not be the best therapy from a pathophysiological standpoint.
26
Batra, Atul, Atul Sharma, Sameer Bakhshi, Ajay Gogia, Raja Pramanik, Sachin Khurana, DEEPAM PUSHPAM, akash kumar, and Aparna Sharma. "Assessing the feasibility of recording smartphone-based patient-reported outcomes in patients with cancer: A pilot study." Journal of Clinical Oncology 41, no. 16_suppl (June 1, 2023): e13528-e13528. http://dx.doi.org/10.1200/jco.2023.41.16_suppl.e13528.
Повний текст джерелаАнотація:
e13528 Background: We conducted this study to evaluate the feasibility of completing patient-reported outcomes (PROs) using a mobile-based secure system at home, as opposed to the traditional method of completing them in crowded outpatient oncology clinics during hospital visits, which may not be ideal in resource-limited settings. Methods: The study included patients aged over 18 years who were newly diagnosed with solid-organ cancer between July 2021 and July 2022 at a tertiary cancer center in India. Patients who were able to use a smartphone were invited to complete a mobile-based Edmonton Symptom Assessment Scale (ESAS) questionnaire, which was accessed via a secure link sent to their phone as a chat. The ESAS questionnaire included physical (six domains: pain, tiredness, drowsiness, shortness of breath, nausea, loss of appetite), psychological (anxiety and depression), and overall well-being (one domain) questions, each rated on a scale of 0-10, with a higher number indicating greater symptom burden. Symptoms were classified as mild (1-3), and moderate to severe (4-10). The primary objective was to determine the completion rate of the questionnaire, while the secondary objectives were to determine the incidence of moderate to severe symptoms, both physical and psychological, at cancer diagnosis. Multivariate logistic regression analysis was used to identify factors associated with moderate to severe symptoms. Results: We reached out to 707 consecutive patients who had recently been diagnosed with solid-organ cancer and used smart phone. The median age of participants was 53 years (with an interquartile range of 43-62 years), and 52.3% were female. Breast cancer (30.6%) was the most common diagnosis, followed by lung cancer (28.8%). Approximately, one-third of all patients had metastatic disease at diagnosis, while others were similarly distributed in stage I-III. Overall, 650 patients (91.9%) patients completed the mobile-based questionnaire; 38.9% of patients had moderate to severe physical symptoms and 30.9% had moderate to severe psychological symptoms. Pain (57.7%) and tiredness (58.7%) were the most commonly reported physical symptoms in moderate to severe category, while nausea (18.1%) and drowsiness (20.3%) were reported least frequently as moderate to severe. Anxiety (35.1%) was more prevalent than depression (26.1%). The total symptom score was mild in 76.5% of patients and moderate to severe in 18.8%. On multivariate logistic regression, patients with advancing age, female sex, and metastatic disease at diagnosis were more likely to report moderate to severe symptoms. Conclusions: Using smartphone-based PROs can be an efficient way to record symptoms in cancer patients, and their high completion rates make them suitable for routine use in oncology clinics, especially considering the increasing number of smartphone subscribers globally.
27
Nandakumar, R., M. C. Rush, and F. Correa. "Association of Burkholderia glumae and B. gladioli with Panicle Blight Symptoms on Rice in Panama." Plant Disease 91, no. 6 (June 2007): 767. http://dx.doi.org/10.1094/pdis-91-6-0767c.
Повний текст джерелаАнотація:
Panicle blight of rice, caused by Burkholderia glumae, has been a serious problem on rice in Japan since 1955. It has been reported from other rice-producing countries around the world and recently was reported on rice in the southern United States (2). A rice producer in Panama contacted us to verify the occurrence of bacterial panicle blight in rice fields where heavy losses were associated with a disease of unknown etiology, but with typical bacterial panicle blight symptoms (2). The observed grain discoloration, sterility, and abortion were thought to be due to the spinki mite, Steneotarsonemus spinki Smiley. After obtaining a USDA-APHIS import permit (73325), rice panicle samples from seven fields in Panama were sent to our laboratory in 2006. Bacteria were isolated from grains showing typical panicle blight symptoms on the semiselective S-Pg medium. Nonfluorescing colonies producing toxoflavin on King's B medium were selected for further identification. Initial PCR analyses, made with DNA isolated directly from grain crushed in sterile water, with B. glumae specific primers (BGF 5′ACACGG AACACCTGGGTA3′ and BGR 5′TCGCTCTCCCGAAGAGAT3′) gave a positive reaction for B. glumae in all seven samples. Biolog tests (Biolog Inc, Hayward, CA), fatty acid analysis, and PCR using species-specific primers for B. glumae and B. gladioli (BLF 5′CGAGCT AATACCGCGAAA3′ and BLR 5′AGACTCGA GTCAACTGA3′) identified 19 B. glumae and 6 B. gladioli strains among 35 bacterial strains isolated. Only the Biolog and fatty acid analyses identified B. gladioli strains. PCR analysis did not identify B. gladioli strains. To confirm B. gladioli, PCR amplification of the 16S rDNA gene from eight representative strains (four each for B. glumae and B. gladioli) using universal primers (16SF 5′AGAGTTTGATCCTGGCTCAG3′ and 16SR5′GGCTACCTTGTTACGACTT3′) and further sequencing of the PCR product was performed. A BLAST analysis of 16S rDNA sequences in the Genbank data base showed 99% sequence similarity for these two species with other published sequences. Our APHIS import permit did not allow us to perform pathogenicity tests with the strains isolated from Panama, but the B. glumae and B. gladioli strains obtained corresponded closely with pathogenic control cultures isolated from rice grown in the United States or with strains obtained from the ATCC. Other B. glumae strains recently isolated from rice in Panama, and identified by PCR, were tested for pathogenicity in tests conducted at CIAT in Colombia and were found to be pathogenic and highly virulent. These strains caused disease on seedlings when inoculated and typical bacterial panicle blight symptoms on panicles when spray inoculated. This disease has caused severe losses in Panama's rice crop for at least 3 years. Similar symptoms reported in Cuba, Haiti, and the Dominican Republic were attributed to damage from the spinki mite in association with Sarocladium oryzae (Sawada) W. Gams & D. Hawksw. (1). Zeigler and Alvarez (3) reported the occurrence of B. glumae in Columbia in 1987, but not in other Latin American countries. Pseudomonas fuscovaginae was reported in association with rice grain discoloration in Panama (4), but to our knowledge, this is the first report of these two Burkholderia species being associated with panicle blight symptoms on rice in Panama. References: (1) T. B. Bernal et al. Fitosanidad 6:15, 2002. (2). A. K. M. Shahjahan et al. Rice J. 103:26, 2000. (3). R. S. Zeigler and E. Alvarez. Plant Dis. 73:368, 1989. (4). R. S. Zeigler et al. Plant Dis. 71:896, 1987.
28
Hamel, Charlotte C., Marcus P. L. M. Snijders, Sjors F. P. J. Coppus, Frank P. H. A. Vandenbussche, Didi D. M. Braat, and Eddy M. M. Adang. "Economic evaluation of a randomized controlled trial comparing mifepristone and misoprostol with misoprostol alone in the treatment of early pregnancy loss." PLOS ONE 17, no. 2 (February 9, 2022): e0262894. http://dx.doi.org/10.1371/journal.pone.0262894.
