Статті в журналах: "Identity Testing in Number Fields"

1

Mérai, László. "Values of rational functions in small subgroups of finite fields and the identity testing problem from powers." International Journal of Number Theory 16, no. 02 (September 18, 2019): 219–31. http://dx.doi.org/10.1142/s1793042120500128.

Повний текст джерела

Анотація:

Motivated by some algorithmic problems, we give lower bounds on the size of the multiplicative groups containing rational function images of low-dimensional affine subspaces of a finite field [Formula: see text] considered as a linear space over a subfield [Formula: see text]. We apply this to the recently introduced algorithmic problem of identity testing of “hidden” polynomials [Formula: see text] and [Formula: see text] over a high degree extension of a finite field, given oracle access to [Formula: see text] and [Formula: see text].

Стилі APA, Harvard, Vancouver, ISO та ін.

2

Karpinski, Marek, László Mérai, and Igor E. Shparlinski. "Identity testing and interpolation from high powers of polynomials of large degree over finite fields." Journal of Complexity 49 (December 2018): 74–84. http://dx.doi.org/10.1016/j.jco.2018.07.006.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

3

MacKenzie, Tyler D. B., Manphool S. Fageria, Xianzhou Nie, and Mathuresh Singh. "Effects of Crop Management Practices on Current-Season Spread of Potato virus Y." Plant Disease 98, no. 2 (February 2014): 213–22. http://dx.doi.org/10.1094/pdis-04-13-0403-re.

Повний текст джерела

Анотація:

The current-season spread of Potato virus Y (PVY) was monitored in 19 fields under various management practices in New Brunswick, Canada, through the 2011 and 2012 growing seasons. The focus of this study was to evaluate the role of seedborne PVY inoculum, aphid vector abundance, and the numbers, timing, and types of insecticide and mineral oil sprays, and to confirm the reliability and forecasting capacity of midseason PVY testing. In each field, 100 to 110 virus-free plants were identified shortly after emergence and were assessed four times from early July to early September (after top-kill) with enzyme-linked immunosorbent assay (ELISA) and reverse-transcription polymerase chain reaction (RT-PCR) to track PVY spread. In addition, tubers harvested during development in August and after top-kill were grown-out in the greenhouse for ELISA testing. PVY spread to selected virus-free plants varied widely, ranging from 0 to 76.2% across all studied fields. Of the 19 fields over two seasons, 10 fields were planted with no detectable seedborne PVY, and they showed 0 to 8.7% (mean 2.9%) PVY spread by harvest. The remaining nine study fields with 0.9 to 5.8% seedborne PVY showed 1 to 76.2% (mean 15.2%) PVY spread by harvest. PVY spread was detected in most fields during midseason testing with ELISA and RT-PCR; all tests correlated well with final PVY rates after top-kill, though RT-PCR detection in developing tubers was most sensitive and correlated. Logistic regression modeling was used to identify major factors in PVY spread, including seedborne PVY, early-season aphid abundance, and the numbers of insecticide and mineral oil sprays. The best-fitting model, constructed using these factors as well as a measurement of July PVY incidence (ELISAJuly), strongly explained PVY spread by harvest, with the most significant management factor being the number of mineral oil sprays supplemented with insecticide used during the growing season. A similar model fitted without the ELISAJuly did not adequately predict ultimate PVY spread. The analysis suggests that mineral oil alone was effective at lowering PVY spread, and more effective when combined with insecticide, particularly when used early in the season. No evidence was found for differences in PVY spread across the eight cultivars used or across the range of mineral oil application rates, whereas some evidence was found for differences in the effectiveness of different insecticide types.

Стилі APA, Harvard, Vancouver, ISO та ін.

4

Agussalim, Muliana Djafar, and Andi Syam Rizal. "Analisis Potensi Debit Air Tanah Melalui Pumping Test Metode Step Draw Down pada Sumur Bor Irigasi di Desa Bonto Rannu, Kecamatan Kajang, Kabupaten Bulukumba, Sulawesi Selatan." JFT: Jurnal Fisika dan Terapannya 9, no. 2 (December 31, 2022): 127–37. http://dx.doi.org/10.24252/jft.v9i2.32277.

Повний текст джерела

Анотація:

The rice fields in Bonto Rannu Village, Kajang District, Bulukumba Regency are dominated by rainfed rice fields. This species has limitations in the dry season because irrigation/agricultural irrigation completely depends on rainwater. Therefore, it is necessary to identify alternative irrigation sources to sustain farmers' farming activities in Bonto Rannu Village. This study aims to analyze the number of groundwater wells by testing in the form of a pump test (pumping test) with the step draw-down method. The optimum discharge (Qopt) of well 1 is 0.01876 m3/s or 67.53 m3/hour with an optimum Sw of 2.891 m. This shows that groundwater in well one can be pumped at 67.53 m3/hour with a decreased water level of 2.891 m, with the pump condition still technically safe. As for well 2, the optimum discharge (Qopt) is 0.00318 m3/s or 11.45 m3/hour with an optimum Sw of 2.100 m. These data indicate that there are limited groundwater reserves.

Стилі APA, Harvard, Vancouver, ISO та ін.

5

Bazanova, E. M., A. V. Gorizontova, N. N. Gribova, T. M. Chikake, and A. V. Samosyuk. "Development and Prospects of National Intelligent System for Testing General Language Competencies Deployed Through Neural Network Solutions." Vysshee Obrazovanie v Rossii = Higher Education in Russia 32, no. 8-9 (September 13, 2023): 147–66. http://dx.doi.org/10.31992/0869-3617-2023-32-8-9-147-166.

Повний текст джерела

Анотація:

The article presents the results of approbation of the intellectual system for testing general language competences (ISTOK) developed by testologists, linguists, specialists in methodology of teaching foreign languages and in artificial intelligence. This system includes a range of tests assessing language ability at levels from A2 to C1 of the Common European Framework of Reference (CEFR), as well as an adaptive placement test. All test materials are calibrated according to the CEFR. ISTOK is an adaptive testing system deployed through neural network solutions and providing assessment of receptive and productive language skills (reading, listening, speaking and writing) by using artificial intelligence and/or neurolinguistic models. The process of ISTOK development implied, apart from writing test items, putting together databases of writing and speaking assignments marked by professional assessors and assessment criteria for productive skills, as well as algorithms to identify various types of mistakes with the help of artificial intelligence. The results of various testing cohorts with the total number of test takers exceeding 5,000 demonstrated high reliability and objectified test validity. The new approach to language skills testing can be used for various purposes in higher education institutions, as well and to identify and/or confirm language proficiency of personnel in different organisations and businesses, while the principles of training and practical use of neurolinguistic models will find wide application in various fields of applied research.

Стилі APA, Harvard, Vancouver, ISO та ін.

6

Kotsiubivska, Kateryna, Olena Tymoshenko, Kostiantyn Bulyha, and Ihor Yarokhno. "Application of Pseudo-Random Numbers in System Design." Digital Platform: Information Technologies in Sociocultural Sphere 6, no. 1 (July 10, 2023): 53–62. http://dx.doi.org/10.31866/2617-796x.6.1.2023.283945.

Повний текст джерела

Анотація:

The purpose of the article is to study and search for optimal strategies for modelling information systems using pseudo-random numbers to improve the performance of information systems and to determine the optimal parameters of random number distributions; to analyze efficient algorithms for generating pseudo-random numbers. The research methods are based on the application of a systematic approach to analyzing the benefits of using pseudorandom numbers in the design of information systems. Scientific novelty. The article analyses the advantages of stochastic modelling of information systems using different approaches to generating pseudorandom numbers, and for the first time considers the application of a random decision tree forest for modelling queuing systems. Conclusions. The application of pseudorandom numbers in system design is an urgent problem that requires further research and development of methods. The design of efficient algorithms for generating, validating, and using pseudorandom values plays an essential role in many fields of science and technology. This approach allows for optimization and planning in the process of designing the system and is essential for validating and testing the system. By generating random variables, you can create different test scenarios and check how the system reacts to various conditions, which helps to identify potential errors, flaws, and problems in the system and ensures the quality of the design. Thus, the use of pseudo-random numbers in system design allows for randomness, risk analysis, optimization and planning, validation, and testing. This is an important aspect of system development that helps to ensure their reliability, performance, and efficiency.

Стилі APA, Harvard, Vancouver, ISO та ін.

7

Kurbanismailov, Z. M., A. T. Tarlanov, and E. M. Akimov. "The technique of point visualization of the electric field in space and time." Russian Technological Journal 9, no. 3 (June 28, 2021): 58–65. http://dx.doi.org/10.32362/2500-316x-2021-9-3-58-65.

Повний текст джерела

Анотація:

Testing of electronic devices is an integral part of the technological process of any manufacturer of such equipment. In this case, an electronic device is understood as an energy-intensive unit such as a mobile phone, data center or spacecraft. One of the key stages of testing is to identify the effect of electric fields on various electronic components of the device. This stage often requires making a mock-up of some part of an unfinished device in order to fix interference with special equipment. This requires time, financial and human resource costs. In order to reduce these costs in the modern world, the use of mathematical modeling tools for testing noise immunity and electromagnetic compatibility is becoming popular. In this paper, it is proposed to use an algorithm for visualizing electric fields in three-dimensional space and time. The algorithm is easily embedded into applications as a component of a mathematical modeling system. The work considered three ways of visualizing the electric field strength: starting from a simple setting of points in space, on the basis of which the electric field will be built, around the source of electric field radiation, to the use of algorithms that make it possible to arrange points equidistantly based on a given number of points in space for the formation of an electric field. The performance and visual implications of these methods were analyzed. The proposed methodology will be useful to the developer community as an embedded solution for point visualization of the electric field in any project in any algorithmic language with the ability to animate in time.

Стилі APA, Harvard, Vancouver, ISO та ін.

8

Fajri, Muhammad. "Penerapan Digital Signature Untuk Identitas File Audio Dengan Metode Snefru." Management of Information System Journal 1, no. 1 (December 3, 2022): 19–28. http://dx.doi.org/10.47065/mis.v1i1.397.

Повний текст джерела

Анотація:

In the era of information technology that is developing very rapidly, the use of signatures has been widely applied digitally through digital signatures. Digital signatures along with the times have led to the need for authentication of data or files that are used digitally. Its use also aims to avoid counterfeiting or interference. Currently, the use of digital signatures has been widely applied to software distribution, financial transactions, file transfers. The crime of falsifying audio files is a serious problem in various fields. Audio authenticity testing is important and significant in all social areas, especially when audio is used as evidence for conclusions in courts, the basis for judicial decision-making, and corporate reports. Forgery of audio files will cause losses that cannot be estimated. One solution to the problems mentioned above is to perform the process of assigning an identity to the audio file, so that it can be seen that the audio cannot be manipulated. The SNEFRU method is a hash function to detect changes in digital audio. SNEFRU has several variants, varying in number of operands and hash size. The supported hash sizes are 128 and 256 bits. The number of passes in the final 2-pass variant source of SNEFRU is two passes, while a more secure 4-pass version is also available. After the previous attack was published, the 8-pass version was introduced as well. This 8-pass version is still considered safe.

Стилі APA, Harvard, Vancouver, ISO та ін.

9

Nuthakki, Siddhartha, Sai Kalyana pranitha buddiga, and Sonika Koganti. "Exploring Deep Learning Models for Image Recognition: A Comparative Review." Signal & Image Processing : An International Journal 15, no. 3 (June 28, 2024): 01–10. http://dx.doi.org/10.5121/sipij.2024.15301.

