Artykuły w czasopismach na temat „Vyg Valley (R.S.F.S.R.)”

ABSTRACT Unlike all the other Rift Valley fever virus strains (Bunyaviridae, Phlebovirus) studied so far, clone 13, a naturally attenuated virus, does not form the filaments composed of the NSs nonstructural protein in the nuclei of infected cells (R. Muller, J. F. Saluzzo, N. Lopez, T. Drier, M. Turell, J. Smith, and M. Bouloy, Am. J. Trop. Med. Hyg. 53:405–411, 1995). This defect is correlated with a large in-frame deletion in the NSs coding region of the S segment of the tripartite genome. Here, we show that the truncated NSs protein of clone 13 is expressed and remains in the cytoplasm, where it is degraded rapidly by the proteasome. Through the analysis of reassortants between clone 13 and a virulent strain, we localized the marker(s) of attenuation in the S segment of this attenuated virus. This result raises questions regarding the role of NSs in pathogenesis and highlights, for the first time in theBunyaviridae family, a major role of the S segment in virulence and attenuation, possibly associated with a defect in the nonstructural protein.

In this study, self-(in) compatibility of 34 wild apricot genotypes, called as Sakit apricots, sampled from Sakit valley located in east Mediterranean region of Turkey and 9 well known Turkish apricot cultivars were determined by using molecular methods. Genomic PCR with S-RNase and SFB-specific primers was conducted using the degenerate primers EM-PC2consFD and EM-PC3consRD for the amplification of the second intron region of the S-RNase gene. To amplify the first intron, the fluorescently labelled (JOE) forward primer SRc-F was used in combination with the reverse primer SRc-R. According to the results, Sc (self-compatible) allele is not present in all wild and cultivated materials. All wild genotypes had same S allele (S6S19) composition indicating they do not carry the SC-haplotype. These wild materials previously reported self-compatible by fruit set studies on field. Mutations rendering the S-locus non-functional in these genotypes can be supposed and checked in the future. The most important dried apricot cultivars of Turkey such as Hacihaliloglu, Kabaasi, and Cataloglu were observed to be self-incompatible cultivars.

Akhter, J., & Cheng, K. (2020). Sustainable empowerment initiatives among rural women through microcredit borrowings in Bangladesh. Sustainability, 12: 2275. Ani, F., Ramlan, N., Yusoff, R., & Damin, Z.A. (2018). Measuring the level of participation and its relationship with psychological empowerment through community based organisation (CBO) activities. International Journal of Academic Research in Business and Social Sciences, 8: 647-658. Barker, J., & Thomson, L. (2015). Helpful relationships with service users: Linking social capital. Australian Social Work, 68: 130-145. Bisaga, I., Parikh, P., & Loggia, C. (2019). Challenges and opportunities for sustainable urban farming in South African low-income settlements: A case study in Durban. Sustainability, 11: 5660. Cheah, J.H., Thurasamy, R., Memon, M.A., Chuah, F., & Ting, H. (2020). Multigroup analysis using SmartPLS: Step-by-step guidelines for business research. Asian Journal of Business Research, 10: I-XIX. Claridge, T. (2018). Functions of social capital–bonding, bridging, linking. Social Capital Research, 20: 1-7. Cohen, J. M., & Uphoff, N. T. (1977). Rural development participation: concepts and measures for project design, implementation and evaluation. Rural development participation: concepts and measures for project design, implementation and evaluation., 2: 29-46. Díaz-Gibson, J., Zaragoza, M.C., Daly, A.J., Mayayo, J.L., & Romaní, J. R. (2017). Networked leadership in educational collaborative networks. Educational Management Administration & Leadership, 45: 1040-1059. Eryanto, H., Swaramarinda, D.R., & Nurmalasari, D. (2019). Effectiveness of entrepreneurship practice program: using CIPP program evaluation. Journal of Entrepreneurship Education, 22: 1-10. Evans, P. (1997). State-society synergy: Government and social capital in development. FAO. (2019). Urban and peri-urban agriculture in Asia and the Pacific: Opportunities, challenges and policy implications. Bangkok: FAO Regional Office for Asia Guitart D., Pickering C., Byrne J. (2012). Past results and future directions in urban community gardens research. Urban Forestry and Urban Greening, 11: 364-373. Gunasekara, R.W.M.N., Premaratne, S.P., & Priyanath, H.M.S. (2017). Impact of social capital on livelihood success of the members of community-based organizations in Sri Lanka. International Journal of Academic Research in Business and Social Sciences, 7: 1156-1167. Hair Jr, J. F., Howard, M. C., & Nitzl, C. (2020). Assessing measurement model quality in PLS-SEM using confirmatory composite analysis. Journal of Business Research, 109: 101-110. Haldane, V., Chuah, F. L., Srivastava, A., Singh, S. R., Koh, G. C., Seng, C. K., & Legido-Quigley, H. (2019). Community participation in health services development, implementation, and evaluation: A systematic review of empowerment, health, community, and process outcomes. PloS one, 14: e0216112. Ibrahim, M. B. (2016). Role of participation in decision making and social capital on sustainability of watershed usage among peri-urban agricultural farmers of Kwadon, Gombe State, Nigeria. Unpublished doctoral thesis, Universiti Putra Malaysia. Jackson, K. T., Burgess, S., Toms, F., & Cuthbertson, E. L. (2018). Community engagement: Using feedback loops to empower residents and influence systemic change in culturally diverse communities. Global Journal of Community Psychology Practice, 9: 1-21. Jiang, J., & Wang, P. (2020). Is linking social capital more beneficial to the health promotion of the poor? Evidence from China. Social Indicators Research, 147: 45-71. Kieffer, C. H. (1984). Citizen empowerment: A developmental perspective. Prevention in Human Services, 3: 9-36. Kilpatrick, S. U. E., Field, J., & Falk, I. A. N. (2003). Social capital: An analytical tool for exploring lifelong learning and community development. British Educational Research Journal, 29: 417-433. Mai, V. N., Nguyen, Q. N., & Hien, L. T. D. (2023). Citizen Participation in Community-Based Tourism Development in the Mekong Delta. Vietnam. Journal of Law and Sustainable Development, 11(5), e749. Manurung, A., & Lubis, S. (2023). The Potential of Budget Participation and Dalihan Natolu Leadership Style to Improve Community Welfare in the Toba Caldera Tourism Geography Area. Journal of Law and Sustainable Development, 11(9), e573-e573. Menasseri-Aubry, S., Viaud, V., Santillàn-Carvantes, P., Akkal-Corfini, N., Le Guillou, C., Prévost-Bouré, N. C., & Ranjard, L. (2018). Landscape-scale analysis of cropping system effects on soil quality in a context of crop-livestock farming. Agriculture, Ecosystems & Environment, 265: 166-177. Nakagawa, Y., & Shaw, R. (2004). Social capital: A missing link to disaster recovery. International Journal of Mass Emergencies & Disasters, 22(1): 5-34. National Agrofood Policy (NAFP). Malaysia’s Agrofood Policy (NAP 2011–2020). Available online: https://ap.fftc.org.tw/article/1368 (accessed on 20 September 2021). Nazuri, N. S., Rosnon, M. R., Ahmad, N., Suhaimi, S. S. A., Sharifuddin, J., & Wijekoon, R. (2022). Vindication