Siga este link para ver outros tipos de publicações sobre o tema: Field crops Diseases and pests Australia.
Artigos de revistas sobre o tema "Field crops Diseases and pests Australia"
Crie uma referência precisa em APA, MLA, Chicago, Harvard, e outros estilos
Veja os 50 melhores artigos de revistas para estudos sobre o assunto "Field crops Diseases and pests Australia".
Ao lado de cada fonte na lista de referências, há um botão "Adicionar à bibliografia". Clique e geraremos automaticamente a citação bibliográfica do trabalho escolhido no estilo de citação de que você precisa: APA, MLA, Harvard, Chicago, Vancouver, etc.
Você também pode baixar o texto completo da publicação científica em formato .pdf e ler o resumo do trabalho online se estiver presente nos metadados.
Veja os artigos de revistas das mais diversas áreas científicas e compile uma bibliografia correta.
1
Li, Y. P., M. P. You, T. N. Khan, P. M. Finnegan e M. J. Barbetti. "First Report of Phoma herbarum on Field Pea (Pisum sativum) in Australia". Plant Disease 95, n.º 12 (dezembro de 2011): 1590. http://dx.doi.org/10.1094/pdis-07-11-0594.
Texto completo da fonteResumo:
Black spot disease on field pea (Pisum sativum) in Australia is generally caused by one or more of the four fungi: Mycosphaerella pinodes (anamorph Ascochyta pinodes), Phoma medicaginis var. pinodella (synonym Phoma pinodella), Ascochyta pisi, and Phoma koolunga (1,2,4). However, in 2010 from a field pea blackspot disease screening nursery at Medina, Western Australia, approximately 25% of isolates were a Phoma sp. that was morphologically different to Phoma spp. previously reported on field pea in Western Australia, while the remaining 75% of isolates were either M. pinodes or P. medicaginis var. pinodella. Single-spore isolations of 23 isolates of this Phoma sp. were made onto potato dextrose agar. A PCR-based assay with the TW81 and AB28 primers was used to amplify from the 3′ end of 16S rDNA, across ITS1, 5.8S rDNA, and ITS2 to the 5′ end of the 28S rDNA. The DNA products were sequenced and BLAST analyses were used to compare sequences with those in GenBank. In each case, the sequence had ≥99% nucleotide identity with the corresponding sequence in GenBank for P. herbarum. Isolates also showed morphological similarities to P. herbarum as described in other reports (e.g., 3). The relevant information for a representative isolate has been lodged in GenBank (Accession No. JN247437). The same primers were used by Davidson et al. (2) to identify P. koolunga, but none of our 23 isolates were P. koolunga. A conidial suspension of 107 conidia ml–1 from a single-spore culture was spray inoculated onto foliage of 10-day-old Pisum sativum cv. Dundale plants maintained under >90% relative humidity conditions for 72 h postinoculation. Symptoms evident by 11 days postinoculation consisted of pale brown lesions that were mostly 1.5 to 2 mm long and 1 to 1.5 mm wide. Approximately 50% of lesions showed a distinct chlorotic halo extending 1 to 2 mm outside the boundary of the lesion. P. herbarum was readily reisolated from infected foliage. A culture of this representative isolate has been lodged in the Western Australian Culture Collection Herbarium maintained at the Department of Agriculture and Food Western Australia (Accession No. WAC13499). Outside of Australia, P. herbarum, while generally considered a soilborne opportunistic pathogen, has been reported on a wide range of species, including field pea (3). Molecular analysis of historical isolates collected from field pea in Western Australia, mostly in the late 1980s, did not show any incidence of P. herbarum, despite this fungus being reported on alfalfa (Medicago sativa) and soybean (Glycine max) in Western Australia in 1985 (Australian Plant Pest Database). In Western Australia, this fungus has also been recorded on a Protea sp. in 1991 and on Arabian pea (Bituminaria bituminosa) in 2010 (Australian Plant Pest Database). To our knowledge, this is the first report of P. herbarum as a pathogen on field pea in Australia. These previous reports of P. herbarum on other hosts in Western Australia and the wide host range of P. herbarum together suggest the potential for this fungus to be a pathogen on a wider range of genera/species than field pea. References: (1) T. W. Bretag and M. Ramsey. Page 24 in: Compendium of Pea Diseases and Pests. 2nd ed. The American Phytopathologic Society, St Paul, MN, 2001. (2) J. A. Davidson et al. Mycologica 101:120, 2009. (3) G. L. Kinsey. Phoma herbarum. No 1501. IMI Descriptions of Fungi and Bacteria, 2002. (4) T. L. Peever et al. Mycologia 99:59, 2007.
2
Goyne, PJ, H. Meinke, SP Milroy, GL Hammer e JM Hare. "Development and use of a barley crop simulation model to evaluate production management strategies in north-eastern Australia". Australian Journal of Agricultural Research 47, n.º 7 (1996): 997. http://dx.doi.org/10.1071/ar9960997.
Texto completo da fonteResumo:
A study was undertaken to identify improved management strategies for barley (Hordeum vulgare L.), particularly in relation to time of planting, location, and frost risk in the variable climate of north-eastern Australia. To achieve this objective, a crop growth simulation model (QBAR) was constructed to integrate the understanding, gained from field experiments, of the dynamics of crop growth as influenced by soil moisture and environmental variables. QBAR simulates the growth and yield potential of barley grown under optimal nutrient supply, in the absence of pests, diseases, and weeds. Genotypic variables have been determined for 4 cultivars commonly grown in the northern cereal production areas. Simulations were conducted using long-term weather data to generate the probabilistic yield outcome of cv. Grimmet for a range of times of planting at 10 locations in the north-eastern Australian grain belt. The study indicated that the common planting times used by growers could be too late under certain circumstances to gain full yield potential. Further applications of QBAR to generating information suitable for crop management decision support packages and crop yield forecasting are discussed.
3
Hochman, Z., D. Holzworth e J. R. Hunt. "Potential to improve on-farm wheat yield and WUE in Australia". Crop and Pasture Science 60, n.º 8 (2009): 708. http://dx.doi.org/10.1071/cp09064.
Texto completo da fonteResumo:
Water-use efficiency (WUE) is defined here as the ratio of grain yield (kg/ha) to crop water use by evapotranspiration (mm). Much of the WUE literature has focussed on either the determination of the boundary of attainable WUE for any amount of available water, or on the practicalities of measurement of the WUE of a crop. While these are important issues for defining the gap between the attained and the potential WUE, little progress has been reported on clarifying the components that contribute to this gap or on how it can be bridged. To address these questions, we analysed 334 wheat fields for which we had the data necessary to both calculate WUE and to simulate crop growth and water use. Simulations were conducted through Yield Prophet®, an on-line version of the APSIM systems model. For this dataset, evapotranspiration accounted for 69% of observed yield variation, although the more commonly used growing-season (April–October) rainfall accounted for 50%. Considering that evapotranspiration efficiency does not account for a wide range of potentially yield-limiting factors including soil and fertiliser nitrogen supply, crop phenology, and sowing dates, or rainfall distribution, these results reinforce the importance of evapotranspiration efficiency as a yield determinant for well managed crops in water-limited environments. WUE attained over the whole dataset was 15.2 kg grain/ha.mm (x-intercept = 67 mm), although this value contained data subsets with important differences in WUE based on soil water-holding capacity and regional diversity. Yield Prophet® simulated commercial wheat yields with RMSDs of 0.80 t/ha (r2 = 0.71), with some systematic error between observed and simulated yields. Simulated crops achieved a higher WUE (16.9 kg grain/ha.mm; x-intercept = 72 mm) than the observed crops, probably because APSIM does not account for effects of factors such as weeds, pests and diseases and impacts of severe weather. Simulated ‘what-if’ analysis suggested that further improvement in WUE may be achieved with an early sowing strategy or a higher nitrogen input strategy. A ‘yield maximising’ strategy that included an optimal plant density, early sowing date, and higher nitrogen inputs resulted in an average WUE (21.4 kg grain/ha.mm; x-intercept = 80 mm) that is close to the previously reported (French-Schultz) boundary of WUE. This outcome suggests a great deal of scope for Australian wheat growers to adopt strategies that improve their WUE. Yield Prophet® farmers have already demonstrated significant improvement in on-farm WUE compared with previous studies. However, additional improvements will only be partially realised due to considerations of the cost: benefit ratio and risk in a highly variable climate, and the operational feasibility of these strategies with current technologies.
4
Nordblom, T. L., T. R. Hutchings, R. C. Hayes, G. D. Li e J. D. Finlayson. "Does establishing lucerne under a cover crop increase farm financial risk?" Crop and Pasture Science 68, n.º 12 (2017): 1149. http://dx.doi.org/10.1071/cp16379.
Texto completo da fonteResumo:
Rainfed farms in south-eastern Australia often combine annual cropping and perennial pasture phases with grazing sheep enterprises. Such diversity serves in managing diseases, pests and plant nutrition while stabilising income in the face of wide, uncorrelated variations in international commodity prices and local weather over time. We use an actuarial accounting approach to capture the above contexts to render financial risk profiles in the form of distributions of decadal cash balances for a representative 1000-ha farm at Coolamon (34°50ʹS, 147°12ʹE) in New South Wales, Australia. For the soil and weather conditions at this location we pose the question of which approach is better when establishing the perennial pasture lucerne (Medicago sativa L.): sowing with the final crop of the cropping phase, or sowing alone following the final crop? It is less expensive to sow lucerne with the final crop, which can provide useful income from the sale of grain, but this practice can reduce pasture quantity and quality in poorer years. Although many years of field research have confirmed that sowing lucerne alone is the most reliable way to establish a pasture in this area, and years of extension messages to this effect have gone out to farmers, they often persist in sowing lucerne with their final cereal crops. For this region, counting all costs, we show that sowing lucerne alone can reduce farm financial risk (i.e. probability of negative decadal cash balances) at stocking rates >10 dry sheep equivalents (DSE)/ha, compared with the practice of sowing lucerne with a cover crop. Establishing lucerne alone allows the farmer the option to profitably run higher stocking rates for higher median decadal cash margins without additional financial risk. At low stocking rates (i.e. 5 DSE/ha), there appears to be no financial advantage of either establishment approach. We consider the level of equity, background farm debt and overhead costs to demonstrate how these also affect risk-profile positions of the two sowing options. For a farm that is deeply in debt, we cannot suggest either approach to establishing lucerne will lead to substantially better financial outcomes.