Повний текст джерела

Анотація:

Image recognition, which comes under Artificial Intelligence (AI) is a critical aspect of computer vision, enabling computers or other computing devices to identify and categorize objects within images. Among numerous fields of life, food processing is an important area, in which image processing plays a vital role, both for producers and consumers. This study focuses on the binary classification of strawberries, where images are sorted into one of two categories. We Utilized a dataset of strawberry images for this study; we aim to determine the effectiveness of different models in identifying whether an image contains strawberries. This research has practical applications in fields such as agriculture and quality control. We compared various popular deep learning models, including MobileNetV2, Convolutional Neural Networks (CNN), and DenseNet121, for binary classification of strawberry images. The accuracy achieved by MobileNetV2 is 96.7%, CNN is 99.8%, and DenseNet121 is 93.6%. Through rigorous testing and analysis, our results demonstrate that CNN outperforms the other models in this task. In the future, the deep learning models can be evaluated on a richer and larger number of images (datasets) for better/improved results.

Стилі APA, Harvard, Vancouver, ISO та ін.

10

Martin, R. R., I. E. Tzanetakis, J. E. Barnes, and J. F. Elmhirst. "First Report of Strawberry latent ringspot virus in Strawberry in the United States and Canada." Plant Disease 88, no. 5 (May 2004): 575. http://dx.doi.org/10.1094/pdis.2004.88.5.575a.

Повний текст джерела

Анотація:

Strawberries in southern California have shown decline symptoms during the last 2 years. More than 70% of plants tested in California were infected with two newly identified criniviruses that infect strawberry (Strawberry pallidosis and Beet pseudo-yellows). Strawberry cultivars are usually symptomless when infected with one virus, and testing for other strawberry viruses is performed to identify any other viruses that may be involved in the symptomatology. Primers SLRSV F (5′ CCTCTCCAACC-TGCTAGACT 3′) and SLRSV R (5′ AAGCGCATGAAGGTGTAACT 3′) that amplify a 497-bp fragment of RNA 2 of Strawberry latent ringspot virus (SLRSV) were developed and utilized for reverse transcription-polymerase chain reaction (RT-PCR) detection. SLRSV belongs to the family Sequiviridae and is transmitted by nematodes of the genus Xiphinema. The virus has a broad host range (4) and is usually symptomless in strawberries. Strawberry plants from commercial fields in California, Oregon, Washington, and British Columbia, Canada were tested. SLRSV was identified in 17% of plants tested from California and 4% of plants tested from British Columbia, while all samples from Oregon and Washington tested negative. The fragment amplified (GenBank Accession No. AY461735, isolate from British Columbia, Canada) shares 84% nucleotide and 94% amino acid sequence identity with the previously published sequence of SLRSV from strawberry (GenBank Accession No. X77466) (3). The virus was transmitted mechanically from strawberry samples from Canada to Chenopodium quinoa, and the infected C. quinoa plants tested positive for SLRSV with RT-PCR, while no amplicons were obtained from noninoculated control plants. To our knowledge, this is the first report of SLRSV in strawberry in North America, although it has been previously reported in a single cherry tree in Ontario, Canada (1) and in an imported seed lot of parsley in California (2). The number of plants that tested positive as well as the geographic distribution of the virus indicates that the virus is widespread in California, but further testing is needed to identify its distribution in other states. References: (1) W. R. Allen et al. Phytopathology 60:1262, 1970. (2) C. M. Hanson and R. N. Campbell. Plant Dis. Rep. 63:142, 1979. (3) S. Kreiah et al. J. Gen. Virol. 75:2527, 1994. (4) K. Schmelzer. Phytopath. Z. 66:1, 1969.

Стилі APA, Harvard, Vancouver, ISO та ін.

11

Coe, Dan A., and Larry D. Bradley. "The First Half Billion Years (z > 9): Results from the Frontier Fields." Proceedings of the International Astronomical Union 11, A29B (August 2015): 804–7. http://dx.doi.org/10.1017/s174392131600689x.

Повний текст джерела

Анотація:

AbstractWe present z > 9 candidates identified in Hubble Frontier Fields imaging of the first four clusters and blank parallel fields (two-thirds of the complete program). Based on the deeper Hubble imaging, we revise the redshift estimate of the CLASH z ~ 9.6 candidate MACS1149-JD to z = 9.2+0.2-0.5 (95% C.L.). We identify a new possible fainter z ~ 9 companion 3” away (~1 kpc in the source plane). And we discover a new z ~ 9.2 candidate in the MACS1149 parallel field. Combined with previously published candidates at z ~ 9.8 and 9.1 (in A2744 and its parallel field, respectively), these five z > 9 candidates fall below our published expectation of 8 – 47 at this stage in the program. We attribute some of this shortfall to incompleteness, which we have yet to quantify. At z ~ 8 (7.5 – 8.5), we detect 26 candidates down to F160W H < 28.7 AB, roughly one-third the ~82 we expect. If our z > 9 incompleteness is similar (~68%), our results would support the sharp drop in z > 9 number counts claimed by some (but not all) previous works and supported by several (but not all) theoretical models. Properly quantifying our incompleteness will require adding simulated high-redshift galaxies into the images and testing our recovery rate. Additionally, incorporating the deep Spitzer imaging into our analysis could potentially significantly improve our identification of z > 9 candidates by rejecting low-redshift (z ~ 2) interlopers. Data from the full Frontier Fields program will provide strong evidence for or against accelerated evolution and a sharp drop in the cosmic star formation rate density at z > 9.

Стилі APA, Harvard, Vancouver, ISO та ін.

12

Priemyshev, V. S., and A. S. Shayakhmetova. "THE INFLUENCE OF ELEMENTS OF CULTIVATION TECHNOLOGY ON THE SOWING QUALITIES AND YIELD OF SPRING RAPESEED GRAIN IN THE CONDITIONS OF NORTHERN KAZAKHSTAN." Vestnik of M. Kozybayev North Kazakhstan University, no. 1 (61) (April 9, 2024): 109–16. http://dx.doi.org/10.54596/2958-0048-2024-1-109-116.

Повний текст джерела

Анотація:

Rapeseed plays a key role in various fields, including the food and feed industry, technical applications, as well as in agrotechnical and environmental terms. The diversity of agricultural production highlights the economic benefits and relevance of introducing new promising varieties and hybrids of oilseeds, including spring rapeseed. In this process, the research and selection of suitable varieties and hybrids plays a key role.The article is aimed at conducting a comparative analysis of varieties and hybrids of spring rapeseed through competitive variety testing in order to identify their productivity potential in the conditions of our region. The research process was based on two-year work within the framework of the Esil grain feed State Variety testing site. To achieve this goal, a number of tasks have been considered: studying the percentage of germination and seed safety, assessing the yield structure and productivity of various varieties and hybrids. The object of the study was varieties and hybrids of spring rapeseed.The research findings will be key to determining the most promising and economically profitable varieties and hybrids of spring rapeseed adapted to the conditions of our region.The conclusions contain estimated information on the most promising varieties and hybrids for cultivation in our region.

Стилі APA, Harvard, Vancouver, ISO та ін.

13

Szymanski, Michael D., David W. Perry, Nicole M. Gage, Howard A. Rowley, John Walker, Mitchel S. Berger, and Timothy P. L. Roberts. "Magnetic source imaging of late evoked field responses to vowels: toward an assessment of hemispheric dominance for language." Journal of Neurosurgery 94, no. 3 (March 2001): 445–53. http://dx.doi.org/10.3171/jns.2001.94.3.0445.

Повний текст джерела

Анотація:

Object. The goal of this study was to determine whether the late neuromagnetic field elicited by simple speech sounds, which is detected by magnetoencephalography, may be used to estimate hemispheric dominance for language and to guide or constrain the intraoperative search for essential language sites. If sufficiently robust, a noninvasive method for assessing hemispheric dominance for language could reduce the necessity for amobarbital testing and the extent of intraoperative cortical stimulation—based mapping, both of which carry the risk of morbidity. Methods. Fifteen patients undergoing surgery for tumors during which intraoperative language mapping would be performed and two additional patients in whom intracarotid amobarbital testing confirmed right-hemisphere language dominance participated. Following a primary auditory response sources of late neuromagnetic fields elicited by vowel stimuli were modeled and coregistered using magnetic resonance images to form magnetic source (MS) images. A laterality index (LI) was calculated by summing the number of equivalent current dipolar sources in the late fields detected from each hemisphere. In 14 right-handed patients, 10 displayed left asymmetric LIs (0.37 ± 0.16, mean ± standard error of the mean in 14 patients). For both right-hemisphere dominant patients in whom an LI was obtainable, the LI was rightward. Stimulation-mapped essential language sites were found in 7 of 15 patients. For six of these seven patients, the MS image—derived LI was leftward. Conclusions. Asymmetry in single equivalent dipole modeling of the late neuromagnetic field evoked by simple speech sounds correlates with hemispheric language dominance, although not to the degree necessary for individual clinical predictions. With further development, MS imaging of simple language tasks may be used preoperatively to predict language dominance and even to identify or constrain the intraoperative search for likely sites of essential language cortex.

Стилі APA, Harvard, Vancouver, ISO та ін.

14

Qiu, Yue, Yinqian Kang, Hao Liu, and Ibtesam Hilmi. "Current and Future Applications of Machine Perfusion and Other Dynamic Preservation Strategies in Liver Transplantation." OBM Transplantation 08, no. 03 (August 30, 2024): 1–23. http://dx.doi.org/10.21926/obm.transplant.2403224.

Повний текст джерела

Анотація:

Machine perfusion (MP) techniques, which simulate physiological conditions to allow for the assessment and preservation of organ viability, are currently applied in various solid organ transplantation fields. Owing to the growing demand for liver transplants and the scarcity of available donor livers, MP offers a practical solution for recovering high-risk grafts and increasing the number of potentially usable donor organs. Furthermore, testing and administering novel therapies to allografts may also become advantageous. Therefore, it has become essential to examine the role of MP in liver transplantation (LT), identify the challenges in its application, and determine future research directions in this field. This review summarizes the findings from clinical trials on hypothermic MP, normothermic MP (NMP), explores novel dynamic preservation approaches, such as normothermic regional perfusion, ischemia-free transplantation, combinations of MP techniques, and long-term NMP, addresses the obstacles to standardizing MP protocols, and highlights the critical role of clinical trials in validating various aspects of the perfusion process.

Стилі APA, Harvard, Vancouver, ISO та ін.

15

Stølum, Hans-Henrik, and Steve Kaye. "The Identification of Fault Pattern Fractals for Improved Oil and Gas Recovery: A New Process to Identify and Describe Fault Sets Using Non-Linear Methods." Energy Exploration & Exploitation 10, no. 4-5 (September 1992): 354–78. http://dx.doi.org/10.1177/014459879201000411.

Повний текст джерела

Анотація:

Unexpected faults are a serious production problem in numerous, complex and compartmentalised oil and gas fields, and are often the single most important restraint on recovery. Fractal mathematics has demonstrated a surprising degree of order in many natural, apparently random systems. It has been shown that fault patterns exhibit a similar order which could be used to indicate the presence of structures missed in the original interpretation of the seismic data and to predict faults below the approximate 20 m limit of seismic resolution. The potential for greater clarity and resolution opened up by this method may greatly aid field description and reservoir production. We will discuss the development of a comprehensive fault pattern characterisation quantatively with a set of parameters arising from non-linear methods of analysis. This allows for the standardised comparison of seismic interpretations and a precise method for testing interpretations from the same dataset. We will show how fractal mathematics may give a measure of the density of the fault set, the number of faults below the limit of seismic resolution, resolve small fault clusters below the limit of seismic resolution and aid in the description and analysis of fault sets.