of linking social capital capacity to urban agriculture: A paradigm of participation based on social empowerment in Klang Valley, Malaysia. Sustainability, 14: 1509. Ndaeji, M. N. (2014). Participation in self-help groups and empowerment among rural women in Niger state, Nigeria. Unpublished doctoral thesis, Universiti Putra Malaysia. Pereira, V. A., dos Santos Brandalize, M., Grosko, S., de Oliveira, I. C., Zitkoski, J. J., Corbari, F., & Zonin, W. J. (2023). Extension, popular education and agroecology in family agriculture: experience report of students and graduate teachers. Revista de Gestão Social e Ambiental, 17(7), 1-17. Purwanto, A. (2021). Partial least squares structural squation modeling (PLS-SEM) analysis for social and management research: a literature review. Journal of Industrial Engineering & Management Research, 21: 65-84 Putnam, R. (2001). Social capital: Measurement and consequences. Canadian Journal of Policy Research, 2: 41-51. Rappaport, J., & Seidman, E. (2000). Handbook of community psychology. Springer Science & Business Media. Ringle, C. M., & Sarstedt, M. (2016). Gain more insight from your PLS-SEM results: The importance-performance map analysis. Industrial Management & Data Systems, 116: 1865-1886. Riwalnu S. (2014). Community empowerment through participatory approach of Indonesia poverty reduction program. Procedia-Social and Behavioral Sciences, 153: 209-220. Siegner, A., Sowerwine, J., & Acey, C. (2018). Does urban agriculture improve food security? Examining the nexus of food access and distribution of urban produced foods in the United States: A systematic review. Sustainability, 10: 2988. Siwar, C., Ahmed, F., Bashawir, A., & Mia, M. S. (2016). Urbanization and urban poverty in Malaysia: consequences and vulnerability. Journal of Applied Sciences, 16: 154-160. Smit, J., Bailkey, M., & Van Veenhuizen, R. (2006). Urban agriculture and the building of communities. Van Veenhuizen, R. Cities farming for the future, urban agriculture for green and productive cities, pp. 146-171, Leusden: RUAF Foundation Press. United Nations. (2018). World Urbanization Prospects: The 2018 Revision. New York: United Nations Department of Economic and Social Affairs, Population Division. Woolcock, M. (2001). The place of social capital in understanding social and economic outcomes. Canadian Journal of Policy Research, 2: 11-17. Yan, X., Lin, H., & Clarke, A. (2018). Cross-sector social partnerships for social change: The roles of non-governmental organizations. Sustainability, 10: 558. Yapanto, L. M., Fadhli, A., Tamod, Z. E., Warouw, F. F., Musa, D. T., & Tenda, M. P. (2023). Community Participation in the Management of Tourist Areas (Case Study in the Tourist Area of Bongo, Gorontalo District) Indonesia. Revista de Gestão Social e Ambiental, 17(5), e03460-e03460. Yusoff, N. H., Hussain, M. R. M., & Tukiman, I. (2017). Roles of community towards urban farming activities. Planning Malaysia, 15: 4-10. Zaidi, N. A. M., Yusoff, S., Ismail, M. H. S., Ismail, S. A., Harun, S. N. S., Latif, M. A. (2019). Urban agriculture in Malaysia: Issues, prospects and sustainability. International Journal of Sustainable Development & World Ecology, 26: 17-25. Zainal, M., & Hamzah, S. R. A. (2018). Urban agriculture: The role of knowledge among farmer in Malaysia. International Journal of Academic Research in Business and Social Sciences, 7: 77-85. Zainoddin, A. I., Shaharudin, M. R., Hassim, N. H., Haniff, W. A. A. W., Shaari, N. F., & Legino, R. (2022). The mediating effects of capability development on the relationships between social capital and the effectiveness of community development programme among farmers in malaysia. Journal of Asian Scientific Research, 12: 28-44.

Tomato (Solanum lycopersicum L.) is an important crop in the Azapa Valley (18°35′ S, 69°30′ W) in northern Chile, with approximately 600 ha of fresh tomatoes under greenhouses. Cultivars resistant to Fusarium oxysporum f. sp. lycopersici (FOL) races 1 and 2 are mainly used. However, in 2012 and 2013, Fusarium wilt incidence was 2 to 3%. Symptoms appeared unilaterally and consisted of yellowing, leaf wilting of lower leaves, dark brown vascular discoloration, and plant death. The aim of this study was to determine the causal agent of tomato wilt in seven tomato greenhouses in the Azapa Valley. Stem samples (5 × 5 mm) were obtained 10 cm of the stem base from wilted tomatoes ‘Naomi’ (BIOAMERICA S.A., Chile) or from Maxifort tomato rootstock (De Ruiter Seed, USA), both FOL resistant to races 1 and 2. Samples were washed with tap water, surface sterilized with 1% NaClO for 3 min, and incubated on sterile moist paper towels in petri plates for 5 days at 22°C. Mycelial fragments from white colonies, emerging from diseased tissues, were transferred to PDA. Six Fusarium isolates were characterized by the presence of hyaline macroconidia, mostly 3 to 5 septate, slightly curved (19.2 to 32.1 × 2.9 to 4.5 μm) and single-celled, oval to elongated microconidia (3.1 to 8.9 × 2.0 to 4.0 μm). Chlamydospores were single or in pairs. These isolates were identified as F. oxysporum (3). The identity of F. oxysporum was confirmed by PCR assays using genomic DNA of each isolated and the universal primers Uni F and Uni R that generate a 672-bp PCR product. The pathogenic form and races were determined by PCR assays using the specific primers uni, sp13, sp23, and sprl that were able to discriminate all the three FOL races as well as F. oxysporum f. sp. radicis-lycopersici (FORL) isolates (2). The sp13 and sp23 primers amplified DNA bands of 445 and 518 bp, confirming the identity of FOL race 3. However, sprl amplified a fragment of 947 bp corresponding to FORL (2). Pathogenicity tests were conducted on 25-day-old seedlings (10 seedlings per isolate) of tomato ‘Poncho Negro,’ which is susceptible to FOL and FORL. Seedling roots were cut, submerged for 5 min in conidial suspension of 2 × 106 conidia/ml, and transplanted to 250-ml plastic containers with sterile substrate (sand/peat, 1:1). Equally treated non-inoculated seedlings were left as controls. The first symptoms induced by each of the five FOL isolates appeared 8 days after incubation under greenhouse and were characterized by yellowing of older leaves, sometimes affecting one side of the plant, vascular discoloration of the stem, and eventually plant death. In contrast, all seedlings inoculated with a FORL isolate developed a necrotic lesion and vascular discoloration at the base of the stems near the soil line, followed by wilting and plant death. Control plants remained asymptomatic. F. oxysporum was re-isolated only from inoculated plants, completing Koch's postulates. FOL and FORL were reported earlier in other tomato growing areas of Chile (1), located over 1,000 km south of the Azapa Valley. However, this is the first report of FOL race 3 and FORL in the Azapa Valley and FOL race 3 is reported for the first time in Chile. References: (1) S. Acuña. Compendio de Fitopatógenos de Cultivos Agrícolas. Servicio Agrícola y Ganadero. Gobierno de Chile, 2008. (2) Y. Hirano and T. Arie. J. Gen. Plant Pathol. 72:273, 2006. (3) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual. Blackwell Publishing, Ames, IA, 2006.

