Увійти

Готові списки джерел за темами / Calothrixin / Статті в журналах

Статті в журналах з теми "Calothrixin"

Щоб переглянути інші типи публікацій з цієї теми, перейдіть за посиланням: Calothrixin.

Автор: Grafiati

Опубліковано: 10 грудня 2022

Оновлено: 28 січня 2023

Оформте джерело за APA, MLA, Chicago, Harvard та іншими стилями

Оберіть тип джерела:

Ознайомтеся з топ-50 статей у журналах для дослідження на тему "Calothrixin".

Біля кожної праці в переліку літератури доступна кнопка «Додати до бібліографії». Скористайтеся нею – і ми автоматично оформимо бібліографічне посилання на обрану працю в потрібному вам стилі цитування: APA, MLA, «Гарвард», «Чикаго», «Ванкувер» тощо.

Також ви можете завантажити повний текст наукової публікації у форматі «.pdf» та прочитати онлайн анотацію до роботи, якщо відповідні параметри наявні в метаданих.

Переглядайте статті в журналах для різних дисциплін та оформлюйте правильно вашу бібліографію.

1

Owen, Elisabeth A., and Max A. Keniry. "Exploring the Binding of Calothrixin A to the G-Quadruplex from the c-myc Oncogene Promotor." Australian Journal of Chemistry 62, no. 11 (2009): 1544. http://dx.doi.org/10.1071/ch09169.

Повний текст джерела

Анотація:

Calothrixin A, a bioactive pentacyclic metabolite from the cyanobacteria Calothrix, has potent antiproliferative behaviour against several cancer cell lines. The in vitro binding of calothrixin A to the DNA quadruplex formed at the promotor region of c-myc was investigated by monitoring changes in the fluorescence emission of 2-aminopurine (2Ap)-substituted analogues of the native Pu22 sequence d(TGAGGGTGGGGAGGGTGGGGAA) on titration with calothrixin A and N-methoxymethyl-calothrixin B. Calothrixin A binds to Pu22 and its constituent loop isomers with a micromolar dissociation constant whereas N-methoxymethyl-calothrixin B has over an order of magnitude lower affinity. Competitive displacement experiments with double-stranded DNA showed preferential binding of calothrixin A to the Pu22 quadruplex compared with double-stranded DNA. The association of calothrixin A with DNA quadruplexes is the first direct evidence that calothrixin A binds to DNA and may aid in the understanding of the bioactivity of the calothrixins.

Стилі APA, Harvard, Vancouver, ISO та ін.

2

Guingant, André, Drissa Sissouma, and Sylvain Collet. "A Synthesis of Calothrixin B." Synlett 2004, no. 14 (October 20, 2004): 2612–14. http://dx.doi.org/10.1055/s-2004-834831.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

3

Kaliyaperumal, Srinivasan A., Shyamapada Banerjee, and Syam Kumar U. K. "Palladium mediated intramolecular multiple C–X/C–H cross coupling and C–H activation: synthesis of carbazole alkaloids calothrixin B and murrayaquinone A." Org. Biomol. Chem. 12, no. 32 (2014): 6105–13. http://dx.doi.org/10.1039/c4ob00493k.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

4

Ramkumar, Nagarajan, and Rajagopal Nagarajan. "Total synthesis of calothrixin B via sequential Sonogashira coupling/copper-catalyzed oxidative cyclization." Organic & Biomolecular Chemistry 13, no. 45 (2015): 11046–51. http://dx.doi.org/10.1039/c5ob01766a.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

5

Sperry, Jonathan, Christopher S. P. McErlean, Alexandra M. Z. Slawin, and Christopher J. Moody. "A biomimetic synthesis of calothrixin B." Tetrahedron Letters 48, no. 2 (January 2007): 231–34. http://dx.doi.org/10.1016/j.tetlet.2006.11.053.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