Стилі APA, Harvard, Vancouver, ISO та ін.

16

Park, Kyungmin, Seung-Ho Lee, Jongwoo Kim, Jingyeong Lee, Geum-Young Lee, Seungchan Cho, Seung Ho Lee, et al. "Multiplex PCR-Based Nanopore Sequencing and Epidemiological Surveillance of Hantaan orthohantavirus in Apodemus agrarius, Republic of Korea." Viruses 13, no. 5 (May 6, 2021): 847. http://dx.doi.org/10.3390/v13050847.

Повний текст джерела

Анотація:

Whole-genome sequencing of infectious agents enables the identification and characterization of emerging viruses. The MinION device is a portable sequencer that allows real-time sequencing in fields or hospitals. Hantaan orthohantavirus (Hantaan virus, HTNV), harbored by Apodemus agrarius, causes hemorrhagic fever with renal syndrome (HFRS) and poses a critical public health threat worldwide. In this study, we aimed to evaluate the feasibility of using nanopore sequencing for whole-genome sequencing of HTNV from samples having different viral copy numbers. Amplicon-based next-generation sequencing was performed in A. agrarius lung tissues collected from the Republic of Korea. Genomic sequences of HTNV were analyzed based on the viral RNA copy numbers. Amplicon-based nanopore sequencing provided nearly full-length genomic sequences of HTNV and showed sufficient read depth for phylogenetic analysis after 8 h of sequencing. The average identity of the HTNV genome sequences for the nanopore sequencer compared to those of generated from Illumina MiSeq revealed 99.8% (L and M segments) and 99.7% (S segment) identities, respectively. This study highlights the potential of the portable nanopore sequencer for rapid generation of accurate genomic sequences of HTNV for quicker decision making in point-of-care testing of HFRS patients during a hantavirus outbreak.

Стилі APA, Harvard, Vancouver, ISO та ін.

17

Baev, A. R., N. V. Levkovich, A. L. Mayorov, and M. V. Asadchaya. "Scattering of Elastic Waves by an Inhomogeneous Boundary in the Acoustic Testing of Permanent Joints." Devices and Methods of Measurements 10, no. 4 (December 12, 2019): 360–72. http://dx.doi.org/10.21122/2220-9506-2019-10-4-360-372.

Повний текст джерела

Анотація:

Improving the reliability and testing performance of permanent joints оf different materials made by welding, spraying, gluing, soldering and other methods is an important production task, for which the ultrasonic method is the simplest and most effective. The purpose of this work was to expand the technical possibilities and increase the sensitivity of ultrasonic testing of adhesion defects of materials joints based on the establishment of laws governing the formation of a scattering field of elastic waves from an inhomogeneous boundary in three-dimensional space and issuing recommendations for the development of suggested method.For the first time, in the framework of classical concepts, the scattering fields of elastic waves of an acoustic beam with a circular cross section moving across the boundary of a semi-infinite defect are calculated. It is proposed to use a phase shift between the waves reflected from the indicated surfaces, which varies in the range of π/4–π, as an important parameter of the material joint's defect. It has a significant effect on the field pattern and its angular amplitude extrema — minima and maxima of different orders when the defect boundary is moved relative to the center of the acoustic beam spot.The features of the evolution of the structure of the scattering field are established, which make it possible to identify optimal conditions for the detection of weakly reflective defects in sound. It is shown that it is possible in principle to estimate the defect's area by measuring a change in the amplitude of the primary maximum of the radiation pattern of the scattered waves.Specific examples show the effectiveness of using the proposed method for a number of practical applications.

Стилі APA, Harvard, Vancouver, ISO та ін.

18

Herviyanti, H., A. Maulana, D. Rezki, S. Yasin, T. B. Prasetyo, Y. M. Mailiza, I. Darfis, and I. Dwipa. "Identification of Insecticide Residues in Inceptisols at The Central of Horticultural Production, Banuhampu Agam West Sumatra." IOP Conference Series: Earth and Environmental Science 1297, no. 1 (February 1, 2024): 012056. http://dx.doi.org/10.1088/1755-1315/1297/1/012056.

Повний текст джерела

Анотація:

Abstract The high persistence of insecticides in soil and their toxicity to farmers and agricultural land are serious problems with insecticide application. This study was to identify and characterize insecticide residues on Inceptisol in the center of horticultural production, Banuhampu Agam West Sumatra. The determination of soil samples was carried out by purposive random sampling with a quantitative survey method. Sample testing using randomized completely block design (RCBD) with four slope levels and three points of sampling : 0-8%; 8-15%; 15-25%, and 25-45% in fields at a depth of 0-20 cm and forests (25-45% slope) as control. Insecticide residues on Inceptisol in the central of horticultural production, Banuhampu Agam West Sumatra, identified as many as 5 types, namely: Cypermethrin [C22H19Cl2NO3]; Permethrin [C21H20Cl2O3]; Profenofos [C11H15BrClO3PS]; Phenthoate [C12H17O4PS2], and Diazinon [C12H21N2O3PS]. Cypermethrin was the most highly contaminated insecticide residue found in soil at 0.1 mg kg−1 and is a pyrethroid insecticide. The effect of slope level was not significant on the identification of the number of active ingredients and total insecticide residue concentration. However, the highest number of active ingredients on 0-8% and 25-45% slope each amounted to 3 units, while the highest total concentration of insecticide residues on 0-8% slope amounted to 0.499 mg kg−1.

Стилі APA, Harvard, Vancouver, ISO та ін.

19

Zmuidinaite, Raminta, Fady I. Sharara, and Ray K. Iles. "Current Advancements in Noninvasive Profiling of the Embryo Culture Media Secretome." International Journal of Molecular Sciences 22, no. 5 (March 3, 2021): 2513. http://dx.doi.org/10.3390/ijms22052513.

Повний текст джерела

Анотація:

There have been over 8 million babies born through in vitro fertilization (IVF) and this number continues to grow. There is a global trend to perform elective single embryo transfers, avoiding risks associated with multiple pregnancies. It is therefore important to understand where current research of noninvasive testing for embryos stands, and what are the most promising techniques currently used. Furthermore, it is important to identify the potential to translate research and development into clinically applicable methods that ultimately improve live birth and reduce time to pregnancy. The current focus in the field of human reproductive medicine is to develop a more rapid, quantitative, and noninvasive test. Some of the most promising fields of research for noninvasive assays comprise cell-free DNA analysis, microscopy techniques coupled with artificial intelligence (AI) and omics analysis of the spent blastocyst media. High-throughput proteomics and metabolomics technologies are valuable tools for noninvasive embryo analysis. The biggest advantages of such technology are that it can differentiate between the embryos that appear morphologically identical and has the potential to identify the ploidy status noninvasively prior to transfer in a fresh cycle or before vitrification for a later frozen embryo transfer.

Стилі APA, Harvard, Vancouver, ISO та ін.

20

Lee, Nam Hee. "Medical licensing examination (uigwa) and the world of the physician officers (uigwan) in Korea’s Joseon Dynasty." Journal of Educational Evaluation for Health Professions 12 (May 7, 2015): 16. http://dx.doi.org/10.3352/jeehp.2015.12.16.

Повний текст джерела

Анотація:

Physicians for ordinary people in Joseon Dynasty (1392-1910) do not need to pass national medical licensing examination. They had done their job after enough period of apprenticeship. Only physician officers were licensed as technical civil servants. These physician officers were middle class, located socially between the nobility and the commoner. They had to pass a national licensing examination to be considered for high-ranking physician officers, that is, those at the rank above the 6th level out of a total of 9 ranks, where the first rank was highest. Royal physicians also had to pass this examination before accepting responsibility for the King’s healthcare. This article aims to describe the world of Physician officers during the Joseon Dynasty. Physician officers enjoyed considerable social status because they dealt with matters of life and death. Owing to the professional nature of their fields and a strong sense of group identity they came to compose a distinct social class. The physician officers’ world was marked by strong group allegiances based on shared professional knowledge; the use of marriage to gain and maintain social status; and the establishment of hereditary technical posts within the medical profession that were handed down from one generation to the next. The medical licensing examination persisted until 1894 when the civil service examination agency, of which it was part, was abolished. Until that time, the testing agency, the number of candidates who were accepted, two-step test procedures, and the method of test item selection were maintained and enforced. These aspects of the test could be considered characteristic of the medical licensing examination.

Стилі APA, Harvard, Vancouver, ISO та ін.

21

Alzahrani, Abdullah I. A., Manel Ayadi, Mashael M. Asiri, Amal Al-Rasheed, and Amel Ksibi. "Detecting the Presence of Malware and Identifying the Type of Cyber Attack Using Deep Learning and VGG-16 Techniques." Electronics 11, no. 22 (November 9, 2022): 3665. http://dx.doi.org/10.3390/electronics11223665.

Повний текст джерела

Анотація:

Malware is malicious software (harmful program files) that targets and damage computers, devices, networks, and servers. Many types of malware exist, including worms, viruses, trojan horses, etc. With the increase in technology and devices every day, malware is significantly propagating more and more on a daily basis. The rapid growth in the number of devices and computers and the rise in technology is directly proportional to the number of malicious attacks—most of these attacks target organizations, customers, companies, etc. The main goal of these attacks is to steal critical data and passwords, blackmail, etc. The propagation of this malware may be performed through emails, infected files, connected peripherals such as flash drives and external disks, and malicious websites. Many types of research in artificial intelligence and machine learning fields have recently been released for malware detection. In this research work, we will focus on detecting malware using deep learning. We worked on a dataset that consisted of 8970 malware and 1000 non-malware (benign) executable files. The malware files were divided into five types in the dataset: Locker, Mediyes, Winwebsec, Zeroaccess, and Zbot. Those executable files were pre-processed and converted from raw data into images of size 224*224*3. This paper proposes a multi-stage architecture consisting of two modified VGG-19 models. The first model objective is to identify whether the input file is malicious or not, while the second model objective is to identify the type of malware if the file is detected as malware by the first model. The two models were trained on 80% of the data and tested on the remaining 20%. The first stage of the VGG-19 model achieved 99% accuracy on the testing set. The second stage using the VGG-19 model was responsible for detecting the type of malware (five different types in our dataset) and achieved an accuracy of 98.2% on the testing set.

Стилі APA, Harvard, Vancouver, ISO та ін.

22

Prinzi, Andrea, Donna Curtis, Sarah Parker, and Sonja Ziniel. "672. The Pediatric Endotracheal Aspirate Culture Survey (Petacs): Examining Practice Variation Across Pediatric Microbiology Laboratories in the United States." Open Forum Infectious Diseases 7, Supplement_1 (October 1, 2020): S391. http://dx.doi.org/10.1093/ofid/ofaa439.865.