Повний текст джерелаАнотація:
Background In case of early pregnancy loss (EPL) women can either choose for expectant, medical or surgical management. One week of expectant management is known to lead to spontaneous abortion in approximately 50% of women. Medical treatment with misoprostol is known to be safe and less costly than surgical management, however less effective in reaching complete evacuation of the uterus. Recently, a number of trials showed that prompt treatment with the sequential combination of mifepristone with misoprostol is superior to misoprostol alone in reaching complete evacuation. In this analysis we evaluate whether the sequential combination of mifepristone with misoprostol is cost-effective compared to misoprostol alone, in the treatment of EPL. Methods and findings A cost-effectiveness analysis (CEA) from a healthcare perspective was performed alongside a randomised controlled trial (RCT) in which standard treatment with misoprostol only was compared with a combination of mifepristone and misoprostol, in women with EPL after a minimum of one week of unsuccessful management. A limited societal perspective scenario was added. This RCT, the Triple M trial, was a multicentre, randomized, double-blinded, placebo-controlled trial executed at 17 hospitals in the Netherlands. The trial started on June 27th 2018, and ended prematurely in January 2020 due to highly significant outcomes from the predefined interim-analysis. We included 351 women with a diagnosis of EPL between 6 and 14 weeks gestation after at least one week of unsuccessful expectant management. They were randomized between double blinded pre-treatment with oral mifepristone 600mg (N = 175) or placebo (N = 176) taken on day one, both followed by misoprostol orally. In both groups, an intention-to-treat analysis was performed for 172 patients, showing a significant difference in success rates between participants treated with mifepristone and misoprostol versus those treated with misoprostol alone (79.1% vs 58.7% respectively). In this cost-effective analysis we measured the direct, medical costs related to treatment (planned and unplanned hospital visits, medication, additional treatment) and indirect costs based on the IMTA Productivity Cost Questionnaire (iPCQ). Quality Adjusted Life Years (QALY’s) were calculated from participants’ scores on the SF-36 questionnaires sent digitally at treatment start, and one, two and six weeks later. We found medical treatment with placebo followed by misoprostol to be 26% more expensive compared to mifepristone followed by misoprostol (p = 0.001). Mean average medical costs per patient were significantly lower in the mifepristone group compared to the placebo group (€528.95 ± 328.93 vs €663.77 ± 456.03, respectively; absolute difference €134.82, 95% CI 50,46–219,18, p = 0.002). Both indirect costs and QALY’s were similar between both groups. Conclusion The sequential combination of mifepristone with misoprostol is cost-effective compared with misoprostol alone, for treatment of EPL after a minimum of one week of unsuccessful expectant management.
29
Okello Candiya Bongomin, George, and Joseph Ntayi. "Trust: mediator between mobile money adoption and usage and financial inclusion." Social Responsibility Journal 16, no. 8 (September 20, 2019): 1215–37. http://dx.doi.org/10.1108/srj-01-2019-0011.
Повний текст джерелаАнотація:
Purpose Recently, a large body of research has been devoted on the role of trust in shaping different types of transactions, especially in rural financial development. Trust is a set of expectations shared by all those who engage in an exchange. Indeed, the “rule of the game” suggests that no trusting party in a transaction should act opportunistically. Consequently, this study aims to establish the mediating effect of trust in the relationship between mobile money adoption and usage and financial inclusion of MSMEs in developing countries with a specific focus on rural Uganda. Design/methodology/approach A quantitative survey-based study was used and responses obtained from 379 MSMEs located in northern Uganda were analysed using partial least square-PLS version 3.0. A semi-structured questionnaire was developed from scales and items used in previous studies referenced in internationally recognised journals to elicit responses from the MSMEs. Structural equation modelling was used to test the models to arrive at a final empirical model derived from the data. Findings The authors found evidence that trust enhances mobile money adoption and usage to increase the scope of financial inclusion of MSMEs in developing countries. Moreover, when individual effect was determined, trust also had significant and positive effect on financial inclusion. Thus, the study results imply that trust enhances mobile money adoption and usage to improve the level of financial inclusion of MSMEs in developing countries. Research limitations/implications The study used cross-sectional data to document the relationship between mobile money adoption and usage and financial inclusion and to establish the mediating effect of trust in the relationship. Future research could use relevant longitudinal data to verify other benefits of trust. Practical implications The results present trust as a significant factor for FINTECH financial services marketing and growth. Specifically, data privacy and effectiveness of the mobile telephone network is more likely to help consumers to bridge the gap between participation and non-participation on the mobile money platform. Customers’ data sent over the mobile network of providers should be protected from unnecessary access and usage by Mobile Network Operators (MNOs) staff and unauthorised persons and agents. Data protection protocols should be set by the MNOs to avoid unnecessary access and use of customers’ data. Originality/value Globally, Fintech scholars have examined the role of mobile money in promoting financial inclusion. However, there is insufficient evidence on the mediating effect of trust in the relationship between mobile money adoption and usage and financial inclusion, especially among rural MSMEs. This study invents a novel direction on the importance of trust in creating transaction efficiency by eliminating opportunism and fraud with in the Fintech ecosystem.
30
Toussirot, E., M. Michaud, D. Wendling, and V. Devauchelle-Pensec. "AB0358 ABATACEPT AS A bDMARD IN STEROID-REFRACTORY POLYMYALGIA RHEUMATICA." Annals of the Rheumatic Diseases 80, Suppl 1 (May 19, 2021): 1204.1–1204. http://dx.doi.org/10.1136/annrheumdis-2021-eular.1246.
Повний текст джерелаАнотація:
Background:polymyalgia rheumatica (PMR) is a chronic inflammatory disorder affecting elderly people. Glucocorticoids (GC) are the mainstay of therapy for PMR. Despite this treatment, the disease may relapse or GC dosage cannot be tapered. Methotrexate (MTX) may be helpful in these cases. Blockade of IL-6 has an effective steroid-sparing effect in patients with giant cell arteritis (GCA) and may improve the clinical symptoms of patients with PMR. The pathophysiology of PMR still remains uncertain but there are evidences for a participation of Th1 and Th17 lymphocytes. Recently, blockade of the costimulatory pathway by abatacept (ABA) gave favorable results in GCA.Objectives:to report our experience (efficacy and safety) of ABA in the treatment of patients with isolated PMR who required longstanding GC and who failed to respond to MTX and/or IL-6 receptor blocking agents.Methods:a call for observations of all cases of patient with PMR who received at least one dose (SC or IV) of ABA was sent to the members of the French specialist network “Club Rhumatismes & Inflammation” (CRI: www.cri-net.com)(rheumatologist and internal medicine). Patients must satisfy the EULAR/ACR criteria for PMR and have isolated PMR without associated GCA.Results:4 cases were declared during a 12 months period: 2 men and 2 women; age (median [range]): 60.7 [50-68] years; disease duration 30 [7-48] months; duration of GC treatment before starting ABA: 60 [10-72] months. They all required prednisolone with a daily dosage of 14.5 mg [10-20]. Before ABA administration, they all received MTX while 2 patients were treated by IL-6R inhibitor (tocilizumab 6 months and sarilumab 3 months, respectively) without improvement. ABA was given as a monthly infusion (10 mg/kg) in one case and subcutaneously (every week) in 3 cases. ABA treatment duration ranged from 3 to 18 months. Two patients responded to the treatment with a progressive decline of DAS-PMR and GC dosage tapering during a 12 month follow-up, while there was no improvement for the 2 others (Table 1). CRP levels also decreased for one responder. The safety was excellent for all. ABA was still maintained in one responder. Among the non-responders, one patient was switched to tocilizumab and the second still received high GC dosage.Conclusion:ABA may be effective in certain PMR patients who were unable to taper GC, with a good safety profile. A randomized controlled trial is required in order to determine its place in the treatment of PMR and to select the appropriate patients who could potentially benefit from this biological agent.References:[1]Langford CA et al. Vasculitis Clinical Research Consortium. A Randomized, Double-Blind Trial of Abatacept (CTLA-4Ig) for the Treatment of Giant Cell Arteritis. Arthritis Rheumatol. 2017; 69: 837-845Table 1.changes in DAS-PMR and CRP levels in 4 patients with PMR while receiving abatacept (M: months; CRP in mg/L).CasesDAS- PMR M0DAS- PMR M3DAS-PMR M6DAS -PMR M12CRP M0CRP M3CRP M6CRP M121202121NA58.68.4NA231.130.5NANA2125NANA310.78.3551337.222.722224182217.2121.23.33.53Disclosure of Interests:None declared
31
Rolli, Erminio. "An interesting case of polystyrene consumption by Reticulitermes lucifugus (Blattodea: Neoisoptera, Rhinotermitidae)." Fragmenta Entomologica 52, no. 2 (November 15, 2020): 349–50. http://dx.doi.org/10.4081/fe.2020.463.