6

Chai, Christina, Paul Bernardo, and Wuri Fitriyanto. "Palladium-Mediated Synthesis of Calothrixin B." Synlett 2007, no. 12 (July 2007): 1935–39. http://dx.doi.org/10.1055/s-2007-984520.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

7

Ramkumar, Nagarajan, and Rajagopal Nagarajan. "Formal total synthesis of calothrixin B and its N-benzyl analogues." RSC Advances 5, no. 107 (2015): 87838–40. http://dx.doi.org/10.1039/c5ra18120h.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

8

Bhosale, Shrikar M., Rupesh L. Gawade, Vedavati G. Puranik, and Radhika S. Kusurkar. "An efficient total synthesis of calothrixin B." Tetrahedron Letters 53, no. 23 (June 2012): 2894–96. http://dx.doi.org/10.1016/j.tetlet.2012.03.131.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

9

Sissouma, Drissa, Lucie Maingot, Sylvain Collet, and André Guingant. "Concise and Efficient Synthesis of Calothrixin B." Journal of Organic Chemistry 71, no. 22 (October 2006): 8384–89. http://dx.doi.org/10.1021/jo061270o.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

10

Bernardo, Paul H., Christina L. L. Chai, and John A. Elix. "A simple and concise route to calothrixin B." Tetrahedron Letters 43, no. 16 (April 2002): 2939–40. http://dx.doi.org/10.1016/s0040-4039(02)00434-3.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

11

Bennasar, M. Lluïsa, Tomàs Roca, and Francesc Ferrando. "A New Radical-Based Route to Calothrixin B." Organic Letters 8, no. 4 (February 2006): 561–64. http://dx.doi.org/10.1021/ol052600e.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

12

Saravanan, Velu, Bose Muthu Ramalingam, and Arasambattu K. Mohanakrishnan. "Total Synthesis of Calothrixin B and Its Analogs." European Journal of Organic Chemistry 2014, no. 6 (December 12, 2013): 1266–79. http://dx.doi.org/10.1002/ejoc.201301524.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

13

Ramkumar, Nagarajan, and Rajagopal Nagarajan. "Total Synthesis of Ellipticine Quinones, Olivacine, and Calothrixin B." Journal of Organic Chemistry 79, no. 2 (January 6, 2014): 736–41. http://dx.doi.org/10.1021/jo402593w.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

14

Kelly, T. Ross, Yajun Zhao, Marta Cavero, and Mercedes Torneiro. "Synthesis of the Potent Antimalarials Calothrixin A and B." Organic Letters 2, no. 23 (November 2000): 3735–37. http://dx.doi.org/10.1021/ol006649q.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

15

Yingyuad, Peerada, Chomdao Sinthuvanich, Theerachart Leepasert, Panumart Thongyoo, and Suwimon Boonrungsiman. "Preparation, characterization and in vitro evaluation of calothrixin B liposomes." Journal of Drug Delivery Science and Technology 44 (April 2018): 491–97. http://dx.doi.org/10.1016/j.jddst.2018.02.010.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

16

Bernardo, Paul H., Christina L. L. Chai, and John A. Elix. "ChemInform Abstract: A Simple and Concise Route to Calothrixin B." ChemInform 33, no. 32 (May 20, 2010): no. http://dx.doi.org/10.1002/chin.200232211.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

17

Saravanan, Velu, Bose Muthu Ramalingam, and Arasambattu K. Mohanakrishnan. "ChemInform Abstract: Total Synthesis of Calothrixin B and Its Analogues." ChemInform 45, no. 49 (November 20, 2014): no. http://dx.doi.org/10.1002/chin.201449206.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

18

Hibino, Satoshi, Tominari Choshi, Shigeo Tohyama, Kohji Matsumoto, Akira Yamabuki, Yuhzo Hieda, and Junko Nobuhiro. "Total Synthesis of Bioactive Indolo[3,2-j]phenanthridine Alkaloid, Calothrixin B." HETEROCYCLES 82, no. 1 (2010): 397. http://dx.doi.org/10.3987/com-10-s(e)11.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