Повний текст джерела

Анотація:

Abstract Background In the absence of evidence-based laboratory guidelines, the workup and interpretation of tracheal aspirate (TA) cultures remains controversial and confusing within the fields of clinical microbiology, infectious diseases, and critical care. Methods Between January 22 and February 24, 2020, we conducted a national, web-based survey of microbiology laboratory personnel in free-standing pediatric hospitals and adult hospitals containing pediatric facilities regarding the laboratory practices used for TA specimens. We hypothesized that there would be substantial center-level variability in laboratory processes of TA cultures. Results The response rate for the survey was 48%. There was a high level of variability in the criteria used for all processes including specimen receipt, Gram staining and culture reporting. Nearly a quarter of respondents (23%) reject TA specimens based on Gram stain criteria, and 56% of labs require that a minimum number of Gram stain fields be reviewed prior to reporting results. Overall, non-academic hospital laboratories and pediatric-only laboratories are more likely to identify, report and perform susceptibility testing on organisms from tracheal aspirate cultures, regardless of organism quantity or predominance. Conclusion There is a substantial amount of process variability among pediatric microbiology laboratories that affects TA culture reporting, which is used to make treatment decisions. This variation within and among labs makes clinical outcome studies related to TA cultures very difficult. Research is needed to determine best laboratory practices for TA culture workup and to provide evidence for the development of clinical guidelines. Disclosures All Authors: No reported disclosures

Стилі APA, Harvard, Vancouver, ISO та ін.

23

Kovtunenko, Lyubov’ V., Elena I. Meshcheryakova, and Yuliya G. Khlopovskikh. "Pedagogical Aspects Related to the Prevention of Professional Marginalism as a Dangerous Psychological Phenomenon in Educational Process at Departmental Universities." Penitentiary science 15, no. 3 (September 30, 2021): 684–90. http://dx.doi.org/10.46741/2686-9764-2021-15-3-684-690.

Повний текст джерела

Анотація:

Introduction: the article analyzes professional marginalism, which became increasingly widespread in recent years. Preventing marginalism becomes an urgent issue for representatives of various scientific fields: sociologists, psychologists, and teachers. At the same time, there is still an insufficient amount of studies on the problems associated with the prevention of professional marginalism as a dangerous psychological phenomenon, despite their high social, national and personal significance. The development of professional marginalism is especially dangerous among employees of law enforcement agencies: military personnel, law enforcement officers, correctional officers, etc. The relevance of this topic is due to the increase in the number of officers who show signs of professional marginalism. Aim: we review theoretical data and experience in studying the problem of professional marginalism as a dangerous psychological phenomenon so as to show possible ways of its prevention and correction in the course of educational process at departmental universities. Methods: theoretical (analysis, synthesis, comparison, systematization, generalization of psychological and pedagogical literature on the research problem, modeling), empirical (survey, testing, experiment), qualitative and quantitative data processing. Results: in the course of the research we have revealed that among the interviewed cadets of departmental educational organizations, including the Federal Penitentiary Service of Russia, the majority (69.0%) tend to show ambivalent feelings about the profession they are mastering; professional marginalism as the antipode of professional commitment is manifested in the majority of cadets (71.4%) at the median level. Only a fifth of the surveyed cadets showed a low level of professional marginalism. Conclusions: having analyzed the results of the assessment of the state and dynamics of the level of professional identity in cadets, we see that the achieved indicators should be increased in order to prevent professional marginalism. It can be achieved by developing and implementing a program to increase the level of formation of the professional identity in cadets. The program should include activities, forms and methods of their organization and implementation, aimed at preventing professional marginalism among law enforcement officers. An essential role in preventing the emergence and development of this psychological phenomenon belongs to educational (especially pedagogical) activities of lecturers in the course of training specialists in departmental universities.

Стилі APA, Harvard, Vancouver, ISO та ін.

24

Cherkasova, E. A., and V. V. Rzaeva. "Influence of the predecessor and the seeding rates on the rape productivity." IOP Conference Series: Earth and Environmental Science 839, no. 2 (September 1, 2021): 022037. http://dx.doi.org/10.1088/1755-1315/839/2/022037.

Повний текст джерела

Анотація:

Abstract The aim of the research is to identify the optimal seeding rate of varieties and hybrids of spring rape for seeds in the conditions of Northern Kazakhstan. The subject of the research is varieties and hybrids of spring rape. On the experimental fields of the Esil state grain-feed variety seed-trial ground, located in the Republic of Kazakhstan, North Kazakhstan region, the Esil district, the village of Yavlenka, in 2019-2020, a competitive test of spring rape was carried out, represented by 5 varieties: Geros, Maikudyk, Hunter, Makhaon and 3 hybrids: Caliber, Builder, GEN0009. The study of varieties and hybrids was carried out against the background of the predecessor - pure fallow, according to several seeding rates, namely 2.0, 2.5 and 3 million viable seeds. The main counts and observations were carried out according to the approved methodology of state variety testing. The studies carried out made it possible to establish that the seed productivity of rape plants is closely related to the meteorological conditions of the growing season and the studied variants of the experiment. Having studied the seeding rates, we came to the conclusion that the highest productivity is provided by rapeseed with a seeding rate of 2.0 million and 2.5 million viable seeds, and with an increase in the seeding rate, the yield decreases. Of the samples presented, over the years of testing, the variety Maikudyk and the hybrid Bilder distinguished themselves by a constant and full-fledged harvest for a number of selected characteristics.

Стилі APA, Harvard, Vancouver, ISO та ін.

25

Ahmad, Muhammad, Usman Sardar, Ildar Batyrshin, Muhammad Hasnain, Khan Sajid, and Grigori Sidorov. "Elegante: A Machine Learning-Based Threads Configuration Tool for SpMV Computations on Shared Memory Architecture." Information 15, no. 11 (November 1, 2024): 685. http://dx.doi.org/10.3390/info15110685.

Повний текст джерела

Анотація:

The sparse matrix–vector product (SpMV) is a fundamental computational kernel utilized in a diverse range of scientific and engineering applications. It is commonly used to solve linear and partial differential equations. The parallel computation of the SpMV product is a challenging task. Existing solutions often employ a fixed number of threads assignment to rows based on empirical formulas, leading to sub-optimal configurations and significant performance losses. Elegante, our proposed machine learning-powered tool, utilizes a data-driven approach to identify the optimal thread configuration for SpMV computations within a shared memory architecture. It accomplishes this by predicting the best thread configuration based on the unique sparsity pattern of each sparse matrix. Our approach involves training and testing using various base and ensemble machine learning algorithms such as decision tree, random forest, gradient boosting, logistic regression, and support vector machine. We rigorously experimented with a dataset of nearly 1000+ real-world matrices. These matrices originated from 46 distinct application domains, spanning fields like robotics, power networks, 2D/3D meshing, and computational fluid dynamics. Our proposed methodology achieved 62% of the highest achievable performance and is 7.33 times faster, demonstrating a significant disparity from the default OpenMP configuration policy and traditional practice methods of manually or randomly selecting the number of threads. This work is the first attempt where the structure of the matrix is used to predict the optimal thread configuration for the optimization of parallel SpMV computation in a shared memory environment.

Стилі APA, Harvard, Vancouver, ISO та ін.

26

Marín, María José. "Evaluation of five single-word term recognition methods on a legal English corpus." Corpora 9, no. 1 (May 2014): 83–107. http://dx.doi.org/10.3366/cor.2014.0052.

Повний текст джерела

Анотація:

Specialised texts are characterised by, amongst other features, the presence of terminology which conveys domain-specific concepts that are essential for the specialist who is interested in analysing such texts. Automatic Term Recognition methods (ATR) are employed to identify those terms automatically, which is especially helpful in view of the large size of corpora nowadays. However, they tend to concentrate on the identification of Multi-Word Terms (MWTs) neglecting Single-Word Terms (SWTs) to a certain extent. This might be related to the greater number of the former found in fields such as biomedicine. However, so far as legal English is concerned, testing has shown that SWTs represent 65.22 percent of the items in the specialised glossary employed for the evaluation of the ATR methods examined herein. This paper presents the evaluation of five SWT recognition methods, namely, those of Chung (2003) , Drouin (2003) , Kit and Liu (2008) , Keywords (2008), and TF-IDF (term frequency-inverse document frequency). These were tested on the United Kingdom Supreme Court Corpus (UKSCC), a legal corpus of 2.6 million words which was compiled for this purpose. The results indicate that Drouin's TermoStat software is the best performing method, achieving 73.45 percent precision on the top 2,000 candidate terms.

Стилі APA, Harvard, Vancouver, ISO та ін.

27

Kostyleva, Liliya Yu, Oleg V. Loginovskiy, Evgeniya A. Retc, and Igor M. Yachikov. "Possibilities of using mathematical models for thermal nondestructive testing of defects in multilayer bimetallic plates." Bulletin of the South Ural State University. Ser. Computer Technologies, Automatic Control & Radioelectronics 22, no. 1 (January 2022): 53–64. http://dx.doi.org/10.14529/ctcr220104.

Повний текст джерела

Анотація:

There is an actual task of delamination detection in multilayer bimetallic materials. Various methods of nondestructive testing (NDT) are used to solve it, including the method of transient thermal NDT. This method consists in remote registration, visualization and analysis of thermal (temperature) fields, which depend on thermophysical and geometric characteristics, thermal effect capacity and internal structure features of the object. The internal structure defects cause the appearance of abnormal temperature zones on the object surface. Their analysis allows us to judge the presence of changes in the material as a whole or in individual areas. It is possible to understand whether there is a defect under the anomalous site, and what its parameters are, if there is an adequate mathematical model that theoretically describes the dependence of the measuring results on the properties of the object and the selected technological modes. This model is a significant component of thermal NDT systems. For the same object or process, a certain set of mathematical models can be compiled, differing in the number of factors taken into account, the assumptions made, the completeness and accuracy of the description of the state of the object or the conditions of the process. The set of factors is determined by the purpose of the study, and in order to unambiguously determine the model of the thermal state, it is necessary to describe the characteristics of the object (geometric shape and thermophysical characteristics of the material) and the heat exchange process (characteristics of heat sources, initial and boundary conditions). Aim. To analyze the existing mathematical models for the research object – a multilayer bimetallic plate with delaminations between the outer and inner layers, and to identify common approaches to modeling the processes of thermal NDT of multilayer objects. Materials and methods. The structure of the mathematical model of the thermal state of the object is determined. An analytical review of mathematical models of thermal NDT of multilayer objects is performed. Results. The requirements, assumptions and limitations for a mathematical model of thermal NDT of a multilayer bimetallic plate with delamination defects are formulated. Conclusion. On the basis of the considered approaches to the mathematical modeling of the thermal state of multilayer objects with ideal layers contact and delamination defects, the necessary factors for the development of a model for the transient thermal NDT processes of the studied objects are determined.

Стилі APA, Harvard, Vancouver, ISO та ін.

28

Pulyaevsky, M. S., N. E. Vedernikov, A. T. Akhmadishin, and A. G. Vakhromeev. "ANALYSIS OF THE EFFECTIVENESS OF STIMULATION METHODS AT THE TRIZ FACILITY — PREOBRAZHENSK PETROLEUM PRODUCT HORIZON, EASTERN SIBERIA." Petroleum Engineering 21, no. 6 (December 29, 2023): 179–87. http://dx.doi.org/10.17122/ngdelo-2023-6-179-187.