Повний текст джерелаАнотація:
A colony of Reticulitermes lucifugus from Apulia (SE Italian Peninsula) was recently observed to have partially consumed some polystyrene panels applied on a wall, and used like seat for termite nest. Further observations could allow to better understand if this colony is just able to physically consume and chew this plastic material, releasing it chemically intact after the passage throughout the termites’ digestive system, or if their microbiome could allow the insects to at least partially metabolize and degrade the ingested polystyrene fragments, as recently observed in a few other insects.
32
Mustaqim, Karna, D. Rio Adiwijaya, and Ferdinand Indrajaya. "Penelitian Atas Penelitian Seni dan Desain: Suatu Studi Kerangka Filosofis-Paradigmatis Bagi Penelitian Seni dan Desain Visual." Humaniora 4, no. 2 (October 31, 2013): 995. http://dx.doi.org/10.21512/humaniora.v4i2.3541.
Повний текст джерелаАнотація:
This paper discusses philosophical framework of practice-based artistic research within the field of art and design in contrast with research in the natural and social science. It is stated that paradigm of artistic inquiry is ilustrated with the role of practicioner as researcher wherein subjectivity, involvement and reflexivity are acknowledged, while (k)nowledge is negotiated – inter-subjective, context bound, and is a result of personal construction. Visual objects have been exhausting large amount of our physical and emotional energy in seeing it which certainly gives them a central role in contemporary ages. It is suggested that research could become part of the needs for experience, to inspire, or to collectively develop a profession. Recently, research as knowledge production has been increasing and gaining its interest within the creative art field. However, there is a foundation which underpins a research, at least some implicit philosophical assumptions of it, which serve as the basis of understanding of reality (ontology), and how to know and justify it (epistemology); and by explicating it, it is believed that scrupulous consideration of it may contribute practical benefits in conducting art and design research. In that regard, this paper presents ontological outlook of Heidegger and also epistemology of art of Merleau-Ponty – which rises within phenomenological tradition – as a philosophical framework which can serve as paradigmatic underpinning of artistic research, in contrast with objectivist approach already identical with research in general.
33
Gavriilaki, Eleni, Arthur Vaught, Nancy Heuppchen, Karin Blakemore, Xuan Yuan, Sara Seifert, Sara York, and Robert A. Brodsky. "Direct Evidence of Complement Activation in HELLP Syndrome: A Link to Atypical Hemolytic Uremic Syndrome." Blood 126, no. 23 (December 3, 2015): 1047. http://dx.doi.org/10.1182/blood.v126.23.1047.1047.
Повний текст джерелаАнотація:
Abstract Introduction: HELLP syndrome (hemolysis, elevated liver enzymes, and low platelets) is a severe variant of preeclampsia that leads to severe morbidity and mortality to both the mother and fetus. Delivery is the treatment of choice at or beyond 34 weeks, but there are no good therapies for pregnant women with HELLP before 34 weeks of pregnancy. Although there are no strict criteria for its diagnosis, the Tennessee and Mississippi classifications have been proposed using platelet count (<100,000 or 150,000 cells/microL), lactate dehydrogenase levels (LDH>600 IU/L), bilirubin (>1.2 mg/dL) and aspartate aminotransferase (AST) with or without alanine aminotransferase (ALT) levels (AST >40 or 70 IU/L, ALT>40 IU/L). However, LDH, AST and bilirubin are not specific for liver dysfunction and their elevation may be caused by intravascular hemolysis alone. Recent evidence and clinical similarities suggest a link to atypical hemolytic uremic syndrome (aHUS), a disease of excessive alternative complement pathway (APC) activation. To test this hypothesis we utilized a functional complement assay, the modified Ham test recently described for aHUS diagnosis. Method: Women with classic HELLP, atypical HELLP, preeclampsia with severe features, and women with normal pregnancies were recruited for the study from September 1, 2014 to May 31, 2015. Women with known sickle cell disease, systemic lupus erythematous, antiphospholipid antibody syndrome, or previous diagnosed microangiopathic and hemolytic diseases were excluded. All participants were greater than 23 weeks pregnant. Classic HELLP syndrome was defined as satisfying all Mississippi or Tennessee criteria for HELLP syndrome; while atypical HELLP as having at least one laboratory abnormality in the Mississippi or Tennessee criteria. Sera was collected and sent blinded to the laboratory. APC activation was detected in the modified Ham test and compared to previously described marker of complement activation, serum C5b-9 levels. Furthermore, we tested the in vitro ability of eculizumab to inhibit APC activation. Eculizumab containing serum was collected from a patient with paroxysmal nocturnal hemoglobinuria (PNH) within 60 minutes after the infusion. Results: Serum from 9 women with classic or atypical HELLP, 7 women with severe preeclampsia, and 11 controls (healthy pregnancy) were tested. We found no significant difference in serum C5b-9 levels among patients with HELLP, preeclampsia and controls (p=0.808). However, increased complement activation in the modified Ham test, represented as significantly higher percentage of non-viable cells/cell killing (25.7±19.8% versus 4.1±7.3%, p=0.005), was found in participants with classic or atypical HELLP compared to participants with healthy pregnancy (Figure 1A). Participants with classic HELLP demonstrated significantly more cell killing when compared to severe preeclampsia (38.7+9.8% versus 13.0+11.7, p=0.048). In the ROC (receiver operating curve) analysis, a percentage of killing higher than 20.5% was determined as a cut-off value for the diagnosis of HELLP with 66.7% sensitivity and 88.9% specificity. Importantly, mixing sera from 4 HELLP patients with eculizumab containing serum in different percentages resulted in a significant decrease of cell killing compared to HELLP serum alone (Figure 1B, p=0.007). Conclusions: We have shown that preeclampsia with severe features along with classic and atypical HELLP syndrome may be considered, at least in part, a disease of excessive complement activation. The modified Ham test is a serum-based assay that does not theoretically detect increased complement activation caused by mutations in cell membrane factors. Other pathophysiological mechanisms beyond complement activation may also account for the negative results in 3 HELLP participants. Importantly, the modified Ham test seems a promising tool to identify patients with increased complement activation who may benefit from complement inhibition. If confirmed in a larger cohort, this rapid, inexpensive and highly specific assay may be valuable to select patients for such a clinical trial. Disclosures Brodsky: Alexion Pharmaceuticals: Membership on an entity's Board of Directors or advisory committees.
34
Verma, Suman M., Ivy T. Le, Abhisek B. Ghosal, Marci L. Hageman, Victoria T. Lee, Brian J. deGuzman, and Lishan Aklog. "Abstract P058: Rapid, noninvasive, office-based, esophageal cell collection for early detection of esophageal precancer and cancer." Cancer Prevention Research 16, no. 1_Supplement (January 1, 2023): P058. http://dx.doi.org/10.1158/1940-6215.precprev22-p058.
