Щоб переглянути інші типи публікацій з цієї теми, перейдіть за посиланням: Extraction de fouillis de mer.
Статті в журналах з теми "Extraction de fouillis de mer"
Оформте джерело за APA, MLA, Chicago, Harvard та іншими стилями
Ознайомтеся з топ-50 статей у журналах для дослідження на тему "Extraction de fouillis de mer".
Біля кожної праці в переліку літератури доступна кнопка «Додати до бібліографії». Скористайтеся нею – і ми автоматично оформимо бібліографічне посилання на обрану працю в потрібному вам стилі цитування: APA, MLA, «Гарвард», «Чикаго», «Ванкувер» тощо.
Також ви можете завантажити повний текст наукової публікації у форматі «.pdf» та прочитати онлайн анотацію до роботи, якщо відповідні параметри наявні в метаданих.
Переглядайте статті в журналах для різних дисциплін та оформлюйте правильно вашу бібліографію.
1
Fiche, Anthony, Ali Khenchaf, Jean-Christophe Cenxus, Arnaud Martin, and Maud Rochdi. "étude statistique du fouillis de mer à partir de lois alpha-stables." Traitement du signal 30, no. 3-4-5 (April 28, 2013): 243–71. http://dx.doi.org/10.3166/ts.30.243-271.
Повний текст джерела
2
Guidez, Joel. "Extraction de l’uranium de l’eau de mer : quelques réalités." Revue Générale Nucléaire, no. 4 (July 2014): 52–55. http://dx.doi.org/10.1051/rgn/20144052.
Повний текст джерела
3
Yang, Kai-Shing, Khalid Hamid, Shih-Kuo Wu, Uzair Sajjad, and Chi-Chuan Wang. "Experimental Analysis of a Heat Pump Dryer with an External Desiccant Wheel Dryer." Processes 9, no. 7 (July 15, 2021): 1216. http://dx.doi.org/10.3390/pr9071216.
Повний текст джерелаАнотація:
This study examines the performance of three heat pump dryers: the original reference design, a modified drying chamber, and an external desiccant wheel design. Unlike most existing studies that normally adopt organic products as the drying materials, in this study we used moist sodium polyacrylate (Orbeez) as the drying material for consistent characterization of the heat pump performance. R-134a was adopted as the refrigerant for the heat pump system. The experiments were performed subject to different weights of Orbeez (drying material) at a constant volumetric flow rate of 100 m3/h. During experimentation, different parameters like the coefficient of performance (COPHP), drying rate, heat transfer rate by the condenser, moisture extraction rate, and specific moisture extraction rate were calculated. The average COPHP, mass transfer rate, heat transfer rate, MER, and SMER of the system were calculated as 3.9, 0.30 kg/s, 0.56 kW, 0.495 kg/h, and 1.614 kg/kWh, respectively. The maximum COP for the refrigeration system was achieved at lower test loads with the desiccant wheel. The moisture extraction rate for a lower test loading was higher than that for a higher test load due to the higher penetration of drying air at the lower test load, although the maximum test load showed the maximum relative humidity at the dryer outlet. The desiccant wheel showed good performance in terms of moisture extraction rate and COPHP, but it showed poor performance in terms of the specific moisture extraction rate due to the high power consumption (around 2.6 kW) of the desiccant dehumidifier. The moisture extraction rate (MER) for all designs increased to a maximum value, followed by consistent decline. However, the maximum MER for the desiccant design exceeded those for the other designs.
4
ZENG, Xiao-xi, Jian-xin TAGN, Pei JIANG, Hong-wei LIU, Zhi-min DAI, and Xue-duan LIU. "Isolation, characterization and extraction of mer gene of Hg2+ resisting strain D2." Transactions of Nonferrous Metals Society of China 20, no. 3 (March 2010): 507–12. http://dx.doi.org/10.1016/s1003-6326(09)60170-9.
Повний текст джерела
5
Kurniadi, Alex, and Marlinda Vasty Overbeek. "Classification of Metagenome Fragments With Agglomerative Hierarchical Clustering." Ultimatics : Jurnal Teknik Informatika 13, no. 2 (January 23, 2022): 114–19. http://dx.doi.org/10.31937/ti.v13i2.2180.
Повний текст джерелаАнотація:
Unlike genomics which study specifically culturable microorganisms, metagenomics is a field that studies microorganic samples retrieved directly from the environment. Such samples produce widely varying fragments when sequenced, many of which are still unidentified or unknown. Assembly of these fragments in the goals of identifying the species contained among them are thus prone to make said goals more difficult, so it becomes necessary for binning techniques to come in handy while trying to classify these mixed fragments onto certain levels in the phylogenetic tree. This research attempts to implement algorithms and methods such as k-mers to use for feature extraction, linear discriminant analysis (LDA) for dimensionality reduction, and agglomerative hierarchical clustering (AGNES) for taxonomic classification to the genus level. Experimentation is done across different objective measurements, including the length of the observed metagenome fragment that spans from 0,5 Kbp up to 10 Kbp for both the 3-mer and 4-mer contexts (k = 3 and k = 4). The averaged validity scores of the resulting data clusters generated from both the training and test sets, computed with the silhouette index metric, are 0.6945 and 0.0879 for the 3-mer context, along with 0.5219 and 0.1884 for the 4-mer context.
6
Yuan, Yizhi. "Emotion of Music: Extraction and Composing." Journal of Education, Humanities and Social Sciences 13 (May 11, 2023): 422–28. http://dx.doi.org/10.54097/ehss.v13i.8207.
Повний текст джерелаАнотація:
Music, the third art that has accompanied the development of human civilization, has played a vital role in human expression of emotions from ancient times to the present. It has played a vital role in human expression of emotions from ancient times to the present. This study describes three different ways of musical emotional extraction within the current research field: a. Extraction by measuring the physiological characteristics of the subject; b. text feature extraction by analyzing lyrics in songs and c. extraction by analyzing audio features. This paper also discusses the research results of three different groups of researchers to use specific emotions for music creation by designing and applying the GA based on KTH rule system, the mLSMN with logistic regression, and the MAgentM framework. The purpose of this research is to provide reference materials for subsequent researchers through the detailed introduction of the MER method, and to provide industry stakeholders with an outlook for the music industry.
7
Sips, Luc, Emmanuel Njumbe Ediage, Benno Ingelse, Tom Verhaeghe, and Lieve Dillen. "LC–MS quantification of oligonucleotides in biological matrices with SPE or hybridization extraction." Bioanalysis 11, no. 21 (November 2019): 1941–54. http://dx.doi.org/10.4155/bio-2019-0117.
Повний текст джерелаАнотація:
Aim: Quantitative LC–MS analysis of oligonucleotides (OGNs) in biological matrices is needed to support candidate selection of new therapeutic OGNs. Methodology & results: A set of 20 single stranded antisense oligonucleotides (ASO) and five siRNAs were extracted from plasma and tissue homogenates. Anion Exchange (AEX) SPE was selected as generic extraction approach, resulting in recoveries from plasma >70%. Extraction from tissue homogenates showed often more variation and lower recoveries. A proof of concept of a novel tailored hybridization extraction is demonstrated for two 16-mer reference OGNs. Conclusion: Two methods for extraction of OGNs were investigated and applied for quantitative analysis. The AEX-SPE is considered a more generic approach preferred when multiple compounds are evaluated. Hybridization extraction has great potential but critical reagents per analyte are needed.
8
Chen, Wu, Qingyue Guo, Chunpeng Yang, and Jin Hou. "Preparation of novel functional MER zeolite membrane for potassium continuous extraction from seawater." Journal of Porous Materials 25, no. 1 (May 12, 2017): 215–20. http://dx.doi.org/10.1007/s10934-017-0435-9.
Повний текст джерела
9
Huang, Xiao-mei, Yi Zhao, and Hui-qing Liu. "Simulation and Experimental Study on Drying Process of the Household Gas Clothes Dryer." Mathematical Problems in Engineering 2019 (November 27, 2019): 1–17. http://dx.doi.org/10.1155/2019/1732197.
Повний текст джерелаАнотація:
This paper analyzed the drying process of the household gas clothes dryer (GCD) based on the principle of heat and mass transfer. The drying models in three scenarios were established: natural gas burned in combustion chamber, ambient air mixed with exhausted gas in hot gas duct, and clothes were dried in the drying drum. The simulation of the drying process was performed on MATLAB software. And the effectiveness of the drying model was verified by comparison with experiment results. The effects of gas flow rate, dry mass of clothes, ambient temperature, ambient humidity, textile type, and moisture extraction rate (MER) on the performance of dryers were studied. This paper provided a theoretical basis for the design and optimization of GCDs. It was found that the drying time of the gas clothes dryer was mostly affected by the gas flow and dry mass of clothes, and the specific moisture extraction rate (SMER) was mostly affected by the ambient temperature and relative humidity. The nylon clothes have the fastest MER and the smallest SMER. Moreover, reducing operating time in falling-rate drying period can improve energy efficiency.
10
Ji, Yuhuan, Yijiang Liu, Wanhong Xia, Alexander Behling, Min Meng, Patrick Bennett, and Laixin Wang. "Importance of probe design for bioanalysis of oligonucleotides using hybridization-based LC-fluorescence assays." Bioanalysis 11, no. 21 (November 2019): 1917–25. http://dx.doi.org/10.4155/bio-2019-0154.
Повний текст джерелаАнотація:
Aim: The importance of the length and/or structure of fluorescently labeled PNA (peptide nucleic acid) probes for quantitative determination of oligodeoxynucleotides (ODNs) is demonstrated in human plasma using hybridization-based LC-fluorescence assays. The length of the PNA probes impacts the peak shape and chromatographic separation of the resulting PNA/ODN hybridization complexes and affects assay sensitivity, dynamic range and carryover. Methods: For quantitative determination of an 18-mer phosphodiester ODN (DNL1818) in human plasma, an assay utilizing an Atto dye-labeled 12-mer PNA probe provided a linear quantitation range of 0.1–50 ng/ml with excellent accuracy and precision (within -5.3–7.73%). Conclusion: This method provides a convenient method for sensitive and specific quantification of ODNs in biological matrix with limited sample volume and no special extraction.
