Статті в журналах: "Haemochromatosis, iron, genetics"

1

Cox, Timothy. "Haemochromatosis: Strike while the iron is hot." Nature Genetics 13, no. 4 (August 1996): 386–88. http://dx.doi.org/10.1038/ng0896-386.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

2

Demetz, Egon, Piotr Tymoszuk, Richard Hilbe, Chiara Volani, David Haschka, Christiane Heim, Kristina Auer, et al. "The haemochromatosis gene Hfe and Kupffer cells control LDL cholesterol homeostasis and impact on atherosclerosis development." European Heart Journal 41, no. 40 (March 30, 2020): 3949–59. http://dx.doi.org/10.1093/eurheartj/ehaa140.

Повний текст джерела

Анотація:

Abstract Aims Imbalances of iron metabolism have been linked to the development of atherosclerosis. However, subjects with hereditary haemochromatosis have a lower prevalence of cardiovascular disease. The aim of our study was to understand the underlying mechanisms by combining data from genome-wide association study analyses in humans, CRISPR/Cas9 genome editing, and loss-of-function studies in mice. Methods and results Our analysis of the Global Lipids Genetics Consortium (GLGC) dataset revealed that single nucleotide polymorphisms (SNPs) in the haemochromatosis gene HFE associate with reduced low-density lipoprotein cholesterol (LDL-C) in human plasma. The LDL-C lowering effect could be phenocopied in dyslipidaemic ApoE−/− mice lacking Hfe, which translated into reduced atherosclerosis burden. Mechanistically, we identified HFE as a negative regulator of LDL receptor expression in hepatocytes. Moreover, we uncovered liver-resident Kupffer cells (KCs) as central players in cholesterol homeostasis as they were found to acquire and transfer LDL-derived cholesterol to hepatocytes in an Abca1-dependent fashion, which is controlled by iron availability. Conclusion Our results disentangle novel regulatory interactions between iron metabolism, KC biology and cholesterol homeostasis which are promising targets for treating dyslipidaemia but also provide a mechanistic explanation for reduced cardiovascular morbidity in subjects with haemochromatosis.

Стилі APA, Harvard, Vancouver, ISO та ін.

3

Lv, Tingxia, Wei Zhang, Anjian Xu, Yanmeng Li, Donghu Zhou, Bei Zhang, Xiaojin Li, et al. "Non-HFE mutations in haemochromatosis in China: combination of heterozygous mutations involving HJV signal peptide variants." Journal of Medical Genetics 55, no. 10 (August 30, 2018): 650–60. http://dx.doi.org/10.1136/jmedgenet-2018-105348.

Повний текст джерела

Анотація:

IntroductionHereditary haemochromatosis (HH) caused by a homozygous p.C282Y mutation in haemochromatosis (HFE) gene has been well documented. However, less is known about the causative non-HFE mutation. We aimed to assess mutation patterns of haemochromatosis-related genes in Chinese patients with primary iron overload.MethodsPatients were preanalysed for mutations in the classic HH-related genes: HFE, HJV, HAMP, TFR2 and SLC40A1. Whole exome sequencing was conducted for cases with variants in HJV signal peptide region. Representative variants were analysed for biological function.ResultsNone of the cases analysed harboured the HFE p.C282Y; however, 21 of 22 primary iron-overload cases harboured at least one non-synonymous variant in the non-HFE genes. Specifically, p.E3D or p.Q6H variants in the HJV signal peptide region were identified in nine cases (40.9%). In two of three probands with the HJV p.E3D, exome sequencing identified accompanying variants in BMP/SMAD pathway genes, including TMPRSS6 p.T331M and BMP4 p.R269Q, and interestingly, SUGP2 p.R639Q was identified in all the three cases. Pedigree analysis showed a similar pattern of combination of heterozygous mutations in cases with HJV p.E3D or p.Q6H, with SUGP2 p.R639Q or HJV p.C321X being common mutation. In vitro siRNA interference of SUGP2 showed a novel role of downregulating the BMP/SMAD pathway. Site-directed mutagenesis of HJV p.Q6H/p.C321X in cell lines resulted in loss of membrane localisation of mutant HJV, and downregulation of p-SMAD1/5 and HAMP.ConclusionCompound heterozygous mutations of HJV or combined heterozygous mutations of BMP/SMAD pathway genes, marked by HJV variants in the signal peptide region, may represent a novel aetiological factor for HH.

Стилі APA, Harvard, Vancouver, ISO та ін.

4

Dallos, Tomáš, Enijad Sahinbegovic, Elmar Aigner, Roland Axmann, Maximilian Schöniger-Hekele, Thomas Karonitsch, Tanja Stamm, et al. "Validation of a radiographic scoring system for haemochromatosis arthropathy." Annals of the Rheumatic Diseases 69, no. 12 (August 2, 2010): 2145–51. http://dx.doi.org/10.1136/ard.2009.122119.

Повний текст джерела

Анотація:

BackgroundArthropathy is one of the earliest and most common manifestations of hereditary haemochromatosis with a significant impact on quality of life. Although its radiographic features are well known, there is no assessment tool for their evaluation.ObjectiveTo develop and validate a novel scoring system for the evaluation of radiographic features of haemochromatosis arthropathy.MethodsA dichotomous scoring system assessing four radiographic features of haemochromatosis arthropathy and a 4-grade scale reflecting severity of radiographic change have been developed. Standard radiographs (hand, wrist, knee and ankle) of 170 subjects (116 male, 54 female) with genetically confirmed haemochromatosis and laboratory signs of iron overload were assessed by three readers and construct validity, feasibility and cross-sectional reliability (intrareader and inter-reader) were assessed.ResultsIntrareader and inter-reader reliability as assessed by percentage pairwise agreement and Cohen's weighed κ were good to excellent for most features and locations evaluated. Radiographic scores correlated well with clinical parameters (bony swollen joint count, hand function and physician's global health assessment; Pearson's correlation, r2=0.18–0.62, p<0.0001). A complete set of radiographs took 3.4±1.2 (mean±SD) min to be assessed. An atlas of characteristic radiographic features was compiled.ConclusionA feasible and reliable radiological assessment tool for the evaluation of haemochromatosis arthropathy has been validated and an atlas of characteristic radiographic features provided.

Стилі APA, Harvard, Vancouver, ISO та ін.

5

Pinson, S., J. Yaouanq, A. M. Jouanolle, B. Turlin, and H. Plauchu. "Non-C282Y familial iron overload: evidence for locus heterogeneity in haemochromatosis." Journal of Medical Genetics 35, no. 11 (November 1, 1998): 954–56. http://dx.doi.org/10.1136/jmg.35.11.954.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

6

Mura, C. "Variation of iron loading expression in C282Y homozygous haemochromatosis probands and sib pairs." Journal of Medical Genetics 38, no. 9 (September 1, 2001): 632–36. http://dx.doi.org/10.1136/jmg.38.9.632.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

7

Heiland, Gisela Ruiz, Elmar Aigner, Tomáš Dallos, Enijad Sahinbegovic, Veit Krenn, Christoph Thaler, Günter Weiss, et al. "Synovial immunopathology in haemochromatosis arthropathy." Annals of the Rheumatic Diseases 69, no. 6 (November 23, 2009): 1214–19. http://dx.doi.org/10.1136/ard.2009.120204.