Повний текст джерелаАнотація:
Abstract Purpose: Esophageal Adenocarcinoma (EAC) is the second most lethal (<20% five-year survival) and fastest growing (>500% increase in incidence over 40 years) cancer in the U.S. All EAC is believed to arise from a metaplastic esophageal precancer, Barrett’s Esophagus (BE), in at-risk patients with gastroesophageal reflux disease (GERD). Non-dysplastic BE can be monitored for progression to dysplastic BE, which can be ablated endoscopically, reliably halting progression to EAC. Since mortality is high even in early stage EAC (<50% five-year survival), clinical practice guidelines recommend BE screening in GERD patients with multiple risk factors. Since, endoscopic BE screening has failed (<10% compliance with guidelines), recently updated guidelines from both the American College of Gastroenterology and American Gastroenterological Association now support non-endoscopic biomarker screening as an acceptable alternative to endoscopy. EsoCheck®, a noninvasive swallowable balloon capsule catheter device, is the only FDA 510(k)-cleared esophageal cell collection device which permits anatomically targeted and protected sampling of distal esophageal mucosal cells. The sample is collected in a less than five-minute office procedure, without sedation or anesthesia, and sent to a central laboratory for molecular biomarker testing. We report our initial clinical experience using EsoCheck® for collection of esophageal cells in outpatient test centers. Experimental Design: 687 patients underwent EsoCheck® distal esophageal cell sampling by a trained nurse practitioner (average sampled length 5 cm). Patient tolerance was rated on a five-point scale for gag reflex (GR) severity: 1 = no GR; 2 = minimal GR; 3 = mild GR; 4 = severe GR; and 5 = worst GR therefore collection could not be completed. DNA was extracted using the QIAamp DNA Mini kit and quantitated using Qubit™ dsDNA Assay kit. Cytologic assessment using H&E staining was performed on 15 samples. Results: 98% of patients successfully completed the procedure. 88% tolerated it well (rating ≤ 3); 10% experienced severe gagging (rating 4); and only 2% were unable to complete the procedure (rating 5). Average procedure time was 3.5 min (range: 1 min to 15 min). Average DNA yield was 868 ng (range: 0 ng to 19 µg) and 92% yielded at least 100 ng. The samples undergoing cytologic assessment averaged 500,000 cells (range: 100,000 to 2.5 million). Conclusion: Rapid, noninvasive, office-based, anatomically-targeted, and protected sampling of distal esophageal mucosal cells using EsoCheck® can be successfully performed in nearly all patients and is broadly well-tolerated. Cellular and DNA yields were very good and are expected to improve with clinical experience and assay optimization. When combined with a highly sensitive molecular biomarker test, the EsoCheck® device has the potential to significantly improve BE screening compliance and prevent EAC deaths. Citation Format: Suman M. Verma, Ivy T. Le, Abhisek B. Ghosal, Marci L. Hageman, Victoria T. Lee, Brian J. deGuzman, Lishan Aklog. Rapid, noninvasive, office-based, esophageal cell collection for early detection of esophageal precancer and cancer. [abstract]. In: Proceedings of the AACR Special Conference: Precision Prevention, Early Detection, and Interception of Cancer; 2022 Nov 17-19; Austin, TX. Philadelphia (PA): AACR; Can Prev Res 2023;16(1 Suppl): Abstract nr P058.
35
Bantekas, Ilias. "The Proper Law of the Arbitration Clause: A Challenge to the Prevailing Orthodoxy." Journal of International Arbitration 27, Issue 1 (February 1, 2010): 1–8. http://dx.doi.org/10.54648/joia2010002.
Повний текст джерелаАнотація:
It has recently been established, at least before English courts, that where the parties have failed to set out the proper law of the arbitration clause, this is necessarily, and by mandatory default, the law of the seat of the arbitration. The justification for this assumption is that if this were not so, then the parties may have access to two distinct curial laws. This assumption in favor of the law of the seat, however, goes against the ordinary assumption that in the absence of a contrary provision by the parties, the law applicable to the arbitration clause will follow the proper law of the contract. Moreover, the justification offered by the courts is pointless in circumstances where the parties in fact designate the law governing the arbitration clause which is contrary to the law of the seat. Ultimately, it is up to the arbitrators and the courts of the lex arbitri to decide on any conflicts of civil procedure law that may arise.
36
Rodríguez-Violante, Mayela, Amin Cervantes-Arriaga, Salvador Velázquez-Osuna, Rodrigo Llorens-Arenas, Humberto Calderón-Fajardo, Dan Piña-Fuentes, and Pablo Martinez-Martin. "Independent Validation of the SEND-PD and Correlation with the MDS-UPDRS Part IA." Parkinson's Disease 2014 (2014): 1–5. http://dx.doi.org/10.1155/2014/260485.
Повний текст джерелаАнотація:
Introduction. Neuropsychiatric symptoms in Parkinson’s disease can be assessed by the MDS-UPDRS part IA. The Scale for Evaluation of Neuropsychiatric Disorders in Parkinson’s disease (SEND-PD) has been recently developed to assess the severity of some neuropsychiatric symptoms. The objective of this study is to compare the performance of the SEND-PD with the corresponding items of the MDS-UPDRS part IA.Methods. Patients with Parkinson’s disease were evaluated using the MDS-UPDRS and the SEND-PD by independent raters. Partial SEND-PD and neuropsychiatric MDS-UPDRS part IA were constructed with equivalent items for comparison.Results. A total of 260 consecutive patients were included. Overall, 61.2% of the patients did not report any psychotic symptom and 83.5% did not report any ICD symptom. On the other hand, 78.5% of the patients did report at least one symptom related to apathy, depression, or anxiety. The partial SEND-PD score was2.9±3.1(range from 0 to 16). The neuropsychiatric MDS-UPDRS part IA score was2.9±3(range from 0 to 14). The correlation coefficient between corresponding items ranged from 0.67 to 0.98 and between both summary indexes wasrs=0.93(all,P<0.001).Conclusion. A high association between equivalent items of the SEND-PD and the MDS-UPDRS was found.
37
BOON, RICHARD G. C., MARIE JORDAAN, and ABRAHAM E. VAN WYK. "A new species of Combretum sect. Ciliatipetala (Combretaceae) from South Africa." Phytotaxa 434, no. 1 (February 24, 2020): 1–12. http://dx.doi.org/10.11646/phytotaxa.434.1.1.
Повний текст джерелаАнотація:
Combretum eugeneanum, a new species from northeastern KwaZulu-Natal, South Africa and confined to the Maputaland Centre of Plant Endemism, is described, illustrated, mapped, and compared with southern African members of the genus with which it may be confused. In a narrowly defined genus Combretum, the new species belongs to Combretum sect. Ciliatipetala. In herbaria, it has usually been confused with close relatives C. apiculatum and C. edwardsii, as well as several other more distantly related members of the genus, in particular C. woodii. The new species is also closely related to the recently described C. stylesii. It is readily distinguished as an essentially glabrous woody climber or scrambling shrub needing other vegetation for support, leaf apices rarely apiculate, tertiary veins raised on the adaxial leaf surface, inflorescences few-flowered and subcapitate, upper hypanthium cupuliform, flowers with orange-red centres (discs) and peltate scales comprised of essentially eight radial cells, most of which are subdivided by at least one tangential wall, the resulting outer and inner cell(s) often with at least one additional radial wall. Combretum eugeneanum grows in Sand Forest and associated sandy bushveld, and its range and habitat does not overlap with that of C. edwardsii or C. stylesii, both of which are also very often lianas.
38
Braglia, Luca, Diego Breviario, Silvia Gianì, Floriana Gavazzi, Jacopo De Gregori, and Laura Morello. "New Insights into Interspecific Hybridization in Lemna L. Sect. Lemna (Lemnaceae Martinov)." Plants 10, no. 12 (December 15, 2021): 2767. http://dx.doi.org/10.3390/plants10122767.
Повний текст джерелаАнотація:
Duckweeds have been increasingly studied in recent years, both as model plants and in view of their potential applications as a new crop in a circular bioeconomy perspective. In order to select species and clones with the desired attributes, the correct identification of the species is fundamental. Molecular methods have recently provided a more solid base for taxonomy and yielded a consensus phylogenetic tree, although some points remain to be elucidated. The duckweed genus Lemna L. comprises twelve species, grouped in four sections, which include very similar sister species. The least taxonomically resolved is sect. Lemna, presenting difficulties in species delimitation using morphological and even barcoding molecular markers. Ambiguous species boundaries between Lemna minor L. and Lemna japonica Landolt have been clarified by Tubulin Based Polymorphism (TBP), with the discovery of interspecific hybrids. In the present work, we extended TBP profiling to a larger number of clones in sect. Lemna, previously classified using only morphological features, in order to test that classification, and to investigate the possible existence of other hybrids in this section. The analysis revealed several misidentifications of clones, in particular among the species L. minor, L. japonica and Lemna gibba L., and identified six putative ‘L. gibba’ clones as interspecific hybrids between L. minor and L. gibba.
39
Antovic, Svetozar, Nikola Jankulovski, and Sinisa Stojanovski. "The Significance of the Sentinel Lymph Node in Colorectal Cancer and its Isolation with Radioactive Colloid-A Pilot Study." Macedonian Medical Review 68, no. 2 (August 1, 2014): 89–92. http://dx.doi.org/10.2478/mmr-2014-0018.