19

Ramkumar, Nagarajan, and Rajagopal Nagarajan. "Total Synthesis of Calothrixin A and B via C–H Activation." Journal of Organic Chemistry 78, no. 6 (February 28, 2013): 2802–7. http://dx.doi.org/10.1021/jo302821v.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

20

Ramkumar, Nagarajan, and Rajagopal Nagarajan. "ChemInform Abstract: Total Synthesis of Ellipticine Quinones, Olivacine, and Calothrixin B." ChemInform 45, no. 25 (June 5, 2014): no. http://dx.doi.org/10.1002/chin.201425174.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

21

Kelly, T. Ross, Yajun Zhao, Marta Cavero, and Mercedes Torneiro. "ChemInform Abstract: Synthesis of the Potent Antimalarials Calothrixin A and B." ChemInform 32, no. 14 (April 3, 2001): no. http://dx.doi.org/10.1002/chin.200114219.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

22

Mori-Quiroz, Luis M., Madeline M. Dekarske, Austin B. Prinkki, and Michael D. Clift. "Exploiting Alkylquinone Tautomerization for the Total Synthesis of Calothrixin A and B." Journal of Organic Chemistry 82, no. 23 (November 17, 2017): 12257–66. http://dx.doi.org/10.1021/acs.joc.7b02101.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

23

Yamabuki, Akira, Hikohito Fujinawa, Tominari Choshi, Shigeo Tohyama, Kohji Matsumoto, Kana Ohmura, Junko Nobuhiro, and Satoshi Hibino. "A biomimetic synthesis of the indolo[3,2-j]phenanthridine alkaloid, calothrixin B." Tetrahedron Letters 47, no. 33 (August 2006): 5859–61. http://dx.doi.org/10.1016/j.tetlet.2006.06.077.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

24

Bernardo, Paul H., Christina L. L. Chai, Maurice Le Guen, Geoffrey D. Smith, and Paul Waring. "Structure–activity delineation of quinones related to the biologically active Calothrixin B." Bioorganic & Medicinal Chemistry Letters 17, no. 1 (January 2007): 82–85. http://dx.doi.org/10.1016/j.bmcl.2006.09.090.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

25

Mohanakrishnan, Arasambattu, Bose Ramalingam, Nachiappan Moorthy, and Elangovan Vellaichamy. "Synthesis of Thia-Analogues of Calothrixin B Involving FeCl3-Mediated Domino Reaction." Synlett 28, no. 01 (September 12, 2016): 133–37. http://dx.doi.org/10.1055/s-0036-1588072.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

26

Yang, Xiaohong, Jiangsheng Gao, Jian Guo, Zimeng Zhao, Shao-Lin Zhang, and Yun He. "Anti-lung cancer activity and inhibitory mechanisms of a novel Calothrixin A derivative." Life Sciences 219 (February 2019): 20–30. http://dx.doi.org/10.1016/j.lfs.2018.12.052.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

27

Tohyama, Shigeo, Tominari Choshi, Kohji Matsumoto, Akira Yamabuki, Kouichiro Ikegata, Junko Nobuhiro, and Satoshi Hibino. "A new total synthesis of an indolo[3,2-j]phenanthridine alkaloid calothrixin B." Tetrahedron Letters 46, no. 32 (August 2005): 5263–64. http://dx.doi.org/10.1016/j.tetlet.2005.06.042.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

28

Tohyama, Shigeo, Tominari Choshi, Kohji Matsumoto, Akira Yamabuki, Yuhzo Hieda, Junko Nobuhiro, and Satoshi Hibino. "ChemInform Abstract: Total Synthesis of Bioactive Indolo[3,2-j]phenanthridine Alkaloid, Calothrixin B." ChemInform 42, no. 19 (April 14, 2011): no. http://dx.doi.org/10.1002/chin.201119189.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