11
Anand, Prachi, Michael Koleto, Dilipkumar R. Kandula, Lei Xiong, and Robert MacNeill. "Novel hydrophilic-phase extraction, HILIC and high-resolution MS quantification of an RNA oligonucleotide in plasma." Bioanalysis 14, no. 1 (January 2022): 47–62. http://dx.doi.org/10.4155/bio-2021-0216.
Повний текст джерелаАнотація:
Aim: In the theme of quantitative LC–MS bioanalysis of oligonucleotides free of ion-pairing, a 22-mer RNA oligonucleotide took center stage. The focus was on a unique polar-based retention scheme to produce a high-recovery extraction presenting a high-performance alternative extraction means, also there was the opportunity to involve hydrophilic-interaction liquid chromatography and contemporary high-resolution MS as the end point. Results: Original LC–MS methodology was developed for the oligonucleotide and the performance was robust for both nominal and accurate mass detection, the latter affording 10× improvement in sensitivity and 4000-fold linear dynamic range, 500 pM to 2000 nM. Conclusion: A novel means of solid-phase extraction is exhibited within a robust pair-free methodology, reaching pM sensitivity with the demonstrably beneficial accurate mass platform.
12
Asim, Muhammad Nabeel, Muhammad Imran Malik, Christoph Zehe, Johan Trygg, Andreas Dengel, and Sheraz Ahmed. "MirLocPredictor: A ConvNet-Based Multi-Label MicroRNA Subcellular Localization Predictor by Incorporating k-Mer Positional Information." Genes 11, no. 12 (December 9, 2020): 1475. http://dx.doi.org/10.3390/genes11121475.
Повний текст джерелаАнотація:
MicroRNAs (miRNA) are small noncoding RNA sequences consisting of about 22 nucleotides that are involved in the regulation of almost 60% of mammalian genes. Presently, there are very limited approaches for the visualization of miRNA locations present inside cells to support the elucidation of pathways and mechanisms behind miRNA function, transport, and biogenesis. MIRLocator, a state-of-the-art tool for the prediction of subcellular localization of miRNAs makes use of a sequence-to-sequence model along with pretrained k-mer embeddings. Existing pretrained k-mer embedding generation methodologies focus on the extraction of semantics of k-mers. However, in RNA sequences, positional information of nucleotides is more important because distinct positions of the four nucleotides define the function of an RNA molecule. Considering the importance of the nucleotide position, we propose a novel approach (kmerPR2vec) which is a fusion of positional information of k-mers with randomly initialized neural k-mer embeddings. In contrast to existing k-mer-based representation, the proposed kmerPR2vec representation is much more rich in terms of semantic information and has more discriminative power. Using novel kmerPR2vec representation, we further present an end-to-end system (MirLocPredictor) which couples the discriminative power of kmerPR2vec with Convolutional Neural Networks (CNNs) for miRNA subcellular location prediction. The effectiveness of the proposed kmerPR2vec approach is evaluated with deep learning-based topologies (i.e., Convolutional Neural Networks (CNN) and Recurrent Neural Network (RNN)) and by using 9 different evaluation measures. Analysis of the results reveals that MirLocPredictor outperform state-of-the-art methods with a significant margin of 18% and 19% in terms of precision and recall.
13
Wells, John, and Wm V. Baird. "Alterations in Gene Expression during Exposure of Bermudagrass to Low, Non-lethal Temperatures." HortScience 32, no. 3 (June 1997): 534E—535. http://dx.doi.org/10.21273/hortsci.32.3.534e.
Повний текст джерелаАнотація:
Temperature is a limiting factor for plant growth. Warm-season turfgrasses can experience winter-kill when grown in the “transition zone.” On the other hand, when properly cold-acclimated, these same plants can withstand otherwise lethal temperatures. As part of our investigations into the biochemistry and molecular biology of cold acclimation in bermudagrass, total RNA from crowns (rhizome buds) isolated at different timepoints before and after chilling temperature exposure, was isolated by salt-buffer/phenol extraction, followed by LiCl precipitation and DNAse treatment. Differential display reverse transcriptase polymerase chain reaction (DD-RT-PCR) was performed using specific-(dT11NN) or variable-(dT12VN) anchor primers (where V = dA, dG and dC and N = dA, dG, dC or dT) for first strand cDNA synthesis by RT. The ss-cDNAs were converted to double stranded molecules and PCR amplified using a randomly chosen 10-mer primer paired with the same anchor primer used for cDNA synthesis. The dCTP32 labeled cDNAs were fractionated on non-denaturing polyacrylamide gels. Individual bands exhibiting differential expression between treated and nontreated samples were identified for reamplification, cloning, sequencing and further characterization of the differential nature of their expression by reverse northern hybridization and RT-PCR. Only those excised bands able to be reamplified using the anchor:10-mer pair were selected for cloning. To date, 90 variable-anchor:10-mer or specific-anchor:10-mer pairs have been screened. Of these, ≈27 have exhibited possible differential expression with one or more bands. Nucleotide (and deduced amino acid) sequence information was used to search on-line databases for similarity/homology with previously reported gene or protein sequences.
14
ValizadehAslani, Taha, Zhengqiao Zhao, Bahrad A. Sokhansanj, and Gail L. Rosen. "Amino Acid k-mer Feature Extraction for Quantitative Antimicrobial Resistance (AMR) Prediction by Machine Learning and Model Interpretation for Biological Insights." Biology 9, no. 11 (October 28, 2020): 365. http://dx.doi.org/10.3390/biology9110365.
Повний текст джерелаАнотація:
Machine learning algorithms can learn mechanisms of antimicrobial resistance from the data of DNA sequence without any a priori information. Interpreting a trained machine learning algorithm can be exploited for validating the model and obtaining new information about resistance mechanisms. Different feature extraction methods, such as SNP calling and counting nucleotide k-mers have been proposed for presenting DNA sequences to the model. However, there are trade-offs between interpretability, computational complexity and accuracy for different feature extraction methods. In this study, we have proposed a new feature extraction method, counting amino acid k-mers or oligopeptides, which provides easier model interpretation compared to counting nucleotide k-mers and reaches the same or even better accuracy in comparison with different methods. Additionally, we have trained machine learning algorithms using different feature extraction methods and compared the results in terms of accuracy, model interpretability and computational complexity. We have built a new feature selection pipeline for extraction of important features so that new AMR determinants can be discovered by analyzing these features. This pipeline allows the construction of models that only use a small number of features and can predict resistance accurately.
15
Pekuwali, Arini, Wisnu Ananta Kusuma, and Agus Buono. "Optimization of Spaced K-mer Frequency Feature Extraction using Genetic Algorithms for Metagenome Fragment Classification." Journal of ICT Research and Applications 12, no. 2 (September 28, 2018): 123. http://dx.doi.org/10.5614/itbj.ict.res.appl.2018.12.2.2.
Повний текст джерела
16
Picton, Deric D., and Harrison G. Hughes. "Characterization of Alstroemeria Species using Random Amplified Polymorphic DNA (RAPD) Analysis." HortScience 32, no. 3 (June 1997): 482F—482. http://dx.doi.org/10.21273/hortsci.32.3.482f.
Повний текст джерелаАнотація:
In this study, 11 species, hybrids, and color variants were characterized using randomly amplified polymorphic DNA (RAPD) analysis. Total genomic DNA was extracted using a 2% CTAB extraction buffer using fresh or frozen leaf material. The DNA was amplified using standard RAPD-PCR protocols utilizing 10-mer primers. All primers utilized exhibited a high degree of polymorphism in their banding patterns among the species and hybrids studied. The primers used produced ≈40 reproducible bands. It was possible to identify and uniquely distinguish all species and hybrids investigated using these bands.
17
Cha, Jeong-Hee, Gye-Young Kim, and Hyung-Il Choi. "Occlusion Processing in Simulation using Improved Object Contour Extraction Algorithm by Neighboring edge Search and MER." Journal of Korean Institute of Intelligent Systems 18, no. 2 (April 25, 2008): 206–11. http://dx.doi.org/10.5391/jkiis.2008.18.2.206.
Повний текст джерела
18
Siron, Robert, and Gérard Giusti. "Hydrocarbon pollution in particle-rich waters (Gulf of Fos-sur-mer): comparative study of extraction procedures." Marine Chemistry 30 (January 1990): 379–88. http://dx.doi.org/10.1016/0304-4203(90)90082-n.
Повний текст джерела
19
Parham, Nicholas J., François J. Picard, Régis Peytavi, Martin Gagnon, Grégoire Seyrig, Pier-Ann Gagné, Maurice Boissinot, and Michel G. Bergeron. "Specific Magnetic Bead–Based Capture of Genomic DNA from Clinical Samples: Application to the Detection of Group B Streptococci in Vaginal/Anal Swabs." Clinical Chemistry 53, no. 9 (September 1, 2007): 1570–76. http://dx.doi.org/10.1373/clinchem.2007.091389.
Повний текст джерелаАнотація:
Abstract Background: Group B streptococci (GBS) are a leading cause of sepsis and meningitis in newborns. We previously developed a rapid diagnostic system for GBS detection from vaginal/anal samples obtained from pregnant women during delivery. To facilitate the adaptation of this method for point-of-care testing, we have developed a specific and efficient GBS DNA capture method that is compatible with both PCR and nonamplification detection technologies. Methods: Superparamagnetic beads were functionalized with oligonucleotide capture probes of different lengths and used to capture GBS genomic DNA (gDNA). A rapid extraction procedure was used to provide DNA from GBS cultures or vaginal/anal samples with added GBS. Hybridization reactions consisting of functionalized beads and target DNA in 30 μL of hybridization buffer were performed for 1 h at room temperature, followed by washing and resuspension in water. Captured DNA was then detected using quantitative PCR. Results: A 25-mer capture probe allowed detection of 1000 genome copies of purified GBS DNA. The ability to detect GBS was improved by use of a 50-mer (100 copies) and a 70-mer capture probe (10 copies). Detection of approximately 1250 CFU/mL was achieved for diluted GBS broth culture and for vaginal/anal swab samples with added GBS. Conclusion: Oligonucleotide-functionalized superparamagnetic microbeads efficiently capture GBS gDNA from both bacterial cultures and vaginal/anal samples with added GBS. Efficiency of gDNA capture increases with oligonucleotide length. This technology could be combined with sample preparation and detection technologies in a microfluidic system to allow point-of-care testing for GBS.