5
Chen, W., F. M. Dugan e R. McGee. "First Report of Dodder (Cuscuta pentagona) on Chickpea (Cicer arietinum) in the United States". Plant Disease 98, n.º 1 (janeiro de 2014): 165. http://dx.doi.org/10.1094/pdis-03-13-0334-pdn.
Texto completo da fonteResumo:
Chickpea (Cicer arietinum L.) is an important rotational and an emerging specialty crop in the Pacific Northwest of the United States, in California, and in the Northern Great Plains of the United States and Canada. Dodders (Cuscuta spp.) are widespread parasitic weeds on many crops worldwide. Several Cuscuta species (primarily C. campestris Yuncker) have been reported to parasitize chickpea, and dodder is important on chickpea in the Indian subcontinent, the Middle East, and recently in Australia (4), but has previously not been reported from North America. On 28 July 2012, a chickpea field near Walla Walla, WA, was found parasitized by dodder. The chickpea was at late flowering and early pod filling stages and there were no other visible green weedy plants as observed from the canopy. There were about 15 dodder colonies varying in size from 2 to 15 meters in diameter in the field of about 500 acres. Chickpea plants in the center of the dodder colonies were wilting or dead. The colonies consisted of orange leafless twining stems wrapped around chickpea stems and spreading between chickpea plants. Haustoria of the dodder penetrating chickpea stems were clearly visible to the naked eye. Flowers, formed abundantly in dense clusters, were white and five-angled, with capitate stigmas, and lobes on developing calyxes were clearly overlapping. The dodder keyed to C. pentagona Engelm. in Hitchcock and Cronquest (3) and in Costea (1; and www.wlu.ca/page.php?grp_id=2147&p=8968 ). Specimens of dodder plants wrapping around chickpea stems with visible penetrating haustoria were collected on 28 July 2013 and vouchers (WS386115, WS386116, and WS386117) were deposited at the Washington State University Ownbey Herbarium. All dodder colonies in the field were eradicated before seed formation to prevent establishment of dodder. Total genomic DNA was isolated from dodder stems, and PCR primers ITS1 (5′TCCGTAGGTGAACCTGCGG) and ITS4 (5′TCCTCCGCTTATTGATATGC) were used to amplify the internal transcribed spacer (ITS) region of the nuclear rDNA. The ITS region was sequenced. BLAST search of the NCBI nucleotide database using the ITS sequence as query found that the most similar sequence was from C. pentagona (GenBank Accession No. DQ211589.1), and our ITS sequence was deposited in GenBank (KC832885). Dodder (C. approximata Bab.) has been historically a regional problem on alfalfa (Washington State Noxious Weed Control Board 2011). Another species stated to be “mainly” associated with legumes is C. epithymum Murr., and C. pentagona is “especially” associated with legumes (3). The latter species has sometimes been considered a variety (var. calycina) of C. campestris Yuncker (1,3). Although chickpea has been cultivated in the Walla Walla region for over 20 years, to our knowledge, this is the first time dodder has been observed on chickpea in North America. The likely source is from nearby alfalfa or other crop fields, with transmission by farm machinery or wild animals. Some chickpea germplasm exhibits partial resistance to C. campestris (2). References: (1) M. Costea et al. SIDA 22:151, 2006. (2) Y. Goldwasser et al. Weed Res. 52:122, 2012. (3) C. L. Hitchcock and A. Cronquist. Flora of the Pacific Northwest: An Illustrated Manual. University of Washington Press, Seattle, 1973. (4) D. Rubiales et al. Dodder. Page 98 in: Compendium of Chickpea and Lentil Diseases and Pests. W. Chen et al., eds. APS Press, St. Paul, Minnesota, 2011.
6
Wheeler, Bryan. "Book Reviews: Pests and Diseases of Tropical Crops. Vol. 2: Field Handbook." Outlook on Agriculture 18, n.º 4 (dezembro de 1989): 192. http://dx.doi.org/10.1177/003072708901800426.
Texto completo da fonte
7
Truzina, Lyudmila, e Larissa Korovina. "TO THE ANNIVERSARY OF THE FEDERAL WILLIAMS RESEARCH CENTER OF FORAGE PRODUCTION AND AGROECOLOGY: ABOUT THE PLANT PROTECTION DEPARTMENT". Adaptive Fodder Production 2022, n.º 1 (5 de maio de 2022): 59–70. http://dx.doi.org/10.33814/afp-2222-5366-2022-1-59-70.
Texto completo da fonteResumo:
The main directions of research on chemical means of protecting fodder crops from diseases, pests and weeds in the field fodder production of the All-Russian Fodder Research Institute are given. Studies on toxicological assessment of feed and soil are given. Plant Protection Department included three laboratories: the Herbicide Laboratory, the Plant Protection Laboratory and the Feed Toxicological Evaluation Laboratory. The Laboratory of Herbicides was established in 1967 to conduct research on the chemical method of controlling weeds on fodder crops, hayfields and pastures. Research on the study of pests of fodder crops was started in 1939 in the newly created laboratory for the protection of fodder crops from pests and diseases. The Feed Toxicology Assessment Laboratory was established in 1980 to assess pesticide residues in crop and soil. As a result of the studies, a system of measures for clover from pests has been developed; alfalfa diseases and pests and measures to combat them in the Non-Chernozem zone were studied. Pests and pathogens of corn, root crops, peas, lupine and other fodder crops were identified; their biology, ecology and harmfulness have been studied. A set of protective measures has been developed to combat the main pests and diseases of fodder crops, including soil cultivation techniques, early sowing dates, the use of resistant varieties, micro- and macrofertilizers, pre-sowing treatment of seeds with combined preparations, etc. Plant Protection Department carried out work with herbicides. As a result of research begun in 1950, a method was developed to clean the meadows from weedy herbaceous vegetation with the help of preparations 2,4-D and 2M-4X. A chemical method for the destruction of woody and shrubby vegetation with the help of the same preparations in the Non-Chernozem zone of the European part of the USSR has been developed. Methods of using herbicides on crops of almost all fodder crops have been developed: perennial and annual legumes and cereal grasses for green mass and seeds, corn, fodder beets, rapeseed, etc. The theoretical issues of the mutual influence of fodder crops and weeds are studied, the substantiation of the effectiveness of the use of herbicides on different types of soils is given.
8
González-Domínguez, Elisa, César Monzó e Antonio Vicent. "New Trends in Disease and Pest Management: Challenges and Opportunities". Agronomy 11, n.º 5 (7 de maio de 2021): 923. http://dx.doi.org/10.3390/agronomy11050923.
Texto completo da fonte
9
McRoberts, N., G. Hughes e S. Savary. "Integrated approaches to understanding and control of diseases and pests in field crops". Australasian Plant Pathology 32, n.º 2 (2003): 167. http://dx.doi.org/10.1071/ap03026.
Texto completo da fonte
10
Etebari, Kayvan, Pauline Lenancker, Kevin S. Powell e Michael J. Furlong. "Transcriptomics Reveal Several Novel Viruses from Canegrubs (Coleoptera: Scarabaeidae) in Central Queensland, Australia". Viruses 14, n.º 3 (21 de março de 2022): 649. http://dx.doi.org/10.3390/v14030649.
Texto completo da fonteResumo:
Canegrubs (Coleoptera: Scarabaeidae) are major pests of sugarcane crops in Australia, but despite long-term and intensive research, no commercially viable biological control agents have been identified. We used the RNA-Seq approach to explore the viriomes of three different species of canegrubs from central Queensland, Australia to identify potential candidates for biological control. We identified six novel RNA viruses, characterized their genomes, and inferred their evolutionary relationships with other closely related viruses. These novel viruses showed similarity to other known members from picornaviruses, benyviruses, sobemoviruses, totiviruses, and reoviruses. The abundance of viral reads varied in these libraries; for example, Dermolepida albohirtum picorna-like virus (9696 nt) was built from 83,894 assembled reads while only 1350 reads mapped to Lepidiota negatoria beny-like virus (6371 nt). Future studies are essential to determine their natural incidence in different life stages of the host, biodiversity, geographical distributions, and potential as biological control agents for these important pests of sugarcane.
11
Boltayev, Botir, e Sanjar Boltayev. "Management methods of harmful pests in the cotton-wheat crop rotation system". E3S Web of Conferences 244 (2021): 02049. http://dx.doi.org/10.1051/e3sconf/202124402049.
Texto completo da fonteResumo:
This article analyzed the ecological succession between pests of crops as a result of the transition from the traditional cotton-alfalfa crop rotation system to the cotton-grain crop rotation system. It was found that the species composition, development and propagation characteristics of harmful organisms in the weeds around the field, as well as in the intermediate crops, can be reduced by up to 60-70%, and protected entomophagous organisms from the destructive effects of pesticides through lateral tillage of the 30-meter edge of the cotton crop. Furthermore, it was possible to apply biological methods to the remaining 70-80% of the field. It was necessary to properly organize the system of crop rotation “Cotton-grain” towards naturally controlling (reduce or eliminate) the number of harmful organisms (pests, diseases and weeds) in the agrophytocenosis. It was observed that diseases (especially rust), weeds (especially wild oats, raygras), pests (weeds, wheat thrips, slime,) were 2-3 times less in the grain planted after cotton, the number of spiders in the cotton field planted after grain were 3-4 times less, and diseases were decreased by 25-30%.
12
Pottorff, Laura Pickett, e Karen L. Panter. "Integrated Pest Management and Biological Control in High Tunnel Production". HortTechnology 19, n.º 1 (janeiro de 2009): 61–65. http://dx.doi.org/10.21273/hortsci.19.1.61.