29

T. Parvatkar, Prakash. "Recent Progress Towards the Total Synthesis and Biological Studies of Calothrixin A and B." Current Organic Chemistry 20, no. 8 (March 3, 2016): 839–55. http://dx.doi.org/10.2174/1385272819666150803235103.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

30

Mori-Quiroz, Luis M., Madeline M. Dekarske, Austin B. Prinkki, and Michael D. Clift. "Correction to “Exploiting Alkylquinone Tautomerization for the Total Synthesis of Calothrixin A and B”." Journal of Organic Chemistry 83, no. 11 (May 16, 2018): 6243. http://dx.doi.org/10.1021/acs.joc.8b01110.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

31

Hatae, Noriyuki, Risa Satoh, Hitomi Chiba, Takahiro Osaki, Takashi Nishiyama, Minoru Ishikura, Takumi Abe, et al. "N-Substituted calothrixin B derivatives inhibited the proliferation of HL-60 promyelocytic leukemia cells." Medicinal Chemistry Research 23, no. 11 (June 15, 2014): 4956–61. http://dx.doi.org/10.1007/s00044-014-1061-6.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

32

Athbi, Ahmed M., Eqbal J. AL-Assedi, and Areej F. AL-Nassir. "solation and identification of an alkaloidic compound similar to Calothrixin-A from green alga Cladophora crispata (Roth.) Kützing." IRAQI JOURNAL OF AQUACULTURE 8, no. 1 (2011): 53–80. http://dx.doi.org/10.21276/ijaq.2011.8.1.4.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

33

Bhosale, Shrikar M., Aadil A. Momin, Shrikant Kunjir, P. R. Rajamohanan, and Radhika S. Kusurkar. "Unexpected observations during the total synthesis of calothrixin B–sodium methoxide as a source of hydride." Tetrahedron Letters 55, no. 1 (January 2014): 155–62. http://dx.doi.org/10.1016/j.tetlet.2013.10.140.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

34

Doan, Nga Thanh, Peter R. Stewart, and Geoffrey D. Smith. "Inhibition of bacterial RNA polymerase by the cyanobacterial metabolites 12-epi-hapalindole E isonitrile and calothrixin A." FEMS Microbiology Letters 196, no. 2 (March 2001): 135–39. http://dx.doi.org/10.1111/j.1574-6968.2001.tb10554.x.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

35

Long, Qun, Xiao Xiao, Ping Yi, Yuancui Liu, Krishnapriya M. Varier, Qing Rao, Jingrui Song та ін. "L20, a Calothrixin B analog, induces intrinsic apoptosis on HEL cells through ROS/γ-H2AX/p38 MAPK pathway". Biomedicine & Pharmacotherapy 137 (травень 2021): 111336. http://dx.doi.org/10.1016/j.biopha.2021.111336.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

36

Deng, Chengdan, Yuancui Liu, Mei Xu, Kaiqiang Xie, and Sheng Liu. "Exploiting an intramolecular Diels–Alder cyclization/dehydro-aromatization sequence for the total syntheses of ellipticines and calothrixin B." Organic & Biomolecular Chemistry 19, no. 6 (2021): 1395–403. http://dx.doi.org/10.1039/d0ob02527e.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

37

Liao, Xianjiu, Chunlei Zhu, Haiyan Zhang, Xuemin Li, Xiaoqing Wen, Shao-Lin Zhang, and Yizhong Shen. "Investigation on the binding of cyanobacterial metabolite calothrixin A with human serum albumin for evaluating its potential toxicology." Food and Chemical Toxicology 155 (September 2021): 112396. http://dx.doi.org/10.1016/j.fct.2021.112396.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