This paper presents an analysis of Icelandic umlaut in Optimality Theory. We account for umlaut in sal[œ]t-[Y]m ‘lettuce’ (dat. pl.) and d[œ:]g-[Y]m ‘day’ (dat. pl.), in which /a/ is fronted and rounded when followed by [Y], as well as forms such as j[œ]kli ‘glacier’ (dat. sg.) and b[œ]rn ‘child’ (ace. pl.) with an umlauted vowel, but no overt trigger. We explain why there is no umlaut in forms such as dal-n[Y]m ‘valley’ (def.), kakt[Y]s ‘cactus’ (nom. sg.), or d[a:]g-[Y]r ‘day’ (nom. sg.) despite the fact that /a/ occurs in the umlaut environment. We also explain why there is one umlauted vowel in sal[œ]t-[Y]m ≪ /salat + Ym/, but two umlauted vowels in f[œ]t-n[Y]ð-[Y]m ≪ /fat + nað + Ym/ ‘clothing’ (dat. pl.) and why the umlauted vowel is sometimes [Y] and sometimes [œ].

Abstract Lexical ambiguity in the English language is abundant. Word-class ambiguity is even inherently tied to the productive process of conversion. Most lexemes are rather flexible when it comes to word class, which is facilitated by the minimal morphology that English has preserved. This study takes a multivariate quantitative approach to examine potential patterns that arise in a lexicon where verb-noun and noun-verb conversion are pervasive. The distributions of three inflectional suffixes, verbal -s, nominal -s, and -ed are explored for their interaction with degrees of verb-noun conversion. In order to achieve that, the lexical dispersion, context-dependency, and lexical similarity between the inflected and bare forms were taken into consideration and controlled for in a Generalized Additive Models for Location, Scale and Shape (GAMLSS; Stasinopoulos, M. D., R. A. Rigby, and F. De Bastiani. 2018. “GAMLSS: A Distributional Regression Approach.” Statistical Modelling 18 (3–4): 248–73). The results of a series of zero-one-inflated beta models suggest that there is a clear “uncanny” valley of lexemes that show similar proportions of verbal and nominal uses. Such lexemes have a lower proportion of inflectional uses when textual dispersion and context-dependency are controlled for. Furthermore, as soon as there is some degree of conversion, the probability that a lexeme is always encountered without inflection sharply rises. Disambiguation by means of inflection is unlikely to play a uniform role depending on the inflectional distribution of a lexeme.

Many investigations has been done on the efficacy of botanicals against various pest and diseases of crops but there is paucity of information on benefit cost ratio of their application. In the present study five indigenous botanicals extracts of Solanum incanum, Allium hookerii, Mariandra benghalensis and Flogacanthus thyrsiflorus, the indigenous plants of Manipur have been used against the brown spot disease of rice caused by Helminthosporium oryzae. The analysis of benefit cost ratio (BCR) recorded maximum value of BCR in Millettia pachycarpa (1.45:1) followed by Solanum incanum (1.36:1), Allium hookerii (1.33:1), Mariandra benghalensis (1.30:1) and Flogacanthus thyrsiflorus (1.26:1) and in Control (1.13:1). It was found that in treatment M. Pachycarpa an investment of Re.1.00 will generate a gross income of Rs.1.45 or net return (Rs.0.45) and net return for following treatment S. incanum (Rs. 0.36), A. hookerii (Rs.0.33), M. Benghalensis (Rs. 0.30) and F. thyrsiflorus (0.26) as compared to low net return in Control (Rs.0.13). References 1.Arivudainambi, S.; Selvamuthukumaran, T.; Baskaran, P Efficacy of herbal extracts in management of amaranth leaf caterpillar. Int.J.Veg.Sci. 2010, 16: 167-173. Aziz, M.A.; UI Hasan, M.; Ali, A.; Iqbal, J Comparative efficacy of different strategies for management of spotted bollworms, Earias spp .on Okra, Abelmoschus esculentus (L). Moench. Pak. J. Zool. 2012, 44: 1203-1208. Bedi, K.S.; and Gill, H.S. Losses caused by the brown leaf spot disease in the Punjab. Indian Phytopath . 1960, 13: 161-164. Blankson, W.; Amoabeng, Geoff M. Gurr.; Catherine W. Gitau.; Philip C. Stevenson Cost: benefit analysis of botanical insecticide use in cabbage: Implications for small holder farmers in developing countries. Crop Protection. 2014, 57: 71-76. Datnoff E. L.; and Lentini, S. Richard Brown spot in Florida Rice. 1994, 128 Devi. O.; Jitendiya. D and Chhetry, G.K.N Evaluation of antifungal properties of certain plants against Drechlera oryzae causing brown leaf spot of rice in Manipur valley, Int.J.of Scientific & Res.Publications. 2013, 3(5) 1-3. Chavan, R.T.; Deshmukh, V.L and Kadam, A.S Antibacterial activity of Cassia toria leaves. Recent Research in Science and Technology. 2011, 3(5): 12-14. Gaichui, G Studies on efficacy of plant extracts and used of panchagavya against wilt disease of Chilli caused by Fusarium oxysporum, M.Sc.(Agri.) Thesis submitted to COA, CAU, Imphal. 2008, 54-65. Khalili, E.; Sadravi, M.; Naeimi, S. and Khosravi,V Biological control of rice brown spot with native isolates of three Trichoderma species. Braz. J. Microbiol. 2012, 43: 297-305. Khus, N Assessment of organic and inorganic fertilization and plant density on production potential of rice-rice- cropping system. Madras Agric. J. 2011, 85 (12): 604-607. Oerke, E. C., Dehne D. W., Schonbeck F and Weber A Crop production and crop protection: estimated losses in major food and cash crops. Elsevier Hardcover, Amsterdam. 1994, 830. Pundir, R. K and Jain, P. Comparative studies on the antimicrobial activity of black paper (Piper nigrum) and turmeric (Curcumalonga) extracts. Int. J. of Applied Bio. and Pharmaceutical Techno. 2010, 1(2): 491-501. Shabozoi, N.U.K.; Abro, G.H.; Syed, T.S and Awan, M.S Economic appraisal of pest management options in Okra. Pak. J. Zool. 2011, 43: 869-878. Reddy,V.R.; Reddy, P.P and Kumar, U.H Ecological and economic aspects of shrimp farming in Andhra Pradesh, Indian Journal of agriculture Economics. 2004, 20(1): 435. R.S. Singh. Plant Diseases. 2005. Oxford publisher. Sunder, S.; Singh, R.; Dodan, D.S and Mehla, D.S Effect of different nitrogen levels on brown spot (Drechslera oryzae) of rice and its management through host resistance and fungicides. Pl. Dis.Res. 2005, 20: 111-114.