Повний текст джерела

Анотація:

BackgroundHereditary haemochromatosis (HH) is a common autosomal recessive inherited disorder that frequently causes arthritis. The pathophysiology of musculoskeletal involvement is, however, unclear.ObjectiveTo analyse synovial tissue obtained at surgery from patients with HH arthropathy and compare it qualitatively and quantitatively with specimens from patients with rheumatoid arthritis (RA) and osteoarthritis (OA).MethodsSynovial tissue from 15 patients with HH, 20 with RA and 39 with OA was obtained during surgery. A synovitis grading system was used to determine the severity of synovial inflammation. Using immunohistochemistry, synovial neovascularisation and infiltration of macrophages, neutrophils and lymphocytes were quantitatively assessed.ResultsSynovitis in HH arthropathy largely resembles OA with mild infiltration of mononuclear cells and lymphocytes, formation of synovial microvessels and a low degree of synovial hyperplasia. While many features of HH arthropathy are reminiscent of OA, macrophage and especially neutrophil invasion is clearly more prominent in HH arthropathy than in primary OA and mimics features of RA. This finding was observed particularly in synovial tissue of HH samples with marked haemosiderin deposition.DiscussionThe histological picture of the synovium in HH arthropathy largely resembles a process reminiscent of OA. Neutrophil invasion is, however, markedly increased in HH arthropathy, especially in joints with iron deposition. Accumulation of neutrophils may be crucial for the production of matrix enzymes, which enables cartilage degradation and more rapidly progressive articular damage.

Стилі APA, Harvard, Vancouver, ISO та ін.

8

Chart, Henrik, and Elwyn Griffiths. "The availability of iron and the growth ofVibrio vulnificusin sera from patients with haemochromatosis." FEMS Microbiology Letters 26, no. 2 (February 1985): 227–31. http://dx.doi.org/10.1111/j.1574-6968.1985.tb01596.x.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

9

Beiranvand, Elham, Saeid Abediankenari, Mosayeb Rostamian, Behnoush Beiranvand, and Saeed Naazeri. "The Study of HFE Genotypes and Its Expression Effect on Iron Status of Iranian Haemochromatosis, Iron Deficiency Anemia Patients, Iron-Taker and Non Iron-Taker Controls." Recent Advances in DNA & Gene Sequences (Formerly Recent Patents on DNA & Gene Sequences) 9, no. 1 (January 26, 2016): 58–64. http://dx.doi.org/10.2174/2352092209666150211233434.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

10

McNamee, Antony P., Surendran Sabapathy, Indu Singh, Jarod Horobin, Janelle Guerrero, and Michael J. Simmonds. "Acute Free-Iron Exposure Does Not Explain the Impaired Haemorheology Associated with Haemochromatosis." PLOS ONE 11, no. 1 (January 7, 2016): e0146448. http://dx.doi.org/10.1371/journal.pone.0146448.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

11

Livesey, K. J. "The 16189 variant of mitochondrial DNA occurs more frequently in C282Y homozygotes with haemochromatosis than those without iron loading." Journal of Medical Genetics 41, no. 1 (January 1, 2004): 6–10. http://dx.doi.org/10.1136/jmg.2003.008805.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

12

McCune, Anne, Layla Al-Jader, Alison May, Sara Hayes, Helen Jackson, and Mark Worwood. "Hereditary haemochromatosis: only 1% of adult HFE C282Y homozygotes in South Wales have a clinical diagnosis of iron overload." Human Genetics 111, no. 6 (December 1, 2002): 538–43. http://dx.doi.org/10.1007/s00439-002-0824-1.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

13

OGOUMA-AWORET, Ludmilla, Jean-Pierre RABES, and Philippe de MAZANCOURT. "A Simple RFLP-Based Method for HFE Gene Multiplex Amplification and Determination of Hereditary Hemochromatosis-Causing Mutation C282Y and H63D Variant with Highly Sensitive Determination of Contamination." BioMed Research International 2020 (December 28, 2020): 1–6. http://dx.doi.org/10.1155/2020/9396318.

Повний текст джерела

Анотація:

Hereditary hemochromatosis is an autosomal recessive disorder with incomplete penetrance that results from excess iron absorption and can lead to chronic liver disease, fibrosis, cirrhosis, and hepatocellular carcinoma. The most common form of hereditary hemochromatosis in Western Europe is due to a homozygous mutation (p.(Cys282Tyr) or C282Y), in the HFE gene which encodes hereditary haemochromatosis protein. In the general European population, the frequency of the homozygous genotype is 0.4%, and this mutation explains up to 95% of hereditary hemochromatosis in France. We report here an improved PCR and restriction endonuclease assay based on multiplex amplification of HFE exon 4 (for C282Y detection), HFE exon 2 (for H63D detection), FZD1 gene (for digestion controls), and two Short Tandem Repeats (SE33 and FGA) for identity monitoring and contamination tracking. Fluorescent primers allow capillary electrophoresis, accurate allele tagging, and sensitive contamination detection.

Стилі APA, Harvard, Vancouver, ISO та ін.

14

Kelly, A. L. "Classification and genetic features of neonatal haemochromatosis: a study of 27 affected pedigrees and molecular analysis of genes implicated in iron metabolism." Journal of Medical Genetics 38, no. 9 (September 1, 2001): 599–610. http://dx.doi.org/10.1136/jmg.38.9.599.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

15

Hannaway, Liam, and Sophie Wellman. "Genetic haemochromatosis." InnovAiT: Education and inspiration for general practice 13, no. 6 (April 7, 2020): 353–60. http://dx.doi.org/10.1177/1755738020911403.

Повний текст джерела

Анотація:

Genetic haemochromatosis (GH) is the UK’s most common genetic condition inherited in an autosomal recessive manner. It is an iron overload disorder, in which increased intestinal absorption of iron leads to deposition of iron in organs and tissues, most commonly the liver, heart, pancreas, and joints. GH often presents in an insidious manner, and as a result is significantly underdiagnosed. It is a multi-system disease, in which patient care involves various specialities, including primary care. This article will outline the inheritance, diagnosis, treatment and implications of GH and aims to raise awareness of the condition in general practice.

Стилі APA, Harvard, Vancouver, ISO та ін.

16

Gottschalk, R., C. Seidl, S. Schilling, A. Braner, E. Seifried, D. Hoelzer, and J. P. Kaltwasser. "Iron-overload and genotypic expression of HFE mutations H63D/C282Y and transferrin receptor Hin 6I and Ban I polymorphism in German patients with hereditary haemochromatosis." European Journal of Immunogenetics 27, no. 3 (June 2000): 129–34. http://dx.doi.org/10.1046/j.1365-2370.2000.00215.x.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

17

George, D. K., G. A. Ramm, L. W. Powell, L. M. Fletcher, N. I. Walker, L. L. Cowley, and D. H. G. Crawford. "Evidence for altered hepatic matrix degradation in genetic haemochromatosis." Gut 42, no. 5 (May 1, 1998): 715–20. http://dx.doi.org/10.1136/gut.42.5.715.