Повний текст джерелаАнотація:
AbstractIntroduction.One of the most important factors for prognosis in patients with colorectal cancer (CRC), especially the 5-year survival is the status of regional lymph nodes (RLN). Threfore, today’s recommendations for systematic lymphadenectomy in CRC operations are very important. For correct staging and accepted by all international recommendations, at least 12 LN must be analyzed microscopically. The sentinel lymph node (SLN) is the first lymph node that drains lymph from the tumor and thus represents a LN that has the greatest chance to be the bearer of metastatic disease. Tests to locate the SLN in CRC have started recently and so far there is no consensus on the method for its localization or its significance. The main aim of this study was to improve the tracing of SLN by using radioactive colloid. The secondary aims were to investigate the accuracy, sensitivity and rate of method’s identification. Especially important for the analysis is the significance of SLN and its correlation with other RLN.Methods.The study is performed at the University Clinic for Digestive Surgery from January 2013 and is still ongoing. A day before the surgery endoscopically around the tumor is injected radioactive colloid with Technetium 99 (Sentiscint Tc 99m Mediradiofarma Ltd) in the amount of 4 ml, which corresponds to 4 mCi (mill curie). Immediately after that, at the Institute of Pathophysiology using a Gamma camera (Mediso DHV nucline spirit), the distribution of the colloid is monitored, which as expected is mostly accumulated in the first LN, that is the genuine sentinel lymph node, thus making lymphatic mapping that is important for identifying possible aberrant drainage. On the day of surgery at 8:00 am, a rerecording with the Gamma camera is made that shows the late distribution of contrast. All patients are operated with standard surgical technique by making resection with systematic lymphadenectomy. Promptly after removing the preparation a Gamma detector probe (Europrobe) is used to determine the radioactivity of the lymph pool and it finds the right SLN which has the highest radioactivity and it is separately sent for complete pathohistological analysis. At the Institute of Pathology all lymph nodes are first treated standardly with HE and then with immunohistochemical method.Results.So far the study includes 10 patients, 6 men and 4 women, mean age 63 years (59-77). Until now the identification rate is 100%, which means that SLN has been found in all procedures. Only in 2 patients two sentinel lymph nodes have been revealed while the in the remaining only 1, average 1.2. At PH analysis, an average of 14.2 lymph nodes have been isolated (6-25). Only in one patient false negative 1 SLN has been revealed. The number of patients with real negative SLN is 2, which means the SLN is negative and also all the other lymph nodes. The total number of patients with real positive SLN is 7, which means SLN is positive and also some of the other lymph nodes. Therefore the accuracy of the procedure is 90%. The sensitivity of the procedure in our study that is still ongoing, is 87.5%. Up to now there have been no micrometastases detected in these 10 patients with immunohistochemical methods and because of it the up staging for now is 0%. In 2 patients the SLN is the only positive lymph node of all examined LN. In none of the patients aberrant lymphatic drainage has been discovered.Conclusions.From the results obtained so far in this study, it can be concluded that the identification of the SLN with this method is possible; the accuracy and sensitivity are high and we expect them to be even higher, which is our motive to continue with the study and to analyze minimum 30 patients. We think this would be the highest number of discovered SLN by a surgeon and an institution and we believe it to be sufficient validation of the method.
40
Greco, Raffaella, Attilio Bondanza, Manuela Badoglio, Myriam Labopin, Maria Carolina Oliveira, Gian Luigi Mancardi, Simona Minguzzi, et al. "Autologous Hematopoietic Stem Cell Transplantation In Neuromyelitis Optica: A Retrospective Study Of The EBMT Autoimmune Diseases Working Party In Collaboration With The University Of Sao Paulo, Ribeirao Preto, Brazil." Blood 122, no. 21 (November 15, 2013): 2125. http://dx.doi.org/10.1182/blood.v122.21.2125.2125.
Повний текст джерелаАнотація:
Abstract Background Neuromyelitis optica (NMO) is an inflammatory and demyelinating disorder of the central nervous system. Recently NMO has been recognized as an autoimmune astrocytopathy, distinct from multiple sclerosis and hallmarked by pathogenic anti-aquaporin 4 (AQP4) antibodies (Kim et al, Mult Scler, 2013). Currently NMO carries a poorer prognosis than multiple sclerosis (MS) and its response to various immunosuppressive treatments remains largely unsatisfactory. Use of Autologous stem cell transplantation (ASCT) has been reported worldwide as a tool for inducing prolonged restoration of self-tolerance in MS and other severe autoimmune diseases (AD), refractory to conventional treatments. In this context, NMO treatment resistant cases were considered for ASCT on a ‘Clinical Option’ basis, according to EBMT guidelines (Snowden et al, Bone Marrow Transplant, 2012). Only 2 isolated NMO cases with contradictory results (Matiello et al, Arch Neurol, 2011; Peng et al, Neurologist, 2010) and a Chinese report of 21 opticospinal multiple sclerosis patients treated by ASCT (Xu et al, Ann Hematol, 2011) are reported in the literature. Therefore, the EBMT Autoimmune Diseases Working Party (ADWP) conducted a survey to address NMO disease response following ASCT. Methods This retrospective study followed the EBMT study guidelines. All centers were invited to participate. Sixteen patients with aggressive forms of NMO refractory to standard treatments treated by ASCT between 2001 and 2011 had been reported to the EBMT registry. For each case, a specific questionnaire was sent to complete information by referring haematologist and neurologist about NMO, ASCT and outcome including disease response, relapse and progression. Results are reported as median. Results Patients (13 females and 3 males) had a median age of 37 years at transplant. Previous treatments had included high-dose steroids (12/16), immunoglobulins (5/16), iv cyclophosphamide (Cy, in 8/16), rituximab (5/16), mitoxantrone (2/16), plasma exchanges (8/16), azathioprine (5/16) and methotrexate (1/16). Median time between NMO diagnosis and transplant was 24 months. Before ASCT, the median EDSS (the Kurtzke Expanded Disability Status Scale) was of 6.5, 10/16 patients were positive for AQP4 antibodies and 11/16 had active lesions on magnetic resonance imaging (MRI). Peripheral blood stem cells mobilization, high-dose alkylating agent such as Cy (14/16) or monoclonal antibodies as Rituximab (2/16), followed by granulocyte colony stimulating factor (G-CSF), was successfully achieved in all cases (16/16). The conditioning regimen consisted of BEAM plus anti-thymocyte globulin (9/16) or Thiotepa-Cy (3/16) or Cy and anti-thymocyte globulin (4/16). Hematopoietic recovery was documented in all patients within 10 days (range 3-25) after ASCT, both for neutrophils and platelets, with a median number of 4 red blood cells and 5 platelet units transfusions. Infectious complications required specific treatment in 9 patients (6 febrile neutropenia, 5 CMV and 2 VZV reactivations, 1 aspergillosis). All patients responded initially. Relapse, necessitating further treatments, occurred in 13/16 at a median of 7 months after ASCT, presenting a median EDSS of 7 (range 3-8.5) and a worsening of MRI (11 cases). NMO progression was observed in 9/16 patients at a median of 10 months after ASCT. In the eight patients evaluable for AQP4 antibodies in the follow-up phase, the pathogenic autoantibodies remained positive after ASCT. Disease-free survival at 3 and 5 years were 31% and 10%, respectively, while progression-free survival at 3 and 5 years were 48%. No secondary malignancy was documented. All patients, but one patient who died from disease progression, are alive at a median follow up of 47 months after ASCT. Conclusions This EBMT retrospective study further demonstrates the potential of ASCT to reduce the highly inflammatory picture typical of NMO, at least in the short term, together with a low incidence of toxicities. Despite transient response after ASCT in the majority of cases, NMO relapsed at later time points underlying the need to investigate maintenance strategies to improve disease outcome in the long term after ASCT. Disclosures: No relevant conflicts of interest to declare.