In 2002, somel sugar beet (Beta vulgaris L.) fields in the Red River Valley (RRV) of Minnesota and North Dakota had symptoms characteristic of Fusarium yellows (4). In 2004, ≈5% of fields in the RRV had symptomatic plants. Interveinal yellowing of older leaves typically began in mid-July and as the disease progressed, younger leaves turned yellow. Sometimes, one side of the leaf was yellow or necrotic while the other side remained green. As leaves died, they remained attached to the crown. Transverse sections of roots revealed a light gray-brown discoloration of the vascular tissue but no external rotting of roots. Isolations from 35 symptomatic roots collected in eight fields yielded 25 isolates identified as F. oxysporum (from single conidia grown on homemade potato dextrose agar and carnation leaf agar) (3). Pathogenicity was determined by dipping roots of 5-week-old sugar beet plants (cv. ACH 9363) in a suspension of 104 conidia per ml for 8 min (12 isolates, 10 to 12 plants per isolate). Plants were planted in Cone-tainers (3.8 cm diameter × 21 cm; Stuewe and Sons, Inc. Corvallis, OR) containing sterile soil. Three known cultures of F. oxysporum Schlecht. emend. Snyd. & Hans. f. sp. betae Stewart (= F. conglutinans var. betae Stewart [4]) also were included (13 and 216c from L. Hanson, USDA-ARS, Fort Collins, CO; 0-1122 from The Pennyslvania State University Fusarium Research Center). The control was sterile water. Plants were placed in a greenhouse at 24 to 27°C with natural light supplemented with illumination from high-pressure sodium-vapor lamps for 16 h daily and lightly fertilized biweekly to avoid chlorosis from nutrient deficiency. After 6 to 7 weeks, plants were rated for disease on a 0 to 4 scale: 0 = no disease; 1 = slight to extreme plant stunting, leaves may be wilted; 2 = chlorotic leaves, some with necrosis at margins; 3 = tap root dried and brown to black in color, leaves dying; and 4 = plant dead (1). The experiment was repeated. Disease severity differed between trials, but all isolates of F. oxysporum and F. oxysporum f. sp. betae resulted in disease ratings statistically (P < 0.05) greater than that of the water control. In Trial 1, isolates of F. oxysporum averaged a rating of 2.1 (range of 1.8 to 3.3) and F. oxysporum f. sp. betae averaged 2.1 (range of 2.0 to 2.2) compared with 0.1 for the water control. One isolate of F. oxysporum had a statistically higher rating than did the cultures of F. oxysporum f. sp. betae. In Trial 2, isolates of F. oxysporum averaged a rating of 3.3 (range of 2.7 to 3.7) and F. oxysporum f. sp. betae averaged 3.1 (range of 2.7 to 3.4) compared with 0.2 for the water control. Cultures of F. oxysporum (8 of 12) resulted in ratings statistically higher than that of the least pathogenic culture of F. oxysporum f. sp. betae. Cultures of F. oxysporum and F. oxysporum f. sp. betae recovered from inoculated plants were identical to those used to inoculate plants. To our knowledge, this is the first report of F. oxysporum f. sp. betae on sugar beet in the Red River Valley of Minnesota and North Dakota. The disease has been reported in California, Colorado, Montana, Nebraska, Oregon, Texas, and Wyoming (1,2). References: (1) R. A. Cramer et al. J. Phytopathol. 151:352, 2003. (2) G. A. Fisher and J. S. Gerik. Phytopathology 84:1098, 1994. (3) P. E. Nelson et al. Fusarium Species: An illustrated Manual for Identification. The Pennsylvania State University Press. University Park, 1983. (4) D. Stewart. Phytopathology 21:59, 1931.