20
Anshori, Mochammad, Wayan Firdaus Mahmudy, and Ahmad Afif Supianto. "Classification Tuberculosis DNA using LDA-SVM." Journal of Information Technology and Computer Science 4, no. 3 (December 20, 2019): 233. http://dx.doi.org/10.25126/jitecs.201943113.
Повний текст джерелаАнотація:
Tuberculosis is a disease caused by the mycobacterium tuberculosis virus. Tuberculosis is very dangerous and it is included in the top 10 causes of the death in the world. In its detection, errors often occur because it is similar to other diffuse lungs. The challenge is how to better detect using DNA sequence data from mycobacterium tuberculosis. Therefore, preprocessing data is necessary. Preprocessing method is used for feature extraction, it is k-Mer which is then processed again with TF-IDF. The use of dimensional reduction is needed because the data is very large. The used method is LDA. The overall result of this study is the best k value is k = 4 based on the experiment. With performance evaluation accuracy = 0.927, precision = 0.930, recall = 0.927, F score = 0.924, and MCC = 0.875 which obtained from extraction using TF-IDF and dimension reduction using LDA.
21
Halperin, Drora, Caroline Reuben, Shlomo Ben-Efraim, Norman Grover, and David W. Weiss. "Effects of the methanol extraction residue (MER) tubercle bacillus fraction on the production of antibodies in vitro." Cellular Immunology 92, no. 2 (May 1985): 404–13. http://dx.doi.org/10.1016/0008-8749(85)90021-8.
Повний текст джерела
22
Meydia, Meydia, Ruddy Suwandi, and Pipih Suptijah. "Isolation Of Compounds Of Steroids Teripang Gamat (Stichopus variegatus) With Various Types Of Solvents." Jurnal Pengolahan Hasil Perikanan Indonesia 19, no. 3 (February 6, 2017): 363. http://dx.doi.org/10.17844/jphpi.v19i3.15114.
Повний текст джерелаАнотація:
<p>Abstract<br />Sea cucumber is one of the fisheries commodity that has an important economic value. Generally is traded in dried form (beche-de-mer). One of thebioactive substances contained in sea cucumber is steroid compounds that serves as an aphrodisiac and sex reversal. The purpose of this study was to extract the steroid of the gamma sea cucumber by using three types of solvents (methanol, ethyl acetate and hexane) and get the best solvent in producing the highest yield of the steroids. The study revealed that steroid of gamma sea cucumber (Stichopus variegatus) dissolved completely ethyl acetate (semi-polar solvent) during the first phase, second phase and the third phase of extraction. In the methanol (polar solvent) steroids only dissolved in the first extraction phase, while using the hexane (non polar solvent) steroid was undetectable. Fractionation by thin layer chromatography was obtained two fractions that identified as cholesterol (Rf = 0.96) and testosterone (Rf = 0.91).</p>
23
Kubatko, O. V., V. M. Ignatchenko, S. V. Shaparenko, I. A. Starodub, and D. O. Yaryomenko. "Economic Optimization of Resource Use Based on Smart Grid." Mechanism of an Economic Regulation, no. 2 (2020): 37–47. http://dx.doi.org/10.21272/mer.2020.88.03.
Повний текст джерелаАнотація:
There are significant changes in society's approaches to the energy policy development in the modern world. It is observable a transition from the old model of the energy sector maintenance, which was dominated by large producers, inefficient networks, fossil fuels, imperfect competition in the markets of natural gas, coal, electricity - to a new model, which creates a more competitive environment and equalizes opportunities for development and the dominance one of the types energy production or sources of fuel supply. The traditional network is based on centralized power plants that supply electricity to consumers through simple one-way transmission and distribution systems. The bulk of the current electricity generation capacity in Ukraine is generated by fossil fuels, which significantly contributes to the increase of the carbon dioxide concentration in the Earth's atmosphere and has a corresponding negative consequences for the climate. At the same time, modern preferences are given to increasing energy efficiency and the use of energy from renewable and alternative sources. Implementation of adaptation and prevention measures for climate change is also one of the priorities of global energy development. The renewable energy promotion is causing new economic and scientific challenges for Ukraine. However, at the same time it opens new perspectives for the search and implementation of innovative developments in the field of extraction, processing of fossil fuels, energy supply and consumption, which leads to create a new energy policy of the state. The article discusses theoretical and methodological approaches that reveal the benefits of Smart Grid using. It is emphasized that ensuring energy security and environmental sustainability of the energy sector should be based on the use of renewable energy sources. The article analyzes the main factors that can affect the development of Smart Grid technology. Also, the article describes the best experience of the EU countries, which are introducing smart energy systems for the economic optimization of renewable energy sources use.
24
Mayanja, Ismael Kilinya, Michael C. Coates, Franz Niederholzer, and Irwin R. Donis-González. "Development of a Stockpile Heated and Ambient Air Dryer (SHAD) for Freshly Harvested Almonds." Applied Engineering in Agriculture 37, no. 3 (2021): 417–25. http://dx.doi.org/10.13031/aea.14364.
Повний текст джерелаАнотація:
HighlightsAlmonds are conventionally sun-dried on the orchard floor. Collection and removal of dried nuts from the orchard generates significant dust.Almonds were dried on-farm directly from the almond tree eliminating field drying.SHAD dryer uses a combination of heated and ambient air to dry almonds in a stockpile.The dryer has a SMER of 0.64 kg/kWh, MER of 1.02 kg/h, and COP of 1.33.Abstract. Dust generated by farming activities is a safety hazard to farmworkers and an environmental contaminant. During the almond (Prunus dulcis) harvest in California, dust is primarily generated by the mechanized movement of almonds disturbing the bare soil of the orchard floor, during the sun-drying, windrowing process, and as they are transferred into trucks for transport to processing facilities. Off-ground dust-less harvesting will only be achieved when the almond industry adopts feasible mechanical drying methods. Therefore, a stockpile heated and ambient air dryer (SHAD) was developed to determine the feasibility of dehydrating almonds (Var. ‘Monterey’). A stockpile containing 4,155 kg of almonds was created and almonds were dehydrated from their initial 12.6% almond kernel dry-basis moisture content (MCdb) to final MCdb of 6.04%. Drying was achieved as a combination of heated air at a temperature of 55°C in the drying plenum with airflow of 0.078 m3/s per m3 of fresh almonds. After drying, almond quality parameters were measured, including damage by molds or decay, insect injury, and presence of internal cavities. Drying energy consumption, cost, and performance indicators were also determined. The differences in MCdb between the bottom, middle, and top layers of the almond stockpile were significant (p = 0.05). Post-hoc Tuckey test was conducted which indicated that the MCdb in the top layer was significantly lower than almond MCdb in the middle and bottom layers. Results showed that damage by molds or decay, insect injury, and internal cavities were 1.81%, 0%, and 1.77%, respectively, after drying. Therefore, the overall almond quality was not compromised. The drying process cost $11.65 per tonne of the initial weight of almonds with a Specific Moisture Extraction Rate (SMER) of 0.64 kg/kWh, Moisture Extraction Rate (MER) of 1.02 kg/h, and a Coefficient of Performance (COP) of 1.33. Comparison with other dryers in the literature shows that SMER and MER were within limits. However, a low COP was observed. Keywords: Dust, Energy, Postharvest, Stockpile drying, Tree nut.s
25
Mannarelli, B. M., and C. P. Kurtzman. "Rapid Identification of Candida albicansand Other Human Pathogenic Yeasts by Using Short Oligonucleotides in a PCR." Journal of Clinical Microbiology 36, no. 6 (1998): 1634–41. http://dx.doi.org/10.1128/jcm.36.6.1634-1641.1998.
Повний текст джерелаАнотація:
A PCR system that can quickly and accurately identify 14 species of human pathogenic yeasts was developed. The procedure distinguished between nine species of a closely related clade, Lodderomyces elongisporus, Candida parapsilosis, a newCandida sp., C. sojae, C. tropicalis, C. maltosa, C. viswanathii,C. albicans, and C. dubliniensis and between another five more divergent species, Pichia guilliermondii,C. glabrata, C. zeylanoides, C. haemulonii, and C. haemulonii type II. A rapid DNA extraction procedure that yields purified DNA in about 1 h is also described. The system uses uniform conditions with four primers for each reaction, two 40- to 50-mer universal primers that serve as a positive control and two 23- to 30-mer species-specific primers. Species-specific primers were derived from a 600-nucleotide variable region (D1/D2) at the 5′ end of the large-subunit (26S) ribosomal DNA gene and were generally designed to use mismatches at the 3′ end. Universal primers were developed from conserved nucleotide sequences in the small-subunit (18S) rRNA gene. In this system, a control 1,200- to 1,300-base DNA fragment was produced in all reactions and a smaller 114- to 336-base DNA fragment was produced if the chromosomal DNA from the target species was present. The PCR procedure is rapid and easy to interpret and may be used with mixed cultures.
26
Golabi, Faegheh, Elnaz Mehdizadeh Aghdam, Mousa Shamsi, Mohammad Hossein Sedaaghi, Abolfazl Barzegar, and Mohammad Saeid Hejazi. "Classification of seed members of five riboswitch families as short sequences based on the features extracted by Block Location-Based Feature Extraction (BLBFE) method." BioImpacts 11, no. 2 (April 17, 2020): 101–9. http://dx.doi.org/10.34172/bi.2021.17.