Повний текст джерела

Анотація:

The history of prospecting and exploration of oil and gas fields within the Nepsko-Botuoba Anteklisa (NBA) and the eponymous oil and gas region (OGR) of the Leno-Tunguska Oil and Gas Province of the Siberian Platform dates back more than half a century. The base object of exploration for a long time remained the terrigenous deposits of the Venda reservoir. A number of large, medium and small hydrocarbon deposits are associated with them. The beginning of a systematic study of the northern regions of the Irkutsk region was the receipt of oil inflow from the Markov reference well in 1962. In 1971, the Yaraktinskoye gas condensate field was discovered north of Markovsky. In 1970, a parametric well was drilled within the Preobrazhensky uplift, which made it possible to identify a productive carbonate horizon (Zone B12), from which a gas inflow was obtained after hydrochloric acid treatment. Further continuation of the complex of geophysical studies east and south of Preobrazhenskaya Square made it possible to identify a number of positive structural forms. In the Chonsky zone, several local complications were identified — Chonsky, Molchalunsky and Verkhnechonsky structural noses, recommended for setting up area studies of MOU. The Preobrazhensky horizon (Zone B12) ranks second among the pay zones in terms of potential in-place reserves. It is the extremely low filtrationcapacitive properties of the natural reservoir and the harsh thermobaric conditions at the pressure of oil saturation with gas close to the initial reservoir pressure that is the basis for classifying these reserves as hard to recover (RHR).This article discusses the methodological features of drilling and completion of oil producing wells with a horizontal end of a long length, ascending inclined boreholes, multi-hole horizontal wells (MHW), conducting MHW, large-volume MKO and KGRP in the carbonate natural reservoir of the Preobrazhensky productive horizon (B12) of one of the fields of the Nepsky arch in the north of the Irkutsk region. The oil reserves of this tank are classified as difficult to recover (RHR). Research and search for new approaches to the development of the TRiZ facilities of the Preobrazhensky carbonate horizon in this field is today the most important task. The main results of the testing of the complex of geological and technological measures (GTM) are summarized, including a new effective technology for conducting multi-stage hydraulic fracturing, which is planned for use in the further full-scale development of the oil reservoir.

Стилі APA, Harvard, Vancouver, ISO та ін.

29

Thomas, Olubusola O., Rajagopal S. Raghavan, and Thomas N. Dixon. "Effect of Scaleup and Aggregation on the Use of Well Tests To Identify Geological Properties." SPE Reservoir Evaluation & Engineering 8, no. 03 (June 1, 2005): 248–54. http://dx.doi.org/10.2118/77452-pa.

Повний текст джерела

Анотація:

Summary This paper discusses specific issues encountered when pressure tests are analyzed in reservoirs with complex geological properties. These issues relate to questions concerning the methodology of scaleup, the degree of aggregation, and the reliability of conventional methods of analysis. The paper shows that if we desire to use pressure-transient analysis to determine more complex geological features such as connectivity and widths of channels, we need a model that incorporates reservoir heterogeneity. This complexity can lead to significantly more computational effort in the analysis of the pressure transient. The paper demonstrates that scaleup criteria, based on steady-state procedures, are inadequate to capture transient pressure responses. Furthermore, the number of layers needed to match the transient response may be significantly greater than the number of layers needed for a reservoir-simulation study. The use of models without a sufficient number of layers may lead to interpretations that are in significant error. The paper compares various vertical aggregation methods to coarsen the fine-grid model. The pressure-derivative curve is used as a measure of evaluating the adequacy of the scaleup procedure. Neither the use of permeability at a wellbore nor the average layer permeability as criteria for the aggregation was adequate to reduce the number of layers significantly. Introduction The objectives of this paper are to demonstrate the impact of the detailed and small-scale heterogeneities of a formation on the flow characteristics that are obtained from a pressure test and how those heterogeneities affect the analysis of the pressure test. The literature recognizes that special scaleup procedures are required in the vicinity of wells located in heterogeneous fields. Our work demonstrates that these procedures apply only to rather small changes in pressure over time and are usually inadequate to meet objectives for history-matching well tests. Using a fine-scale geological model derived by geological and geophysical techniques, this work systematically examines the interpretations obtained by various aggregation and scaleup techniques. We will demonstrate that unless care is taken, the consequences of too much aggregation may lead to significant errors on decisions concerning the value of a reservoir. Current scaleup techniques presume that spatial (location of boundaries, location of faults, etc.) variables are maintained. In analyzing a well test, however, one of our principal objectives is to determine the relationship between the well response and geometrical variables. We show that a limited amount of aggregation will preserve the spatial and petrophysical relationships we wish to determine. At this time, there appears to be no method available to determine the degree of scaleup a priori. Because the objective of well testing is to estimate reservoir properties, the scaleup process needs to be made a part of the history-matching procedure. By assuming a truth case, we show that too much vertical aggregation may lead to significant errors. Comparisons with traditional analyses based on analytical techniques are made. Whenever an analytical model is used in the analysis, unless otherwise stated, we use a single-layer-reservoir solution.

Стилі APA, Harvard, Vancouver, ISO та ін.

30

Phadke, Abhishek, F. Antonio Medrano, Chandra N. Sekharan, and Tianxing Chu. "Designing UAV Swarm Experiments: A Simulator Selection and Experiment Design Process." Sensors 23, no. 17 (August 23, 2023): 7359. http://dx.doi.org/10.3390/s23177359.

Повний текст джерела

Анотація:

The rapid advancement and increasing number of applications of Unmanned Aerial Vehicle (UAV) swarm systems have garnered significant attention in recent years. These systems offer a multitude of uses and demonstrate great potential in diverse fields, ranging from surveillance and reconnaissance to search and rescue operations. However, the deployment of UAV swarms in dynamic environments necessitates the development of robust experimental designs to ensure their reliability and effectiveness. This study describes the crucial requirement for comprehensive experimental design of UAV swarm systems before their deployment in real-world scenarios. To achieve this, we begin with a concise review of existing simulation platforms, assessing their suitability for various specific needs. Through this evaluation, we identify the most appropriate tools to facilitate one’s research objectives. Subsequently, we present an experimental design process tailored for validating the resilience and performance of UAV swarm systems for accomplishing the desired objectives. Furthermore, we explore strategies to simulate various scenarios and challenges that the swarm may encounter in dynamic environments, ensuring comprehensive testing and analysis. Complex multimodal experiments may require system designs that may not be completely satisfied by a single simulation platform; thus, interoperability between simulation platforms is also examined. Overall, this paper serves as a comprehensive guide for designing swarm experiments, enabling the advancement and optimization of UAV swarm systems through validation in simulated controlled environments.

Стилі APA, Harvard, Vancouver, ISO та ін.

31

Gazdecki, Michal. "Factors of business relationships change in agribusiness input distribution channel." IMP Journal 12, no. 3 (November 12, 2018): 567–82. http://dx.doi.org/10.1108/imp-01-2018-0011.

Повний текст джерела

Анотація:

Purpose The purpose of this paper is to identify factors of change in business relationships among companies operating in agribusiness input distribution channel. Design/methodology/approach This study, based on a qualitative approach applying network perspective, is focused on agri-markets for plant protection products. Primary data were collected via individual in-depth interviews with among managers of trade companies operating on agri-inputs products market. Findings Although relation between input producers and trade companies on agri-inputs market is affected by a large number of factors, representatives of trade companies seem to be focused on a limited number of them. In particular two factors need to be underlined as main ones: contract conditions and structural changes on the markets which manifest themselves mainly by consolidation of market entities. The function differentiation of the trade companies results not only in generated sales but also in a larger intensity of interactions with other market operators and in the necessity of creating new relationships. In the long term, it may generate the intensification of competitive structures that occur at the same level in a distribution channel. Research limitations/implications Generalization based on qualitative approach employed in this paper requires further testing and quantitative validation. Originality/value Even though agri-markets appear to be well-suited for studying network systems, such an approach has hardly ever been used. Interactions between different kinds of entities on agri-markets are incredibly strong and complex. The paper contributes to the two fields. First, it provides results related to the business relationship dynamics, especially factors that trigger relation change. Second, paper contributes to the agribusiness markets theory, especially from the structural point of view.

Стилі APA, Harvard, Vancouver, ISO та ін.

32

Baev, A. R., A. I. Мitkovets, M. V. Asadchaya, and A. L. Mayorov. "Impulsively-Laser Excitation and Propagation of Ultrasonic Waves through Nanomagnetic Fluid." Devices and Methods of Measurements 12, no. 3 (October 15, 2021): 211–19. http://dx.doi.org/10.21122/2220-9506-2021-12-3-211-219.

Повний текст джерела

Анотація:

Magnetic fluids belong to the class of nanomaterials with a high gain of light absorption, aggregative and sedimentation stability as well as controllability by external fields, which is of interest to use in the field of optoacoustics. The purpose of the work was to experimentally study the effect of the optoacoustic transformation in a magnetic fluid, depending on the concentration of magnetic colloidal particles, boundary conditions, intensity of the laser as well as to identify the possibilities of using the magnetic fluid as an element of the optoacoustic transformation in a number of applications.A brief analysis of the optoacoustic transformation mechanism in a magnetic fluid was carried out and a technique and an installation that implements the shadow measurement variant developed. A Lotis type laser was used as a source of ultrasonic pulse-laser excitation in magnetic fluids. A quartz and air were used as a material transmitting the energy of laser radiation in a magnetic fluid. Receiving of ultrasound signals was made by a piezoelectric probe at a working frequency of 5 MHz. In the measurement process, the concentration of the dispersed phase in tmagnetic fluid was varied from zero to 8 % and the energy in the impulse – from zero to 10 mJ.For the first time, it was established that: a) an amplitude of the function of the optoacoustic transformation in a magnetic fluid, depending on the concentration of the dispersed phase, has a maximum determined by the fluid physical properties and boundary conditions; b) for all samples within the measurement error, a quasilinear dependence of the specified amplitude of energy in the laser pulse in the range of 0–8 MJ has been established.A number ways of the optoacoustic effects in magnetic fluids to use in ultrasonic testing, measuring the intensity of the laser radiation had been suggested.

Стилі APA, Harvard, Vancouver, ISO та ін.

33

Tasrif, Arifin, Yuliar Yuliar, Dwiwanti Sulistyowati, Endang Krisnawati, Bayu Adirianto, and Dwi Sugiharti. "Potential Antagonists Trichoderma viride as Biofungicide, Plant Spacing, and Agricultural Lime Application to Suppress Anthracnose on Chili." Jurnal Perlindungan Tanaman Indonesia 28, no. 1 (July 19, 2024): 46. http://dx.doi.org/10.22146/jpti.87342.

Повний текст джерела

Анотація:

Anthracnose caused by Colletotrichum capsici and C. gloesporium on chili is a disease that can reduce chili yields up to 80%. Control with fungicide has not been able to provide maximum results, because Colletotrichum can spread due to splashing of water, especially in the rainy season. The use of antagonistic fungi against Colletotrichum spp. has been widely published but is still limited to the laboratory and greenhouse scale, while field conditions are unpredictable. This study aims to identify the potency of Trichoderma viride that can be used as a biofungicide to control anthracnose in chili and to determine aspects of agronomic that can reduce the risk of anthracnose in chili. Samples of infected plants of stems, leaves, and fruits were collected from experimental farm of Bogor Agricultural Development Polytechnic. The experiment was conducted using Randomized Complete Design and Randomized Complete Block Design. The percentage of disease intensity of the fungus C capsici and the intensity of anthracnose in chili both under screen house and open fields. While testing the effect of cultivation aspects using different types of fertilizer on plant height, fruit weight, number of fruits, and the percentage of disease intensity of Colletotrichum spp. were analyzed. The results of this study shown that four isolates of fungi have been identified such as Penicillium sp., Aspergillus flavus, T. viride, and C. capsici. In vitro analysis shown the ability of T. viride to suppress the growth of the C. capsici up to 71%. The fungus T. viride with a density of 7×106 CFU/mL can suppress the development of anthracnose by 59 to 87% under screen house conditions. However, under field conditions, the fungus T. viride was not able to suppress the development of anthracnose. Agronomic aspects such as plant height, number of fruits and production, and productivity of chili were not significantly effect on anthracnose.