Повний текст джерела

Анотація:

Background—Altered matrix degradation contributes to fibrosis in some liver diseases but the role of matrix degradation in fibrogenesis associated with genetic haemochromatosis has not previously been addressed.Aims—To measure serum concentrations of tissue inhibitor of metalloproteinase 1 (TIMP-1) and matrix metalloproteinases (MMP), MMP-1, MMP-2, and MMP-3 in patients with haemochromatosis and control subjects.Patients—Forty patients with haemochromatosis and 19 healthy control subjects. Ten of the 40 patients were studied before and after venesection therapy.Methods—Serum levels of TIMP-1, MMP-1, MMP-2, and MMP-3 were measured by enzyme immunoassay and correlated to hepatic iron concentration and degree of histological fibrosis.Results—Serum TIMP-1 was increased in patients with haemochromatosis compared with controls (163 (30) versus 123 (28) ng/ml, p<0.0002). Mean serum TIMP-1 concentration of patients with haemochromatosis without fibrosis was significantly higher than in controls (153 (16) versus 123 (28) ng/ml, p=0.03). Serum TIMP-1 concentration correlated with both hepatic iron concentration and hepatic iron index (r=0.42, p<0.01; r=0.42, p<0.01). Serum MMP-2 concentrations correlated with increasing degree of fibrosis in patients with haemochromatosis (r=0.38, p=0.01). The mean MMP-1:TIMP-1, MMP-2:TIMP-1 and age/sex matched MMP-3:TIMP-1 ratios were significantly lower in patients with haemochromatosis than controls (0.11 (0.06) versus 0.2 (0.14), p=0.02; 3.32 (0.9) versus 3.91 (0.81), p=0.05; and 0.26 (0.12) versus 0.47 (0.27), p=0.007, respectively). Following venesection, MMP-2 and MMP-3 concentrations increased by 11% (p=0.03) and 19% (p=0.03), respectively.Conclusions—This study provides the first evidence of an alteration in matrix degradation in haemochromatosis that may be a contributing factor to hepatic fibrogenesis in this disease.

Стилі APA, Harvard, Vancouver, ISO та ін.

18

Krasin, Elisha, Aviram Gold, Samuel Morgan, and Yaniv Warschawski. "Screening for hereditary haemochromatosis in patients undergoing knee arthroplasty." Bone & Joint Open 2, no. 12 (December 1, 2021): 1062–66. http://dx.doi.org/10.1302/2633-1462.212.bjo-2021-0162.r1.

Повний текст джерела

Анотація:

Aims Hereditary haemochromatosis is a genetic disorder that is caused by several known mutations in the human homeostatic iron regulator protein ( HFE) gene. Abnormal accumulation of iron causes a joint disease that resembles osteoarthritis (OA), but appears at a relatively younger age and is accompanied by cirrhosis, diabetes, and injury to other organs. Increased serum transferrin saturation and ferritin levels are known markers of haemochromatosis with high positive predictive values. Methods We have retrospectively analyzed the iron studies of a cohort of 2,035 patients undergoing knee joint arthroplasty due to OA. Results No patients had HFE gene C282Y, S65C, or H63D mutations testing. In total, 18 patients (2.96%) of the male cohort and 51 (3.58%) of the female cohort had pathologically increased ferritin levels that may be indicative of haemochromatosis. Seven patients (0.34%) had serum transferrin saturation above 45%. Conclusion The awareness for the diagnosis of this disorder in Orthopaedics is low and needs improvement. Osteoarthritic patients undergoing knee arthroplasty should be routinely screened for haemochromatosis by iron studies and referred to genetic testing when needed. Level of evidence: Level III - Retrospective cohort study. Cite this article: Bone Jt Open 2021;2(12):1062–1066.

Стилі APA, Harvard, Vancouver, ISO та ін.

19

Kaltwasser, J. P., E. Werner, K. Schalk, C. Hansen, R. Gottschalk, and C. Seidl. "Clinical trial on the effect of regular tea drinking on iron accumulation in genetic haemochromatosis." Gut 43, no. 5 (November 1, 1998): 699–704. http://dx.doi.org/10.1136/gut.43.5.699.

Повний текст джерела

Анотація:

Background—Black tea is known to be a potent inhibitor of intestinal absorption of non-haem iron at least in healthy subjects.Aims—To investigate this effect in patients with genetic haemochromatosis, and, more importantly, the effect of regular tea drinking on the accumulation of storage iron in these patients over one year.Patients—Investigations were carried out on 18 patients with clinically proven genetic haemochromatosis. For the study of storage iron accumulation, they were separated into a group instructed to drink a particularly tannin rich tea regularly with meals and a control group.Methods—Intestinal iron absorption from a test meal was measured using whole body counting. Body iron stores were evaluated quantitatively by exhaustive phlebotomy, using haemoglobin, saturation of serum iron binding capacity, and serum ferritin for the assessment of body iron status.Results—A significant reduction in iron absorption was observed when the test meal was accompanied by drinks of tea instead of water. In the tea drinking group, the increase in storage iron was reduced by about one third compared with that of the control group.Conclusions—Regular tea drinking with meals reduces the frequency of phlebotomies required in the management of patients with haemochromatosis.

Стилі APA, Harvard, Vancouver, ISO та ін.

20

Eijkelkamp, Emmeke J., Thomas R. Yapp, and Lawrie W. Powell. "HFE-Associated Hereditary Haemochromatosis." Canadian Journal of Gastroenterology 14, no. 2 (2000): 121–25. http://dx.doi.org/10.1155/2000/360372.

Повний текст джерела

Анотація:

Hereditary hemochromatosis is a common inherited disorder of the iron metabolism. Screening studies indicate that it has a prevalence of one in 200 to 400, depending on the population studied, and a carrier rate of about one in seven to one in 10. Feder et al identified the hereditary hemochromatosis gene (HFE) in 1996 and two candidate mutations; the C282Y mutation has been shown to be responsible for the majority of the hereditary hemochromatosis cases worldwide. The gene discovery has led to rapid advances in the field of iron metabolism. Although the basic defect is still not fully understood, much is known about the sequence of events leading to iron overload.Hereditary hemochromatosis is a major candidate for population screening and meets the screening criteria of the World Health Organization, and Wilson and Jungner. It is one of the most prevalent genetic diseases in white populations, and, importantly, early diagnosis and simple effective treatment allow normal life expectancy.The discovery of theHFEgene and the frequency of the single C282Y mutation as a cause of most cases of hereditary hemochromatosis allow the possibility of widespread genetic testing. However, the logistics, and the psychological and social consequence of this, coupled with incomplete expression of the genotype, necessitate further studies before population screening can be justified.

Стилі APA, Harvard, Vancouver, ISO та ін.

21

Aguilar-Martinez, P., J. F. Schved, C. Badens, I. Thuret, G. Michel, M. G. Neonato, J. Y. Peltier, et al. "Iron overload in thalassaemias and genetic haemochromatosis." European Journal of Haematology 64, no. 4 (April 2000): 279–80. http://dx.doi.org/10.1034/j.1600-0609.2000.9l135.x.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

22

Milman, Nils Thorm. "A Review of Nutrients and Compounds, Which Promote or Inhibit Intestinal Iron Absorption: Making a Platform for Dietary Measures That Can Reduce Iron Uptake in Patients with Genetic Haemochromatosis." Journal of Nutrition and Metabolism 2020 (September 14, 2020): 1–15. http://dx.doi.org/10.1155/2020/7373498.

Повний текст джерела

Анотація:

Objective. To provide an overview of nutrients and compounds, which influence human intestinal iron absorption, thereby making a platform for elaboration of dietary recommendations that can reduce iron uptake in patients with genetic haemochromatosis. Design. Review. Setting. A literature search in PubMed and Google Scholar of papers dealing with iron absorption. Results. The most important promoters of iron absorption in foods are ascorbic acid, lactic acid (produced by fermentation), meat factors in animal meat, the presence of heme iron, and alcohol which stimulate iron uptake by inhibition of hepcidin expression. The most important inhibitors of iron uptake are phytic acid/phytates, polyphenols/tannins, proteins from soya beans, milk, eggs, and calcium. Oxalic acid/oxalate does not seem to influence iron uptake. Turmeric/curcumin may stimulate iron uptake through a decrease in hepcidin expression and inhibit uptake by complex formation with iron, but the net effect has not been clarified. Conclusions. In haemochromatosis, iron absorption is enhanced due to a decreased expression of hepcidin. Dietary modifications that lower iron intake and decrease iron bioavailability may provide additional measures to reduce iron uptake from the foods. This could stimulate the patients’ active cooperation in the treatment of their disorder and reduce the number of phlebotomies.