Повний текст джерелаАнотація:
Introduction: Riboswitches are short regulatory elements generally found in the untranslated regions of prokaryotes’ mRNAs and classified into several families. Due to the binding possibility between riboswitches and antibiotics, their usage as engineered regulatory elements and also their evolutionary contribution, the need for bioinformatics tools of riboswitch detection is increasing. We have previously introduced an alignment independent algorithm for the identification of frequent sequential blocks in the families of riboswitches. Herein, we report the application of block location-based feature extraction strategy (BLBFE), which uses the locations of detected blocks on riboswitch sequences as features for classification of seed sequences. Besides, mono- and dinucleotide frequencies, k-mer, DAC, DCC, DACC, PC-PseDNC-General and SC-PseDNC-General methods as some feature extraction strategies were investigated. Methods: The classifiers of the Decision tree, KNN, LDA, and Naïve Bayes, as well as k-fold cross-validation, were employed for all methods of feature extraction to compare their performances based on the criteria of accuracy, sensitivity, specificity, and f-score performance measures. Results: The outcome of the study showed that the BLBFE strategy classified the riboswitches indicating 87.65% average correct classification rate (CCR). Moreover, the performance of the proposed feature extraction method was confirmed with average values of 94.31%, 85.01%, 95.45% and 85.38% for accuracy, sensitivity, specificity, and f-score, respectively. Conclusion: Our result approved the performance of the BLBFE strategy in the classification and discrimination of the riboswitch groups showing remarkable higher values of CCR, accuracy, sensitivity, specificity and f-score relative to previously studied feature extraction methods.
27
Li, Jing, Ju Liu, Jennifer Enders, Michael Arciprete, Chris Tran, Krishna Aluri, Li-Hua Guan, et al. "Discovery of a novel deaminated metabolite of a single-stranded oligonucleotide in vivo by mass spectrometry." Bioanalysis 11, no. 21 (November 2019): 1955–65. http://dx.doi.org/10.4155/bio-2019-0118.
Повний текст джерелаАнотація:
Aim: A novel single-stranded deaminated oligonucleotide metabolite resulting from a REVERSIR™ oligonucleotide was discovered and identified in monkey liver after subcutaneous administration. Results & methodology: REVERSIR-A and its metabolites were extracted from biological matrices by solid phase extraction and analyzed using LC coupled with high-resolution MS under negative ionization mode. A novel 9-mer metabolite of REVERSIR-A, resulting from deamination of the 3′ terminal 2′- O-methyl-adenosine nucleotide to 2′- O-methyl-inosine, was discovered at significant levels in monkey liver. The metabolite's identity was confirmed by LC–MS/MS. Conclusion: This report describes the first observation of a long-chain deaminated metabolite of a single-stranded REVERSIR oligonucleotide in vivo in monkey liver.
28
Murphy, Anthony T., Patricia Brown-Augsburger, Rosie Z. Yu, Richard S. Geary, Stefan Thibodeaux, and Bradley L. Ackermann. "Development of an Ion-Pair Reverse-Phase Liquid Chromatographic/Tandem Mass Spectrometry Method for the Determination of an 18-Mer Phosphorothioate Oligonucleotide in Mouse Liver Tissue." European Journal of Mass Spectrometry 11, no. 2 (April 2005): 209–15. http://dx.doi.org/10.1255/ejms.674.
Повний текст джерелаАнотація:
A quantitative method for the determination of a partially modified, 2′-ribose alkoxy 18-mer phosphorothioate oligonucleotide in liver tissue has been developed. A liquid:liquid extraction, ion-pair reverse phase chromatographic separation and tandem mass spectrometry were used to achieve a quantitation range of 125 to 10,000 ng g−1 mouse liver tissue. A total cycle time of 5 min was obtained while maintaining separation of three potential impurities. Separations were performed using a Discovery RP-Amide C16, 100 × 2 mm column packed with 5 μm particles. The separation was facilitated by the use of triethylamine (TEA) and hexafluoroisopropanol (HFIP) as ion-pair agents. The method has subsequently been used for the determination of other phosphorothioate oligonucleotides in support of discovery research.
29
Meydia, Meydia, Ruddy Suwandi, and Pipih Suptijah. "Isolation Of Compounds Of Steroids Teripang Gamat (Stichopus variegatus) With Various Types Of Solvents." Jurnal Pengolahan Hasil Perikanan Indonesia 19, no. 3 (December 26, 2016): 363. http://dx.doi.org/10.17844/jphpi.v19i3.14548.
Повний текст джерелаАнотація:
Sea cucumber is one of the fisheries commodity that has an important economic value. Generally is<br />traded in dried form (beche-de-mer). One of thebioactive substances contained in sea cucumber is steroid<br />compounds that serves as an aphrodisiac and sex reversal. The purpose of this study was to extract the<br />steroid of the gamma sea cucumber by using three types of solvents (methanol, ethyl acetate and hexane)<br />and get the best solvent in producing the highest yield of the steroids. The study revealed that steroid of<br />gamma sea cucumber (Stichopus variegatus) dissolved completely ethyl acetate (semi-polar solvent) during<br />the first phase, second phase and the third phase of extraction. In the methanol (polar solvent) steroids only<br />dissolved in the first extraction phase, while using the hexane (non polar solvent) steroid was undetectable.<br />Fractionation by thin layer chromatography was obtained two fractions that identified as cholesterol (Rf =<br />0.96) and testosterone (Rf = 0.91).<br /><br />
30
Daupor, Hasan. "Extraction of Hydroxyapatite by Alkaline Acid from Budu Waste and Synthesis Using Calcination Method." Journal of Physics: Conference Series 2049, no. 1 (October 1, 2021): 012041. http://dx.doi.org/10.1088/1742-6596/2049/1/012041.
Повний текст джерелаАнотація:
Abstract Hydroxyapatite powders were synthesised using anchovy fish bone waste collected from the Budu production process. Liquid Budu factory leaved much fish bones waste containing valuable calcium and phosphorous. It was extracted by two different acid solutions (HCl and HNO3) and was subsequently precipitated by NH4OH. Finally, as-prepared products were calcined at 800 °C for 2 hours in a muffle furnace. The per cent yield of both obtaining products was 80%. The obtained samples were characterised by X-ray diffractometry (XRD), Fourier-transform infrared (FT-IR) spectroscopy and energy dispersive X-ray spectrometry (EDS). As a result, the XRD patterns of the products prepared from two different acids were identical; these acids have no significant influence on the structure of a product. The XRD patterns were identified as calcium magnesium sodium pentaphosphate [Ca9MgNa(PO4)7] or merrillite (MER) crystallisation in the rhombohedral structure, and the crystal sizes of these products were estimated as nanometers. The FT-IR spectra showed the vibration modes of PO4 3- at 562, 596, 983, and 1034 cm−1, while the peak located at 369 cm−1 correspondings to the vibration of the metal-oxygen bonding in the merrillite structure. Moreover, the presence of Mg2+ in the product was confirmed by EDS technique. This paper showed the excellent potential for the phase transformation of merrillite from hydroxyapatite at low temperatures.
31
Zhao, Zheng-Yang, Jie Lin, Zhen Wang, Jian-Xin Guo, Xin-Ke Zhan, Yu-An Huang, Chuan Shi, and Wen-Zhun Huang. "SEBGLMA: Semantic Embedded Bipartite Graph Network for Predicting lncRNA-miRNA Associations." International Journal of Intelligent Systems 2023 (February 24, 2023): 1–15. http://dx.doi.org/10.1155/2023/2785436.
Повний текст джерелаАнотація:
Identifying the association between long noncoding RNA (lncRNA) and micro-RNA (miRNA) is of great significance for the treatment of diseases by interfering with the combination of miRNA and messenger RNA (mRNA). Although many efforts and resources have been invested to identify lncRNA-miRNA associations (LMAs), clinical trials are still expensive and laborious. Nevertheless, the experiments also need to consult a large number of side effects. Therefore, novel computer-aided models are urgently needed to predict LMAs. This paper proposed a semantic embedded bipartite graph network for predicting lncRNA-miRNA associations (SEBGLMA), which provided a novel feature extraction method by integrating K-mer segmentation, word2vec, Gaussian interaction profile (GIP), and graph convolution network (GCN). Concretely, the attribute characteristics of RNA sequences are extracted by K-mer segmentation and word2vec modules. Afterward, the adjacent matrix is completed by GIP self-similarity. Then, the attribute characteristics and adjacent matrix are fed into GCN for embedding behavior features. Finally, the features are sent into the rotation forest (RoF) for detecting potential LMAs. The average accuracy, precision, sensitivity, specificity, Matthews correlation coefficient, and F1-Score are 87.09%, 87.66%, 87.03%, 87.84%, 74.18%, and 86.99% on the benchmark data set. For fairly validating the performance of our model, we conducted various comparisons with different classifiers. Furthermore, the case studies of hsa-miR-497-5P and NONHSAT022145.2 are also established. The results of comparisons and case studies further illustrated that our method is anticipated to become a robust and reliable tool for the identification of LMAs.
32
Muflikhah, Lailil, Muh Arif Rahman, and Agus Wahyu Widodo. "Profiling DNA Sequence of SARS-Cov-2 Virus Using Machine Learning Algorithm." Bulletin of Electrical Engineering and Informatics 11, no. 2 (April 1, 2022): 1037–46. http://dx.doi.org/10.11591/eei.v11i2.3487.
Повний текст джерелаАнотація:
Corona virus disease-19 (COVID-19) is growing rapidly because it is an infectious disease. This disease is caused by a virus belonging to the type of DNA virus with very diverse genetics. This study proposes a feature extraction method using k-mer to obtain nucleotide frequencies in protein coding. In profiling viral DNA sequences, this study proposes to obtain similarity by country using hierarchical k-means, where the results are averaged by the hierarchical clustering method and then find the initial cluster center. The experimental results show that the silhouette, purity, and entropy are 0.867, 0.208, and 0.892, respectively. Then, we apply the Gini index feature selection to find the important components as characteristics in each country. The selected components are implemented using the ensemble method, Random Forest, to evaluate their performance. The experimental results showed high performance, including sensitivity, accuracy, specificity, and area under the curve (AUC).
33
Grobe, George L., Anthony S. Nagel, Joseph A. Gardella, Roland L. Chin, and Lawrence Salvati. "Characterization of Solution-Cast Extracts from Cardiothane-51 ® by FT-IR and ESCA." Applied Spectroscopy 42, no. 6 (August 1988): 980–89. http://dx.doi.org/10.1366/0003702884430506.