38

Collet, Sylvain, André Guingant, Lucie Maingot, Frédéric Thuaud, Drissa Sissouma, and Michel Evain. "Synthesis of a Calothrixin B Isomer with a Novel 7H-Indolo[2,3-j]phenanthridine-7,13(8H)-dione Structure." Synlett 2008, no. 2 (January 2008): 263–67. http://dx.doi.org/10.1055/s-2007-1000933.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

39

Bhosale, Shrikar M., Aadil A. Momin, Shrikant Kunjir, P. R. Rajamohanan, and Radhika S. Kusurkar. "ChemInform Abstract: Unexpected Observations During the Total Synthesis of Calothrixin B-Sodium Methoxide as a Source of Hydride." ChemInform 45, no. 20 (April 28, 2014): no. http://dx.doi.org/10.1002/chin.201420036.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

40

Lee, Sungjong, Kyung-Hee Kim, and Cheol-Hong Cheon. "Total Syntheses of Arcyriaflavin A and Calothrixin B Using 2,2′-Bisindole-3-acetic Acid Derivative as a Common Intermediate." Organic Letters 19, no. 11 (May 18, 2017): 2785–88. http://dx.doi.org/10.1021/acs.orglett.7b00687.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

41

Lin, Kai, Yong Jian, Peng Zhao, Chun-shen Zhao, Wei-dong Pan, and Sheng Liu. "A rapid construction of a specific quino[4,3-b] carbazolone system and its application for the synthesis of calothrixin B." Organic Chemistry Frontiers 5, no. 4 (2018): 590–94. http://dx.doi.org/10.1039/c7qo00864c.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

42

Singh, Shweta, Ramesh Samineni, Srihari Pabbaraja, and Goverdhan Mehta. "A General Carbazole Synthesis via Stitching of Indole–Ynones with Nitromethanes: Application to Total Synthesis of Carbazomycin A, Calothrixin B, and Staurosporinone." Organic Letters 21, no. 9 (April 23, 2019): 3372–76. http://dx.doi.org/10.1021/acs.orglett.9b01111.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

43

Rickards, Rodney W., Jennifer M. Rothschild, Anthony C. Willis, Nola M. de Chazal, Julie Kirk, Kiaran Kirk, Kevin J. Saliba, and Geoffrey D. Smith. "Calothrixins A and B, novel pentacyclic metabolites from Calothrix cyanobacteria with potent activity against malaria parasites and human cancer cells." Tetrahedron 55, no. 47 (November 1999): 13513–20. http://dx.doi.org/10.1016/s0040-4020(99)00833-9.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

44

Rickards, Rodney W., Jennifer M. Rothschild, Anthony C. Willis, Nola M. de Chazal, Julie Kirk, Kiaran Kirk, Kevin J. Saliba, and Geoffrey D. Smith. "ChemInform Abstract: Calothrixins A (I) and B (II), Novel Pentacyclic Metabolites from Calothrix Cyanobacteria with Potent Activity Against Malaria Parasites and Human Cancer Cells." ChemInform 31, no. 6 (June 11, 2010): no. http://dx.doi.org/10.1002/chin.200006222.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

45

Mal, Dipakranjan, Joyeeta Roy, and Kumar Biradha. "Regiodivergent and short total synthesis of calothrixins." Org. Biomol. Chem. 12, no. 41 (August 21, 2014): 8196–203. http://dx.doi.org/10.1039/c4ob01309c.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

46

Dethe, Dattatraya H., and Ganesh M. Murhade. "Diversity-Oriented Synthesis of Calothrixins and Ellipticines." European Journal of Organic Chemistry 2014, no. 31 (September 19, 2014): 6953–62. http://dx.doi.org/10.1002/ejoc.201402837.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

47

Abe, Takumi, Toshiaki Ikeda, Reiko Yanada, and Minoru Ishikura. "Concise Total Synthesis of Calothrixins A and B." Organic Letters 13, no. 13 (July 2011): 3356–59. http://dx.doi.org/10.1021/ol201107a.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

48

Berrendero, Esther, Elvira Perona, and Pilar Mateo. "Phenotypic variability and phylogenetic relationships of the genera Tolypothrix and Calothrix (Nostocales, Cyanobacteria) from running water." International Journal of Systematic and Evolutionary Microbiology 61, no. 12 (December 1, 2011): 3039–51. http://dx.doi.org/10.1099/ijs.0.027581-0.