41
Alia, F., O. Hamdi, S. Miladi, H. Boussaa, M. Yasmine, L. Souebni, K. Ouenniche, et al. "AB1714 GOUT TREATMENT: ARE TUNISIAN INTERNS FOLLOWING INTERNATIONAL RECOMMENDATIONS?" Annals of the Rheumatic Diseases 82, Suppl 1 (May 30, 2023): 2093.3–2094. http://dx.doi.org/10.1136/annrheumdis-2023-eular.3904.
Повний текст джерелаАнотація:
BackgroundGout is a common metabolic disease affecting at least 1% of the population. Its therapeutic management was recently redefined by the recommendations of the French society of rheumatology (SFR) 2020 [1,2].ObjectivesWe aimed to determine the level of adherence of Tunisian rheumatology interns to these recommendations.MethodsWe conducted a 26-item online questionnaire via Google Drive Forms destined to rheumatology interns. The questionnaire intended to assess the degree of application of the French recommendations for the treatment of gout.ResultsThe online questionnaire was sent to 50 rheumatology interns, 19 of whom (38%) responded. Thirty-one percent of participants were in first year, 15.7% in second year, 16% in third year and 31.5% in fourth year. The mean age was 28.3 ±8.7 years [26-33]. All participants were female. The average number of rheumatology internships performed was 3.9 ±0,2 [1-6]. All of the participants declared informing their patients of their pathology. The information given concerned the disease (94.7%), the aim of treatment (78.9%), the need for long-term adherence to treatment (94.7%), the risk of onset of gout symptoms at initiation of treatment (84.7%) and necessary adaptations to lifestyle (94.7%). Eighteen interns (94.7%) advised their patients to avoid certain foods: soda (84.2%), beer (89.4%), wine (36.8%), red meat (84.2%), fish (63.1%), chicken (26.3%) and seafood (73.6%). Almost all physicians screened for comorbidities (94.7%): hypertension (73.6%), dyslipidemia (78.9%), obesity (63.1%) and renal failure (78.9%). The therapeutic means that can be used in gout flares according to the doctors questioned were the following: non-steroidal anti-inflammatory drugs (NSAIDs) (94.7%), colchicine (100%), corticosteroid therapy (94.7%) and anti-interleukin1 (36.8%). Faced with a gout flare, 17 interns (89.4%) prescribed colchicine within 12 hours after the symptoms’ onset. Eleven interns (57.8%) followed the therapeutic regimen recommended by the SFR for flare treatment with colchicine. In the event of the onset of diarrhoea under colchicine, 8 interns (42.1%) stopped the treatment. Regarding corticosteroid therapy, the recommended dose of 30 to 35 mg/day was prescribed in 42.1% of cases. In case of kidney failure, doctors avoided prescribing NSAIDs in 89.4% of cases and colchicine in 63.1% of cases. Eighteen physicians (94.7%) prescribed allopurinol from the first gout flare. Colchicine was prescribed simultaneously with allopurinol in 47.3% of cases. Sixteen interns prescribed colchicine for six months in combination with urate-lowering treatment. Interns were aiming for a therapeutic uricemia target of 50mg/L in 15.7% of cases and 60mg/L in 73.6% of cases. The urate-lowering treatment was maintained for life by 57.8% of the interns, while it was stopped as soon as the therapeutic target was reached in 26.3% with retreatment if recurrence in 21% of the cases. Faced with a decrease in renal clearance, no intern stopped allopurinol and 78.9% of doctors prescribed it subject to monitoring. Once the therapeutic target had been reached, 84.2% of participants recommended monitoring uricemia every 6 to 12 months.ConclusionTunisian rheumatology interns do not fully follow the new French recommendations for the treatment of gout. Thus, medical training on the subject seems necessary in order to optimize the treatment of this pathology in Tunisian hospitals.References[1]Latourte A, Pascart T, Flipo R-Marc, Chalès G, Coblentz-Baumann L, Cohen-Solal A, et al. Recommandations 2020 de la Société Française de Rhumatologie pour la prise en charge de la goutte: traitement des crises de goutte. Revue du rhumatisme. 2020;87: 324-31.[2]Latourte A, Pascart T, Flipo R-Marc, Chalès G, Coblentz-Baumann L, Cohen-Solal A, et al. Recommandations de la Société Française de Rhumatologie pour la prise en charge de la goutte: le traitement hypouricémiant. Revue du rhumatisme. 2020;87:332-41.Acknowledgements:NIL.Disclosure of InterestsNone Declared.
42
Mallory, J. P., and C. J. Lynn. "Recent excavations and speculations on the Navan complex." Antiquity 76, no. 292 (June 2002): 532–41. http://dx.doi.org/10.1017/s0003598x00090669.
Повний текст джерелаАнотація:
Emain Macha, the legendary seat of the kings of Ulster, has long been identified with the Navan complex, 2.6 km west of Armagh. This complex comprises more than a dozen proximate, in some cases presumably associated. prehistoric monuments (Warner 1994). Excepting a number of outlying monuments, the major portion of the Navan complex is anchored between to large enclosures, each with adjacent sitcs associated with votive depositions in water. On the east is Navan Fort defined by a hengiform bank-and-ditch enclosure some 230 m across and containing two field monuments: Site A, a ring-work c. 50 m across with a low rise in the centre, and Site B, a 6–7-m high mound (FIGURE 1) . At the eastern base of the drumlin on which the enclosure sits is Loughnashade, a small lake from whose marshy edge four large Iron Age horns, at least one of which bore La The decoration, were recovered in the late 18th century (Raftery 1987).
43
FRAMKE, MARIA. "‘We Must Send a Gift Worthy of India and the Congress!’ War and political humanitarianism in late colonial South Asia." Modern Asian Studies 51, no. 6 (November 2017): 1969–98. http://dx.doi.org/10.1017/s0026749x16000950.
Повний текст джерелаАнотація:
AbstractThe interwar period has recently been described as a highly internationalist one in South Asia, as a series of distinct internationalisms—communist, anarchist, social scientific, socialist, literary, and aesthetic1—took shape. At the same time, it has been argued that the Second Sino-Japanese War of 1937 drew to a close various opportunities for international association (at least, temporarily). Taking into account both these contradistinctive developments, this article deals with another—and thus far largely overlooked—South Asian internationalism in the form of wartime Indian humanitarianism. In 1938, the Indian National Congress helped organize an Indian medical mission to China to bring relief to Chinese victims of the Second Sino-Japanese War. By focusing on this initiative, this article traces the ideas, the practices, and the motives of Indian political humanitarianism. It argues that such initiatives, as they became part of much wider global networks of humanitarianism in the late 1930s and early 1940s, created new openings for Indian nationalists to establish international alliances. This article also examines the way in which political humanitarianism enabled these same nationalists to perform as independent leaders on an international stage, and argues that humanitarianism served as a tool of anti-colonial emancipation.
44
Jeon, Ji-Hyeon, and Seung-Chul Kim. "Comparative Analysis of the Complete Chloroplast Genome Sequences of Three Closely Related East-Asian Wild Roses (Rosa sect. Synstylae; Rosaceae)." Genes 10, no. 1 (January 3, 2019): 23. http://dx.doi.org/10.3390/genes10010023.
Повний текст джерелаАнотація:
Species belonging to Rosa section Synstylae (Rosaceae) are mainly distributed in East Asia, and represent recently diverged lineages within the genus. Over decades, inferring phylogenetic relationships within section Synstylae have been exceptional challenges, due to short branch lengths and low support values. Of approximately 36 species in the section Synstylae, Rosa multiflora, Rosa luciae and Rosa maximowicziana are widely distributed in the Sino-Japanese floristic region. In this study, we assembled chloroplast genomes of these three species to compare the genomic features within section Synstylae, and to compare with other infrageneric groups. We found that three Rosa sect. Synstylae species had lost infA genes with pseudogenization, and they were almost identical to each other. Two protein-coding gene regions (ndhF and ycf1) and five non-coding regions (5’matK-trnK, psbI-trnS-trnG, rps16-trnG, rpoB-trnC, and rps4-trnT) were identified as being highly informative markers. Within three section Synstylae chloroplast genomes, 85 simple sequence repeat (SSR) motifs were detected, of which at least 13 motifs were identified to be effective markers. The phylogenetic relationships of R. multiflora, R. luciae and R. maximowicziana could not be resolved, even with chloroplast genome-wide data. This study reveals the chloroplast genomic data of Rosa sect. Synstylae, and it provides valuable markers for DNA barcoding and phylogenetic analyses for further studies.