Повний текст джерелаАнотація:
Extracts from Cardiothane-51 ® have been cast from solvents of varying polarity. Cardiothane-51® can be described as block polyether-polyurethane copolymer with a 10% by weight addition of polydimethylsiloxane (DMS) that is partially copolymerized and partially blended to form a copolv mer/polv blend. FT-IR has been utilized to probe bulk and near-surface bonding and composition in the solution-cast extract films. Results show that Cardiothane-51 ® is similar in bulk composition, as measured by FT-IR, to Avcothane-51®. However, these two polymers are quite different in composition over a depth of microns. Both Cardiothane-51 ® and Avcothane-51 ® have surfaces, as measured by ESCA, which are dominated by their DMS component with a significant amount of the polyether present. Results suggest that the DMS in Cardiothane-51 ® is a blended phase, because of its ease of extraction.
34
Shi, Yongqi, Ruopeng Yang, Changsheng Yin, Yiwei Lu, Yuantao Yang, and Yu Tao. "Entity Linking Method for Chinese Short Texts with Multiple Embedded Representations." Electronics 12, no. 12 (June 15, 2023): 2692. http://dx.doi.org/10.3390/electronics12122692.
Повний текст джерелаАнотація:
Entity linking, a crucial task in the realm of natural language processing, aims to link entity mentions in a text to their corresponding entities in the knowledge base. While long documents provide abundant contextual information, facilitating feature extraction for entity identification and disambiguation, entity linking in Chinese short texts presents significant challenges. This study introduces an innovative approach to entity linking within Chinese short texts, combining multiple embedding representations. It integrates embedding representations from both entities and relations in the knowledge graph triples, as well as embedding representations from the descriptive text of entities and relations, to enhance the performance of entity linking. The method also incorporates external semantic supplements to strengthen the model’s feature learning capabilities. The Multi-Embedding Representation–Bidirectional Encoder Representation from Transformers–Bidirectional Gated Recurrent Unit (MER-BERT-BiGRU) neural network model is employed for embedding learning. The precision, recall, and F1 scores reached 89.73%, 92.18%, and 90.94% respectively, demonstrating the effectiveness of our approach.
35
Masotti, Andrea, Viviana Caputo, Letizia Da Sacco, Antonio Pizzuti, Bruno Dallapiccola, and Gian Franco Bottazzo. "Quantification of Small Non-Coding RNAs Allows an Accurate Comparison of miRNA Expression Profiles." Journal of Biomedicine and Biotechnology 2009 (2009): 1–9. http://dx.doi.org/10.1155/2009/659028.
Повний текст джерелаАнотація:
MicroRNAs (miRNAs) are highly conserved∼22-mer RNA molecules, encoded by plants and animals that regulate the expression of genes binding to the3′-UTR of specific target mRNAs. The amount of miRNAs in a total RNA sample depends on the recovery efficiency that may be significantly affected by the different purification methods employed. Traditional approaches may be inefficient at recovering small RNAs, and common spectrophotometric determination is not adequate to quantify selectively these low molecular weight (LMW) species from total RNA samples. Here, we describe the use of qualitative and quantitativelab-on-a-chiptools for the analysis of these LMW RNA species. Our data emphasize the close correlation of LMW RNAs with the expression levels of some miRNAs. We therefore applied our result to the comparison of some miRNA expression profiles in different tissues. Finally, the methods we used in this paper allowed us to analyze the efficiency of extraction protocols, to study the small (but significant) differences among various preparations and to allow a proper comparison of some miRNA expression profiles in various tissues.
36
Deng, Xiang, Huan Sun, Alyssa Lees, You Wu, and Cong Yu. "TURL." Proceedings of the VLDB Endowment 14, no. 3 (November 2020): 307–19. http://dx.doi.org/10.14778/3430915.3430921.
Повний текст джерелаАнотація:
Relational tables on the Web store a vast amount of knowledge. Owing to the wealth of such tables, there has been tremendous progress on a variety of tasks in the area of table understanding. However, existing work generally relies on heavily-engineered task-specific features and model architectures. In this paper, we present TURL, a novel framework that introduces the pre-training/fine-tuning paradigm to relational Web tables. During pre-training, our framework learns deep contextualized representations on relational tables in an unsupervised manner. Its universal model design with pre-trained representations can be applied to a wide range of tasks with minimal task-specific fine-tuning. Specifically, we propose a structure-aware Transformer encoder to model the row-column structure of relational tables, and present a new Masked Entity Recovery (MER) objective for pre-training to capture the semantics and knowledge in large-scale unlabeled data. We systematically evaluate TURL with a benchmark consisting of 6 different tasks for table understanding (e.g., relation extraction, cell filling). We show that TURL generalizes well to all tasks and substantially outperforms existing methods in almost all instances.
37
Pan, Y. B., M. P. Grisham, D. M. Burner, K. E. Damann, and Q. Wei. "A Polymerase Chain Reaction Protocol for the Detection of Clavibacter xyli subsp. xyli, the Causal Bacterium of Sugarcane Ratoon Stunting Disease." Plant Disease 82, no. 3 (March 1998): 285–90. http://dx.doi.org/10.1094/pdis.1998.82.3.285.
Повний текст джерелаАнотація:
A polymerase chain reaction (PCR) protocol was developed that specifically detected Clavibacter xyli subsp. xyli, the causal agent of sugarcane ratoon stunting disease. Generic PCR products from the intergenic transcribed spacer (ITS) region of 16S-23S ribosomal DNA of C. xyli subsp. xyli and C. xyli subsp. cynodontis were cloned and sequenced. Based on a multiple sequence alignment among these two sequences and other nonredundant highly homologous sequences from the database, two C. xyli subsp. xyli-specific PCR primers were designed, Cxx1 (5′ CCGAAGTGAGCAGATTGACC) and Cxx2 (5′ ACCCTGTGTTGTTTTCAACG). These two 20-mer oligonucleotides primed the specific amplification of a 438-bp DNA product from genomic DNA samples of 21 C. xyli subsp. xyli strains. Amplification was not observed with genomic DNA of one C. xyli subsp. cynodontis strain, five strains of four other Clavibacter species, and two strains of two Rathayibacter species. The 438-bp PCR product also was amplified directly from cultured C. xyli subsp. xyli cells and from C. xyli subsp. xyli-infected sugarcane vascular sap with a unique reaction buffer containing polyvinylpyrrolidone and ficoll. Extraction of genomic DNA was not necessary prior to PCR assay.
38
Ilyasova, X. N. "THE STUDY OF ION-EXCHANGE EQUILIBRIUM OF HEAVY METAL IONS Cо2+ AND Cd2+ ON THE NATURAL AND SYNTHETIC SORBENTS". Azerbaijan Chemical Journal, № 4 (8 грудня 2022): 122–27. http://dx.doi.org/10.32737/0005-2531-2022-4-122-127.
Повний текст джерелаАнотація:
These article summaries the results of studying the sorption equilibrium of ions close to their concentration in the liquid industrial waste. For experimental research, solutions with concentration of Со2+ and Cd2+ ions in the range of 1·10-3–1·10-4 N have been used. These concentrations match to ion con¬cen¬tration in industrial liquid waste with the ions mentioned. In the experiments, the Na+- modified forms of natural sorbents based on clinoptilolite from the Aydag deposit and on bentonite from the Dash-Salakhli (Azerbaijan) deposit were used. For comparison, among industrial sorbents, we used synthetic cation exchanger KU–2–8 (styrene and divinylbenzene co–poly¬mer), which we modified in H+, Na+-form. The thermodynamic constant of ion-exchange equilibrium for differently charged ions, calculated by the Gorshkov-Tolmachev formula, does not depend on the solution concentration, and to calculate this value, it is not required to determine the activity coefficient. Based on experiments to determine equilibrium concentrations, we can recommend inexpensive and available Na-clinoptilolite and Na-bentonite instead of synthetic industrial KU-2-8 for the sorption extraction of Co2+ and Cd2+ ions from wastewater
39
Benkrid, M., and A. Noureddine. "Plutonium Isotopes Concentration in Seawater along the Algerian Coast." Science and Technology of Nuclear Installations 2007 (2007): 1–5. http://dx.doi.org/10.1155/2007/68742.
Повний текст джерелаАнотація:
The International Atomic Energy Agency has organised in the framework of the regional project RAF/7/004, in collaboration with “Commissariat à l'Energie Atomique” (COMENA) and “Institut des Sciences de la Mer et de l'Aménagement du Littoral” (ISMAL), during August 2001, a scientific campaign along the Algerian coast, on board of the research vessel M.S. Benyahia of ISMAL is. Three stations, at the centre, east and west, were selected to collect five seawater samples for each water column reaching a maximum depth of 2000 m, using a stainless-steel water sampler of a volume of 250 litres. After recording the marine environment parameters (temperature and conductivity), seawater samples were conditioned and preconcentrated to precipitate plutonium isotopes usingMnCl2in the form ofMnO2in order to proceed to plutonium extraction by radiochemical separation and prepare the source by coprecipitation using neodymium fluoride (NdF3) by vacuum filtration and an evaluation of the activity by alpha spectrometry. Concentration results in units ofμBq/l of plutonium isotopes were obtained in the range of 6.7±1.00 to 25.5±3.70 forP239+240uand 0.21±0.04 to 0.77±0.15 forP238u. Distribution of Pu through the plot of its profile was studied and the concentration was estimated. The obtained results were compared toC137sand those found by other authors in the same Mediterranean area.
40
Gaseitsiwe, Simani, Davide Valentini, Raija Ahmed, Shahnaz Mahdavifar, Isabelle Magalhaes, Johannes Zerweck, Mike Schutkowski, et al. "Major Histocompatibility Complex Class II Molecule-Human Immunodeficiency Virus Peptide Analysis Using a Microarray Chip." Clinical and Vaccine Immunology 16, no. 4 (February 18, 2009): 567–73. http://dx.doi.org/10.1128/cvi.00441-08.