Texto completo da fonteResumo:
Crops grown in high tunnels are just as susceptible to pests and diseases as those grown under greenhouse and field conditions. Crops that lend themselves economically to this type of production system are edible and/or minor crops. Therefore, labeled pesticides for these crops are limited and sometimes nonexistent. However, there is a wide range of integrated pest management (IPM) strategies available to high tunnel producers. These strategies include biological control, which is often left out of traditional IPM programs when labeled pesticides are available. High tunnel production is very conducive to the inclusion of biological controls and allows for a truly IPM system. This article provides a selective overview of common arthropod pests and diseases encountered in high tunnels, as well as strategies that have potential for becoming best management practices in high tunnels with additional research.
13
Clouston, Annabel, Owain Edwards e Paul Umina. "An insecticide baseline study of Australian broadacre aphids". Crop and Pasture Science 67, n.º 2 (2016): 236. http://dx.doi.org/10.1071/cp15208.
Texto completo da fonteResumo:
Brevicoryne brassicae (Linnaeus), Lipaphis pseudobrassicae (Davis), Acyrthosiphon kondoi (Shinji), Aphis craccivora (Koch) and Rhopalosiphum padi (Linnaeus) are among the most important aphid pests in Australian broadacre systems. In this study a leaf-dip method was used to assay pirimicarb, dimethoate, α-cypermethrin and imidacloprid against field populations collected from Victoria, New South Wales, South Australia, Western Australia and Queensland. This research established toxicity baseline data that will be important for future monitoring of insecticide responses in broadacre crops. It also provided an opportunity to identify any chemical tolerance that may be evolving in these pests. Acyrthosiphon craccivora populations showed differences in their responses to dimethoate, pirimicarb and imidacloprid (but not to α-cypermethrin), indicating possible shifts in field sensitivity to these three chemicals. Rhopalosiphum padi had the lowest sensitivity to all insecticides tested, with two populations (collected from South Australia and Queensland) showing less than 100% mortality when tested at the field rate of α-cypermethrin. There were few differences in insecticide responses between populations of the other three species. Continued screening of A. craccivora and R. padi populations is needed to fully assess the current status of tolerance among field populations and to strengthen resistance management tactics.
14
Seamark, Robert F. "Biotech prospects for the control of introduced mammals in Australia". Reproduction, Fertility and Development 13, n.º 8 (2001): 705. http://dx.doi.org/10.1071/rd01073.
Texto completo da fonteResumo:
More than twenty exotic vertebrate species are now listed as pests in Australia. Collectively, these pests have a huge economic and environmental impact and pose a major threat to Australia’s ecosystems and unique biodiversity. Management of such pests on a continental scale is a major challenge. Recent advances in biotechnology suggest alternatives to the lethal diseases normally sought for use as biological control agents. One proposal, being investigated in the Pest Animal Control Cooperative Research Centre, Canberra, is the use of biotechnology to develop a new generation of agents that act through controlling reproduction to prevent the build up of pest populations. The core concept is fertility control through immunocontraceptive vaccines delivered by viruses that specifically infect the target pest population. Proof of this exciting concept has been obtained for the mouse and, very recently, the rabbit, and a candidate vaccine vector identified for the fox, portending better control of a trio of Australia’s most pervasive pests. Other advances in biotechnology suggest ways to negate the build up of both innate and acquired immune resistance in target pest populations that normally act to limit the efficacy and effective life of biocontrol agents in the field. Prospects for extending the use of virally vectored vaccines to the field management of wildlife diseases are also identified. Targets for such vaccines include a growing suite of emerging diseases, hosted by Australia’s wildlife, which pose a threat to human and livestock health. Numerous technical challenges remain to be addressed before any of these new agents are ready for use in the field. However, the major risk to their development is now no longer viewed as being technical, but the failure to gain public acceptance for their use in the field. This already significant risk is exasperated by the present heightened level of public concern about all introductions of genetically modified organisms.
15
Qureshi, S. A., D. J. Midmore, S. S. Syeda e D. J. Reid. "A comparison of alternative plant mixes for conservation bio-control by native beneficial arthropods in vegetable cropping systems in Queensland Australia". Bulletin of Entomological Research 100, n.º 1 (27 de março de 2009): 67–73. http://dx.doi.org/10.1017/s0007485309006774.
Texto completo da fonteResumo:
AbstractCucurbit crops host a range of serious sap-sucking insect pests, including silverleaf whitefly (SLW) and aphids, which potentially represent considerable risk to the Australian horticulture industry. These pests are extremely polyphagous with a wide host range. Chemical control is made difficult due to resistance and pollution, and other side-effects are associated with insecticide use. Consequently, there is much interest in maximising the role of biological control in the management of these sap-sucking insect pests. This study aimed to evaluate companion cropping alongside cucurbit crops in a tropical setting as a means to increase the populations of beneficial insects and spiders so as to control the major sap-sucking insect pests. The population of beneficial and harmful insects, with a focus on SLW and aphids, and other invertebrates were sampled weekly on four different crops which could be used for habitat manipulation: Goodbug Mix (GBM; a proprietary seed mixture including self-sowing annual and perennial herbaceous flower species); lablab (Lablab purpureus L. Sweet); lucerne (Medicago sativa L.); and niger (Guizotia abyssinica (L.f.) Cass.). Lablab hosted the highest numbers of beneficial insects (larvae and adults of lacewing (Mallada signata (Schneider)), ladybird beetles (Coccinella transversalis Fabricius) and spiders) while GBM hosted the highest numbers of European bees (Apis mellifera Linnaeus) and spiders. Lucerne and niger showed little promise in hosting beneficial insects, but lucerne hosted significantly more spiders (double the numbers) than niger. Lucerne hosted sig-nificantly more of the harmful insect species of aphids (Aphis gossypii (Glover)) and Myzus persicae (Sulzer)) and heliothis (Heliothis armigera Hübner). Niger hosted significantly more vegetable weevils (Listroderes difficillis (Germar)) than the other three species. Therefore, lablab and GBM appear to be viable options to grow within cucurbits or as field boundary crops to attract and increase beneficial insects and spiders for the control of sap-sucking insect pests. Use of these bio-control strategies affords the opportunity to minimise pesticide usage and the risks associated with pollution.
16
Shi, Yue-Xin, Bo-Kai Zhang, Yong-Xiang Wang, Han-Qian Luo e Xiang Li. "Constructing Crop Portraits Based on Graph Databases Is Essential to Agricultural Data Mining". Information 12, n.º 6 (27 de maio de 2021): 227. http://dx.doi.org/10.3390/info12060227.
Texto completo da fonteResumo:
Neo4j is a graph database that can use not only data, but also data relationships. Crop portraits, a kind of property graph, model the crop entity in the real world based on data to realize the networked management of crop knowledge. The existing crop knowledge base has shortcomings such as single crop variety, incomplete description, and lack of agricultural knowledge. Constructing crop portraits can provide a comprehensive description of crops and make up for these shortcomings. This research used agricultural question-and-answer data and popular science data obtained by text crawling as the original data, selected labels to establish a crop portrait that including three categories (crops, pesticides, and diseases and pests), and used the graph database (Neo4j) to store and display these portrait data. Information mining found that the crop portrait revealed the occurrence trend of diseases and pests, exhibited a nonintrinsic connection between different diseases and pests, and provided a variety of pesticides to choose from for control of diseases and pests. The results showed that constructing crop portraits is beneficial to agricultural analysis, and has practical application values and theoretical research prospects in the field of big data analytics.
17
Ward, Samantha E., Paul A. Umina, Sarina Macfadyen e Ary A. Hoffmann. "Hymenopteran Parasitoids of Aphid Pests within Australian Grain Production Landscapes". Insects 12, n.º 1 (8 de janeiro de 2021): 44. http://dx.doi.org/10.3390/insects12010044.
Texto completo da fonteResumo:
In grain crops, aphids are important pests, but they can be suppressed by hymenopteran parasitoids. A challenge in incorporating parasitoids into Integrated Pest Management (IPM) programs, however, is that parasitoid numbers can be low during periods within the season when aphids are most damaging. Understanding the population dynamics of key aphid species and their parasitoids is central to ameliorating this problem. To examine the composition and seasonal trends of both aphid and parasitoid populations in south-eastern Australia, samples were taken throughout the winter growing seasons of 2017 and 2018 in 28 fields of wheat and canola. Myzus persicae (Sulzer) was the most abundant aphid species, particularly within canola crops. Across all fields, aphid populations remained relatively low during the early stages of crop growth and increased as the season progressed. Seasonal patterns were consistent across sites, due to climate, crop growth stage, and interactions between these factors. For canola, field edges did not appear to act as reservoirs for either aphids or parasitoids, as there was little overlap in the community composition of either, but for wheat there was much similarity. This is likely due to the presence of similar host plants within field edges and the neighbouring crop, enabling the same aphid species to persist within both areas. Diaeretiella rapae (M’Intosh) was the most common parasitoid across our study, particularly in canola, yet was present only in low abundance at field edges. The most common parasitoid in wheat fields was Aphidius matricariae (Haliday), with field edges likely acting as a reservoir for this species. Secondary parasitoid numbers were consistently low across our study. Differences in parasitoid species composition are discussed in relation to crop type, inter-field variation, and aphid host. The results highlight potential focal management areas and parasitoids that could help control aphid pests within grain crops.
18
Ward, Samantha E., Paul A. Umina, Sarina Macfadyen e Ary A. Hoffmann. "Hymenopteran Parasitoids of Aphid Pests within Australian Grain Production Landscapes". Insects 12, n.º 1 (8 de janeiro de 2021): 44. http://dx.doi.org/10.3390/insects12010044.