Стилі APA, Harvard, Vancouver, ISO та ін.

34

Philipp, Robert, Andreas Mladenow, Christine Strauss, and Alexander Voelz. "Revealing Challenges within the Application of Machine Learning Services – A Delphi Study." Journal of Data Intelligence 2, no. 1 (March 2021): 1–29. http://dx.doi.org/10.26421/jdi2.1-1.

Повний текст джерела

Анотація:

Over the past years, Machine Learning has been applied to an increasing number of problems across numerous industries. However, the steady rise in the application of Machine Learning has not come without challenges since companies often lack the expertise or infrastructure to build their own Machine Learning systems. These challenges led to the emergence of a new paradigm, called Machine Learning as a Service. Scientific literature has mainly analyzed this topic in the context of platform solutions that provide ready-to-use environments for companies. We recently have developed a platform-independent approach and labeled it Machine Learning Services. The aim of the present study is to identify and evaluate challenges and opportunities in the application of Machine Learning Services. To do so, we conducted a Delphi Study with a panel of machine learning experts. The study consisted of three rounds and was structured according to the five steps of the Data Science Lifecycle. A variety of challenges from the areas “Communication”, “Environment”, “Approach”, “Data”, “Retraining, Testing, Monitoring and Updating”, “Model Training and Evaluation” were identified. Subsequently, the challenges revealed by the Delphi Study were compared with previous work on Machine Learning as a Service, which resulted from a structured literature review. The identified areas serve as possible future research fields and give further implications for practice. Alleviating communication issues and assessing the business IT infrastructure prior to the machine learning project are among the key findings of our study.

Стилі APA, Harvard, Vancouver, ISO та ін.

35

Wahyudi, Rizki, Muhammad Iqbal, and Lussy Dwi Oktaviana. "Recording dan Pencarian Silsilah Kambing Perah Menggunakan Algoritme Depth First Search." Jurnal Teknologi Informasi dan Ilmu Komputer 9, no. 1 (February 7, 2022): 1. http://dx.doi.org/10.25126/jtiik.2022913349.

Повний текст джерела

Анотація:

Perkembangan teknologi informasi telah merata hampir ke semua bidang, salah satunya bidang peternakan. Keuntungan teknologi informasi diantaranya dapat memberikan kemudahan dalam aktifitas. Perkumpulan Peternak Akar Rumput merupakan perkumpulan peternak yang melakukan kegiatan budidaya kambing secara intensif. Kegiatan budidaya kambing perah dilakukan dengan memuliabiakan kambing Saanen, serta melakukan kawin silang/cross breeding dengan kambing lokal. Jumlah total anggota Perkumpulan yang aktif sebanyak 186 Anggota dan jumlah total kambing yang dibudidaya per Desember 2018 adalah 2.214 ekor. Pencatatan data ternak dan pencatatan silsilah hewan ternak merupakan dasar dalam manajemen pemeliharaan ternak, dengan mengetahui catatan ternak dapat menentukan manajemen pemeliharaan yang tepat. Namun dalam aktifitasnya Perkumpulan Peternak Akar Rumput melakukan pencatatan secara manual pada sebuah buku, hal ini mengakibatkan sulitnya untuk mengetahui identitas, ciri khusus, kejadian penting ternak, riwayat penyakit dan silsilah ternak secara cepat. Tujuan penelitian ini adalah mempermudah proses pencatatan data ternak, pencarian silsilah data kambing perah dan pencetakan sertifikat. Pencatatan data ternak dan pencarian silsilah data kambing perah juga dapat dijadikan acuan dalam penentuan ternak unggul. Untuk menyelesaikan permasalahan yang ada maka dibangun sistem Recording untuk pencatatan data ternak berbasis website dan untuk pencarian silsilah akan menggunakan Algoritme Depth first search. Agar penelitian yang dilakukan dapat terarah maka penelitian ini menggunakan metode waterfall dengan tahapan requirement analysis, design, implementation, testing, dan maintenance. Metode waterfall memiliki kelebihan Setiap proses memiliki spesifikasinya sendiri, sehingga sebuah sistem dapat dikembangkan sesuai dengan apa yang dikehendaki. Hasil pengujian black-box sistem recording dan pencarian silsilah data kambing menunjukkan fungsional sistem berjalan sesuai harapan. Sementara pengujian acceptance testing yang bertujuan untuk mendapatkan feedback dari pengguna menggunakan kuesioner dengan jumlah sampel 65 orang responden dari anggota peternak akar rumput, didapatkan prosentase sebesar 95,38 % menyatakan bahwa sistem recording dan pencarian silsilah berfungsi sesuai yang diharapkan, ini tergolong dalam kriteria sangat baik, sehingga dapat disimpulkan bahwa sistem sudah layak diterapkan. Abstract The development of information technology has been evenly distributed to almost all fields, one of which is the field of livestock. The advantages of information technology can provide ease of activity. Perkumpulan Peternak Akar Rumput is a farmer's association that conducts intensive goat cultivation activities. The cultivation of dairy goats is carried out by breeding Saanen goats, as well as cross breeding with local goats. The total number of active members of the Association is 186 Members and the total number of goats cultivated as of December 2018 is 2,214. Livestock data recording and pedigree recording of farm animals are the basis in livestock maintenance management, knowing that livestock records can determine proper maintenance management. But in his activities, Perkumpulan Peternak Akar Rumput was manually recorded in a book, and this made it difficult to know the identity, special features, important events of livestock, disease history and genealogy of livestock quickly. The purpose of this research is to facilitate the process of recording livestock data, genealogy search of dairy goat data and printing certificates. The recording of livestock data and the search for the genealogy of dairy goat data can also be used as a reference in the determination of superior livestock. To solve the problem, a Recording system is built for website-based livestock data logging and for genealogical search will use the Depth first search algorithm. In order for the research to be directed, this research uses waterfall method with stage requirement analysis, design, implementation, testing, and maintenance. Waterfall method has its own advantages Each process has its own specifications, so that a system can be developed according to what is desired. The results of black-box recording system testing and pedigree search of goat data show the functional system went as expected. While acceptance testing testing, which aims to get feedback from users using questionnaires with a sample of 65 respondents from grassroots farmers, obtained a percentage of 95.38% stated that the genealogy recording and search system functioned as expected, this is classified in the criteria very well, so it can be concluded that the system is worth applying.

Стилі APA, Harvard, Vancouver, ISO та ін.

36

Pope, Barbara L. "Immunopharmacology: A new frontier." Canadian Journal of Physiology and Pharmacology 67, no. 6 (June 1, 1989): 537–45. http://dx.doi.org/10.1139/y89-087.

Повний текст джерела

Анотація:

Immunopharmacology is a hybrid science which has been founded upon the principles, theory, and technical developments of both immunology and pharmacology, but which has a unique identity incorporating both basic and applied areas of research. Basic immunopharmacological research is concerned with the underlying mechanisms by which endogenous and synthetic chemicals interact with the cells of the immune system. Important areas of research include the actions of chemicals such as lymphokines, cytokines, complement, kinins, autacoids, drugs, and even neuropeptides on immune function. Applied immunopharmacology is concerned with the development and testing of new immunomodulatory drugs which will be of benefit to clinical medicine but also as basic research tools. In the past, the two fields of immunology and pharmacology have contributed to each other in many significant ways. Immunology has contributed to pharmacological research by the development of antibodies which are frequently used today as specific probes for the quantitative and qualitative analysis of many different classes of chemicals of interest. Pharmacology has contributed to the field of immunology by providing basic pharmacological information on subjects such as the mediators of hypersensitivity reactions and inflammation. In the future, the truly hybrid field of immunopharmacology promises to have an expanding role in clinical medicine and basic research. This prediction is based on the observation that recombinant lymphokines and newly discovered immunomodulatory substances have begun to enter the clinic in ever increasing numbers. Future immunopharmacological research will include the study of the pharmacology of these lymphokines but also the rational development of new drugs that act as antagonists or agonists for the endogenous lymphokines that normally regulate the immune response. These studies will require scientists well versed in the fundamentals of both pharmacology and immunology. Our universities must be prepared to play their role in educating these individuals.Key words: immunopharmacology, immunomodulators.

Стилі APA, Harvard, Vancouver, ISO та ін.

37

Zielińska, Monika A., Agata Białecka, Barbara Pietruszka, and Jadwiga Hamułka. "Vegetables and fruit, as a source of bioactive substances, and impact on memory and cognitive function of elderly." Postępy Higieny i Medycyny Doświadczalnej 71, no. 1 (April 12, 2017): 0. http://dx.doi.org/10.5604/01.3001.0010.3812.

Повний текст джерела

Анотація:

The phenomenon of population aging is not only associated with an increase in the number and proportion of older people in society, but also with an increase in the incidence of cognitive impairment. This can impair the functioning of the elderly in everyday life, work and social life participation and impair their quality of life. Hence, it is important to identify the protective factors. Neurodegenerative changes are closely linked to inflammatory processes and oxidative stress. Diet is of great importance, with particular attention being paid to the adequate intake of fruits and vegetables, due to their proven health benefits. This may be correlated to the protective effect of the bioactive substances that are present in fruits and vegetables, in particular flavonoids and carotenoids. The elderly who consume 5 servings a day of fruits and vegetables have a higher antioxidant capacity of blood serum, while the risk of chronic diseases, including neurodegenerative and mortality rates are lower. The analysis included the results of 16 published epidemiological studies, including people aged 65+. Their results are discussed in 4 fields of the effects on cognitive function (1) fruit and vegetable intake; (2) flavonoids intake; (3) carotenoid nutritional status; (4) mechanism of action of plant bioactive substances. It has been found that the positive effects of consumption of fruits and vegetables may be associated with cognitive functions in the three possible areas, ie.: (1) improvement in cognitive testing; (2) delaying or preventing age-related deterioration of cognitive decline; (3) reducing the risk of neurodegenerative diseases.

Стилі APA, Harvard, Vancouver, ISO та ін.

38

Silvestre, R., M. Untiveros, and W. J. Cuellar. "First Report of Potato yellowing virus (Genus Ilarvirus) in Solanum phureja from Ecuador." Plant Disease 95, no. 3 (March 2011): 355. http://dx.doi.org/10.1094/pdis-09-10-0624.