Повний текст джерелаАнотація:
ABSTRACT Identification of major histocompatibility complex (MHC) class II binding peptides is a crucial step in rational vaccine design and immune monitoring. We designed a novel MHC class II molecule-peptide microarray binding assay and evaluated 346 peptides from already identified human immunodeficiency virus (HIV) epitopes and an additional set (n = 206) of 20-mer peptides, overlapping by 15 amino acid residues, from HIV type 1B (HIV-1B) gp160 and Nef as a paradigm. Peptides were attached via the N-terminal part to a linker that covalently binds to the epoxy glass slide. The 552 peptides were printed in triplicate on a single peptide microarray chip and tested for stable formation of MHC class II molecule-peptide complexes using recombinant soluble DRB1*0101(DR1), DRB1*1501(DR2), and DRB1*0401(DR4) molecules. Cluster analysis revealed unique patterns of peptide binding to all three, two, or a single MHC class II molecule. MHC class II binding peptides reside within previously described immunogenic regions of HIV gp160 and Nef, yet we could also identify new MHC class II binding peptides from gp160 and Nef. Peptide microarray chips allow the comprehensive and simultaneous screening of a high number of candidate peptide epitopes for MHC class II binding, guided by subsequent quality data extraction and binding pattern cluster analysis.
41
Yantsevich, Aleksei V., Veronika V. Shchur, and Sergey A. Usanov. "Oligonucleotide Preparation Approach for Assembly of DNA Synthons." SLAS TECHNOLOGY: Translating Life Sciences Innovation 24, no. 6 (June 5, 2019): 556–68. http://dx.doi.org/10.1177/2472630319850534.
Повний текст джерелаАнотація:
An effective oligonucleotide preparation approach for the thermodynamically balanced, inside-out (TBIO) PCR-based assembly of long synthetic DNA molecules (synthons) is described in the current work. We replaced the necessity to purify individual oligonucleotides with just one purification procedure per approximately 500 base pairs (bp) of duplex DNA. So for an enhanced green fluorescent protein (EGFP) gene of 717 bp, we synthesized 24 oligonucleotides with a length of 50 bases and performed just two solid-phase extraction (SPE) purification procedures. It was found that the capacity of ZipTip microextractors, usually used for sample desalting in proteomics, perfectly corresponds to the gene synthesis scale (40–60 pmol). The robustness of the approach was validated with a 65-mer oligonucleotide design of the same gene. The modification of the oligonucleotide concentration gradient from the original TBIO scheme substantially increased the purity of the PCR product. We proposed a mechanism for the formation of supramolecular structures, which often occur during TBIO assembly. By using the proposed workflow, any laboratory with a standard facility for molecular biology manipulation, a 16-channel oligonucleotide synthesizer, and a conventional thermocycler has the ability to prepare one gene with a length of about 700 bp per day.
42
Andreazza, R., L. Bortolon, S. Pieniz, F. M. Bento, and F. A. O. Camargo. "Evaluation of two Brazilian indigenous plants for phytostabilization and phytoremediation of copper-contaminated soils." Brazilian Journal of Biology 75, no. 4 (November 10, 2015): 868–77. http://dx.doi.org/10.1590/1519-6984.01914.
Повний текст джерелаАнотація:
Abstract Indigenous plants have been grown naturally and vigorously in copper contaminated soils. Thus, the aim of this study was to evaluate the phytoremediation ability of two indigenous plants naturally grown in two vineyard soils copper contaminated, and in a copper mining waste. However, it was evaluated the macro and micronutrient uptake and the potential of phytoremediation. So, a greenhouse study was carried out with Bidens pilosa and Plantago lanceolata in samples of vineyard soils (Inceptisol and Mollisol) copper contaminated, and in a copper mining waste. Plant growth, macro and micronutrient up take, tolerance index (TI), translocation factor (TF), metal extraction ratio (MER), bioaccumulation factor (BCF), plant effective number of the shoots (PENs), and plant effective number of the total plant (PENt) were analyzed. Both plants grown in vineyard soils showed high phytomass production and TI. P. lanceolata plants cultivated in the Inceptisol showed the highest copper concentrations in the shoots (142 mg kg–1), roots (964 mg kg–1) and entire plants (1,106 mg kg–1). High levels of copper were phytoaccumulated from the Inceptisol by B. pilosa and P. lanceolata with 3,500 and 2,200 g ha–1 respectively. Both B. pilosa and P. lanceolata plants showed characteristics of high copper hyperaccumulator. Results showed that both species play an important role in the natural copper phytoaccumulation in both vineyard soils contaminated with copper, being important to its phytoremediation.
43
Kaltsas, Aris, Eleftheria Markou, Athanasios Zachariou, Fotios Dimitriadis, Evangelos N. Symeonidis, Athanasios Zikopoulos, Charalampos Mamoulakis, Dung Mai Ba Tien, Atsushi Takenaka, and Nikolaos Sofikitis. "Evaluating the Predictive Value of Diagnostic Testicular Biopsy for Sperm Retrieval Outcomes in Men with Non-Obstructive Azoospermia." Journal of Personalized Medicine 13, no. 9 (September 7, 2023): 1362. http://dx.doi.org/10.3390/jpm13091362.
Повний текст джерелаАнотація:
Background: Non-obstructive azoospermia (NOA) presents a challenge in male infertility management. This study aimed to assess the efficacy of diagnostic testicular biopsy (DTB) in predicting sperm retrieval success via therapeutic testicular biopsy (TTB) and to understand the role of systemic inflammation in microdissection testicular sperm extraction (mTESE) outcomes. Methods: A retrospective analysis was conducted on 50 NOA males who underwent mTESE at the University of Ioannina’s Department of Urology from January 2017 to December 2019. All participants underwent thorough medical evaluations, including semen analyses and endocrinological assessments. Results: DTB did not detect spermatozoa in half of the patients who later showed positive sperm findings in TTB. Preoperative variables, such as age, plasma levels of follicle-stimulating hormone (FSH), luteinizing hormone (LH), total testosterone (TT), prolactin (PRL), estradiol (E2), and inflammation biomarkers (neutrophil–lymphocyte ratio (NLR), platelet–lymphocyte ratio (PLR), monocyte–eosinophil ratio (MER)), were not consistently predictive of sperm retrieval success. Notably, TTB-negative patients had elevated NLR and PLR values, suggesting a possible link between systemic inflammation and reduced sperm retrieval during mTESE. Conclusions: The findings question the necessity of an initial DTB, which might provide misleading results. A negative DTB should not deter further TTB or intracytoplasmic sperm injection (ICSI) attempts. The study emphasizes the need for further research to refine diagnostic approaches and deepen the understanding of factors influencing sperm retrieval in NOA patients, ultimately enhancing their prospects of biological parenthood.
44
Zhang, Dan, Bisheng Huang, Wei Wu, and Siliang Li. "An Idle-State Detection Algorithm for SSVEP-Based Brain–Computer Interfaces Using a Maximum Evoked Response Spatial Filter." International Journal of Neural Systems 25, no. 07 (August 27, 2015): 1550030. http://dx.doi.org/10.1142/s0129065715500306.
Повний текст джерелаАнотація:
Although accurate recognition of the idle state is essential for the application of brain–computer interfaces (BCIs) in real-world situations, it remains a challenging task due to the variability of the idle state. In this study, a novel algorithm was proposed for the idle state detection in a steady-state visual evoked potential (SSVEP)-based BCI. The proposed algorithm aims to solve the idle state detection problem by constructing a better model of the control states. For feature extraction, a maximum evoked response (MER) spatial filter was developed to extract neurophysiologically plausible SSVEP responses, by finding the combination of multi-channel electroencephalogram (EEG) signals that maximized the evoked responses while suppressing the unrelated background EEGs. The extracted SSVEP responses at the frequencies of both the attended and the unattended stimuli were then used to form feature vectors and a series of binary classifiers for recognition of each control state and the idle state were constructed. EEG data from nine subjects in a three-target SSVEP BCI experiment with a variety of idle state conditions were used to evaluate the proposed algorithm. Compared to the most popular canonical correlation analysis-based algorithm and the conventional power spectrum-based algorithm, the proposed algorithm outperformed them by achieving an offline control state classification accuracy of 88.0 ± 11.1% and idle state false positive rates (FPRs) ranging from 7.4 ± 5.6% to 14.2 ± 10.1%, depending on the specific idle state conditions. Moreover, the online simulation reported BCI performance close to practical use: 22.0 ± 2.9 out of the 24 control commands were correctly recognized and the FPRs achieved as low as approximately 0.5 event/min in the idle state conditions with eye open and 0.05 event/min in the idle state condition with eye closed. These results demonstrate the potential of the proposed algorithm for implementing practical SSVEP BCI systems.
45
S. PANDIN, DONATA. "KERAGAMAN GENETIK KELAPA DALAM BALI (DBI) DAN DALAM SAWARNA (DSA) BERDASARKAN PENANDA RANDOM AMPLIFIED POLYMORPHIC DNA (RAPD)." Jurnal Penelitian Tanaman Industri 16, no. 2 (June 19, 2020): 83. http://dx.doi.org/10.21082/jlittri.v16n2.2010.83-89.