Texto completo da fonteResumo:
In grain crops, aphids are important pests, but they can be suppressed by hymenopteran parasitoids. A challenge in incorporating parasitoids into Integrated Pest Management (IPM) programs, however, is that parasitoid numbers can be low during periods within the season when aphids are most damaging. Understanding the population dynamics of key aphid species and their parasitoids is central to ameliorating this problem. To examine the composition and seasonal trends of both aphid and parasitoid populations in south-eastern Australia, samples were taken throughout the winter growing seasons of 2017 and 2018 in 28 fields of wheat and canola. Myzus persicae (Sulzer) was the most abundant aphid species, particularly within canola crops. Across all fields, aphid populations remained relatively low during the early stages of crop growth and increased as the season progressed. Seasonal patterns were consistent across sites, due to climate, crop growth stage, and interactions between these factors. For canola, field edges did not appear to act as reservoirs for either aphids or parasitoids, as there was little overlap in the community composition of either, but for wheat there was much similarity. This is likely due to the presence of similar host plants within field edges and the neighbouring crop, enabling the same aphid species to persist within both areas. Diaeretiella rapae (M’Intosh) was the most common parasitoid across our study, particularly in canola, yet was present only in low abundance at field edges. The most common parasitoid in wheat fields was Aphidius matricariae (Haliday), with field edges likely acting as a reservoir for this species. Secondary parasitoid numbers were consistently low across our study. Differences in parasitoid species composition are discussed in relation to crop type, inter-field variation, and aphid host. The results highlight potential focal management areas and parasitoids that could help control aphid pests within grain crops.
19
Tomescu, A., e G. Negru. "AN OVERVIEW ON FUNGAL DISEASES AND PESTS ON THE FIELD TOMATO CROPS IN ROMANIA". Acta Horticulturae, n.º 613 (setembro de 2003): 259–66. http://dx.doi.org/10.17660/actahortic.2003.613.41.
Texto completo da fonte
20
Morales, José Pablo, Félix Navarro, Félix Rondón, Clemente Báez e Ricardo Genao. "Evaluación de variedades de cebolla en la República Dominicana." Agronomía Mesoamericana 11, n.º 2 (1 de julho de 2006): 115. http://dx.doi.org/10.15517/am.v11i2.17322.
Texto completo da fonteResumo:
A field study was conducted in order to evaluate 16 onion crops for their yield, grade and susceptibility to pests and diseases under field conditions in San Cristóbal, Dominican Republic. The cultivars 'Texas Grano 438', 'Liberty', 'Lexus', 'Domingo', 'Serrana', 'Mercedes', 'Yellow Granex', 'Cougar', XPH 6700, 'Sebaqueña', 'Contessa', 'White Hawk', 'Diamante', 'Red Creole', 'Híbrido Rojo' and 'Sivan' were distributed in randomized complete blocks with three repetitions. Experimental units consisted of two double rowsthree meters in length. 'Red Creole', 'Yellow Granex' and 'Contessa' were utilized as prototypes for the red, yellow, and white onion crops, respectively. Onion crops were managed following a medium level technology package recommended for the zone. The variables evaluated were early development, diameter of thebulb neck at harvest, number of rings per bulb, incidence of pests and diseases, yield grades, total commercial yield, percentage of twin bulbs and percentage of rotten bulbs after curing. Statistical analysis revealed that among yellow cultivars, the materials with the best attributes of yield and bulb quality were 'Texas Grano 438', 'Lexus', 'Liberty' and XPH 6700. The yield of the of 'Texas Grano 438'. Among white onion crops, 'Diamante' and 'Contessa' were significantly better than 'Sebaqueña' and 'White Hawk' in terms of early development and/or yield. For the red crops, 'Red Creole' was significantly inferior than 'Híbrido Rojo' and 'Sivan' in bulb grade and yield.
21
Dassanayake, Mackingsley Kushan, Chien Hwa Chong, Teng-Jin Khoo, Adam Figiel, Antoni Szumny e Chee Ming Choo. "Synergistic Field Crop Pest Management Properties of Plant-Derived Essential Oils in Combination with Synthetic Pesticides and Bioactive Molecules: A Review". Foods 10, n.º 9 (27 de agosto de 2021): 2016. http://dx.doi.org/10.3390/foods10092016.
Texto completo da fonteResumo:
The management of insect pests and fungal diseases that cause damage to crops has become challenging due to the rise of pesticide and fungicide resistance. The recent developments in studies related to plant-derived essential oil products has led to the discovery of a range of phytochemicals with the potential to combat pesticide and fungicide resistance. This review paper summarizes and interprets the findings of experimental work based on plant-based essential oils in combination with existing pesticidal and fungicidal agents and novel bioactive natural and synthetic molecules against the insect pests and fungi responsible for the damage of crops. The insect mortality rate and fractional inhibitory concentration were used to evaluate the insecticidal and fungicidal activities of essential oil synergists against crop-associated pests. A number of studies have revealed that plant-derived essential oils are capable of enhancing the insect mortality rate and reducing the minimum inhibitory concentration of commercially available pesticides, fungicides and other bioactive molecules. Considering these facts, plant-derived essential oils represent a valuable and novel source of bioactive compounds with potent synergism to modulate crop-associated insect pests and phytopathogenic fungi.
22
Cubero, Sergio, Ester Marco-Noales, Nuria Aleixos, Silvia Barbé e Jose Blasco. "RobHortic: A Field Robot to Detect Pests and Diseases in Horticultural Crops by Proximal Sensing". Agriculture 10, n.º 7 (7 de julho de 2020): 276. http://dx.doi.org/10.3390/agriculture10070276.
Texto completo da fonteResumo:
RobHortic is a remote-controlled field robot that has been developed for inspecting the presence of pests and diseases in horticultural crops using proximal sensing. The robot is equipped with colour, multispectral, and hyperspectral (400–1000 nm) cameras, located looking at the ground (towards the plants). To prevent the negative influence of direct sunlight, the scene was illuminated by four halogen lamps and protected from natural light using a tarp. A GNSS (Global Navigation Satellite System) was used to geolocate the images of the field. All sensors were connected to an on-board industrial computer. The software developed specifically for this application captured the signal from an encoder, which was connected to the motor, to synchronise the acquisition of the images with the advance of the robot. Upon receiving the signal, the cameras are triggered, and the captured images are stored along with the GNSS data. The robot has been developed and tested over three campaigns in carrot fields for the detection of plants infected with ‘Candidatus Liberibacter solanacearum’. The first two years were spent creating and tuning the robot and sensors, and data capture and geolocation were tested. In the third year, tests were carried out to detect asymptomatic infected plants. As a reference, plants were analysed by molecular analysis using a specific real-time Polymerase Chain Reaction (PCR), to determine the presence of the target bacterium and compare the results with the data obtained by the robot. Both laboratory and field tests were done. The highest match was obtained using Partial Least Squares-Discriminant Analysis PLS-DA, with a 66.4% detection rate for images obtained in the laboratory and 59.8% for images obtained in the field.
23
Horne, Paul A., Jessica Page e Cam Nicholson. "When will integrated pest management strategies be adopted? Example of the development and implementation of integrated pest management strategies in cropping systems in Victoria". Australian Journal of Experimental Agriculture 48, n.º 12 (2008): 1601. http://dx.doi.org/10.1071/ea08072.
Texto completo da fonteResumo:
This paper discusses the development and implementation of integrated pest management (IPM) strategies for broadacre cropping in Victoria, Australia, with reference to other crops and also the levels of adoption of IPM in Australia and overseas. Levels and rates of adoption are mostly low but with some exceptions. The reasons for differing levels of adoption include the failure of strategies to successfully deal with all pests, the lack of motivation to change to using IPM given current successful pesticide-based controls, and the poor availability of IPM advisors in the field. This paper outlines how IPM strategies for wheat, barley and canola crops were developed and implemented using a collaborative approach between farmers, agronomists and entomologists. It was found that although there were no existing specific IPM strategies for the crops grown in the region of south-eastern Australia, there was sufficient information for farmers to start using an IPM approach. This paper gives a case study of implementing change to IPM from conventional pesticide spraying, including the development of a course in IPM for growers and agronomists. It focuses on the process of changing practices and information transfer rather than on entomological details.
24
Fatimah, Siti, Siti Muafalah, Nurholis Nurholis e Achmad Djunaedy. "Inventory of Pests and Diseases Intensity on 10 Bambara Groundnut (Vigna subterranea (L.) Verdc.) Lines in The Dryland of Madura, Indonesia, during The Dry Season". Rekayasa 15, n.º 1 (10 de abril de 2022): 79–86. http://dx.doi.org/10.21107/rekayasa.v15i1.13988.
Texto completo da fonteResumo:
Landraces breeding scheme of bambara groundnut from various regions of Indonesia since 2012 provides several potential lines which are uniform, high yielding and drought-tolerant. Evaluation of resistance to pests and diseases is aimed to select potential lines which are resistant to pests and diseases and potential for development in Madura dry land during the dry season. The present study used descriptive method through field observation technique on 10 selected potential lines of Bambara groundnut. The results showed that there were 5 (five) types of pests and 4 types of diseases found in bambara groundnut crops planted during the dry season in Bangkalan Regency of Madura. The pests attacking more than 25% per plot were aphids, ladybugs and grasshoppers. A symptom of pathogen attacking more than 25% per plot were Bean common mosaic virus and soybean common mosaic virus. The GSG 1.1.1 potential line had the lowest pest attack and the BBL 2.1.1 potential line had the lowest disease incidence.
25
Khan, Masudulla, Azhar U. Khan, Mohd Abul Hasan, Krishna Kumar Yadav, Marina M. C. Pinto, Nazia Malik, Virendra Kumar Yadav, Afzal Husain Khan, Saiful Islam e Gulshan Kumar Sharma. "Agro-Nanotechnology as an Emerging Field: A Novel Sustainable Approach for Improving Plant Growth by Reducing Biotic Stress". Applied Sciences 11, n.º 5 (4 de março de 2021): 2282. http://dx.doi.org/10.3390/app11052282.
Texto completo da fonteResumo:
In the present era, the global need for food is increasing rapidly; nanomaterials are a useful tool for improving crop production and yield. The application of nanomaterials can improve plant growth parameters. Biotic stress is induced by many microbes in crops and causes disease and high yield loss. Every year, approximately 20–40% of crop yield is lost due to plant diseases caused by various pests and pathogens. Current plant disease or biotic stress management mainly relies on toxic fungicides and pesticides that are potentially harmful to the environment. Nanotechnology emerged as an alternative for the sustainable and eco-friendly management of biotic stress induced by pests and pathogens on crops. In this review article, we assess the role and impact of different nanoparticles in plant disease management, and this review explores the direction in which nanoparticles can be utilized for improving plant growth and crop yield.