Studying physical science and then teaching it to children, as is known from decades of science education research, creates a huge problem of unknown origin. This study aims to develop a media and determine its effectiveness in increasing knowledge of physics for children. This research is a research and development with the stages of the ADDIE model to develop Roll Book media with the roll technique containing physical science material for early childhood. Data collection techniques were carried out through expert validation tests and field trial data. Analysis of effectiveness test data using a paired sample T-test statistical test. The results of the media effectiveness test showed an increase in knowledge of physics in the pre-test and pots-test. The summary of all the test results of the developed media shows that Roll Book products are effectively used to increase children's knowledge of physics. The concept of storybook media that has been developed in various interesting forms is expected to be an alternative solution for the scientific development of early childhood education studies. Keywords: Early childhood, Physical science, Roll book References: Angelica Torres, & Vitti, D. (2007). A Kinder Science Fair. Science and Children. Arsyad, A. (2013). Media Pembelajaran [Learning Media]. PT Raja Grafindo Persada. Branch, R. M. (2009). Instructional Design: The ADDIE Approach. Springer Science Business Media. California Department of Education. (2012). California Preschool Learning Foundations (Vol. 3). Sacramento. Charlesworth, R., & Lind, K. K. (2012). Math and Science for Young Children. Cengage Learning. https://books.google.co.id/books?id=p5x-3ir8mz4C Citra, A., Hapidin, D., & Akbar, Z. (2019). Pengaruh Model Pembelajaran dan Kemampuan Berpikir Kritis terhadap Pemahaman Sains Fisik. 3(1), 18–29. https://doi.org/10.31004/obsesi.v3i1.136 Dewi, T. H. S., Gunarhadi, & Riyadi. (2018). The Important of Learning Media Based on Illustrated Storybook for Primary School. Proceeding of International Conference on Child-Friendly Education, 233–236. Eshach, H., & Fried, M. N. (2005). Should Science Be Taught in Early Childhood? Journal of Science Education and Technology, 14(3), 315–336. Featherstone, S. (2003). The Little Book of Investigations: Little Books with Big Ideas. Featherstone Education Ltd. Fleer, M. (2015). How Preschools Environments Afford Science Learning. In M. Fleer & N. Pramling (Eds.), A Cultural-Historical Study of Children Learning Science: Foregrounding Affective Imagination in Play-based Settings(pp. 23–37). Springer Netherlands. https://doi.org/10.1007/978-94-017-9370-4_2 Fridberg, M., Jonsson, A., Redfors, A., Thulin, S., Fridberg, M., Jonsson, A., Redfors, A., Thulin, S., Jonsson, A., Redfors, A., & Thulin, S. (2019). Teaching chemistry and physics in preschool: A matter of establishing intersubjectivity establishing intersubjectivity. 0693. https://doi.org/10.1080/09500693.2019.1689585 Gitomer, D. H., & Zisk, R. C. (2015). Knowing What Teachers Know. Review of Research in Education, 39(1), 1–53. https://doi.org/10.3102/0091732X14557001 Greenfield, D. B., Jirout, J., Greenberg, A., Maier, M., & Fuccillo, J. (2009). Early Education and Development Science in the Preschool Classroom: A Programmatic Research Agenda to Improve Science Readiness. October 2014, 37–41. https://doi.org/10.1080/10409280802595441 Gur, C. (2011). Physics in preschool. International Journal of Physical Sciences, 6(4), 939–943. https://doi.org/10.5897/IJPS10.653 Hsiao, C.-Y., & Chang, Y.-M. (2015). A Study of the Use of Picture Books by Preschool Educators in Outlying Islands of Taiwan. International Education Studies, 9(1), 1. https://doi.org/10.5539/ies.v9n1p1 Kalogiannakis, M., Nirgianaki, G. M., & Papadakis, S. (2018). Teaching Magnetism to Preschool Children: The Effectiveness of Picture Story Reading. Early Childhood Education Journal, 46(5), 535–546. https://doi.org/10.1007/s10643-017-0884-4 Kamii, C., & Vries, R. De. (1993). Physical Knowledge in Preschool Education: Implications of Piaget’s Theory. Teachers College Press. Kelemen, D., Emmons, N. A., Seston Schillaci, R., & Ganea, P. A. (2014). Young Children Can Be Taught Basic Natural Selection Using a Picture-Storybook Intervention. Psychological Science, 25(4), 893–902. https://doi.org/10.1177/0956797613516009 Larasati, A., & Yulianti, D. (2014). Pengembangan Bahan Ajar Sains (Fisika) Tema Alam Semesta Terintegrasi Karakter dan berwawasan Konservasi [Development of Teaching Materials for Science (Physics) Themes of the Universe Integrated Character and Conservation insight]. Unnes Physic Education Journal, 3(2), 26–33. Lind, K. K. (2005). Exploring Science in Early Childhood Education. Thomson Delmar Learning. Lorente, L. M. (2017). Implementation of early childhood physical activity curriculum (SPARK) in the Central Valley of California ( USA ). Procedia - Social and Behavioral Sciences, 237(June 2016), 319–325. https://doi.org/10.1016/j.sbspro.2017.02.097 Marton, F. (2014). Necessary conditions of learning. Routledge. Mutmainnah, M., Nessa, R., Bukhari, B., Farhana Mohd Radzif, N., & Kurniawati, R. (2021). Development of Learning Media for Acehnese Culture Picture Books to Get to Know Local Culture in Early Childhood. Al-Athfal: Jurnal Pendidikan Anak, 7(1), 53–72. https://doi.org/10.14421/al-athfal.2021.71-05 Oppliger, P. A., & Davis, A. (2016). Portrayals of Bullying: A Content Analysis of Picture Books for Preschoolers. Early Childhood Education Journal, 44(5), 515–526. https://doi.org/10.1007/s10643-015-0734-1 Oskarsson, M., & Karlsson, K.-G. (1970). Health care or Atom bombs? Interest profiles connected to a science career in Sweden. Nordic Studies in Science Education, 7(2), 190–201. https://doi.org/10.5617/nordina.242 Phillips, E. C., & Sturm, B. W. (2013). Do Picture Books About Starting Kindergarten Portray the Kindergarten Experience in Developmentally Appropriate Ways? Early Childhood Education Journal, 41(6), 465–475. https://doi.org/10.1007/s10643-012-0560-7 Pramitasari, Muktia., Yetti, Elindra., & Hapidin. (2018). Pengembangan Media Sliding Book untuk Pengenalan Sains Kehidupan (Life Science) Kelautan untuk Anak Usia Dini [Development of Sliding Book Media for Introduction to Marine Life Science for Early Childhood]. 12(November), 221–230. https://doi.org/10.21009/JPUD.122.09 Saçkes, M., Akman, B., & Trundle, K. C. (2012). A Science Methods Course for Early Childhood Teachers: A Model for Undergraduate Pre-Service Teacher Education. Necatibey Faculty of Education Electronic Journal of Science and Mathematics Education, 6(2), 1–26. Sari, N. E., & Suryana, D. (2019). Thematic Pop-Up Book as a Learning Media for Early Childhood Language Development. JPUD - Jurnal Pendidikan Usia Dini, 13(1), 43–57. https://doi.org/10.21009/10.21009/jpud.131.04 Sjøberg, S., & Schreiner, C. (2010). The ROSE project—Overview and key findings. March 1–31. Skibbe, L. E., Thompson, J. L., & Plavnick, J. B. (2018). Preschoolers’ Visual Attention during Electronic Storybook Reading as Related to Different Types of Textual Supports. Early Childhood Education Journal, 46(4), 419–426. https://doi.org/10.1007/s10643-017-0876-4 Solfiah, Y. S., Risma, D., Hukmi, & Kurnia, R. (2020). Early Childhood Disaster Management Media Through Picture Story Books. JPUD - Jurnal Pendidikan Usia Dini, 14(1), 141–155. https://doi.org/10.21009/141.10 Thorson, R. M. (2017). Physical Science Teacher’s Guide. Henry David Thoreau In Context.https://doi.org/Https"//Doi.Org/10.1017/9781316569214.025 Thulin, S., & Jonsson, A. (2014). Child Perspectives and Children’ s Perspectives – a Concern for Teachers in Preschool. Educare, 2, 13–37. Thulin, S., & Redfors, A. (2017). Student Preschool Teachers’ Experiences of Science and Its Role in Preschool. Early Childhood Education Journal, 45(4), 509–520. https://doi.org/10.1007/s10643-016-0783-0 Woodard, C., & Davitt, R. (1987). Physical Science in Early Childhood. Thomas Publications.