Стилі APA, Harvard, Vancouver, ISO та ін.

23

Pique, Karina, William Taber, Anthony Thompson, and Charles Gerry Maitland. "Isolated optic neuropathy due to folate deficiency with associated iron overload." BMJ Case Reports 14, no. 7 (July 2021): e242399. http://dx.doi.org/10.1136/bcr-2021-242399.

Повний текст джерела

Анотація:

Isolated optic neuropathy due to folate deficiency is rarely reported. Poor dietary practices, malabsorption, and tobacco/alcohol abuse are usually responsible. We examined a patient with blinding optic neuropathies and isolated folic acid deficiency. Visual acuity recovered after folate replacement. At the same time, serological investigation revealed high ferritin and iron saturation levels with negative genetic markers for haemochromatosis consistent with the diagnosis of iron overload syndrome. There are no reports of blindness associated with iron overload syndrome.

Стилі APA, Harvard, Vancouver, ISO та ін.

24

Utke Rank, Cecilie, Jesper Petersen, Henrik Birgens, and Ove Juul Nielsen. "Hereditary Hyperferritinemia-cataract Syndrome." European Oncology & Haematology 11, no. 2 (2015): 147. http://dx.doi.org/10.17925/eoh.2015.11.02.147.

Повний текст джерела

Анотація:

Hereditary hyperferritinemia-cataract syndrome (HHCS) is a rare autosomal dominant disorder associated with high plasma ferritin concentration without iron overload and early-onset bilateral cataract. The deregulation of ferritin production in HHCS is caused by mutations in the iron-responsive elements (IREs) of the ferritin L-subunit gene (FTLgene) – interfering with the high-affinity interaction between IREs and iron regulatory proteins (IRPs), disturbing the negative regulatory control of ferritin synthesis and resulting in excessive production of L-ferritin. We report a 44-year-old woman initially suspected of having hereditary haemochromatosis and later together with family members diagnosed with HHCS. Genetic analysis showed heterozygosity for a G32T point mutation (Paris 2 mutation) in the IRE located in the 5' untranslated region (UTR) of theFTLgene. The differential diagnosis of hereditary haemochromatosis and HHCS together with the rarity and the versatile phenotype in HHCS obscures the diagnostic process, which emphasises the importance of the correct diagnosis of HHCS in order to prevent unnecessary phlebotomy.

Стилі APA, Harvard, Vancouver, ISO та ін.

25

Hübscher, Stefan G. "Iron overload, inflammation and fibrosis in genetic haemochromatosis." Journal of Hepatology 38, no. 4 (April 2003): 521–25. http://dx.doi.org/10.1016/s0168-8278(03)00078-3.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

26

Mortimore, Gerri. "Genetic haemochromatosis: diagnosing and treating hereditary iron overload." Gastrointestinal Nursing 15, Sup10 (December 2017): S16—S21. http://dx.doi.org/10.12968/gasn.2017.15.sup10.s16.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

27

Gangaidzo, I. T., V. M. Moyo, T. Saungweme, H. Khumalo, R. M. Charakupa, Z. A. R. Gomo, M. Loyevsky, et al. "Iron overload in urban Africans in the 1990s." Gut 45, no. 2 (August 1, 1999): 278–83. http://dx.doi.org/10.1136/gut.45.2.278.

Повний текст джерела

Анотація:

BACKGROUNDIn a previously described model, heterozygotes for an African iron loading locus develop iron overload only when dietary iron is high, but homozygotes may do so with normal dietary iron. If an iron loading gene is common, then homozygotes with iron overload will be found even in an urban population where traditional beer, the source of iron, is uncommon.AIMSTo determine whether iron overload and the C282Y mutation characteristic of hereditary haemochromatosis are readily identifiable in an urban African population.METHODSHistological assessment, hepatocellular iron grading, and dry weight non-haem iron concentration were determined in post mortem tissue from liver, spleen, heart, lungs, and skin. DNA of subjects with elevated hepatic iron indexes was analysed for the C282Y mutation. Iron concentrations in other tissues were compared.RESULTSA moderate increase (>30 μmol/g) in hepatic iron concentrations was found in 31 subjects (23%; 95% confidence interval 15.9 to 30.1%), and they were considerably elevated (>180 μmol/g) in seven subjects (5.2%; 95% confidence interval 1.5 to 8.9%). Appreciably elevated hepatic iron concentrations were associated with heavy iron deposition in both hepatocytes and macrophages, and either portal fibrosis or cirrhosis. All were negative for the C282Y mutation. Very high concentrations were uncommon in subjects dying in hospital. Concentrations of iron in spleen, heart, lung, and skin were significantly higher in subjects with elevated hepatic iron.CONCLUSIONSIron overload is readily identified among urban Africans and is associated with hepatic damage and iron loading of several tissues. The condition is unrelated to the genetic mutation found in hereditary haemochromatosis.

Стилі APA, Harvard, Vancouver, ISO та ін.

28

Sudmantaitė, Vaida, Jelena Čelutkienė, Sigita Glaveckaite, and Rimgaudas Katkus. "Difficult diagnosis of cardiac haemochromatosis: a case report." European Heart Journal - Case Reports 4, no. 1 (February 1, 2020): 1–6. http://dx.doi.org/10.1093/ehjcr/ytaa012.

Повний текст джерела

Анотація:

Abstract Background Primary iron overload cardiomyopathy is an important and potentially preventable cause of heart failure (HF), usually manifesting in the 4–5th decade of life. Patients may be asymptomatic early in the disease with hidden progression of cardiac dysfunction. The challenge of timely detection is an awareness of this systemic disorder and an adequate degree of clinical vigilance. Case summary A 48-year-old man was referred to the university clinic due to the episode of atrial fibrillation. The specific features of bronze skin and yellow eyes together with a combination of syndromes (cardiomyopathy, cirrhosis, ascites and portal hypertension, diabetes mellitus, and chronic kidney disease) stimulated the testing of iron metabolism markers, which were far above the normal range. Echocardiography and cardiac magnetic resonance (CMR) showed the dilatation of all cardiac cavities and biventricular systolic dysfunction. CMR T2* mapping was consistent with the diagnosis of myocardial and hepatic siderosis. Hereditary Type I haemochromatosis was confirmed by a genetic test. After 6 months of standard HF treatment, chelation therapy with deferiprone and regular phlebotomies imaging tests showed a reduction of ventricular and atrial volumes, an improvement in the cardiac systolic function and a decrease of iron accumulation. Discussion In this case, complicating syndromes were detected earlier than underlying disease of primary haemochromatosis. Cardiac haemochromatosis should be considered in any patient with unexplained HF, especially in the case of a positive family history, abnormal liver enzymes, endocrinopathies, or evidence of involvement of other organ systems. Screening for systemic iron overload with transferrin saturation and serum ferritin is the first step. Further non-invasive imaging tests should be done to confirm organ involvement.

Стилі APA, Harvard, Vancouver, ISO та ін.