26
Chen, Liming, Heping Zhu, Leona Horst, Matthew Wallhead, Michael Reding e Amy Fulcher. "Management of Pest Insects and Plant Diseases in Fruit and Nursery Production with Laser-guided Variable-rate Sprayers". HortScience 56, n.º 1 (janeiro de 2021): 94–100. http://dx.doi.org/10.21273/hortsci15491-20.
Texto completo da fonteResumo:
Laser-guided variable-rate intelligent spray technology is anticipated to reduce pesticide use in production of crops and safeguard the environment. However, the ability of this technology to effectively control insect pests and diseases of crops must be validated before it becomes part of integrated pest management programs. Abilities of three different intelligent sprayers were tested to control pest insects and plant diseases at one fruit farm and two ornamental nurseries in Ohio during three consecutive growing seasons. The same sprayers with disabled intelligent functions were used as conventional constant-rate applications for comparisons. Test crops were apple (Malus pumila), peach (Prunus persica), blueberry (Vaccinium sect. Cyanococcus), black raspberry (Rubus occidentalis), crabapple (Malus sp.), maple (Acer sp.), birch (Betula sp.), and dogwood (Cornus florida). There were five insects and six diseases total involved in the investigations in the fruit farm and two nurseries. The field tests showed the intelligent spray applications reduced pesticide and foliar fertilizer use by ≈30% to 65% on average during the 3-year experiments. At the same time, intelligent spray technology was similar or more effective than conventional spray technology when controlling insects and diseases on a variety of crops. These results demonstrated that intelligent spray technology was environmentally friendly and more effective for control of insect and disease pests in fruit farms and ornamental tree nurseries.
27
Lagos-Ortiz, Katty, María del Pilar Salas-Zárate, Mario Andrés Paredes-Valverde, José Antonio García-Díaz e Rafael Valencia-García. "AgriEnt: A Knowledge-Based Web Platform for Managing Insect Pests of Field Crops". Applied Sciences 10, n.º 3 (4 de fevereiro de 2020): 1040. http://dx.doi.org/10.3390/app10031040.
Texto completo da fonteResumo:
In the agricultural context, there is a great diversity of insects and diseases that affect crops. Moreover, the amount of data available on data sources such as the Web regarding these topics increase every day. This fact can represent a problem when farmers want to make decisions based on this large and dynamic amount of information. This work presents AgriEnt, a knowledge-based Web platform focused on supporting farmers in the decision-making process concerning crop insect pest diagnosis and management. AgriEnt relies on a layered functional architecture comprising four layers: the data layer, the semantic layer, the web services layer, and the presentation layer. This platform takes advantage of ontologies to formally and explicitly describe agricultural entomology experts’ knowledge and to perform insect pest diagnosis. Finally, to validate the AgriEnt platform, we describe a case study on diagnosing the insect pest affecting a crop. The results show that AgriEnt, through the use of the ontology, has proven to produce similar answers as the professional advice given by the entomology experts involved in the evaluation process. Therefore, this platform can guide farmers to make better decisions concerning crop insect pest diagnosis and management.
28
MacDougall, Samantha, Fatih Bayansal e Ali Ahmadi. "Emerging Methods of Monitoring Volatile Organic Compounds for Detection of Plant Pests and Disease". Biosensors 12, n.º 4 (13 de abril de 2022): 239. http://dx.doi.org/10.3390/bios12040239.
Texto completo da fonteResumo:
Each year, unwanted plant pests and diseases, such as Hendel or potato soft rot, cause damage to crops and ecosystems all over the world. To continue to feed the growing population and protect the global ecosystems, the surveillance and management of the spread of these pests and diseases are crucial. Traditional methods of detection are often expensive, bulky and require expertise and training. Therefore, inexpensive, portable, and user-friendly methods are required. These include the use of different gas-sensing technologies to exploit volatile organic compounds released by plants under stress. These methods often meet these requirements, although they come with their own set of advantages and disadvantages, including the sheer number of variables that affect the profile of volatile organic compounds released, such as sensitivity to environmental factors and availability of soil nutrients or water, and sensor drift. Furthermore, most of these methods lack research on their use under field conditions. More research is needed to overcome these disadvantages and further understand the feasibility of the use of these methods under field conditions. This paper focuses on applications of different gas-sensing technologies from over the past decade to detect plant pests and diseases more efficiently.
29
Vasilieva, T. V., e A. S. Vasilieva. "Integrated protection of the Galega orientalis on sod-podzolic soil". Agrarian science, n.º 4 (21 de maio de 2022): 73–76. http://dx.doi.org/10.32634/0869-8155-2022-358-4-73-76.
Texto completo da fonteResumo:
Relevance. The Galega orientalis, growing in one place for many years in a row, accumulates many different diseases and insect pests in its agrobiocenosis and the seed productivity of the crop decreases, so comprehensive protection of crops is relevant.Methods. The accounting platforms were laid on the experimental field of the Vologda State Agricultural Academy in 2012 on the Gale variety. The soil of the site is sod-slightly podzolic, medium loamy, with a capacity of the arable horizon of 20-22 cm and a humus content of 2.6%. Observations of diseases and pests were carried out during the entire growing season of the Galega orientalis from May to September once a decade. The collection of insect pests was carried out with an entomological net, based on samples in 10 strokes, which corresponded to the density of insects per 1 m2.Results. Diseases such as peronosporosis, powdery mildew and rust with an average number of 5-9 specimens per 1 m2 were detected on Galega orientalis. The pests were dominated by nodule weevils of the genus Sitona, clover seed eaters of the genus Apion and grass bugs, with a number of more than 10 specimens per 1 m2. The integrated protection of Galega orientalis included weeding of experimental plots from weeds, spraying of crops from diseases in the phase of regrowth of the Galega orientalis with a fungicide — Falcon with a consumption rate of 0.6 l/ha and from pests in the budding phase of the culture — with a microbiological preparation Bitoxibacillin with consumption rates of 2, 3 and 4 kg/ha. A sufficiently high efficiency of the fungicide Falcon, CS (suspension concentrate) with a consumption rate of 0.6 l /ha — 80.9-91.7% — was established. The efficiency of Bitoxibacillin with a consumption rate of 4 kg/ha was 89.5-92.5%.
30
Vasilieva, T. V., e A. S. Vasilieva. "Integrated protection of the Galega orientalis on sod-podzolic soil". Agrarian science, n.º 2 (10 de abril de 2022): 90–93. http://dx.doi.org/10.32634/0869-8155-2022-356-2-90-93.
Texto completo da fonteResumo:
The Galega orientalis, growing in one place for many years in a row, accumulates many different diseases and insect pests in its agrobiocenosis and the seed productivity of the crop decreases, so comprehensive protection of crops is relevant. The accounting platforms were laid on the experimental field of the Vologda State Agricultural Academy in 2012 on the Gale variety. The soil of the site is sod-slightly podzolic, medium loamy, with a capacity of the arable horizon of 20–22 cm and a humus content of 2.6%. Observations of diseases and pests were carried out during the entire growing season of the Galega orientalis — from May to September once a decade. The collection of insect pests was carried out with an entomological net, based on samples in 10 strokes, which corresponded to the density of insects per 1 m2. Diseases such as peronosporosis, powdery mildew and rust with an average number of 5–9 specimens per 1 m2 were detected on Galega orientalis. The pests were dominated by nodule weevils of the genus Sitona, clover seed eaters of the genus Apion and grass bugs, with a number of more than 10 specimens per 1 m2. The integrated protection of the eastern goat patch included weeding of experimental plots from weeds, spraying of crops: from diseases in the regrowth phase of the eastern goat patch — with the fungicide "Falcon" with a consumption rate of 0.6 l/ha, from pests in the budding phase of the culture — with the microbiological preparation "Bitoxibacillin" with consumption rates of 2, 3 and 4 kg /ha. A sufficiently high efficiency of the fungicide "Falcon", CS (suspension concentrate) with a consumption rate of 0.6 l/ha — 80.9–91.7% has been established. The effectiveness of the drug "Bitoxibacillin" with a consumption rate of 4 kg / ha was 89.5–92.5%.
31
Myhal, Mykola, Iryna Layko, Serhiy Mishchenko, Hanna Kyrychenko, Hanna Layko e Tetiana Biryukova. "Conditions of development of weeds, pests and diseases in crops of monoculture of hemp, depending on fertilizer". Bast and Technical Crops, n.º 6(11) (1 de dezembro de 2018): 66–80. http://dx.doi.org/10.48096/btc.2018.6(11).66-80.
Texto completo da fonteResumo:
The article presents the results of studies of the conditions for the development of weeds, pests and diseases in the sowing of hemp monoculture. It was found that hemp is well adapted for growing for a long time in one field, providing a high yield of hemp production. It is recommended to grow a monoculture on fiber (harvesting in the phase of flowering plants). This makes it possible to avoid the ripening of seeds of the bulk of weeds and the main periods of harmfulness of pests and diseases. Differences in the degree of weediness of the field were revealed depending on the form and dose of fertilizers. In areas fertilized with manure, there are more weeds than in areas with introduced fertilizers. The large contamination of the fertilized areas is a consequence of the introduction of viable weed seeds together with manure, which is not properly harvested and stored in field shoulders. With an increase in the dose of manure, the number of weeds increases, and an increase in the dose of mineral fertilizers with which weed seeds are not introduced, on the contrary, decreases as a result of an increase in the height of the stalk and its foliage. This is clearly confirmed by the fact that during the period from 3-4 pairs of leaves and to the phase of flowering plants, a large number of weeds die. Indicated on agrotechnical methods of weed, pest and disease control when growing hemp monoculture.
32
Baker, Geoff H., Colin R. Tann e Gary P. Fitt. "Production of Helicoverpa spp. (Lepidoptera, Noctuidae) from different refuge crops to accompany transgenic cotton plantings in eastern Australia". Australian Journal of Agricultural Research 59, n.º 8 (2008): 723. http://dx.doi.org/10.1071/ar07421.