Повний текст джерелаАнотація:
<p>ABSTRACT</p><p>Keragaman genetik dan hubungan kekerabatan dalam populasikelapa Dalam Bali (DBI) dan Dalam Sawarna (DSA) dianalisismenggunakan penanda RAPD. Penelitian dilaksanakan di LaboratoriumBiologi Tumbuhan, Pusat Penelitian Sumber Daya Hayati danBioteknologi, Institut Pertanian Bogor pada Februari-Mei 2007. Bahanyang digunakan dalam penelitian sebanyak 10 individu dari masing-masing populasi. Primer acak digunakan dalam analisis terdiri atas 10primer -10 mer yaitu OPA-02, OPA-08, OPA-10, OPA-13, OPA-20,OPB-08, OPB-11, OPB-12, OPB-15, OPB-20. DNA diekstraksimenggunakan metode Rohde yang telah dimodifikasi, konsentrasiditetapkan menggunakan metode Sambrook. Untuk melihat tingkatkekerabatan antar individu berdasarkan pola pita RAPD dari setiap primerdigunakan program NTsys ver. 2,0 (Program Numerical Taxonomy andMultivariate Analysis), sedangkan untuk analisis gerombol digunakanmetode UPGMA untuk membuat dendogram. Koefisien keragaman antarindividu dalam populasi kelapa DBI berkisar antara 2,4% – 30,7% denganrata-rata 21,7%, dan untuk populasi kelapa DSA antara 1,5% – 22,4%dengan rata-rata 12,7%. Jarak genetik individu-individu dalam populasikelapa Dalam Bali (DBI) cukup jauh menunjukkan bahwa keragamangenetik dalam populasi Dalam Bali masih tinggi, sehingga seleksi untukmaksud perbaikan sifat masih sangat memungkinkan. Pada populasikelapa Dalam Sawarna (DSA) jarak genetik individu-individu dalam sudahsemakin sempit, artinya keanekaragaman genetik antar individu di dalampopulasi DSA sudah sangat rendah oleh karena itu seleksi untuk maksudperbaikan sifat harus dilakukan dengan selektif. Hubungan kekerabatanantar populasi kelapa Dalam Bali dan Dalam Sawarna sebesar 44% artinyajarak genetik kedua populasi ini cukup jauh yaitu 56%. Sehingga jikaindividu-individu terseleksi dari kedua populasi tersebut disilangkan, akandiperoleh keturunan yang memilikinilai heterosis tinggi.</p><p>Kata kunci: Kelapa Dalam Bali, kelapa Dalam Sawarna, keragamangenetik, hubungan kekerabatan, RAPD</p><p>ABSTRACT</p><p>Genetic Diversity of Bali Tall (DBI) and Sawarna Tall(DSA) Coconuts Based on Random AmplifiedPolymorphic DNA (RAPD</p><p>)Genetic Diversity of Bali Tall (DBI) and Sawarna Tall (DSA)coconuts based on Random Amplified Polymorphic DNA (RAPD) wasobserved. Ten plants were used in each population. The objectives of thisresearch were to determine genetic diversity within-and inter-population ofBali Tall (DBI) and Sawarna Tall (DSA) coconuts, and geneticrelationship of those population based on RAPD (Random AmplifiedPolymorphic DNA). Research was done in Plant Biology Laboratory ofCenter Research of Genetic Resources and Biotechnology, InstitutPertanian Bogor, February – May 2007. DNA extraction was done bymodified Rohde method and to determine the concentration and quality ofDNA by Sambrook method. Ten RAPD 10-mer were used namely OPA-02, OPA-08, OPA-10, OPA-13, OPA-20, OPB-08, OPB-11, OPB-12,OPB-15, OPB-20. To find out the level of genetic relationship betweenindividuals based on RAPD banding pattern of each primer, we usedNTsys program ver. 2.0 (program Numerical Taxonomy and MultivariateAnalysis System), whereas for the analysis of clustering UPGMA methodis used to create a dendogram. These ten RAPD primers could separateDBI and DSA in each group. Genetic diversity within-population of BaliTall coconut population varied from 2.4 to 30.7% with average of 21.7%.So that, opportunity to improve characters in DBI coconut populationcould be done by selection. Genetic diversity within-population ofSawarna Tall coconut population progressively was narrow, ranging from1.5 to 12.4% with average 12.7%, so the selection in order to do characterimprovement in this population could be done selectively. Geneticrelationship between DBI dan DSA populations was far enough (54%), sothe crossing between those population will be good for charactersimprovment.</p><p>Key words : Bali Tall coconut, Sawarna Tall coconut, genetic diversity,genetic relationship, RAPD</p>
46
Cavaleri, Sylvie Cécile. "The Validity of Knock-for-Knock Clauses in Comparative Perspective." European Review of Private Law 26, Issue 1 (February 1, 2018): 3–29. http://dx.doi.org/10.54648/erpl2018002.
Повний текст джерелаАнотація:
Abstract: This article discusses the validity of so-called knock-for-knock clauses, by which parties to offshore oil and gas or maritime contracts agree that each of them will cover its own losses regardless of who caused them. The issue of validity of such clauses and of the liability exclusions they contain is analysed in a comparative perspective between the law of their tradition of origin (common law, especially UK law) and Nordic civil law, where such agreements are also frequently used, namely in the context of oil extraction activities in the North Sea. Based on an assessment of the different criteria used to promote or dismiss knock-for-knock clauses in case law and academic literature, the article reaches the conclusion that the question of whether knock-for-knock clauses should be held valid depends on whose interests are being considered, and that further research is warranted on the efficiency of mechanisms supposed to replace the deterrence effect of tort or contractual liability. Résumé: Le présent article traite de la validité des clauses dites knock-for-knock, par lesquelles les parties à des contrats en matière de production d´énergie offshore et de droit maritime conviennent que chacune des parties supportera les dommages qu´elle subit sans tenir compte de qui les a causés. La question de la validité de telles clauses et des exclusions de responsabilité qu´elles contiennent est analysée dans une perspective de droit comparé entre le droit de leur tradition d´origine (le droit commun, plus particulièrement le droit anglais) et le droit civil nordique, dans lequel de telles clauses sont également fréquemment employées, en particulier en relation avec les activités d ´extraction pétrolière dans la Mer du Nord. Sur la base d´une discussion des différents arguments avancés en faveur ou contre les clauses knock-for-knock, l´article parvient à la conclusion que la question de leur validité peut recevoir différentes réponses en fonction des acteurs dont les intérêts sont considérés. De surcroît, des recherches approfondies concernant l’efficacité de mesures contractuelles de droit public de sécurité et de prévention des accidents sont nécessaires afin de déterminer si l’effet de dissuasion visé par la responsabilité délictuelle ou contractuelle peut être atteint par d´autres moyens. Zusammenfassung: Dieser Artikel diskutiert die Gültigkeit von sogenannten Knockfor-Knock-Klauseln, durch die Parteien zu Offshore-Öl- und Gas- oder Seeverkehrsverträgen zustimmen, dass jeder von ihnen seine eigenen Verluste abdecken wird, unabhängig davon, wer sie verursacht hat. Die Frage der Gültigkeit solcher Klauseln und die darin enthaltenen Haftungsausschlüsse wird in einer vergleichenden Perspektive zwischen dem Gesetz ihrer Herkunft (Common Law, insbesondere dem britischen Recht) und dem nordischen Zivilrecht analysiert, wobei auch solche Vereinbarungen häufig verwendet werden im Rahmen der Ölförderung in der Nordsee. Auf der Grundlage einer Einschätzung der verschiedenen Kriterien, die zur Förderung oder Entlassung von Knock-for-Knock-Klauseln in der Rechtsprechung und der akademischen Literatur verwendet werden, kommt der Artikel zu dem Schluss, dass die Frage, ob Knock-for-Knock Klauseln gültig gehalten werden sollte, davon abhängt, wessen Interessen werden berücksichtigt, und dass weitere Untersuchungen über die Effizienz von Mechanismen, die die Abschreckungseffekte der unerlaubten Handlung oder der vertraglichen Haftung ersetzen sollen, gerechtfertigt sind.
47
HEESOM, Kate J., Matthew B. AVISON, Tricia A. DIGGLE, and Richard M. DENTON. "Insulin-stimulated kinase from rat fat cells that phosphorylates initiation factor 4E-binding protein 1 on the rapamycin-insensitive site (serine-111)." Biochemical Journal 336, no. 1 (November 15, 1998): 39–48. http://dx.doi.org/10.1042/bj3360039.
Повний текст джерелаАнотація:
The effects of insulin and rapamycin on the phosphorylation of the translation regulator, initiation factor 4E-binding protein 1 (4E-BP1) have been studied in rat fat cells by following changes in the incorporation of 32P from [32P]Pi under steady-state conditions. Both unbound 4E-BP1 and 4E-BP1 bound to eukaryotic initiation factor 4E (eIF4E) were isolated from the cells and then digested with trypsin and other proteases; the radiolabelled phosphopeptides were then separated by two-dimensional thin- layer analysis and HPLC. The results provide confirmation of the conclusion of Fadden, Haystead and Lawrence [J. Biol. Chem. (1997) 272, 10240–10247] that insulin increases the phosphorylation of four sites that fit a Ser/Thr-Pro motif (Thr-36, Thr-45, Ser-64 and Thr-69) and that taken together these phosphorylations result in the dissociation of 4E-BP1 from eIF4E. The effects of insulin on the phosphorylation of these sites, and hence dissociation from eIF4E, are blocked by rapamycin. However, the present study also provides evidence that insulin increases the phosphorylation of 4E-BP1 bound to eIF4E on a further site (Ser-111) and that this is by a rapamycin-insensitive mechanism. Extraction of rat epididymal fat cells followed by chromatography on Mono-S and Superose 12 columns resulted in the separation of both an insulin-stimulated eIF4E kinase and an apparently novel kinase that is highly specific for Ser-111 of 4E-BP1. The 4E-BP1 kinase was activated more than 10-fold by incubation of the cells with insulin and was markedly more active towards 4E-BP1 bound to eIF4E than towards unbound 4E-BP1. The effects of insulin were blocked by wortmannin, but not by rapamycin. A 14-mer peptide based on the sequence surrounding Ser-111 of 4E-BP1 was also a substrate for the kinase, but peptide substrates for other known protein kinases were not. The kinase is quite distinct from casein kinase 2, which also phosphorylates Ser-111 of 4E-BP1. The possible importance of these kinases in the phosphorylation of 4E-BP1 in fat cells is discussed. It is suggested that the phosphorylation of Ser-111 might be a priming event that facilitates the subsequent phosphorylation of Thr-36, Thr-45, Ser-64 and Thr69 by a rapamycin-sensitive process that initiates the dissociation of 4E-BP1 from eIF4E and hence the formation of the eIF4F complex.
48
Ivy, Morgan, Matthew Thoendel, Patricio Jeraldo, Kerryl Greenwood-Quaintance, Arlen D. Hanssen, Matthew Abdel, Nicholas Chia, et al. "Direct Detection and Identification of Prosthetic Joint Pathogens in Synovial Fluid (SF) by Metagenomic Shotgun Sequencing." Open Forum Infectious Diseases 4, suppl_1 (2017): S32. http://dx.doi.org/10.1093/ofid/ofx162.078.