Повний текст джерела

Анотація:

A bacilliform virus, named Potato yellowing virus (PYV), causing chlorosis of leaves was reported in 1992 in potato (Solanum tuberosum) fields in Peru (1) and symptomless wild potatoes (S. fernandezianum) in Chile (4). PYV is reported as an alfamo-like virus (1) (family Bromoviridae) but no sequence information is available for this virus, making its taxonomic position inside the Bromoviridae uncertain (currently this family is organized into five genera: Alfamovirus, Bromovirus, Cucumovirus, Ilarvirus, and Oleavirus). Herein we report the presence of PYV in native potatoes (Solanum phureja) collected from Ecuador where the crop constitutes an important source of income in rural communities. Forty accessions of S. phureja collected in Ecuador in June 1986 and maintained in vitro at the International Potato Center (CIP) germplasm bank were analyzed by double-antibody sandwich (DAS)-ELISA with antiserum raised against a Peruvian isolate of PYV (1). PYV was detected in six accessions (15% of the material) corresponding to cultivars Chaucha Tomate and Chaucha Blanca (from the province of Cañar), Chaucha Negra Ojona and Chaucha Amarilla (Loja Province), and Cuica and Chaucha (Azuay Province). Mechanical inoculation of the indicator plant Physalis floridiana with leaf extracts of these six plants, a PYV isolate from Peru (1) (positive control), and an additional four plants testing negative for PYV (negative controls) induced symptoms of mosaic and leaf deformation only with the six clones from Ecuador and the PYV isolate from Peru. To further confirm the presence of the virus, we used universal PCR primers designed for the Bromoviridae (Ilar1F5: 5′-GCNGGWTGYGGDAARWCNAC-3′ and Ilar1R7: 5′-AMDGGWAYYTGYTYNGTRTCACC-3′) that target the helicase motif (RNA1) (3). Total RNA was extracted from 200 mg of leaf material (from potato and mechanically inoculated P. floridiana) using Trizol (Invitrogen, Carlsbad, CA) following the manufacturer's instructions and cDNA was synthesized using random hexamer primers. We obtained a reverse transcription-PCR amplified band only from samples that were DAS-ELISA positive to PYV. To identify the virus at the genus level, we cloned the PCR fragments (265 nucleotides) from four of the samples from Ecuador and the Peruvian isolate into plasmid vectors (pGEM-T Easy Vector cloning system; Promega, Madison, WI) for Sanger sequencing (Macrogen, Seoul, Korea). Phylogenetic analysis grouped PYV sequences with those of the genus Ilarvirus. Among the ilarviruses, Fragaria chiloensis latent virus (2) was the closest relative of PYV, with which it shares 77% nucleotide and 85% amino acid sequence identity. PYV isolates from Ecuador split into two different variants (91% identity) that shared 93% nucleotide and 99% amino acid sequence identity with the Peruvian isolate. Collectively, the data suggest that PYV is a distinct ilarvirus and that it is more widely spread among South American potatoes than previously suggested. The GenBank Accession Numbers for the sequences described are: HQ141053 (Loja1), HQ141054 (Azuay), HQ141055 (Cañar), and HQ141056 (Loja2) for the isolates from Ecuador and HQ141057 (PYV-Cañete) for the isolate from Peru. References: (1) S. Fuentes and U. Jayasinghe. Fitopatología 28:22, 1993. (2) I. E. Tzanetakis and R. R. Martin. Virus Res. 112:32, 2005. (3) M. Untiveros et al. J. Virol. Methods 165:97, 2010. (4) J. P. T. Valkonen et al. Potato Res. 35:411, 1992.

Стилі APA, Harvard, Vancouver, ISO та ін.

39

Xicola, Rosa Munoz, Vinit Singh, Thomas Rafter, Jing Liu, Quiana Brown, Nitu Kashyap, and Xavier Llor. "Abstract A138: Decreasing disparities in inherited cancer syndrome identification through a systems approach, The At-Risk Cancer Genetic Syndrome Identification (ARCAGEN-ID) system." Cancer Epidemiology, Biomarkers & Prevention 33, no. 9_Supplement (September 21, 2024): A138. http://dx.doi.org/10.1158/1538-7755.disp24-a138.

Повний текст джерела

Анотація:

Abstract Three percent of cancers are due to inherited cancer-predisposing syndromes, the most common ones being Hereditary Breast and Ovarian cancer syndrome and Lynch syndrome. Surveillance and preventive measures among diagnosed individuals lead to early detection, prevention of future cancers, and appropriate treatment modalities ultimately resulting in lower cancer mortality. Thus, identifying these individuals through genetic testing is of most importance. While guidelines have been drafted to identify people who need to be ruled out based on personal and family history of cancer, less than 30% of qualifying individuals are currently tested and these numbers are much worse among underserved communities. Lack of awareness, largely due to guideline complexity, has been documented as a critical factor for the low testing rates while clinician’s unconscious bias contributes to disparities. The objective of this project was to increase the identification of individuals at risk, especially among the underserved groups. We hypothesized that this could be accomplished by establishing a mechanism of automatic identification of candidates leveraging the electronic health records (EHR), the ARCAGEN-ID (At-Risk Cancer Genetic Syndrome Identification) system. Methods: An inclusion logic was designed based on 218 rules that evaluate personal and family history of specific cancers and age at diagnosis, relevant to NCCN/ACMG guidelines for genetic testing. Structured data was pulled from discrete fields in the EHR. External data was accessed by enabling the standard interoperability exchange of information system. The system was applied to the wellness registry, a cohort of 1,357,337 patients with an active EHR in our healthcare system. Results: The ARCAGEN-ID system identified 57,628 individuals at-risk (4.25%). Of those, 45,646 (79.2%) had no evidence of prior genetic test, cancer genetics evaluation, or referral. A manual chart review of 559 cases showed an identification accuracy rate of 96.2%. The ARCAGEN-ID identified a lower proportion of self-reported African Americans, Hispanics and Medicaid insured patients than the overall wellness registry (likely reflecting less complete relevant information in the EHR). However, patients in those categories were significantly overrepresented among the ones who were not previously referred for genetic testing. Thus, ARCAGEN-ID significantly increased the identification of individuals from minority groups by 12.7 to 23% in each category. Regarding criteria for inclusion, individuals identified only through ARCAGEN-ID were more likely identified because of family history of cancer only, representing 80.69%. In conclusion, a fully automated system that leverages the EHR was able to multiply by 5 the number of individuals who need to be ruled out for an inherited cancer syndrome while addressing the bias against underserved communities seen under current routine care. Citation Format: Rosa Munoz Xicola, Vinit Singh, Thomas Rafter, Jing Liu, Quiana Brown, Nitu Kashyap, Xavier Llor. Decreasing disparities in inherited cancer syndrome identification through a systems approach, The At-Risk Cancer Genetic Syndrome Identification (ARCAGEN-ID) system [abstract]. In: Proceedings of the 17th AACR Conference on the Science of Cancer Health Disparities in Racial/Ethnic Minorities and the Medically Underserved; 2024 Sep 21-24; Los Angeles, CA. Philadelphia (PA): AACR; Cancer Epidemiol Biomarkers Prev 2024;33(9 Suppl):Abstract nr A138.

Стилі APA, Harvard, Vancouver, ISO та ін.

40

PRIYA, K., and Dr P. JAGADEESAN. "EFFECTS OF SOCIAL MEDIA MARKETING ON SUBSEQUENT FMCG PERFORMANCE." International Journal of Scientific Research in Modern Science and Technology 2, no. 8 (August 31, 2023): 63–75. http://dx.doi.org/10.59828/ijsrmst.v2i8.137.

Повний текст джерела

Анотація:

Aim of the study: This study help the FMCG businesses to performance and identify their role in social media marketing. Design/ Methodology: A one sample t-test is utilized for analysis used for hypothesis testing and anova is used to examine the respondent’s educational background and performance in the Fmcg business performance. Findings: The finding of the study to the proper effectiveness of social media marketing (SMM) and customer’s happiness with FMCG items. The creative use of a variety of social media platforms for marketing their goods and business performance. Additionally, it was established the consumers are satisfied they buy FMCG products through a platform like social media marketing. In imperative to be competitive, businesses must keep up with rapidly evolving technology and possess the marketing acumen necessary to effectively promote their goods and services. The growing number of automated gadgets found in every home is helpful for social media marketing purposes. the customers may carefully compare the company's quality and pricing, can replace their products with roughly better alternatives, and can share their personal experiences with other customers, leading to the delivery of higher quality goods and services. Practical Implications: In imperative to be competitive businesses must keep up with rapidly evolving technology and possess the marketing acumen necessary to effectively promote their goods and services. The growing number of automated gadgets found in every home is helpful for social media marketing purpose. The customers may carefully compare the business quality and pricing can replace their product with roughly better alternatives and can share their personal experiences with other customer leading to the delivery of higher quality of goods and services. Originality/ Value: According to a survey of the literature, social media marketing in various fields is the focus of the majority of studies. However, no research has been done on the effectiveness of social media marketing for the FMCG industry.

Стилі APA, Harvard, Vancouver, ISO та ін.

41

Wiśniewski, Bernard. "On the need of reaching the origins of security – an introduction to the discussion." Internal Security Special Issue (June 4, 2019): 105–18. http://dx.doi.org/10.5604/01.3001.0013.2182.

Повний текст джерела

Анотація:

This article presents basic issues concerning security research in the past, called reaching the origins of security. Reaching the origins is not a concept that finds its rightful place in security research. It has been used and thus fixed permanently in other areas, therefore, the issues discussed in this article concern problems from many fields of knowledge. Security testing covers a number of processes, including retrospective ones, the essence of which is a scientific look into the past. Reaching the origins, all in all, makes it possible to identify the sources of danger and the requirements to be met for safety to reach an acceptable level. It allows, on the one hand, to prevent the recurrence of these sources and, on the other hand, to apply the solutions of the past to today's and tomorrow's security efforts. It can also be said that reaching the origins of safety is connected with determining the methods of eliminating and minimizing threats, and thus indicating the procedures providing an appropraite level of security. It's a utilitarian effect. In the cognitive context, it should be emphasized that the results of reaching the origins may serve to enrich the contemporary knowledge in the field of security. In both cases the procedures of avoiding mistakes made in the past are going to be worked out, especially that their sources are usually human mistakes having their origins in the lack of knowledge of past times. The considerations presented in the article allowed to determine the meaning of reaching the origins, its types and mutual relations between it and the diagnosis, monitoring and forecasting of security. In conclusion, the presented deliberations are summarized.

Стилі APA, Harvard, Vancouver, ISO та ін.

42

Khan, Nizamuddin, Ajay Singh, and Rajeev Agrawal. "Enhancing Feature Extraction Technique Through Spatial Deep Learning Model for Facial Emotion Detection." Annals of Emerging Technologies in Computing 7, no. 2 (April 1, 2023): 9–22. http://dx.doi.org/10.33166/aetic.2023.02.002.

Повний текст джерела

Анотація:

Automatic facial expression analysis is a fascinating and difficult subject that has implications in a wide range of fields, including human–computer interaction and data-driven approaches. Based on face traits, a variety of techniques are employed to identify emotions. This article examines various recent explorations into automatic data-driven approaches and handcrafted approaches for recognising face emotions. These approaches offer computationally complex solutions that provide good accuracy when training and testing are conducted on the same datasets, but they perform less well on the most difficult realistic dataset, FER-2013. The article's goal is to present a robust model with lower computational complexity that can predict emotion classes more accurately than current methods and aid society in finding a realistic, all-encompassing solution for the facial expression system. A crucial step in good facial expression identification is extracting appropriate features from the face images. In this paper, we examine how well-known deep learning techniques perform when it comes to facial expression recognition and propose a convolutional neural network-based enhanced version of a spatial deep learning model for the most relevant feature extraction with less computational complexity. That gives a significant improvement on the most challenging dataset, FER-2013, which has the problems of occlusions, scale, and illumination variations, resulting in the best feature extraction and classification and maximizing the accuracy, i.e., 74.92%. It also maximizes the correct prediction of emotions at 99.47%, and 98.5% for a large number of samples on the CK+ and FERG datasets, respectively. It is capable of focusing on the major features of the face and achieving greater accuracy over previous fashions.