Texto completo da fonteResumo:
The adoption of transgenic (Bt) cotton varieties has markedly reduced feeding damage by noctuid pests, Helicoverpa armigera and H. punctigera, in Australian cotton crops. However, the potential for Bt resistance to evolve within these insect pests is a major concern. To reduce the likelihood of Bt resistance occurring, it is mandatory for growers of Bt cotton to also grow refuge crops which produce large numbers of Bt-susceptible moths. We present here findings from a series of field studies which sought to identify the relative Helicoverpa productivity of different refuge crop options. The abundance of Helicoverpa pupae (during the cotton season) was compared under crops of Ingard® (transgenic, single Bt gene) cotton, sprayed conventional cotton, and various unsprayed refuge crops (cotton, sorghum, maize, pigeon pea) from 1996 to 2003 in the major cotton-producing regions of northern New South Wales, plus St George and Dirranbandi in southern Queensland. Unsprayed, conventional cotton was used as the ‘control’ refuge in these studies. Productivity of adult Helicoverpa was estimated by surveying for pupae and discounting those that were parasitised and dead. Some supplementary experiments were also conducted to evaluate specific issues, in particular the value of additional refuge crops sown late in 2000–01 (due to accidental over-planting of Ingard® cotton that year) and the potential productivity of mixed plantings of various refuge crops which individually flowered at different times throughout the cotton season. Unsprayed refuges generally produced many more pupae than sprayed, conventional cotton and Ingard® cotton. Overall, pigeon pea, which has the advantage of prolonged flowering and thus on-going attractiveness to Helicoverpa, was the most reliable and productive refuge option, producing about twice as many pupae as unsprayed cotton. The seed mix refuge is perhaps a viable alternative option, although logistically more difficult for growers to adopt. Laboratory rearing of live pupae until moth emergence indicated that parasitism can be a substantial source of mortality in some refuge crops, especially sorghum. The most common parasitoid of Helicoverpa pupae was the ichneumonid wasp, Heteropelma scaposum. Such parasitism can greatly reduce productivity of adult Helicoverpa from refuges and needs to be taken into account when assessing relative refuge ‘value’, although such refuges will obviously contribute to the abundance of these beneficial species across the landscape.
33
Prymak, I. D., O. M. Yakovenko, M. V. Voytovyk, V. M. Karaulna, L. V. Yezerkovska, O. B. Panchenko, Yu V. Fedoruk, I. A. Pokotylo e I. A. Panchenko. "Effect of soil treatment on pest infestation and crop disease distribution in black soil fields with short rotation crops". Ukrainian Journal of Ecology 10, n.º 1 (10 de fevereiro de 2020): 127–32. http://dx.doi.org/10.15421/2020_20.
Texto completo da fonteResumo:
We have established the influence of four tillage systems on pest distribution and development of diseases in cultivated cereals during three-year research (2017-2019) in the field stationary of the Bila Tserkva National Agrarian University, Ukraine (chernozem grain sprouting with five-course rotation). The population of turnip moth in winter wheat, spring barley, and soya was the highest under application of disk tillage, the lowest – under moldboard tillage. The moldboard treatment limited while the beardless and disk treatments stimulate the development of beet webworm in the cereal crops. The number of pests in soya, winter wheat, spring barley, and maize was higher under combined soil treatment compared to moldboard. We recorded no significant difference in pests towards tillage systems in sunflower crops. In soya, winter wheat and maize crops, the number of wireworm was significantly higher in molded than in molded cultivation; the opposite pattern was observed in the sunflower field, while for spring barley these values were at the same level. The distribution and development of root rot in cereal crops was higher in comparison with control, but this difference was insignificant in spring barley. The development of powdery mildew in spring barley crops was almost the same for these tillage options. In cereal crops, septoriosis lesions were almost at the same level in case of moldboard and combined tillage. Significant deterioration of phytosanitary condition at beardless and disk tillage resulted in significant reduction of crop rotation productivity in comparison with control. In the fields with combined and disk treatments, the productivity value was almost the same.
34
Lenné, J., e D. Wood. "Monodominant natural vegetation provides models for nature-based cereal production". Outlook on Agriculture 51, n.º 1 (11 de fevereiro de 2022): 11–21. http://dx.doi.org/10.1177/00307270221078022.
Texto completo da fonteResumo:
Nature-based solutions, principally diverse systems, are increasingly being promoted as the solution to future food production as they are perceived to be more productive, resilient and ecologically based. This ‘paradigm of in-field diversity’ approach is inciting a growing perception that monocultures, the source of most global food production, are ecologically dysfunctional and highly vulnerable to diseases and pests. Our perspective paper clearly shows that natural monodominant vegetation is common in nature and that the ancestral species of major cereals including wheat, barley and rice grew in monocultures maintained by disturbances such as fire or flood. Early farmers mimicked these ecological stresses during field management, favouring annual monodominant crops. We also present well-supported evidence that cereal monocultures are an ancient method of farming founded in the origins of agriculture and that modern plant breeding generates and supports monoculture crops that are inherently genetically diverse and usually resistant to prevailing diseases and pests. Until research has been done on the ecology, agronomy and management of diverse nature-based solutions to future agriculture, the scarce funding to agricultural research for future food production is better targeted at improving monoculture agriculture to be more efficient, productive, resilient and environmentally benign. Monoculture agriculture, particularly for cereals, is a proven natural model for future food production.
35
Baker, G. H. "The population dynamics of the mediterranean snails Cernuella virgata, Cochlicella acuta (Hygromiidae) and Theba pisana (Helicidae) in pasture - cereal rotations in South Australia: a 20-year study". Australian Journal of Experimental Agriculture 48, n.º 12 (2008): 1514. http://dx.doi.org/10.1071/ea08031.
Texto completo da fonteResumo:
The snails Cernuella virgata, Cochlicella acuta and Theba pisana are introduced pests of grain crops and pastures in southern Australia. The population dynamics of these three species of snail were studied for 20 years in two adjacent fields where they coexisted on a farm on the Yorke Peninsula in South Australia. The fields were used for pasture–cereal rotations. Surveys were conducted in autumn and spring each year, coinciding respectively with the start of the breeding season and peak abundance of snails (mostly juveniles). Populations varied greatly in abundance between years and between species, but snails were generally most common in spring, in wet years, especially those with wet autumns and wet springs. Rainfall early in a particular year (i.e. at sowing of crops in autumn) can thus be used to predict the likelihood of heavy snail infestations later in spring (i.e. at harvest). In contrast, the abundance of adult snails in autumn was a poor predictor of the subsequent abundance of juvenile snails in spring, especially in crops. There were no significant correlations, at field scale, between the average abundance of the three species of snail in spring, in either pastures or crops. However, at a sampling scale of 0.25 m2, there were consistent, negative relationships between the abundance of all three snail species. Such patterns may reflect either competitive interactions between snails or subtle differences in micro-habitat choice. Patterns in the abundance of snails (e.g. large numbers near field edges) were suggestive of occasional invasion from dense populations in adjacent fields.
36
Anago, Firmin N., Emile C. Agbangba, Brice T. C. Oussou, Gustave D. Dagbenonbakin e Lucien G. Amadji. "Cultivation of Cowpea Challenges in West Africa for Food Security: Analysis of Factors Driving Yield Gap in Benin". Agronomy 11, n.º 6 (3 de junho de 2021): 1139. http://dx.doi.org/10.3390/agronomy11061139.
Texto completo da fonteResumo:
Feeding the world in 2050 requires us to find ways to boost yields of the main local crops. Among those crops, cowpea is one of the grain legumes that is playing an important role in the livelihood of millions of people in West Africa, especially in Benin. Unfortunately, cowpea on-farm yields are very low. In order to understand the main factors explaining cowpea yield gaps, we collected and analyzed detailed survey data from 298 cowpea fields in Benin during the 2017, 2018 and 2019′s rainy seasons, respectively. Composite soil samples were collected from cowpea fields and analyzed in the laboratory. Data on farm field management practices and field conditions were recorded through interviews with 606 farmers. Average cowpea grain yields were low and seldom surpassed 700 kg ha−1 on farmer’s fields. Significant differences were observed between cowpea grain yields from northern to southern Benin (p < 0.05), and the lowest yields were observed in northern Benin. These low yields are related to crop management practices, soil nutrient contents, and the interaction of both. According to the model of regression tree from northern to southern Benin, the use of mineral fertilizer, insecticide sprays to control pests, and the improvement of phosphorus, nitrogen, potassium (P, N, K) and cation sum content in the topsoil would increase cowpea grain yields. Insect pests, diseases, and soil fertility decline are the largest constraints limiting grain yield in Benin. Future research should focus on formulating site-specific fertilizer recommendations for effective cowpea cultivation in Benin, as well as the control of insect pests and diseases.
37
Che’Ya, Nik Norasma, Nur Adibah Mohidem, Nor Athirah Roslin, Mohammadmehdi Saberioon, Mohammad Zakri Tarmidi, Jasmin Arif Shah, Wan Fazilah Fazlil Ilahi e Norsida Man. "Mobile Computing for Pest and Disease Management Using Spectral Signature Analysis: A Review". Agronomy 12, n.º 4 (16 de abril de 2022): 967. http://dx.doi.org/10.3390/agronomy12040967.
Texto completo da fonteResumo:
The demand for mobile applications in agriculture is increasing as smartphones are continuously developed and used for many purposes; one of them is managing pests and diseases in crops. Using mobile applications, farmers can detect early infection and improve the specified treatment and precautions to prevent further infection from occurring. Furthermore, farmers can communicate with agricultural authorities to manage their farm from home, and efficiently obtain information such as the spectral signature of crops. Therefore, the spectral signature can be used as a reference to detect pests and diseases with a hyperspectral sensor more efficiently than the conventional method, which takes more time to monitor the entire crop field. This review aims to show the current and future trends of mobile computing based on spectral signature analysis for pest and disease management. In this review, the use of mobile applications for pest and disease monitoring is evaluated based on image processing, the systems developed for pest and disease extraction, and the structure of steps outlined in developing a mobile application. Moreover, a comprehensive literature review on the utilisation of spectral signature analysis for pest and disease management is discussed. The spectral reflectance used in monitoring plant health and image processing for pest and disease diagnosis is mentioned. The review also elaborates on the integration of a spectral signature library within mobile application devices to obtain information about pests and disease in crop fields by extracting information from hyperspectral datasets. This review demonstrates the necessary scientific knowledge for visualising the spectral signature of pests and diseases using a mobile application, allowing this technology to be used in real-world agricultural settings.