45
Kucine, Nicole, Ross L. Levine, and James B. Bussel. "Issues in Categorization and Management of Pediatric Patients with Myeloproliferative Neoplasms." Blood 124, no. 21 (December 6, 2014): 1843. http://dx.doi.org/10.1182/blood.v124.21.1843.1843.
Повний текст джерелаАнотація:
Abstract Myeloproliferative Neoplasms (MPN) are well characterized in adults, with symptoms including thrombotic episodes, severe bleeding episodes, splenomegaly, and transformation to AML. Accepted treatment algorithms are available for management and multiple clinical trials are being done in adult patients. Much has been done to understand the pathogenesis in adults, and mutations in JAK2, MPL, and most recently CALR are established as causative lesions in these disorders. In contrast, knowledge of these disorders in children is more rudimentary, with limited information available regarding long-term clinical outcomes in children. Children have a lower frequency of the known mutations; studies to identify alternative driver mutations in children are ongoing. Eight pediatric patients with MPN have been seen at Cornell during their illness. Seven were diagnosed with Essential Thrombocytosis (ET) and the eighth had an initial diagnosis of ET but later was diagnosed with myelofibrosis (MF). One patient did not have bone marrow testing but was diagnosed by her primary hematologist on the basis of extreme thrombocytosis, and JAK2V617F positive testing on peripheral blood when no cause of reactive thrombocytosis was identified. Table 1 summarizes key features of these patients. The average age of diagnosis for these children is 10 years and 3 months. The oldest patient was diagnosed in 2006 and has had the longest consecutive period of thrombocytosis, 8 years. These patients presented with a variety of symptoms, including headache, abdominal pain, fatigue, and bleeding. All the children experienced extreme thrombocytosis (platelet count > 1,000 x 109/L) during their illness. Despite the presence of acquired von Willebrand's disease in at least three patients, none have experienced severe bleeding symptoms. There have been no reported severe thrombotic episodes, and any evaluations done for complaints of headache, chest pain, or palpitations have shown no CNS infarcts or cardiac abnormalities. One child developed pseudo tumor cerebri with no cerebral venous sinus thrombosis or CNS lesion detected. Four children have been treated with aspirin with no significant bleeding complications. Six of the eight had been treated with cytoreductive therapy (Hydroxyurea) by their primary hematologist at some point in their course, for various findings including extreme thrombocytosis, fatigue, erythromelalgia, and recurrent headache. All showed a good response in platelet count to Hydroxyurea treatment, none developed dose-limiting side effects, and the highest dose that was needed to relieve symptoms at any point was 35mg/kg. Four patients remain on therapy with Hydroxyurea. Genetic sequencing was positive for JAK2V617F in three of eight patients. All of these patients have received Hydroxyurea treatment, and the child with pseudotumor cerebri was JAK2V617F positive. Of the five patients who are negative for JAK2 mutation, four were tested for MPLW515K/L and all are negative. Two of these patients have had sequencing sent for CALR mutations, and one patient is negative for CALR mutation as well (one patient is pending.) Figure 1 summarizes the sequencing completed to date on these patients. This cohort of pediatric patients shows a lower frequency of the known causative mutations than their adult counterparts. There is variation in how these patients were managed by their primary hematologists, likely due to the lack of treatment guidelines in this patient population (Kucine et al, 2014.) With the apparent differences in clinical course and genetic drivers from adults with MPN, there is a clear need for further research on the outcomes and pathogenesis in pediatric patients with MPN. Our group is currently working to answer some of the questions regarding pathogenesis and outcomes in pediatric patients with MPN to allow for individualization of treatment recommendations and family guidance in these children. Table 1. Summary of Eight Pediatric MPN Patients Patient Age at Diagnosis (years) Diagnosis Initial Symptoms A 9 ET Weakness, Paresthesias B 7 ET Headache C 10 ET Headache, Fatigue D 7 ET Headache E 8 ET Bleeding F 13 MF Abdominal Pain, Splenomegaly G 10 ET Headache H 19 ET Fatigue, Itching Figure 1. Clinical Sequence of Genetic Testing For Pediatric Cohort Figure 1. Clinical Sequence of Genetic Testing For Pediatric Cohort References Kucine N, Chastain KM, Mahler MB, Bussel JB. Primary thrombocytosis in children. Haematologica. 2014;99(4)620-28. Disclosures Off Label Use: Hydroxyurea use in certain children with MPN is accepted practice but is technically off-label.
46
DeSerres, Joshua J., Matthew W. T. Curran, Eric H. Fung, Edward E. Tredget, Gordon H. Wilkes, and Jaret L. Olson. "Advanced Training and Job Satisfaction Among Recent Canadian Plastic Surgery Graduates." Plastic Surgery 27, no. 3 (March 31, 2019): 223–29. http://dx.doi.org/10.1177/2292550319826089.
Повний текст джерелаАнотація:
Background: In order to increase one’s competitiveness in the current job market, Canadian plastic surgery graduates may complete additional degrees and multiple fellowships. The authors sought to determine the impact of this additional training on the practice profile of recent graduates and determine the current state of job satisfaction among this group. Methods: An anonymous cross-sectional online survey was created and sent to all 250 graduates of Canadian plastic surgery residencies from 2005 to 2015. Demographics were collected and questions grouped into clinical, teaching, research, and administrative components. Questions pertaining to job satisfaction were also included. Results: The response rate to the survey was 39%. Sixty-nine (71%) respondents had permanent attending positions at the time of survey completion, while the remaining 28 respondents did not. Among those with permanent positions, 59 (86%) completed at least one fellowship and 30 (43%) have an advanced degree. Of those who did fellowship training, 76% practice primarily in their area of subspecialty. Having an advanced degree showed a trend to a higher percentage of practice dedicated to research (5.6% vs 1.9%; P = .074) and more publications per year were seen among this group (1.31 vs 0.30; P = .028). Eighty-six percent of respondents are satisfied with their current attending position. Conclusions: The majority of recent Canadian plastic surgery graduates are undergoing fellowship training and are practicing primarily in their fields of subspecialty training. Having a postgraduate degree was associated with a higher number of publications per year as an attending surgeon. Job satisfaction is high among recent graduates.
47
Derebery, M. Jennifer. "Allergic and Immunologic Aspects of Meniere's Disease." Otolaryngology–Head and Neck Surgery 114, no. 3 (March 1996): 360–65. http://dx.doi.org/10.1016/s0194-59989670204-8.
Повний текст джерелаАнотація:
Meniere's disease, although idiopathic by definition, has been ascribed to a variety of causes, which more recently include autoimmune factors. Interest in the role of allergy in Meniere's disease has also increased. Studies from this institution and elsewhere provide evidence that allergy and immunologic factors play a role in Meniere's disease in at least some patients. The symptoms of Meniere's disease are thought to be produced by a sudden influx of fluid into the endolymphatic sac, producing a rupture of Reissner's membrane in the cochlea. The endolymphatic sac is capable of trapping antigen and generating its own immune response. It has a highly vascular subepithelial space containing numerous fenestrated blood vessels that are peripheral and “leaky.” At least three mechanisms by which allergy may play a role in the production of fluid in the endolymphatic sac are described: the endolymphatic sac itself might be a “target organ” of mediator released from systemic inhalant or food reactions; deposition of circulating immune complex may produce inflammation and interfere with the sac's filtering capability; and a predisposing viral infection in childhood that produces a mild impairment of endolymphatic sac function may interact with allergies in adulthood and cause the endolymphatic sac to decompensate, resulting in endolymphatic hydrops. The endolymphatic sac is the seat of immune reactivity in the inner ear. Repeated inflammatory reactions can produce sac dysfunction and eventual production of Meniere's disease.