DINÂMICA DO POTÁSSIO, CLORO E FÓSFORO EM SOLO DA REGIÃO DO SUBMÉDIO DO VALE DO RIO SÃO FRANCISCO PEDRO ROBINSON FERNANDES DE MEDEIROS1; MARAÍSA DA SILVA FERREIRA2; JARBAS HONÓRIO DE MIRANDA3; MIGUEL JÚLIO MACHADO GUIMARÃES4; ALLAN CUNHA BARROS5 E CLÁUDIO AUGUSTO UYEDA6 1 Colegiado de Engenharia Agrícola e Ambiental, Universidade Federal do Vale do São Francisco – Campus Juazeiro, Av. Antônio C. Magalhães, 510 - Country Club, Juazeiro - BA, CEP: 48902-300. Brasil. E-mail: pedro.fernandes@univasf.edu.br. 2 Programa de Pós-Graduação em Engenharia Agrícola, Universidade Federal do Vale do São Francisco – Campus Juazeiro, Av. Antônio C. Magalhães, 510 - Country Club, Juazeiro - BA, CEP: 48902-300. Brasil. E-mail: silva.maraisaf@gmail.com. 3 Departamento de Engenharia de Biossistemas, Universidade de São Paulo, Escola Superior de Agricultura “Luiz de Queiroz”, Av. Pádua Dias, 11, Piracicaba - SP, CEP 13418-900. Brasil. E-mail: jhmirand@usp.br. 4 Colegiado de Agronomia, Instituto Federal do Maranhão - Campus São Raimundo das Mangabeiras., Rod. Transamazônica, sn, São Raimundo das Mangabeiras - MA, CEP: 65840-000. Brasil. E-mail: miguel.guimaraes@ifma.edu.br. 5 Agronomia, Universidade Federal de Alagoas – Campus Arapiraca, Av. Manoel Severino Barbosa - Bom Sucesso, Arapiraca - AL, CEP: 57309-005. Brasil. E-mail: allan.cunha@arapiraca.ufal.br. 6 Departamento de Desenvolvimento Educacional, Instituto Federal do Pernambuco - Campus Vitória do Santo Antão, End.: Propriedade Terra Preta, s/n, Zona Rural, Vitória de Santo Antão - PE, CEP: 55602-970. Brasil. E-mail: claudio.uyeda@vitoria.ifpe.edu.br. 1 RESUMO Os modelos matemáticos podem ser usados para entender a dinâmica dos íons no solo, em função principalmente da mobilidade da fração liquida em ralação a fração sólida. O objetivo da pesquisa foi avaliar o deslocamento miscível dos íons potássio, cloro e fósforo, em colunas de PVC preenchidas com Argissolo Amarelo Distrófico típico (PAd) em diferentes densidades, utilizando como ferramenta adicional, o modelo matemático STANMOD (STudio of ANalytical MODels) para o ajuste numérico das Breakthrough Curves (BTC). Os ensaios foram realizados no Laboratório de Irrigação da UNIVASF Campus Juazeiro-BA, utilizando-se colunas de PVC nas profundidades (alturas) de 0,10; 0,20 e 0,30 m e nas densidades de 1,30; 1,50 e 1,70 g cm-3. Utilizou-se solução com concentração de 1000 mg L-1 contendo os fertilizantes Cloreto de Potássio (58% de K2O e 39% de Cl) e Superfosfato Simples (8% de P2O5, 16% de Cálcio (Ca) e 8% de Enxofre (S)). Os resultados permitiram concluir que os íons potássio, cloro e fósforo tiveram uma elevada mobilidade no Argissolo Amarelo Distrófico típico (PAd) apresentando um menor valor do fator de retardamento (R) e um maior número de Peclet (P). O modelo STANMOD apresentou desempenho satisfatório no ajuste numérico das Breakthrough Curves (BTC´s). Palavras-chave: dispersividade, curvas de avanço de íons, dinâmica de solutos, STANMOD MEDEIROS, P. R. F.; FERREIRA, M. S.; MIRANDA, J. H.; GUIMARÃES, M. J. M.; BARROS, A. C.; UYEDA, C. A. IONS DYNAMICS IN POTASSIUM, CHLORINE AND PHOSPHORUS IN SOILS IN THE SÃO FRANCISCO RIVER VALLEY 2 ABSTRACT Mathematical models can be used to understand the dynamics of ions in the soil, mainly due to the mobility of the liquid fraction in relation to the solid fraction. The objective was to measure the miscible displacement of potassium, chlorine and phosphorus ions in PVC columns filled with typical Dystrophic Yellow Argisol (PAd) in different densities, using the mathematical model STANMOD (Analytical Model Studio) as an additional tool Numeric Advance Curves (BTC). The tests were conducted at the Irrigation Laboratory of UNIVASF Campus Juazeiro-BA, using PVC columns at depths (heights) of 0.10; 0.20 and 0.30 m and densities of 1.30; 1.50 and 1.70 g cm-3. A solution with a concentration of 1000 mg L-1 containing the fertilizers Potassium chloride (58% K2O and 39% Cl) and Simple Superphosphate (8% P2O5, 16% Calcium (Ca) and 8% Sulfur) was used. (S)). The results allowed to conclude that the potassium, chlorine and phosphorus ions had high mobility in the typical Yellow Dystrophic Argisol (PAd), reducing a lower value of the delay factor (R) and a greater number of Peclet (P). The STANMOD model presents satisfactory performance without numerical adjustment of Breakthrough Curves (BTC´s). Keywords: dispersive, ion advance curves, solute dynamics, STANMOD

ABSTRAK Penelitian ini dikembangkan untuk menganalisa faktor yang mempengaruhi keputusan menginap seorang konsumen muslim terhadap Hotel Syariah. Pengambilan data dilakukan pada tahun 2021 dengan 200 responden dengan menggunakan metode purposive sampling. Dari hasil analisa regresi berganda halal awareness dan lifestyle seorang konsumen muslim berpengaruh signifikan dengan keputusan menginap di Hotel Syariah. Dengan demikian, penelitian ini mengungkapkan pentingnya para pelaku bisnis Hotel Syariah untuk menyusun strategi yang sesuai dengan halal awareness dan lifestyle pasar sasaran seorang konsumen muslim. Kata Kunci: Halal awareness, lifestyle, keputusan pembelian, Hotel Syariah. ABSTRACT This study was developed to analyze the factors that influence the decision to stay at a sharia hotel consumer. Data collection was carried out in 2021 with 200 respondents using the purposive sampling