38
Schellhorn, Nancy A., Sarina Macfadyen, Felix J. J. A. Bianchi, David G. Williams e Myron P. Zalucki. "Managing ecosystem services in broadacre landscapes: what are the appropriate spatial scales?" Australian Journal of Experimental Agriculture 48, n.º 12 (2008): 1549. http://dx.doi.org/10.1071/ea08112.
Texto completo da fonteResumo:
Over the past 200 years agriculture has expanded throughout Australia. The culmination of clearing and cultivating land at the farm scale has resulted in highly modified landscapes and a perceived loss of ecosystem services from pest control and pollination. We examine the literature: (i) to identify the appropriate spatial scale for managing pests, natural enemies and pollinators; and (ii) for evidence that farm-scale changes (due to agricultural intensification) across a landscape have resulted in a tipping point favouring pests and hindering pollinators. Although there is limited information to draw firm conclusions, the evidence suggests that actions undertaken on individual farms have an impact both on their neighbours and regionally, and that the culmination of these actions can lead to changes in population dynamics of pests, natural enemies and pollinators. For major pest species, there is reasonable evidence that grain growers may benefit from improved management and higher yields by implementing area-wide pest management strategies on a landscape scale in collaboration with growers of other crops that also share these pests. As yet, for natural enemies and pollinators there is little direct evidence that similar area-wide initiatives will have a greater effect than management strategies aimed at the field and farm level. Managing pests, natural enemies and pollinators beyond the scale of the field or farm is technically and socially challenging and will required a well defined research agenda, as well as compromise, balance and trading among stakeholders. We highlight critical knowledge gaps and suggest approaches for designing and managing landscapes for ecosystem services.
39
Clements, David R., Antonio DiTommaso, Stephen J. Darbyshire, Paul B. Cavers e Alison D. Sartonov. "The biology of Canadian weeds. 127. Panicum capillare L." Canadian Journal of Plant Science 84, n.º 1 (1 de janeiro de 2004): 327–41. http://dx.doi.org/10.4141/p02-147.
Texto completo da fonteResumo:
Panicum capillare L., witch grass, is an annual grass native to North America that infests field crops, small grains, grasslands, and a variety of other habitats. High seed production, a persistent seed bank, a tumble-weed seed-dispersing mechanism, and the ability to tolerate some herbicides contribute to the success of P. capillare in these habitats. Despite the widespread presence of P. capillare in crops, its actual impact on crop yield is not well documented. It is an additional host for several insect pests (e.g., cereal aphids) and diseases attacking crop species. Key words: Panicum capillare, witch grass, panic capillaire, weed biology, native weed species
40
Tasrif, Arifin, Muhammad Taufik e Nazaruddin Nazaruddin. "New Paradigm on Plant Quarantine System for Protection of Biological Diversity in Indonesia". Jurnal Perlindungan Tanaman Indonesia 25, n.º 1 (24 de julho de 2021): 1. http://dx.doi.org/10.22146/jpti.62605.
Texto completo da fonteResumo:
Plant quarantine system becomes an important pillar in the protection of biological diversities from the threat of plant pests and diseases. The implementation of plant quarantine system currently covers prevention of spread of quarantine pests, food safety, food quality, genetic resources and bio-agents, as well as invasive alien species and genetically modified organism. During 2014 to 2018, a total of 232 frequency intercepted of quarantine pests of viruses, bacteria, fungi, nematodes, insects, and weeds have been detected. These pests associated with plant materials from various countries in Asia, Europe, the United States, Australia and Africa that may potentially threaten biological diversities when dispersed within Indonesian territory. Implementation of risk analysis and appropriate level of protection consideration can be clustered in to pre-border, at-border, and post-border activities in order to mitigate the risk of quarantine pests and biosafety monitoring into Indonesian territory. Utilizing advances in pest detection technology in the industrial era 4.0 could provide benefits in the agricultural sectors. Various detection technologies using drones and bio-sensors have contributed in the field of plant protection, especially as pest detection and monitoring tools in the field. Furthermore, the establishment of proficiency certification agency for plant quarantine systems may contribute efficient and effective operations in the near future.
41
Garmendia, Alfonso, María Dolores Raigón, Olmo Marques, María Ferriol, Jorge Royo e Hugo Merle. "Effects of nettle slurry (Urtica dioica L.) used as foliar fertilizer on potato (Solanum tuberosum L.) yield and plant growth". PeerJ 6 (7 de maio de 2018): e4729. http://dx.doi.org/10.7717/peerj.4729.
Texto completo da fonteResumo:
Organic agriculture is becoming increasingly important, and many natural products are now available for organic farmers to manage and improve their crops. Several ethnobotanical studies have indicated that the use of nettle slurry as fertilizer in organic farming for horticultural crops is spreading. Sometimes, however, the consequences of using these natural products have been poorly evaluated, and there is very little scientific evidence for the effects of using these slurries. In this study, we aimed to analyze the possible effect of nettle slurry on potato yields produced by organic farming. To achieve this main objective, we assessed the effect of nettle slurry on potato yields, plant size and growth parameters, chlorophyll content, and the presence of pests and diseases. Different slurry doses were assessed in 36 plots and nine variables were measured during the crop cycle. Under these field experimental conditions, nettle slurry (including one treatment with Urtica in combination with Equisetum) had no significant effects on yield, chlorophyll content, or the presence of pests and diseases in organic potato crops. The highest chlorophyll content was found in the double dose treatment, but the difference was not significant. This result, together with a small improvement in plant height with the double dose treatment, might indicate very slight crop enhancement which, under our experimental conditions, was not enough to improve yield. The Urtica and Equisetum slurry chemical analyses showed very low levels of nitrogen, phosphorus, and potassium.
42
Gower, Jane M. C., Ary A. Hoffmann e Andrew R. Weeks. "Effectiveness of spring spraying targeting diapause egg production for controlling redlegged earth mites and other pests in pasture". Australian Journal of Experimental Agriculture 48, n.º 8 (2008): 1118. http://dx.doi.org/10.1071/ea07048.
Texto completo da fonteResumo:
Earth mites are a complex of related species introduced into Australia in the early part of last century that cause economic damage to crops, especially canola, and to pastures. A general method of chemical control aimed at interrupting the life cycle at the most effective stage, by spraying in the spring before the mites enter diapause, has recently been adopted for controlling earth mites, particularly the redlegged earth mite Halotydeus destructor (Tucker). Here we use paired-paddock treatments and field enclosures to test the effectiveness of this method on pest populations of H. destructor as well as on other pests over two seasons at multiple pasture sites in Victoria. Halotydeus destructor numbers at the start of the winter growing season were suppressed by up to 85%, but this control level was not sustained. The numbers of H. destructor and other pests were similar to or higher than those in the unsprayed areas by spring. Spring spraying is, therefore, a useful means of suppressing H. destructor in early autumn, but its effects disappear relatively quickly over time in Victoria. This strategy also has little impact on the control of the blue oat mite Penthaleus major (Duges) and other phytophagous invertebrate pests.
43
Tărău, Adina Daniela, Camelia Urdă, Felicia Mureşanu, Felicia Chețan, Vasile Oltean, Adrian Negrea e Loredana Suciu. "PROTECTION OF THE SOYBEAN CROP AGROECOSYSTEM THROUGH INNOVATIVE TECHNOLOGIES". Romanian Journal for Plant Protection 13 (2020): 68–75. http://dx.doi.org/10.54574/rjpp.13.11.
Texto completo da fonteResumo:
"Soybean is an important economical crop used for human consumption, animal feed and industrial raw material. Also, soybean is succesfully used in crop roatations with the main cereal crops because it’s biological nitrogen-fixing capabilities. A great diversity of pests and diseases including nematodes, insects and phytopathogenic fungi are known to affect soybean crop. From plant emergence to grain maturity, pests Tetranychus urticae and Etiella zinckenella, pseudofungi Peronospora manshurica and fungi Fusarium sp. and Botrytis cinerea can cause economic damage. In this study was evaluated the influence of tillage systems, different types of fertilizers and pesticide treatments on the most economical important diseases and pests of soybean crop in a field experiment at Agricultural Research and Development Station (ARDS Turda) in the climatic conditions of 2020. Teo TD, an early maturing soybean variety created at ARDS Turda, was used for the experiment. Based on the assessments made, soil tillage system, fertilization and control of pests and diseases have differently influenced the downy mildew and T. urticae attack. To reduce the attack of pathogens in soybean crop, the best technological option is plowing, balanced fertilization and application of fungicides, either without or in combination with an insecticide. The T. urticae populations developed on mineral, organic and green fertilized plants. Integrated control methods must combine agro-technical measures with the application of chemical treatments in accordance with the warning of the appearance of the first adults. "
44
Davidson, J. A., e M. D. Ramsey. "Pea yield decline syndrome in South Australia: the role of diseases and the impact of agronomic practices". Australian Journal of Agricultural Research 51, n.º 3 (2000): 347. http://dx.doi.org/10.1071/ar99111.
Texto completo da fonteResumo:
Sixty commercial pea crops were surveyed in 1995 to determine the causes of declining yields. Blackspot (Mycosphaerella pinodes and Phoma medicaginis var. pinodella) and downy mildew (Peronospora viciae) were prevalent in most crops and were identified as probable major contributors to the syndrome. Short rotation intervals (<5 years) between pea crops in paddocks were correlated with increased levels of blackspot and lower grain yields. Early sowing dates were correlated with increased levels of blackspot. A detailed survey of blackspot development was conducted in 5 commercial paddocks in 1996. The relative importance of sowing time and rotation varied between regions and seasons. The impact of a range of herbicides and the micronutrients manganese and zinc on blackspot, caused by the M. pinodes component of the blackspot complex, was investigated in a field trial during 1996. The herbicides diuron, metribuzin, and fluazifop significantly increased blackspot crown lesions compared with the nil treatment. There was a significant interaction between blackspot severity, herbicides, and the micronutrients manganese and zinc. Manganese concentration in pea plants was negatively correlated with the severity of blackspot crown lesions and positively correlated with severity of downy mildew.