Повний текст джерела

Анотація:

The taxonomy of heterocystous cyanobacteria belonging to the genera Calothrix and Tolypothrix has long been a matter of debate, but their phylogenetic relationships are still not well understood. Our aim was to compare the phylogeny and morphology of members of these genera, which exhibit basal–apical polarity. A phylogeny was reconstructed on the basis of 16S rRNA gene sequences and compared with the morphological characterization of new isolates and environmental samples. Strains isolated from several rivers and streams showed a high degree of tapering when they were cultured in a nutrient-rich medium. However, clear differences were apparent when they were transferred to a nutrient-poor medium. Some strains showed a low degree of tapering and other morphological features corresponding to the genus Tolypothrix, such as false branching, whereas others maintained the morphological characteristics of the genus Calothrix. Phylogenetic analysis was congruent with the phenotypic characterization, in which the strains and environmental samples of the Tolypothrix and Calothrix morphotypes could be clearly separated. Isolates with a low degree of tapering and natural samples of Tolypothrix distorta were grouped in the same cluster, but strains of the genus Calothrix fell into well separated clades. Results from this study showed that representatives of the genus Tolypothrix share most morphological and developmental properties and a high degree of 16S rRNA gene sequence similarity. However, although similar and sometimes overlapping morphologies may occur in isolates of the genus Calothrix, these morphotypes may be distinguished on the basis of their clear genetic divergence.

Стилі APA, Harvard, Vancouver, ISO та ін.

49

Thajamanbi, Moirangthem, Jayashree Rout, and Nooruddin Thajuddin. "Isolation and Characterization of Two Cyanobacterial Strains Calothrix Sp. and Microchaete Sp. from Rice Fields of Karimganj District, Assam, North East India." Current World Environment 11, no. 2 (August 25, 2016): 399–405. http://dx.doi.org/10.12944/cwe.11.2.07.

Повний текст джерела

Анотація:

Studies on various nitrogen fixing microalgal strains found in the rice paddy field soils are carried out in different parts of the world. In the present study two cyanobacterial strains belonging to the order nostocales, Calothrix sp. and Microchaete sp. were isolated from the rice fields of Karimganj district, South Assam, India and characterized based on their morphological, biochemical and molecular analysis. For the phenotypic characterization - growth, pigments (chlorophyll a, total carotenoid content, phycobiliproteins) and biochemical properties (total carbohydrate and soluble proteins) were studied. The study showed that both strains contain lower phycoerythrin content as compared to the other pigments. The Microchaete strain contain a higher total carotenoid content while chlorophyll a accumulation was higher in the Calothrix strain. Phylogenetic compairision was made using 16S rRNA gene sequences including other sequences of Calothrix, Microchaete and Tolypothrix species from GenBank. The results showed that polyphasic approach provides necessary information for the identification of cyanobacterial species using morphological analysis in combination with molecular techniques.

Стилі APA, Harvard, Vancouver, ISO та ін.

50

Xu, Su, Bhavitavya Nijampatnam, Shilpa Dutta, and Sadanandan Velu. "Cyanobacterial Metabolite Calothrixins: Recent Advances in Synthesis and Biological Evaluation." Marine Drugs 14, no. 1 (January 12, 2016): 17. http://dx.doi.org/10.3390/md14010017.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

Ми пропонуємо знижки на всі преміум-плани для авторів, чиї праці увійшли до тематичних добірок літератури. Зв'яжіться з нами, щоб отримати унікальний промокод!