29

Camaschella, Clara, Antonella Roetto, and Marco De Gobbi. "Genetic haemochromatosis: genes and mutations associated with iron loading." Best Practice & Research Clinical Haematology 15, no. 2 (June 2002): 261–76. http://dx.doi.org/10.1053/beha.2002.0207.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

30

Salvador, Maria, Fernando A. Gonzalez, Paloma Ropero, Briceño Olga, Anguita Eduardo, and Villegas Ana. "16189 Mitocondrial Variant and Iron Overload." Blood 106, no. 11 (November 16, 2005): 3705. http://dx.doi.org/10.1182/blood.v106.11.3705.3705.

Повний текст джерела

Анотація:

Abstract Hereditary haemochromatosis(HH) is one of the most common autosomal recessive diseases in Europe, this is characterized by iron overload. There are two predominant mutations associated with the disease in the HFE gene: C282Y and H63D. The majority of haemochromatosis patients are homozygous for C282Y mutation and a small proportion are compound heterozygous C282Y/H63D. Not all C282Y homozygotes and compound heterozygous will show signs of iron loading. Several studies have shown the incomplete penetrance of haemochromatosis and suggest that iron overload is influenced by both enviromental and genetic factors wich may modify the phenotipic expression of the disease. Iron loading is associated with impaired mitochondrial function. It has been reported that the T16189C variant of mitochondrial DNA may act as a modifier increasing iron loading in HH. 16189 variant lies in the first hypervariable region (HV1), close to the sequences controlling replication and transcription. Aim: to determine the frequency of the 16189 variant in normal population and in a group of HH pacients with mutations in HFE gene or iron loading due to Mayor or Intermediate b-Thalassemia. Materials and methods: We stablished the frequence of 16189 variant in normal population by studying it in a group of 102 blood donors which did not have any mutation in HFE gene. We determined the variant in 27 C282Y homozygous, 32 compound heterozygous C282Y/H63D and 31 H63D homozygous and 16 β-thalassemics aswell. DNA was extracted from peripheral blood, HV1 region was amplified by PCR using primers: F(15800–15819)CAAGTAGCATCCGT ACTATA; R(16344–16325)GTAATGTGCTATGTACGGTA The product of amlification was digested with MnlI acording to manufacturer’s specifications. In wild type there is a restriction site at position 16189 which is absent in mutant allele. All samples lacking MnlI site were directly sequenced in a ABI PRISM 310 Genetic Analyzer. Statistical analysis was performed using the SPSS package. Results: shown in table 1 Conclusions: Our results do not show significant differences between the groups analyzed, but no significant increased frequency of the variant in the group of compound heterozygous. With this study we cannot conclude that mitochondrial function influences iron overload. This is could be dued to the short number of samples analyzed. In β-Thalassemia iron loading is modifed by an increased absorption(TM y TI) and transfusions(TM). At the present we are studying other factors that could play an important role in iron homeostasis: Transferrin receptor, Hepcidine and Hemojuveline. Table 1. Results Controls C282Y/C282Y C282Y/H63D H63D/H63D β-Thalassemia 16189C 12% 11.1% 18.7% 6.4% 12.5%

Стилі APA, Harvard, Vancouver, ISO та ін.

31

Upadhyay, Binayak, Steven D. Green, Nabin Khanal, and Aśok C. Antony. "Clinical conundrum: managing iron overload after renal transplantation." BMJ Case Reports 14, no. 2 (February 2021): e239568. http://dx.doi.org/10.1136/bcr-2020-239568.

Повний текст джерела

Анотація:

Iatrogenic iron overload, which is not uncommon in patients undergoing long-term haemodialysis, arises from a combination of multiple red cell transfusions and parenteral iron infusions that are administered to maintain a haemoglobin concentration of approximately 10 g/dL. Although iron overload due to genetic haemochromatosis is conventionally managed by phlebotomy, patients with haemoglobinopathies and chronic transfusion-induced iron overload are treated with iron-chelation therapy. However, the management of iron overload in our patient who presented with hepatic dysfunction and immunosuppressive drug-induced mild anaemia in the post-renal transplant setting posed unique challenges. We report on the decision-making process used in such a case that led to a successful clinical resolution of hepatic iron overload through the combined use of phlebotomy and erythropoiesis stimulating agents, while avoiding use of iron-chelating agents that could potentially compromise both hepatic and renal function.

Стилі APA, Harvard, Vancouver, ISO та ін.

32

Johnson, Martin, and Gerri Mortimore. "Genetic haemochromatosis: diagnosis and treatment of an iron overload disorder." Nursing Standard 37, no. 11 (September 20, 2022): 77–82. http://dx.doi.org/10.7748/ns.2022.e11896.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

33

Reichert, Cadiele Oliana, Joel da Cunha, Débora Levy, Luciana Morganti Ferreira Maselli, Sérgio Paulo Bydlowski, and Celso Spada. "Hepcidin: Homeostasis and Diseases Related to Iron Metabolism." Acta Haematologica 137, no. 4 (2017): 220–36. http://dx.doi.org/10.1159/000471838.

Повний текст джерела

Анотація:

Iron is an essential metal for cell survival that is regulated by the peptide hormone hepcidin. However, its influence on certain diseases is directly related to iron metabolism or secondary to underlying diseases. Genetic alterations influence the serum hepcidin concentration, which can lead to an iron overload in tissues, as observed in haemochromatosis, in which serum hepcidin or defective hepcidin synthesis is observed. Another genetic imbalance of iron is iron-refractory anaemia, in which serum concentrations of hepcidin are increased, precluding the flow and efflux of extra- and intracellular iron. During the pathogenesis of certain diseases, the resulting oxidative stress, as well as the increase in inflammatory cytokines, influences the transcription of the HAMP gene to generate a secondary anaemia due to the increase in the serum concentration of hepcidin. To date, there is no available drug to inhibit or enhance hepcidin transcription, mostly due to the cytotoxicity described in the in vitro models. The proposed therapeutic targets are still in the early stages of clinical trials. Some candidates are promising, such as heparin derivatives and minihepcidins. This review describes the main pathways of systemic and genetic regulation of hepcidin, as well as its influence on the disorders related to iron metabolism.

Стилі APA, Harvard, Vancouver, ISO та ін.

34

Perruccio, Katia, Francesco Arcioni, Carla Cerri, Roberta La Starza, Donatella Romanelli, Ilaria Capolsini, and Maurizio Caniglia. "The Hereditary Hyperferritinemia-Cataract Syndrome in 2 Italian Families." Case Reports in Pediatrics 2013 (2013): 1–4. http://dx.doi.org/10.1155/2013/806034.

Повний текст джерела

Анотація:

Two 8- and 9-year-old brothers were referred to the Pediatric Oncology Unit, Perugia General Hospital, because of hyperferritinemia. Both had a history of bilateral cataract and epilepsy. Genetic investigation revealed two distinct mutations in iron haemostasis genes; homozygosity for the HFE gene H63D mutation in the younger and heterozygosity in the elder. Both displayed heterozygosity for C33T mutation in the ferritin light chain iron response element. A 7-year-old boy from another family was referred to our unit because of hyperferritinemia. Genetic analyses did not reveal HFE gene mutations. Family history showed that his mother was also affected by hyperferritinemia without HFE gene mutations. Magnetic resonance imaging in the mother was positive for iron overload in the spleen. Cataract was diagnosed in mother and child. Further genetic investigation revealed the C29G mutation of the ferritin light chain iron response element. C33T and C29G mutations in the ferritin light chain iron response element underlie the Hereditary Hyperferritinemia-Cataract Syndrome (HHCS). The HFE gene H63D mutation underlies Hereditary Haemochromatosis (HH), which needs treatment to prevent organ damages by iron overload. HHCS was definitively diagnosed in all three children. HHCS is an autosomal dominant disease characterized by increased L-ferritin production. L-Ferritin aggregates accumulate preferentially in the lens, provoking bilateral cataract since childhood, as unique known organ damage. Epilepsy in one case and the spleen iron overload in another could suggest the misleading diagnosis of HH. Consequently, the differential diagnosis between alterations of iron storage system was essential, particularly in children, and required further genetic investigation.