45
Velicof, Mihai. "Conceptual Delimitations in the Field of Biosecurity". International conference KNOWLEDGE-BASED ORGANIZATION 26, n.º 1 (1 de junho de 2020): 167–71. http://dx.doi.org/10.2478/kbo-2020-0026.
Texto completo da fonteResumo:
AbstractBiosecurity is a term who was brought more into our attention after the events of September 11, 2010 who have been followed by the most famous bioterrorist attack with the anthrax letters. Defining biosecurity is not as easy how it looks at first side because this term it has a lot of interpretations according to various disciplines where it is used. At the beginning biosecurity was introduced as a set of measures with the purpose to reduce the risk of transmission of the infectious diseases in living modified organism, quarantined pests and infectious diseases in livestock and crops. Nowadays the term includes also the biological threats to environment, industries and to people and brings into our attention terms like bioterrorism, bioattack, bioweapons, biodefense, biosafety, biohazard, biorisk, biocontainment and biosurety. This article has one primary objective and that is to assess the roots and etymology of the term biosecurity by presenting a short historical perspective which will lead to a better delimitation of the concept, and to define some key concepts related to this area. The result of this conceptual delimitation of the biosecurity is to bring into attention the importance of this area which before COVID-19 events wasn’t took into consideration at the level it should be.
46
Xin, Mingyuan, e Yong Wang. "Image Recognition of Crop Diseases and Insect Pests Based on Deep Learning". Wireless Communications and Mobile Computing 2021 (27 de abril de 2021): 1–15. http://dx.doi.org/10.1155/2021/5511676.
Texto completo da fonteResumo:
Deep learning algorithms have the advantages of clear structure and high accuracy in image recognition. Accurate identification of pests and diseases in crops can improve the pertinence of pest control in farmland, which is beneficial to agricultural production. This paper proposes a DCNN-G model based on deep learning and fusion of Google data analysis, using this model to train 640 data samples, and then using 5000 test samples for testing, selecting 80% as the training set and 20% as the test set, and compare the accuracy of the model with the conventional recognition model. Research results show that after degrading a quality level 1 image using the degradation parameters above, 9 quality level images are obtained. Use YOLO’s improved network, YOLO-V4, to test and validate images after quality level classification. Images of different quality levels, especially images of adjacent levels, are subjectively observed by human eyes, and it is difficult to distinguish the quality of the images. Using the algorithm model proposed in this article, the recognition accuracy is 95%, which is much higher than the basic 84% of the DCNN model. The quality level classification of crop disease and insect pest images can provide important prior information for the understanding of crop disease and insect pest images and can also provide a scientific basis for testing the imaging capabilities of sensors and objectively evaluating the image quality of crop diseases and pests. The use of convolutional neural networks to realize the classification of crop pest and disease image quality not only expands the application field of deep learning but also provides a new method for crop pest and disease image quality assessment.
47
Bouraïma, Amoussatou, Rachidatou Sikirou, Bruno Zocli, Vincent Ezin, Sètondji Alban Paterne Etchiha Afoha, Léopold Simplice Gnancadja, Adolphe Adjanonhoun e Kerstin Hell. "Pests and Diseases Associated with Yam Bean (Pachyrhizus erosus) Cultivation at Farmers’ Levels in the Central Region of Benin". Biosaintifika: Journal of Biology & Biology Education 12, n.º 2 (1 de agosto de 2020): 132–39. http://dx.doi.org/10.15294/biosaintifika.v12i2.23771.
Texto completo da fonteResumo:
Roots and tubers are one of the most important crops that provide food security in West Africa. Thus, Pachyrhisus erosus with its various potentials, is planned to be introduced in Benin to improve the nutritional quality of the population. Prior to that, this study aimed at assessing pests and disease of P. erosus in the agroecological conditions in the central parts of Benin. Conducted at experimental field in Savè during two consecutive years, experiments were laid in a completely randomized block design with 4 replications and three treatments including EC 533 and EC Kew cultivars of P. erosus and cowpea variety named Kpodji-Guèguè. Results showed that the major pests collected from P. erosus namely Ootheca mutabilis, Medythia quaterna, Piezotrachelus varium, Megalurothrips sjostedti and Brevipalpus phoenis were not so far reported in it. Compared to cowpea, pest’s infestation and their damages were lower on P. erosus. Infestation severity on leaves and the percentage of perforated green pods ranged from 0.7% to 3% against 0.8% to 88.9% and from 12.5% to 16% against 57.2% to 64% respectively on P. erosus and cowpea. Cercospora disease caused by Cercospora canescens and yam bean leaf blight caused by an unknown fungus were observed. Cercospora disease affected cowpea and P. erosus while yam bean leaf blight affected only P. erosus. This study provides additional data on pests and diseases associated with P. erosus worldwide and alerts farmers regarding their management.
48
Underwood, Roger, e D. Garth Nikles. "The status of the domestication of African mahogany (Khaya senegalensis) in Australia, as documented in the CD ROM Proceedings of a 2006 Workshop". BOIS & FORETS DES TROPIQUES 300, n.º 300 (1 de junho de 2009): 101. http://dx.doi.org/10.19182/bft2009.300.a20410.
Texto completo da fonteResumo:
Le résumé en français est disponible dans le fichier PDF de l'article. A Workshop was held in Townsville, Queensland, Australia in May 2006 entitled: "Where to from here with R&D to underpin plantations of highvalue timber species in the ¿seasonally-dry¿ tropics of northern Australia?" Its focus was on African mahogany, Khaya senegalensis, and followed a broader-ranging Workshop with a similar theme held in Mareeba, Queensland in 2004. The 2006 Workshop comprised eight technical working sessions over two days preceded by a field trip to look at local trial plantings of African mahogany. The working sessions covered R&D in: tree improvement, nutrition, soils, silviculture, establishment, management, productivity, pests, diseases, wood properties; and R&D needs and management. (Résumé d'auteur)
49
Paridaen, Annieka, e John A. Kirkegaard. "Forage canola (Brassica napus): spring-sown winter canola for biennial dual-purpose use in the high-rainfall zone of southern Australia". Crop and Pasture Science 66, n.º 4 (2015): 275. http://dx.doi.org/10.1071/cp14119.
Texto completo da fonteResumo:
European winter canola (Brassica napus L.) varieties adapted to the long, cool seasons in high-rainfall areas of southern Australia have recently been adopted as autumn-sown, grain-only and dual-purpose crops. A spring-sown winter canola could be used as a biennial dual-purpose crop, to provide additional forage for summer and autumn grazing before recovery to produce an oilseed crop. We report a series of field experiments demonstrating that European winter canola types have suitable phenological characteristics to allow for their use as biennial, spring-sown crops, providing significant forage (2.5–4 t ha–1) for grazing while remaining vegetative through summer and autumn, and recovering following vernalisation in winter to produce high seed yield (2.5–5.0 t ha–1). Sowing too early (September) in colder inland areas risked exposure of the crop to vernalising temperatures, causing the crop to bolt to flower in summer, whereas all crops sown from mid-October remained vegetative through summer. Crop stands thinned by 20–30% during summer, and this was exacerbated by grazing, but surviving stands of ~30 plants m–2 were sufficient to support high yields. Grazing had no effect on grain yield at one site, but reduced yield by 0.5 t ha–1 at a second site, although this was more than offset by the value of the grazed forage. The spring-sowing approach has potential to replace the existing forage rape–spring cereal sequence, or to add a further option to the existing autumn-sown winter canola in areas such as southern Victoria, where early autumn establishment can be problematic and spring-sown crops can better withstand pests and winter waterlogging, which limit yield of autumn-sown crops. Because these are the first known studies in Australia to investigate the use of spring-sown winter canola, further work is warranted to refine further the crop and grazing strategies to maximise productivity and profitability from this option.
50
Hill, Matthew P., Sarina Macfadyen e Michael A. Nash. "Broad spectrum pesticide application alters natural enemy communities and may facilitate secondary pest outbreaks". PeerJ 5 (19 de dezembro de 2017): e4179. http://dx.doi.org/10.7717/peerj.4179.
Texto completo da fonteResumo:
BackgroundPesticide application is the dominant control method for arthropod pests in broad-acre arable systems. In Australia, organophosphate pesticides are often applied either prophylactically, or reactively, including at higher concentrations, to control crop establishment pests such as false wireworms and earth mite species. Organophosphates are reported to be disruptive to beneficial species, such as natural enemies, but this has not been widely assessed in Australian systems. Neither has the risk that secondary outbreaks may occur if the natural enemy community composition or function is altered.MethodsWe examine the abundance of ground-dwelling invertebrate communities in an arable field over successive seasons under rotation; barley, two years of wheat, then canola. Two organophosphates (chlorpyrifos and methidathion) were initially applied at recommended rates. After no discernible impact on target pest species, the rate for chlorpyrifos was doubled to elicit a definitive response to a level used at establishment when seedling damage is observed. Invertebrates were sampled using pitfalls and refuge traps throughout the experiments. We applied measures of community diversity, principal response curves and multiple generalised linear modelling techniques to understand the changes in pest and natural enemy communities.ResultsThere was large variability due to seasonality and crop type. Nevertheless, both pest (e.g., mites and aphids) and natural enemy (e.g., predatory beetles) invertebrate communities were significantly affected by application of organophosphates. When the rate of chlorpyrifos was increased there was a reduction in the number of beetles that predate on slug populations. Slugs displayed opposite trends to many of the other target pests, and actually increased in numbers under the higher rates of chlorpyrifos in comparison to the other treatments. Slug numbers in the final rotation of canola resulted in significant yield loss regardless of pesticide application.DiscussionOrganophosphates are a cost-effective tool to control emergent pests in broad-acre arable systems in Australia. We found risks associated with prophylactic application in fields under rotation between different crop types and significant changes to the community of pests and natural enemy. Disrupting key predators reduced effective suppression of other pests, such as slugs, and may lead to secondary outbreaks when rotating with susceptible crops such as canola. Such non-target impacts are rarely documented when studies focus on single-species, rather than community assessments. This study represents a single demonstration of how pesticide application can lead to secondary outbreaks and reinforces the need for studies that include a longer temporal component to understand this process further.