48
Bralich, Philip A. "The new SAT and fundamental misunderstandings about grammar teaching." English Today 22, no. 3 (July 2006): 61–64. http://dx.doi.org/10.1017/s0266078406003105.
Повний текст джерелаАнотація:
THE TEACHING of traditional grammar has been on the wane in education for the last 25 to 50 years, in the face of more interactive classrooms, more exotic developments in transformational grammar, and research suggesting that it may not play an effective role in improving student's writing. Recently, however, there has been a resurgence of interest in teaching at least some of its fundamental concepts. This new interest has taken on a more imperative bent as secondary schools and to some extent primary schools have been feeling pressure to teach basic grammatical concepts in order to prepare students for the 45 multiple-choice questions on grammar and usage in the new SAT (Scholastic Aptitude Test). Teachers and schools that have not done well enough in this area will be held to account by parents and politicians, both of whom tend to believe that instruction in traditional formal grammar is the best means to this end. Teachers who send students off, without this training, to undergo the new SAT will have some serious questions to answer if those students scores are too low.
49
Uaprasert, Noppacharn, Benjaporn Akkawat, Rattaporn Vichitratchaneekorn, Chantiya Chanswangphuwana, and Ponlapat Rojnuckarin. "Low Pre-Test Probability Scores Are Not Sufficient to Exclude Heparin-Induced Thrombocytopenia in Critically Ill Patients." Blood 126, no. 23 (December 3, 2015): 3256. http://dx.doi.org/10.1182/blood.v126.23.3256.3256.
Повний текст джерелаАнотація:
Abstract Background: Heparin-induced thrombocytopenia (HIT) is a serious complication of heparin administration. Diagnosis of HIT is a clinical challenge. The 4Ts scoring model (0-3 low, 4-5 intermediate, 6-8 high probability of HIT) has been validated in several studies including the recent meta-analysis (Blood 2012;120:4160-7), which demonstrated that a low probability 4Ts score conferred a high negative predictive value (0.998; 95% CI, 0.970-1.000) for excluding HIT. Some experts propose a diagnostic approach for HIT based on the 4Ts scoring model and exclude HIT in patients with a low probability score without serologic testing for HIT. Another recently constructed model 'HIT expert probability' (HEP) score (< 2 unlikely, ≥ 2 likely) demonstrated better diagnostic performance in mainly surgical patients. However, in critically ill patients who receive heparin, other concomitant causes of thrombocytopenia are common and may interfere with clinically diagnosis of HIT. In this study, we aimed to determine the diagnostic accuracy of the 4Ts and the HEP score for excluding HIT in a population of critically ill patients. Methods: Consecutive patients admitted in critical care units during 2006-2015 were included in this study. Clinical and laboratory data of individuals were retrospectively reviewed from medical records. The 4Ts and the HEP score were blindly computed by two independent reviewers (NU and RV). The rapid particle gel immunoassay (platelet factor 4/heparin-PaGIA) was used for HIT screening. Subjects yielding positive PaGIA were sent for the confirmatory testing using the in-house platelet aggregometry measuring heparin-induced platelet aggregation (HPA). However, during the shortage of PaGIA, HPA was performed in all cases. HPA using platelet-rich plasma from healthy donors with known reactive platelets was performed as previously described with a few modification. Aggregation values of at least 20% above negative controls in the presence of 0.5 or 1.0 U/ml of heparin, which were subsequently inhibited by the addition of 100 U/ml of heparin, were defined as positive results. Results: There were 92 critically ill patients with suspected for HIT. Among them, 56 (60.9%), 33 (35.9%) and 3 (3.3%) yielded low, intermediate and high probability 4Ts score, respectively, while 33 (35.9%) and 59 (64.1%) yielded unlikely and likely high probability HEP score, respectively. Of 78 with obtainable PaGIA, 25 cases (37.2%; 6/6 HPA+ and 19/72 HPA-) yielded positive results. Eleven patients (12.0%) yielded positive results for HPA were diagnosed as HIT. There were 6 (54.5%) developing thrombosis (4 new proven and 2 progressive). Clinical data of all documented HIT were summarized in the table 1. Documented HIT was diagnosed in 5.4%, 18.2% and 66.7% of low, intermediate and high probability 4Ts score, respectively, whereas HIT was demonstrated in 9.4% and14.3% of unlikely and likely probability HEP score, respectively. The receiver operating characteristic curve analysis demonstrated that the 4Ts score was tended to display better diagnostic performance than the HEP score with the area under curve of 0.740 and 0.587 (P = 0.053), respectively. The HIT cases with low pre-test probability scores were due to concomitant causes of thrombocytopenia resulting in earlier onset, lower nadir of platelet counts and/or more minus scores from alternative etiologies of thrombocytopenia. Conclusions: The diagnostic performance of the 4Ts and the HEP score is limited in complicated and/or critically ill patients due to multiple etiologies affecting onset and severity of thrombocytopenia. Both low probability 4Ts score and unlikely HEP score are unsafe for excluding HIT in this patient group. Table 1. Clinical characteristics of patients documented heparin-induced thrombocytopenia Case Age (years)/ sex Patient type Heparin type Thrombosis PaGIA 4Ts score HEP score 1 61/ M CVT UFH New + 2 -6 2 37/ M CCU UFH, LMWH Progressive NA 3 -3 3 74/ F CVT UFH No NA 3 3 4 83/ M GenS UFH, LMWH New + 4 -6 5 80/ F Med LMWH No + 4 6 6 62/ M CCU UFH No NA 5 4 7 51/ M CCU UFH No NA 5 5 8 80/ M Med UFH No + 5 6 9 76/ M CCU UFH Progressive NA 5 10 10 50/ F Med UFH, LMWH New + 6 5 11 87/ M CCU UFH New + 7 9 M: male, F: female, CVT: cardiovascular thoracic surgery, CCU: coronary care unit, GenS: general surgery, Med: medicine, UFH: unfractionated heparin, LMWH: low molecular weight heparin, NA: not available Disclosures No relevant conflicts of interest to declare.
50
Neumann, Claudia, Nadine Straßberger-Nerschbach, Achilles Delis, Johannes Kamp, Alexandra Görtzen-Patin, Dishalen Cudian, Andreas Fleischer, et al. "Digital Online Patient Informed Consent for Anesthesia before Elective Surgery—Recent Practice in Europe." Healthcare 11, no. 13 (July 5, 2023): 1942. http://dx.doi.org/10.3390/healthcare11131942.
Повний текст джерелаАнотація:
Background: Digitalization in the health system is a topic that is rapidly gaining popularity, and not only because of the current pandemic. As in many areas of daily life, digitalization is becoming increasingly important in the medical field amid the exponential rise in the use of computers and smartphones. This opens up new possibilities for optimizing patient education in the context of anesthesia. The main aim of this study was to assess the implementation of remote consent in Europe. Methods: An online survey entitled “Digital online Patient Informed Consent for Anesthesia before Elective Surgery. Recent practice in Europe,” with a total of 27 questions, was sent by the European Society of Anesthesiology and Intensive Care (ESAIC) to their members in 47 European countries. To assess the effect of the economy on digitalization and legal status with regard to anesthesia consent, data were stratified based on gross domestic product per capita (GDPPC). Results: In total, 23.1% and 37.2% of the 930 participants indicated that it was possible to obtain consent online or via telephone, respectively. This observation was more often reported in countries with high GDPPC levels than in countries with low GDPPC levels. Furthermore, 27.3% of the responses for simple anesthesia, 18.7% of the responses for complex anesthesia, and 32.2% of the responses for repeated anesthesia indicated that remote consent was in accordance with the law, and this was especially prevalent in countries with high GDPPC. Concerning the timing of consent, patients were informed at least one day before in 67.1% of cases for simple procedures and in 85.2% of cases for complex procedures. Conclusion: Even European countries with high GDPPC use remote informed consent only in a minority of cases, and most of the time for repeated anesthetic procedures. This might reflect the inconsistent legal situation and inhomogeneous medical technical structures across Europe.