method. From the results of multiple regression analysis, halal awareness and lifestyle of a Muslim consumer have a significant effect on the decision to stay at a sharia hotel. Thus, this study reveals the importance of sharia hotel business players to develop strategies that are in accordance with halal awareness and the lifestyle of the target market of Muslim consumers. Keywords: halal awareness, lifestyle, decision to stay, sharia hotel. DAFTAR PUSTAKA Ahmad, N. A., Abaidah, T. N. T., & Yahya, M. H. A. (2013). A study on halal food awareness among Muslim customers in Klang Valley. Proceedings 4th International Conference on Business and Economic Research, 1073–1087. Alam, S. S., Rohani M., & Hisham, B. (2011). Is religiosity an important determinant on Muslim consumer behaviour in Malaysia? Journal of Islamic Marketing, 2(1), 83-96. https://doi.org/10.1108/17590831111115268 Amarul, A., Sukirno, S., & Kurnia, D. (2019). Understanding the awareness of the importance of halal labels to business actors based on range of long business variations. Business and Management Research, 8(1), 17-21. http://dx.doi.org/10.5430/bmr.v8n1p17 Ambali, A. R., & Bakar, A. N. (2013). Halal food andproducts in Malaysia: People's awareness and policy implications. Intellectual Discourse, 21(1), 7-32. Awan, H. M., Siddiquei, A. N., & Haider, Z. (2015). Factors affecting halal purchase intention–evidence from Pakistan’s halal food sector. Management Research Review, 38(6), 640-660. https://doi.org/10.1108/MRR-01-2014-0022 Azam, A. (2016). An empirical study on non-muslim’s packaged halal food manufacturers: Saudi Arabian consumers’ purchase intention. Journal of Islamic Marketing, 7(4), 441-460. https://doi.org/10.1108/JIMA-12-2014-0084 BPS. (2019). Statistik hotel dan akomodasi lainnya di Indonesia 2018. Retrieved from https://www.bps.go.id/publication/2019/04/11/d64817c1f0294f59556bc76b/statistik-hotel-dan-akomodasi-lainnya-di-indonesia-2018.html BPS. (2020). Statistik hotel dan akomodasi lainnya di Indonesia 2019. Retrieved from https://www.bps.go.id/publication/2020/07/03/4206448bd185bf883b73d414/statistik-hotel-dan-akomodasi-lainnya-di-indonesia-2019.html Dewi, M. N. (2015). Pengaruh gaya hidup (lifestyle), harga, promosi terhadap pemilihan tempat tujuan wisata (destination) studi kasus pada konsumen Artojaya Tour & Travel Surabaya. Jurnal Strategi Pemasaran, 3(1), 1-13. Essoo, N., & Dibb, S. (2004). Religious influences on shopping behaviour: An exploratory study. Journal of Marketing Management, 20(7-8), 683-712. https://doi.org/10.1362/0267257041838728 Ghozali, I. (2011). Aplikasi analisis multivariate dengan program IBM SPSS 19. Semarang: Badan Penetrbit Undip. Haque, A., Chowdhury, N. A., Yasmin, F., & Tarofder, A. K. (2019). Muslim consumers’ purchase behavior towards shariah compliant hotels in Malaysia. Vidyodaya Journal of Management, 5(1), 121-138. https://doi.org/10.31357/vjm.v5i1.3918. Kotler, P., & Keller, K. L. (2012). Manajemen pemasaran. Jakarta: Erlangga. Kotler, P., & Keller, K. L. (2016). Marketing management. London: Pearson Education, Inc. Kotler, P. (2008). Manajemen pemasaran. Jakarta: Indeks. Kotler, P. (2014). Manajemen pemasaran. Jakarta: Prenhalindo. Lutfi, B. A. (2020). Analisis faktor yang memengaruhi preferensi konsumendalam memilih hotel berbasis syariah di kota Malang. Jurnal Ilmiah Mahasiswa FEB, 8(2), 1-11. Mohamed, Z. Rezai, G., Shamsudin, M. N., & Chiew, F. C. E. (2008). Halal logo and consumers’ confidence: What are the important factors. Economic Technology Management Review, 3, 37-45. Mokoagouw, M. L. (2016). Pengaruh lifestyle, harga, kualitasproduk terhadap keputusan pembelian handphone samsung di samsung mobile IT center Manado. Jurnal Berkala Ilmiah Efisiensi, 16(1), 493-502. Mowen, J., & Minor, M. (2002). Perilaku konsumen. Jakarta: Erlangga. Muslichah, M., Abdullah, R., & Razak, L. A. (2019). The effect of halal foods awareness on purchase decision with religiosity as a moderating variable: A study among university students in Brunei Darussalam. Journal of Islamic Marketing, 11(5), 1091-1104. https://doi.org/10.1108/JIMA-09-2017-0102 Muthoifin. (2015). Fenomena maraknya hotel syariah: Studi efektifitas, existensi, dan kesyariahan Hotel Syariah di surakarta. Prosiding University Research Colloquium, 93-106. Nitisusastro, M. (2012). Perilaku konsumen dalam perspektif kewirausahaan. Bandung: Alfabeta. Nurcahyo, A., & Hudrasyah, H. (2017). The influence of halal awareness, halal certification, and personal societal perception toward purchase intention: a study of instant noodle consumption of college student in Bandung. Journal of Business and Management, 6(1), 21-31. Nurhayati, T., & Hendar, H. (2019). Personal intrinsic religiosity and product knowledge on halal product purchase intention: Role of halal product awareness. Journal of Islamic Marketing, 11(3), 603-620. https://doi.org/10.1108/JIMA-11-2018-0220 Pektaş, F. (2018). The effect of lifestyle on the demand for alternative tourism. Uluslararası Yönetim İktisat ve İşletme Dergisi, 14(1), 187-198. http://dx.doi.org/10.17130/ijmeb.2018137581 Rachmawati, E., Suliyanto, & Suroso, A. (2020). A moderating role of halal brand awareness to purchase decision making. Journal of Islamic Marketing, 13(2), 542-563. https://doi.org/10.1108/JIMA-05-2020-0145 Rahardi, N., & Wiliasih, R. (2016). Analisis