Стилі APA, Harvard, Vancouver, ISO та ін.

35

Burke, Wylie, Giuseppina Imperatore, and Michelle Reyes. "Iron deficiency and iron overload: effects of diet and genes." Proceedings of the Nutrition Society 60, no. 1 (February 2001): 73–80. http://dx.doi.org/10.1079/pns200069.

Повний текст джерела

Анотація:

Like most essential nutrients, Fe needs to be maintained in the body at a defined level for optimal health, with appropriate adaptation to varying Fe needs and supply. The primary mechanism for controlling Fe level is the regulation of Fe absorption. Several different proteins have been identified as contributors to the process. Despite a complex regulatory system, Fe disorders (both Fe deficiency and Fe overload) occur. Fe deficiency is a common problem worldwide, resulting from inadequate dietary Fe and blood loss. Complications include pre-term labour, developmental delay, and impaired work efficiency. No specific genetic syndromes causing isolated Fe deficiency have been described, but animal studies and clinical observations suggest that such a relationship may be a possibility. Conversely, the known causes of Fe overload are genetic. Fe overload is less common than Fe deficiency, but can result in serious medical complications, including cirrhosis, primary liver cancer, diabetes, cardiomyopathy and arthritis. The most common and best characterized syndrome of Fe overload is hereditary haemochromatosis (HHC), an autosomal recessive disorder. Mutations in the HFE protein cause HHC, but the clinical presentation is variable. Of particular interest is the factor that some HFE genotypes appear to be associated with protection from Fe deficiency. Other genetic variants in the regulatory pathway may influence the likelihood of Fe deficiency and Fe overload. Studies of genetic variants in HFE and other regulatory proteins provide important tools for studying the biological processes in Fe regulation. This work is likely to lead to new insights into Fe disorders and potentially to new therapeutic approaches. It will not be complete, however, until coordinated study of both genetic and nutritional factors is undertaken.

Стилі APA, Harvard, Vancouver, ISO та ін.

36

Gautier, Alain, Fabrice Lainé, Catherine Massart, Laure Sandret, Xavier Piguel, Pierre Brissot, Beverley Balkau, Yves Deugnier, and Fabrice Bonnet. "Liver iron overload is associated with elevated SHBG concentration and moderate hypogonadotrophic hypogonadism in dysmetabolic men without genetic haemochromatosis." European Journal of Endocrinology 165, no. 2 (August 2011): 339–43. http://dx.doi.org/10.1530/eje-11-0215.

Повний текст джерела

Анотація:

AimsTo assess the relation between moderate iron overload on sex hormone binding globulin (SHBG) levels and gonadotroph function in men with dysmetabolic iron overload syndrome and the effects of phlebotomy.MethodsThe relationship between magnetic resonance imaging assessed liver iron concentration (LIC) and plasma ferritin levels with total testosterone, bioavailable testosterone (BT), SHBG and LH levels, were studied in 50 men with moderate dysmetabolic iron excess, in the absence of genetic haemochromatosis, who were randomised to phlebotomy therapy or to normal care.ResultsFour patients (8%) had low total testosterone (<10.4 nmol/l) and 13 patients (26%) had low BT (<2.5 nmol/l). In the entire population, those with LIC above the median (90 μmol/l) had a higher mean SHBG (P=0.028), lower LH (P=0.039) than those with LIC below the median. In multivariable analysis (adjusted for age, and fasting insulin) LIC was significantly associated with SHBG (positively) and LH (negatively). Patients in the highest quartile of SHBG had higher LIC (P=0.010) and higher ferritinaemia (P=0.012) than those in the three other quartiles. Iron depletion by venesection did not significantly improve any hormonal levels.ConclusionsHypogonadism is not infrequent in men with dysmetabolic iron overload syndrome. Liver iron excess is associated with increased plasma SHBG and moderate hypogonadotrophic hypogonadism. Phlebotomy therapy needs further investigation in symptomatic hypogonadal men with dysmetabolic iron excess.

Стилі APA, Harvard, Vancouver, ISO та ін.

37

Goyal, Abhishek, Bishav Mohan, Kavita Saggar, and Gurpreet Singh Wander. "Primary haemochromatosis resulting in dilated cardiomyopathy arising out of mutation in HJV gene in Indian patients: a rare scenario." BMJ Case Reports 13, no. 9 (September 2020): e235650. http://dx.doi.org/10.1136/bcr-2020-235650.

Повний текст джерела

Анотація:

Primary haemochromatosis (PH) is a genetic disorder of iron metabolism with multiorgan involvement due to mutations in HFE or more rarely haemojuvelin (HJV) gene. Cardiac involvement results in dilated cardiomyopathy with reduced ejection fraction and progressive heart failure. PH is rarely reported from India and cardiomyopathy due to PH from HJV mutations is thought to be uncommon. We report two families with cardiomyopathy resulting from PH. Diagnosis was suspected on the basis of skin pigmentation, markedly elevated serum ferritin and transferring saturation. Genetic testing revealed a rare mutation in HJV gene in one family. Being a treatable condition, PH should be suspected and investigated in cardiomyopathy patients in Indian subcontinent. If HFE is negative, analysis of non-HFE mutation should always be considered.

Стилі APA, Harvard, Vancouver, ISO та ін.

38

Beutler, Ernest. "Genetic irony beyond haemochromatosis: clinical effects of HLA-H mutations." Lancet 349, no. 9048 (February 1997): 296–97. http://dx.doi.org/10.1016/s0140-6736(97)22005-2.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

39

Conti, Clara Benedetta, Alessandra Baccarin, Dario Conte, and Mirella Fraquelli. "Decreasing iron-related indexes without anaemia in a patient with genetic haemochromatosis." Internal and Emergency Medicine 10, no. 7 (July 26, 2015): 839–42. http://dx.doi.org/10.1007/s11739-015-1284-7.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

40

BASCLAIN, KERRIE A., KEITH B. SHILKIN, GEOFFREY WITHERS, WILLIAM D. REED, and GARY P. JEFFREY. "Cellular expression and regulation of iron transport and storage proteins in genetic haemochromatosis." Journal of Gastroenterology and Hepatology 13, no. 6 (June 1998): 624–34. http://dx.doi.org/10.1111/j.1440-1746.1998.tb00701.x.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

41

Arnold, J. D., A. D. Mumford, J. O. Lindsay, U. Hegde, M. Hagan, and J. R. Hawkins. "Hyperferritinaemia in the absence of iron overload." Gut 41, no. 3 (September 1, 1997): 408–10. http://dx.doi.org/10.1136/gut.41.3.408.

Повний текст джерела

Анотація:

Background—Serum ferritin is normally a marker of iron overload. Ferritin genes are sited at chromosomes 19 and 11. Regulation of ferritin synthesis involves an interaction between an iron regulatory protein (IRP) and part of the ferritin mRNA designated the iron regulatory element (IRE). A disorder of ferritin synthesis resulting in hyperferritinaemia in the absence of iron overload has been described recently.Patients and methods—Hyperferriti- naemia in the absence of iron overload was detected in a patient who was investigated for possible haemochromatosis. Serum iron, transferrin saturation, and ferritin concentration were studied in 11 members of this patient’s family from three generations. Eight members had DNA samples analysed by direct cycle sequencing of the 5′ untranslated region of the L ferritin gene.Results—Six of the family members studied had serum ferritin concentrations greater than 900 μg/l. However, serum iron and transferrin saturation were normal in these subjects who all had evidence of cataracts. Three affected family members who had genetic studies of the L ferritin gene on chromosome 19 had an A to G point mutation which was not found in unaffected members.Conclusions—There was complete concordance between a mutated IRE, cataracts, and hyperferritinaemia in three generations of this family. This family study confirms the finding that hereditary hyperferritinaemia in the absence of iron overload is an autosomal dominant inherited disorder.