Повний текст джерелаАнотація:
Abstract Background Detection and identification of microorganism(s) involved in periprosthetic joint infection (PJI) can inform surgical management and directed antibiotic therapy. Metagenomic shotgun sequencing is a powerful tool with the potential to change how many PJIs are diagnosed as it allows direct detection and identification of pathogens in clinical specimens. In the largest series to date, we utilized a metagenomics-based approach applied to SF to define potential microbial etiologies of failed total knee arthroplasties (TKAs). Methods Synovial fluid was collected from 112 failed TKAs [74 PJI and 38 aseptic implant failure (AF)] via preoperative arthrocentesis. Cell count and differential, standardized culture and DNA-based metagenomic shotgun sequencing were performed. Human DNA was depleted using the MolYsis basic kit prior to DNA extraction, whole genome amplification, and sequencing. Taxonomic assignment of reads and pathogen identification was achieved using a pipeline incorporating k-mer- and marker gene-based classification software. A scheme for analysis and filtration of false-positives was created and applied, incorporating cut-offs for the number of reads, quality scores, and coverage across a reference genome. Patients were classified as having PJI using the IDSA criteria and expert review. Analyses were recorded as percent agreement, with 95% confidence intervals (CI), of metagenomics to SF culture. Results Metagenomic analysis identified the known pathogen in 54 (90%) (CI, 79.5%–96.2%) of the 60 culture-positive PJIs analyzed and one (2%) (CI, 0.0%–8.9%) potential polymicrobial infection not detected by culture. For the 14 culture-negative PJIs tested, metagenomics showed 79% (CI, 49.2%–95.3%) agreement for negative findings; potential pathogens were identified in three (21%) (CI, 4.7%–50.8%) culture-negative PJI cases, with one being polymicrobial. Of the 37 culture-negative AF cases, metagenomics showed 97% (CI, 85.8%–99.9%) agreement with negative culture and identified one (3%) (CI, 0.0%–14.2%) potential pathogen. For the one culture-positive AF case, metagenomic results were negative, suggesting possible culture contamination. Conclusion Metagenomic shotgun sequencing performed on SF can be used to diagnose PJI and may be particularly useful for culture-negative PJI. Disclosures R. Patel, ASM: Board Member, None; CD Diagnostics, BioFire, Curetis, Merck, Hutchison Biofilm Medical Solutions, Accelerate Diagnostics, Allergan, and The Medicines Company: Grant Investigator, Grant recipient; Curetis: Consultant, Monies paid to my employer; A patent on Bordetella pertussis/parapertussis PCR issued, a patent on a device/method for sonication with royalties paid by Samsung to Mayo Clinic, and a patent on an anti-biofilm substance issued: Patents, Patents, any money is paid to my employer; Actelion: DSMB, Money paid to my employer; ASM and IDSA: Editor’s stipends, Editor’s stipends; NBME, Up-to-Date and the Infectious Diseases Board Review Course: NBME, Up-to-Date and the Infectious Diseases Board Review Course, Honoraria; Roche, ASM, and IDSA: Travel reimbursement, Travel reimbursement
49
Chng, Wee-Joo, Angela Baker, Travis Henry, Tammy Price-Troska, Scott Van Wier, Tae-Hoon Chung, Kim Henderson, et al. "Combined High Resolution Array Comparative Genomic Hybridization and Gene Expression Profiling Reveal Rb1 Haploinsufficiency as a Possibile Tumorigenic Mechanism in Myeloma." Blood 108, no. 11 (November 16, 2006): 113. http://dx.doi.org/10.1182/blood.v108.11.113.113.
Повний текст джерелаАнотація:
Abstract Chromosome 13 deletion (Δ13) is one the most common genetic abnormalities observed in multiple myeloma (MM) and confers a poor prognosis. Studies to identify critical tumor suppressor genes in MM till date have lack adequate resolution, and the molecular phenotype associated with Δ13 has not been established. In this study we seek to establish a molecular profile for Δ13 and to finely map the minimal common region of deletion (CDR) on chromosome 13 by using gene expression profiling (GEP) and array comparative genomic hybridization (aCGH). GEP was performed on RNA from purified plasma cells of 72 newly diagnosed MM and 50 human myeloma cell lines (HMCLs) using the Affymetrix U133A chip and U133plus chip (Affymetrix, Santa Clara, CA) respectively. Patients were assigned TC classes which correlates with underlying genetic subtypes. In addition, aCGH was performed on 79 MM samples (36 with GEP data) and 50 myeloma cell lines (HMCLs; 48 with GEP data) using a platform utilizing 60-mer oligonucleotides (Human Genome CGH 44B Oligo Microarrays, Agilent Technologies), which have a resolution of about 70Kb. Raw data was extracted using the Feature Extraction 8.1 and visualized using CGH Analytics 3.2 (Agilent Technologies). To define a signature that reflects the biological consequences of Δ13 and not its close association with some genetic subtypes of MM (example, t(4;14) and t(14;16)), we selected a training cohort consisting of cases belonging to D1, D2, 11q13 and none TC class such that cases with and without Δ13 are balanced for ploidy and TC classes (n=28). A 152-gene Δ13 signature was identified. Its specificity was confirmed by leave-one-out cross validation using the K-nearest neighbor (KNN) class prediction algorithm (predictive accuracy of 100% in the training cohort). It was subsequently validated in a validation cohort that includes t(4;14) and t(14;16) that were not use to derive this gene signature, maintaining a high predictive accuracy (88%). This gene-set may therefore reflect core transcriptional consequences of Δ13 and is enriched for genes involved in the cell cycle and apoptosis. Using aCGH, 20 patients have Δ13 (mostly whole chromosome) all involving the 13q14–q21 region. Of the 32 HMCLs with Δ13 (whole chromosome or interstitial), 22 have mono-allelic loss of RB1 whereas 4 had bi-allelic loss. Besides RB1, bi-allelic loss of several other genes in the 13q14–q21 region (CYSLTR2, CDADC1, ITM2B, PCDH9) was also observed. As the CDR is large and contains a number of genes, we utilized a set of criteria (bi-allelic loss in HMCLs, within 13q14–q21 CDR, gene expression significantly correlated with copy number, and loss could explain molecular phenotype) to narrow down the potential candidates. Only RB1 and ITM2B fulfilled these criteria. Furthermore, RB protein levels correlated well with mRNA levels and DNA copy suggesting that even in absence of mutations resulting in bi-allelic loss, mono-allelic loss of RB1 could be tumorigenic through a haploinsufficiency mechanism.
50
Saito, Anri, Miwako Narita, Toshio Yano, Naoko Sato, Asuka Sekiguchi, Norihiro Watanabe, Ayumi Yokoyama, et al. "Generation of Antigen Specific Cytotoxic T Lymphocytes (CTL) by Dendritic Cells (DCs) Transfected with In Vitro Transcribed (IVT) SART-1 and WT-1 mRNA." Blood 104, no. 11 (November 16, 2004): 3859. http://dx.doi.org/10.1182/blood.v104.11.3859.3859.
Повний текст джерелаАнотація:
Abstract Transfection with tumor antigen RNA is one of the promising tools not only because of a possible sufficient amplification of tumor antigen RNA but also because of the absence of antigen peptides-associated MHC restriction. Several succeeded experiments about generation of CTLs using DCs transfeced in vitro transcribed (IVT) cancer specific antigen mRNA such as PSA, CEA, hTERT and MUC-1 have been reported in these a few years. In addition, recent reports about the simultaneous presentation of peptides in both MHC class I and class II molecules on DCs after mRNA electroporation show another superiority of mRNA transfection into DCs. In this presentation, we demonstrate successful generation of tumor antigen specific CTLs using with DCs transfected with IVT mRNA such as SART-1 and WT-1 by electroporation. This is the first report about the generation of SART-1 and WT-1 specific CTLs by using mRNA transfected DCs. [Methods] HLA-A24 positive human PB CD14+ cell-derived DCs were transfected with IVT mRNA (SART-1and WT-1) by electroporation. MRNA transfected DCs were co-cultured with autologous lymphocytes. The bulk co-cultures were re-stimulated several times with same DCs. CD8+ cells were separated and CTL activity was evaluated by 51chromium release assay. To determine whether the induced CTL cells could recognize the target cells in an HLA class I restricted manner, anti-HLA class I monoclonal antibodies were utilized to block the cytotoxicity of effectors. [Results] Electroporation of mRNA showed no effect on the surface phenotypes and antigen presenting ability of DCs. In addition to the demonstration of efficient transfection of M1 mRNA into DCs by using RT-PCR, which eliminated the amplification of transfected mRNA by the treatment with RNase before RNA extraction from the transfected cells, we identified the definite expression of WT-1 protein in the cytoplasm of DCs by using immunoblotting. CTL assay indicated that 1) DCs transfected with mRNA stimulated the generation of antigen-specific CTLs which are capable of lysing autologous DCs transfected with the same mRNA. 2) CTLs also demonstrated cytotoxic ability against cell lines such as KE-4 presenting SART-1 peptides on HLA-A24, MEGO1 presenting WT-1 peptides on MHC class I, and HLA-A24 cDNA transfected T2 which were used as target cells after co- incubation with 9 mer SART-1 peptides with strong affinity to HLA-A24. 3) Each cytotoxicities were markedly blocked after co-incubation of target cells with anti-MHC class I antibody and not inhibited with anti-MHC class II antibody. [Conclusion] Our results showed that IVT mRNA-transfected DCs which is constructed non-virally have a highly efficient ability to stimulate specific T-cell immunity against tumor. Unlike peptide- or tumor cells extract-pulsed DCs based vaccines, anti-tumor immunotherapy using the DCs transfected with antigen mRNA could be extended to a wide range of patients who have previously been excluded from clinical trials for the reason of the un-identification of tumor specific antigens, for the reason of the impossibility of obtaining sufficient tumor specimens, or for the reason of MHC restriction of the tumor specific antigens.