Стилі APA, Harvard, Vancouver, ISO та ін.

43

Diwan, Sinan, and Abdul Syukor Mohamad. "Machine Learning Empowered Software Prediction System." Wasit Journal of Computer and Mathematics Science 1, no. 3 (October 1, 2022): 54–64. http://dx.doi.org/10.31185/wjcm.61.

Повний текст джерела

Анотація:

Prediction of software defects is one of the most active study fields in software engineering today. Using a defect prediction model, a list of code prone to defects may be compiled. Using a defect prediction model, software may be made more reliable by identifying and discovering faults before or during the software enhancement process. Defect prediction will play an increasingly important role in the design process as the scope of software projects grows. Bugs or the number of bugs used to measure the performance of a defect prediction procedure are referred to as "bugs" in this context. Defect prediction models can incorporate a wide range of metrics, including source code and process measurements. Defects are determined using a variety of models. Using machine learning, the defect prediction model may be developed. Machine inclining in the second and third levels is dependent on the preparation and assessment of data (to break down model execution). Defect prediction models typically use 90 percent preparation information and 10 percent testing information. Improve prediction performance with the use of dynamic/semi-directed taking in, a machine learning approach. So that the results and conclusion may be sharply defined under many circumstances and factors, it is possible to establish a recreated domain to house the entire method. Computer-aided engineering (CAE) is being used to identify software defects in the context of neural networks. Neural network-based software fault prediction is compared to fuzzy logic fundamental results in this research paper. On numerous parameters, neural network training provides better and more effective outcomes, according to the recommended findings and outputs.

Стилі APA, Harvard, Vancouver, ISO та ін.

44

Buchmann, Johannes, and H. C. Williams. "On principal ideal testing in algebraic number fields." Journal of Symbolic Computation 4, no. 1 (August 1987): 11–19. http://dx.doi.org/10.1016/s0747-7171(87)80049-4.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

45

Goto, Yusuke, Gakuji Yaegashi, Kazuhiro Fukunari, and Tohru Suzuki. "An Importance of Long-Term Clinical Analysis to Accurately Diagnose Calves Persistently and Acutely Infected by Bovine Viral Diarrhea Virus 2." Viruses 13, no. 12 (December 3, 2021): 2431. http://dx.doi.org/10.3390/v13122431.

Повний текст джерела

Анотація:

Bovine viral diarrhea virus (BVDV) infection results in a wide variety of clinical manifestations and is a pathogen that is able to cause huge economic losses in the cattle industry worldwide. It is important to identify cattle that are persistently infected (PI) by BVDV within the herd as early as possible because PI animals are the main reservoir of the virus. In contrast, cattle who are acutely infected (AI) with BVDV show various clinical signs, but most cattle show either mild symptoms or are asymptomatic. In general, AI and PI animals can be distinguished by repeat testing within an interval of at least 21 days. However, we found a rare case of a BVDV2-infected AI animal with long-term viral presence, making it indistinguishable from PI through two tests within an interval of 21 days. As a result, we diagnosed one infected animal as AI after 35 days from the initial sample collection via multiple analyses. Our findings recommend performing an additional test using samples that have been collected after 14–21 days from the second sample collection in cases where it is difficult to accurately differentiate an AI diagnosis from a PI diagnosis after only two tests. Additionally, our analysis exhibits that monitoring the number of copies of viruses with similar genomes in the sera by means of quantitative real-time RT-PCR through several sample collections periods might be useful to distinguish AI from PI. Furthermore, our data suggest that the AI animals with a long-term viral presence who show test results similar to those of PI animals might be the result of a coincidental combination of various factors that are present in cattle fields. These findings provide useful information that can be used to improve the diagnosis of BVDV in the field.

Стилі APA, Harvard, Vancouver, ISO та ін.

46

Tăucean, Ilie, Matei Tămășilă, Larisa Ivascu, Șerban Miclea, and Mircea Negruț. "Integrating Sustainability and Lean: SLIM Method and Enterprise Game Proposed." Sustainability 11, no. 7 (April 9, 2019): 2103. http://dx.doi.org/10.3390/su11072103.

Повний текст джерела

Анотація:

Sustainability and leanness are organizational approach concepts for more efficient activities and increased competitiveness. This paper presents a study and an application of the concepts of sustainability and lean, with the purpose to capitalize on the benefits of the two concepts’ tools when used together in an industry and education activity. A literature review was carried out to evaluate qualitatively and empirically the concepts of sustainability, lean, and enterprise games, and the possibility to integrate the first two concepts into a new tool applied into an enterprise game. An online survey was done to identify which tools are used within companies in the region, how and what training methods they used, and what the reported benefits are. The survey results were used to design a new tool integrated in a new enterprise game (SLIM) developed by the authors. The game was tested and validated in educational laboratory with students and actual employees from companies. The game follows the frame of an enterprise game, considering the simulation of enterprise classical functions. The game’s purpose is to improve the activity in successive rounds. A scorecard is used to fill in and compute the key performance indicators (KPIs), and a new indicator is proposed (SLIMx). Applications of the instrument/game include: students’ training in an educational laboratory; lifelong learning; professional training in companies; and professional perfection/reconversion of potential employees and the unemployed. The SLIM game was simulated in a team of 15 players over three rounds, with teachers playing the role of the supervisor. A number of possible improvements have been identified. The next step is testing it in enterprises with various fields of activity. SLIM has proven to be an effective solution to improve organizational efficiency and motivate players to gain new knowledge.

Стилі APA, Harvard, Vancouver, ISO та ін.

47

Ivanyos, Gábor, Marek Karpinski, Miklos Santha, Nitin Saxena, and Igor E. Shparlinski. "Polynomial Interpolation and Identity Testing from High Powers Over Finite Fields." Algorithmica 80, no. 2 (January 5, 2017): 560–75. http://dx.doi.org/10.1007/s00453-016-0273-1.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

48

Rossmann, Tobias. "Primitivity testing of finite nilpotent linear groups." LMS Journal of Computation and Mathematics 14 (March 1, 2011): 87–98. http://dx.doi.org/10.1112/s1461157010000227.

Повний текст джерела

Анотація:

AbstractWe describe a practical algorithm for primitivity testing of finite nilpotent linear groups over various fields of characteristic zero, including number fields and rational function fields over number fields. For an imprimitive group, a system of imprimitivity can be constructed. An implementation of the algorithm in Magma is publicly available.

Стилі APA, Harvard, Vancouver, ISO та ін.

49

Miller, David, and Sundas Ali. "Testing the national identity argument." European Political Science Review 6, no. 2 (June 17, 2013): 237–59. http://dx.doi.org/10.1017/s1755773913000088.

Повний текст джерела

Анотація:

The national identity argument holds that a shared national identity is necessary to motivate citizens in democratic societies to pursue a number of goals, especially social justice. We review the empirical evidence for and against this claim, looking particularly at how national identities have been measured. We distinguish between studies that aim to compare the relative strength of identities cross-nationally and those that look at individual differences within one nation. We separate four dimensions of national identity: national attachment, national pride, critical vs. uncritical patriotism, and civic vs. cultural conceptions of identity. These are only weakly correlated with each other, and impact differently on support for social justice and the welfare state. Using case studies from the United States, Canada, and the United Kingdom, we suggest that the relationship between national identity and social justice varies between societies, and that a key factor is finding an appropriate balance between the strength of such identities and their inclusiveness.

Стилі APA, Harvard, Vancouver, ISO та ін.

50

Aguilar, E., V. G. Sengoda, B. Bextine, K. F. McCue, and J. E. Munyaneza. "First Report of “Candidatus Liberibacter solanacearum” on Tobacco in Honduras." Plant Disease 97, no. 10 (October 2013): 1376. http://dx.doi.org/10.1094/pdis-04-13-0453-pdn.

Повний текст джерела

Анотація:

In April of 2012, tobacco (Nicotiana tabacum L.) plants with symptoms resembling those associated with viral infection were observed in commercial fields in the Department of El-Paraíso, Honduras. Symptoms on affected plants included apical leaf curling and stunting, overall chlorosis and plant stunting, young plant deformation with cabbage-like leaves, wilting, and internal vascular necrosis of stems and leaf petioles. All cultivars grown were affected, with disease incidence ranging from 5 to 80% of symptomatic plants per field. The fields were also heavily infested with the psyllid Bactericera cockerelli. This psyllid is a serious pest of solanaceous crops in the United States, Mexico, Central America, and New Zealand and has been shown to transmit the bacterium “Candidatus Liberibacter solanacearum” to potato, tomato, and other solanaceous species (2,3). Tobacco (cv. Habano criollo) plant samples were collected from one field in the municipality of Trojes. Initial testing of the plant samples for viruses, including Tobacco mosaic virus, Impatiens necrotic spot virus, Cucumber mosaic virus, and Potato virus Y, using Immunostrips (Agdia, Elkhart, IN) were negative. Total DNA was then extracted from leaf tissues of a total of 13 plants, including eight symptomatic plants and five asymptomatic plants with the cetyltrimethylammonium bromide (CTAB) buffer extraction method (2,4). The DNA samples were tested by PCR using specific PCR primer pairs OA2/OI2c and OMB 1482f/2086r, to amplify a portion of 16S rDNA and the outer membrane protein (OMB) gene of “Ca. L. solanacearum,” respectively (2). All eight (100%) symptomatic plant samples were positive for “Ca. L. solanacearum” with both sets of primer pairs. “Ca. L. solanacearum” was not detected in the asymptomatic plants. The 16S rDNA and OMB gene amplicons of two plant samples each were cloned and four clones of each of the four amplicons were sequenced. BLASTn analysis of the consensus sequences confirmed “Ca. L. solanaeacrum” in the tobacco samples. The 16S rDNA consensus sequences (1,168 bp) of all amplicons were identical and showed 100% identity with several 16S rDNA sequences of “Ca. L. solanacearum” in GenBank (e.g., Accession Nos. HM245242, JF811596, and JX559779). The consensus sequence of the OMB amplicon (605 bp) showed 97 to 100% homology with a number of “Ca. L. solanacearum” OMB sequences in GenBank, including Accession Nos. CP002371, FJ914617, JN848754 and JN848752. The tobacco-associated consensus 16S rDNA and OMB sequences from this study were deposited in GenBank as Accession Nos. KC768320 and KC768328, respectively. To our knowledge, this is the first report of “Ca. L. solanacearum” associated with tobacco in Honduras, where this cash crop is economically important. This bacterium has also caused millions of dollars in losses to potato, tomato, and several other solanaceous crops in North and Central America and New Zealand, particularly in regions where B. cockerelli is present (3). Furthermore, “Ca. L. solanacearum” has caused significant economic damage to carrot crops in Europe, where it is transmitted by the psyllids Trioza apicalis in northern Europe (4) and B. trigonica in the Mediterranean region (1). References: (1) A. Alfaro-Fernandez et al. Plant Dis. 96:581, 2012. (2) J. M. Crosslin. Southwest. Entomol. 36:125, 2011. (3) J. E. Munyaneza. Am. J. Pot. Res. 89:329, 2012. (4) J. E. Munyaneza et al. J. Econ. Entomol. 103:1060, 2010.

Стилі APA, Harvard, Vancouver, ISO та ін.

Статті в журналах з теми "Identity Testing in Number Fields"

Оформте джерело за APA, MLA, Chicago, Harvard та іншими стилями