Стилі APA, Harvard, Vancouver, ISO та ін.

42

Rainero, I., E. Rubino, C. Rivoiro, W. Valfrè, E. Binello, E. Zampella, P. De Martino, et al. "Haemochromatosis Gene (HFE) Polymorphisms and Migraine: An Association Study." Cephalalgia 27, no. 1 (January 2007): 9–13. http://dx.doi.org/10.1111/j.1468-2982.2006.01231.x.

Повний текст джерела

Анотація:

Several studies have suggested that iron metabolism may be involved in the pathogenesis of migraine. Using a case-control design, we performed an association study in a cohort of Italian migraine patients to evaluate whether a particular allele or genotype of the haemochromatosis gene ( HFE) would modify the occurrence and clinical features of the disease. We genotyped 256 migraine patients and 237 healthy age-, sex- and ethnicity-matched controls for the C282Y and H63D polymorphisms of the HFE gene. Phenotype and allele frequencies of both polymorphisms were similarly distributed in migraine patients and controls. The patients carrying the DD genotype of the H63D polymorphism showed a later age at onset of the disease and an increased number of migraine attacks. Our data suggest that the HFE gene is not a major disease gene for migraine. However, the H63D polymorphism of the HFE gene may be considered a modifying genetic factor in migraine.

Стилі APA, Harvard, Vancouver, ISO та ін.

43

Pellegrino, R. M., F. Riondato, L. Ferbo, M. Boero, A. Palmieri, L. Osella, P. Pollicino, B. Miniscalco, G. Saglio, and A. Roetto. "Altered Erythropoiesis in Mouse Models of Type 3 Hemochromatosis." BioMed Research International 2017 (2017): 1–12. http://dx.doi.org/10.1155/2017/2408941.

Повний текст джерела

Анотація:

Type 3 haemochromatosis (HFE3) is a rare genetic iron overload disease which ultimately lead to compromised organs functioning. HFE3 is caused by mutations in transferrin receptor 2 (TFR2) gene that codes for two main isoforms (Tfr2αand Tfr2β). Tfr2αis one of the hepatic regulators of iron inhibitor hepcidin. Tfr2βis an intracellular isoform of the protein involved in the regulation of iron levels in reticuloendothelial cells. It has been recently demonstrated that Tfr2 is also involved in erythropoiesis. This study aims to further investigate Tfr2 erythropoietic role by evaluating the erythropoiesis of two Tfr2 murine models wherein either one or both of Tfr2 isoforms have been selectively silenced (Tfr2 KI and Tfr2 KO). The evaluations were performed in bone marrow and spleen, in 14 days’ and 10 weeks’ old mice, to assess erythropoiesis in young versus adult animals. The lack of Tfr2αleads to macrocytosis with low reticulocyte number and increased hemoglobin values, together with an anticipation of adult BM erythropoiesis and an increased splenic erythropoiesis. On the other hand, lack of Tfr2β(Tfr2 KI mice) causes an increased and immature splenic erythropoiesis. Taken together, these data confirm the role of Tfr2αin modulation of erythropoiesis and of Tfr2βin favoring iron availability for erythropoiesis.

Стилі APA, Harvard, Vancouver, ISO та ін.

44

George, P. M., C. Conaghan, H. B. Angus, T. A. Walmsley, and B. A. Chapman. "Comparison of histological and biochemical hepatic iron indexes in the diagnosis of genetic haemochromatosis." Journal of Clinical Pathology 49, no. 2 (February 1, 1996): 159–63. http://dx.doi.org/10.1136/jcp.49.2.159.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

45

PARTRIDGE, Jason, Daniel F. WALLACE, Kishor B. RAJA, James S. DOOLEY, and Ann P. WALKER. "Monocyte–macrophage ferric reductase activity is inhibited by iron and stimulated by cellular differentiation." Biochemical Journal 336, no. 3 (December 15, 1998): 541–43. http://dx.doi.org/10.1042/bj3360541.

Повний текст джерела

Анотація:

The enzyme ferric reductase catalyses the reduction of Fe(III) as a prerequisite to its transportation across the cell membrane. Duodenal mucosal biopsies from iron overloaded patients with genetic haemochromatosis (GH) have increased ferric reductase activity and iron absorption compared with controls, yet the GH mucosa is iron deficient. A similar GH-related iron deficiency is also seen in macrophages. The aim of this study was to investigate whether macrophage ferric reductase activity is altered in GH, and to determine ferric reductase activity in monocytes and differentiated macrophages. The erythroleukaemic K562 cell line was studied as a clonal reference cell line. The basal K562 ferric reductase activity is characteristic of a membrane bound enzyme, being both temperature and protease sensitive. Ferric reductase activity was also demonstrated in human leucocyte, monocyte and macrophage preparations. Assays of K562 and macrophage cell supernatants confirmed that the ferric reductase activity was not due to a secreted factor. Assay of ferric reductase in normalized-iron and iron-enriched (100 µM ferric citrate) conditions showed no significant difference between Cys282Tyr (Cys282 → Tyr) homozygous GH macrophages and Cys282-Tyr negative control activities (P> 0.05). However, a 900% increase in ferric reductase activity was observed during monocyte to macrophage differentiation (P< 0.05), possibly reflecting the co-ordinate up-regulation of iron metabolism in these cells. The demonstration of approx. 25% activity after macrophage differentiation at high free-iron concentrations compared with ‘normalized ’ iron is consistent with repression of human ferric reductase activity by iron. The identification of the human ferric reductase gene and its protein will ultimately provide insight into its regulation and role in mammalian iron metabolism.

Стилі APA, Harvard, Vancouver, ISO та ін.

46

O'Hara, R., N. Cavanagh, M. Cassidy, and M. Cullina. "The role of transferrin saturation as a screening test for hereditary haemochromatosis in an Irish population seeking medical care." Annals of Clinical Biochemistry: International Journal of Laboratory Medicine 40, no. 2 (March 1, 2003): 169–74. http://dx.doi.org/10.1258/000456303763046111.

Повний текст джерела

Анотація:

Background: Genetic studies have indicated a high prevalence of mutations for hereditary haemochromatosis (HH) in Irish populations. Given the high cost of genetic screening and the ethical implications thereof, we assessed the role of transferrin saturation (TS) as a primary screening test for HH in an Irish population seeking medical care. Methods: TS and ferritin were measured on 330 consecutive blood specimens received in the laboratory for routine screening. Patients with TS > 45% were genetically screened for the C282Y and H63D mutations. Results: Twenty-six patients had TS values > 45%. Of these, specimens were available for genetic screening on 20 patients. Three previously undiagnosed patients were found to be C282Y homozygotes and one a compound heterozygote (C282Y/H63D). The prevalence of C282Y homozygotes was 0·93%, which is similar to the reported prevalence found in Irish populations by genetic screening. Conclusion: Given the number of positive findings in this study, we conclude that, in the absence of a national programme, TS could be used as part of a health-screening panel in the Irish setting. Patients expressing iron overload would be detected before organ damage occurred, leading to less severe clinical disease and better patient prognosis.

Стилі APA, Harvard, Vancouver, ISO та ін.

47

O'Toole, Rebecca, Collette Bromhead, and Kenneth R. Romeril. "Using Iron Studies to Target Testing for Hereditary Haemochromatosis in New Zealand." Blood 126, no. 23 (December 3, 2015): 2150. http://dx.doi.org/10.1182/blood.v126.23.2150.2150.

Повний текст джерела

Анотація:

Abstract Objective: Hereditary haemochromatosis (HH) follows a prolonged pre-symptomatic phase. The clinical features of HH are non-specific and subsequently, an accurate diagnosis may not be reached until the irreversible manifestations of the disease are apparent. Genetic testing for SNPs of the HFE gene is diagnostic of HH; however it is not economically viable in New Zealand to screen all patients with molecular testing unless there is sound clinical, familial or biochemical evidence to indicate testing. Abnormalities in iron biochemical assays are often the first indicator of HH and it has now become widely accepted that transferrin saturation (TS) and serum ferritin (SF) are the best initial tests for HH (Bacon et al 2011; King and Barton, 2006). These results however, particularly SF, may be affected by other conditions, making interpretation difficult and often misunderstood e.g. acute phase response. There is currently no national guideline for requesting HFE testing in New Zealand and existing recommendations are based on international data. This study evaluates the correlation between the iron phenotype and HFE genotype to inform future guidelines and cost-effective clinical pathways specific to our population. Materials and Methods: We audited the results from 2388 patients genotyped for HFE at Aotea Pathology Ltd; Wellington, between 2007 and 2013, and compared their C282Y, H63D and S65C genotypes to their iron status as quantified by SF and TS, as well as serum iron (SI) and serum transferrin (ST). The predictive power of the iron studies markers was evaluated by Receiver Operator Characteristic (ROC) curve analysis and if a statistically significant association for a variable was seen, the sensitivity, specificity, positive and negative predictive values were calculated at varying intervals. Results: Test ordering patterns showed that the majority (62%) of HFE genotyping tests were ordered on the basis of an elevated SF alone, without a full iron studies profile performed (which includes TS). Furthermore, only 11% of these patients had a C-Reactive Protein (CRP) test performed, which is a clinically useful marker of inflammatory states to establish if an elevated SF is acute phase in origin. In ROC curve analysis, the Area Under the Curve (AUC) of TS is larger than any other marker and a decision threshold of 45% produces the most favourable outcomes for patients in statistical analysis. Our results show that there is little association between SF and individual HFE genotypes and that SF values < 1000 µg/L are relatively insensitive to genotype. A SF of >1000 μg/L was found in one at-risk patient (C282Y homozygote) who had a TS < 45%, which provides some evidence to support the incorporation of SF into a diagnostic screening strategy for HH. AUCs for SI are analogous to that of TS, however, the sensitivity is poor at cut-offs above the normal range. ST showed no statistically significant association with any HFE genotype in ROC curve analysis. Using the thresholds of SF ≥ 1000 µg/L or TS ≥ 45% for consideration of HFE genotyping, any additional misidentified C282Y homozygotes in this study cohort were found to have a family history of HH, highlighting the importance of HFE testing on this basis. Conclusion: We conclude that an elevated SF of <1000 μg/L alone is not a predictor of HH since these levels are commonly encountered in the normal population. Our analysis of test ordering patterns however; proves that local primary care physicians rely heavily on SF as a predictor of HH, and suggest that there is little adherence to existing guidelines with regard to TS. Based on the lack of CRP testing requested, it also appears that HFE genotyping is being inappropriately requested without consideration of other causes of elevated SF. On the contrary, this study confirms that TS is a more accurate marker of HFE-related iron overload than SF. All C282Y homozygous patients would have been identified using a diagnostic algorithm requiring a TS ≥ 45%, a SF ≥ 1000 µg/L and/or a family history of HH. The data yielded by this study could be used by primary care physicians as a clinical guide for screening to identify appropriate candidates for genetic testing of the HFE gene which will facilitate earlier detection of a higher number of at-risk individuals. This strategy offers clinically appropriate solution which will enhance the accuracy of HFE genotyping requests and improve the cost effectiveness of molecular testing. Disclosures No relevant conflicts of interest to declare.

Стилі APA, Harvard, Vancouver, ISO та ін.

48

Dorniak, Karolina, Ludmiła Daniłowicz-Szymanowicz, Katarzyna Sikorska, Katarzyna Rozwadowska, Jadwiga Fijałkowska, Anna Glińska, Magdalena Tuzimek, et al. "Left Ventricular Function and Iron Loading Status in a Tertiary Center Hemochromatosis Cohort—A Cardiac Magnetic Resonance Study." Diagnostics 12, no. 11 (October 28, 2022): 2620. http://dx.doi.org/10.3390/diagnostics12112620.

Повний текст джерела

Анотація:

Background: Haemochromatosis (HCH), a common genetic disorder with variable penetrance, results in progressive but understudied iron overload. We prospectively evaluated organ iron loading and cardiac function in a tertiary center HCH cohort. Methods: 42 HCH patients (47 ± 14 years) and 36 controls underwent laboratory workup and cardiac magnetic resonance (CMR), including T1 and T2* mapping. Results: Myocardial T2* (myoT2*), myocardial T1 (myoT1) and liver T2* (livT2*) were lower in patients compared to controls (33 ± 4 ms vs. 36 ± 3 ms [p = 0.004], 964 ± 33 ms vs. 979 ± 25 ms [p = 0.028] and 21 ± 10 ms vs. 30 ± 5 ms [p < 0.001], respectively). MyoT2* did not reach the threshold of clinically significant iron overload (<20 ms), in any of the patients. In 22 (52.4%) patients, at least one of the tissue parameters was reduced. Reduced myocardial T2* and/or T1 were found in 10 (23.8%) patients, including 4 pts with normal livT2*. LivT2* was reduced in 18 (42.9%) patients. MyoT1 and livT2* inversely correlated with ferritin (rs = −0.351 [p = 0.028] and rs = −0.602 [p < 0.001], respectively). LivT2* by a dedicated sequence and livT2* by cardiac T2* mapping showed good agreement (ICC = 0.876 p < 0.001). Conclusions: In contemporary hemochromatosis, significant myocardial iron overload is rare. Low myocardial T2* and/or T1 values may warrant closer follow-up for accelerated myocardial iron overload even in patients without overt liver overload. Cardiac T2* mapping sequence allows for liver screening at the time of CMR.

Стилі APA, Harvard, Vancouver, ISO та ін.

49

Kaltwasser, J. P., E. Werner, R. Schalk, C. Hansen, R. Gottschalk, and C. Seidl. "Clinical trial on the effect of regular tea drinking on iron accumulation in genetic haemochromatosis." European Journal of Gastroenterology & Hepatology 10, no. 12 (December 1998): 1064. http://dx.doi.org/10.1097/00042737-199812000-00022.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

50

Donnelly, Sc, Ng Joshi, D. Thorburn, A. Cooke, G. Reid, M. Neilson, H. Capell, and Aj Stanley. "Prevalence of Genetic Haemochromatosis and Iron Overload in Patients Attending Rheumatology and Joint Replacement Clinics." Scottish Medical Journal 55, no. 1 (February 2010): 14–16. http://dx.doi.org/10.1258/rsmsmj.55.1.14.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

Статті в журналах з теми "Haemochromatosis, iron, genetics"

Оформте джерело за APA, MLA, Chicago, Harvard та іншими стилями