faktor-faktor yang mempengaruhi preferensi konsumen terhadap hotel syariah. Jurnal Syarikah: Jurnal Ekonomi Islam, 2(1), 180-192. https://doi.org/10.30997/jsei.v2i1.293 Rozalinda. (2014). Ekonomi Islam. Jakarta: Raja Grafindo. Saputra, N., & Tresnati, R. (2020). Pengaruh kesadaran halal dan pengetahuan produk halal terhadap keputusan pembelian pada wisata halal di Bali. Prosiding Manajemen, 6(1). Setiadi, N. J. (2003). Perilaku konsumen: Konsep dan implikasi untuk strategi dan penelitian pemasaran. Jakarta: Kencana. Setiadi, N. J. (2010). Perilaku konsumen. Jakarta: Kencana Prenada Media Group. Setyaningsih, E. D., & Marwansyah, S. (2019). The effect of halal certification and halal awareness through interest in decisions on buying halal food products. Syiar Iqtishadi: Journal of Islamic Economics, Finance and Banking, 3(1), 65-79. Sujarweni, V. W. (2014). SPSS untuk penelitian. Yogyakarta: Pustaka Baru. Sulastiyono, A. (2011). Seri manajemen usaha jasa sarana pariwisata dan akomodasi manajemen penyelenggaraan hotel. Bandung: Alfabeta. Sumarwan, U., Jauzi, A., Mulyana, A., Karno, B. N., Mawardi, P. K., & Nugroho, W. (2011). Riset pemasaran dan konsumen seri 1. Bogor: IPB Press. Suprapti, N. W. S. (2010). Perilaku konsumen: Pemahaman dasar dan aplikasinya dalam strategi pemasaran. Bali: Universitas Udayana Bali. Swidi, A., Cheng, W., Hassan, M. G., Al-Hosam, A., & Mohd Kassim, A. W. (2010). The mainstream cosmetics industry in Malaysia and the emergence, growth, and prospects of halal cosmetics. Proceedings of Third International Conference on International Studies, 1-20. Yunus, N. S. N. M., Rashid, W. E. W., Ariffin, N. M., & Rashid, N. M. (2014). Muslim's purchase intention towards non-Muslim's Halal packaged food manufacturer. Procedia-Social and Behavioral Sciences, 130, 145-154.

During the fungal forays for the collection of macro-fungi from different districts of Punjab province of Pakistan three specimens of Termitomyces were collected in the rainy seasons of the year 2021 and 2022s. After detailed morpho-anatomical studies, these specimens were recognized as T. umkowaan, which an edible taxon, and first time reported from two districts (Khanewal and Lahore) of Pakistan. In current study, taxonomic description, macrographs of basidiomata, illustrations and light micrographs of microscopic features are given. Morpho-anatomical comparison with similar species is also provided. REFERENCES Aryal HP, Budathoki U (2015). Systematics of Nepalese Termitomyces. Our Nature. 13: 31-44. http://dx.doi.org/10.3126/ on.v13i1.14207 Batra LR, Batra SWT (1979). Termite–fungus mutualism. Batra LR, Batra SWT editors. Insect-fungus symbiosis. New York, USA. https://lccn.loc.gov/78020640 Chakraborty I, Mondal S, Rout D, Islam SS (2006). A water-insoluble (1→ 3)-β-d-glucan from the alkaline extract of an edible mushroom Termitomyces eurhizus. Res. 341: 2990-2993. https://doi.org/10.1016/j.carres.2006.09.009 FrØSlev TG, Aanen DK, Laessøe T, Rosendahl S (2003). Phylogenetic relationships of Termitomyces and related taxa. Res. 107: 1277-1286. https://doi.org/10.1017/S0953756203008670 Heim R (1942). New descriptive studies on termitophilous agarics of tropical Africa. Nat. Hist. 6: 107-166. https://sciencepress.mnhn.fr/en/periodiques/archives-serie6/18/1/2 Hussain S, Afshan NS, Ahmad H, Khalid AN (2015). New report of edible mushroom, Termitomyces umkowaan from Pakistan. Sylwan. 159: 185-197. https://www.researchgate.net/publication/292158545_Title_New_Report_of_edible_mushroom_Termitomyces_umkowaan_from_Pakistan Izhar A, Khalid AN, Bashir H (2020). Termitomyces sheikhupurensis nov.(Lyophyllaceae, Agaricales) from Pakistan, evidence from morphology and DNA sequences data. Turk. J. Bot. 44: 694-704. https://journals.tubitak.gov.tr/cgi/viewcontent.cgi?article=1069&context=botany Kansci G, Mossebo DC, Selatsa AB, Fotso M (2003). Nutrient content of some mushroom species of the genus Termitomyces consumed in Cameroon. Food/Nahrung. 47: 213-216. https://pubmed.ncbi.nlm.nih.gov/12866626/ Karun NC, Sridhar KR (2013). Occurrence and distribution of Termitomyces (Basidiomycota, Agaricales) in the Western Ghats and on the west coast of India. Mykol. 65: 233-254. http://www.czechmycology.org/_cmo/CM65207.pdf Khowala S, Ghosh AK, Sengupta S (1992). Saccharification of xylan by an amyloglucosidase of Termitomyces clypeatus and synergism in the presence of xylanase. Microbiol. Biotechnol. 37: 287-292. https://link.springer.com/article/10.1007/BF00210979 Kirk PM, Cannon PF, Minter DW, Stalpers JA (2008). Dictionary of Fungi, 10th edn. CABI press, UK. https://www.researchgate.net/publication/311424562_Dictionary_of_the_Fungi10th_ed Nobre T, Aanen DK (2012). Fungiculture or Termite Husbandry? The Ruminant Hypothesi. Insects. 3: 307-323. Ogundana SK, Fagade OE (1982). Nutritive value of some Nigerian edible mushrooms. Food chem. 8: 263-268. https://doi.org/10.1016/0308-8146(82)90028-0 Razaq A, Ishaq A, Ilyas S, Niaz S, Sadia S (2023). Termitomyces pakistanensis, a new mushroom species from Pakistan based on scanning electron microscopy and ITS‐rDNA barcoding. Res. Tech. 86: 115-121. https://doi.org/10.1002/jemt.24265 Sultana K, Rauf CA, Riaz A, Naz F, Irshad G, Haque MI (2011). Checklist of agarics of Kaghan valley. Pak. J. Bot. 43: 1777-1787. Tang SM, He MQ, Raspe O, Luo X, Zhang XL, Li YJ, Su KM, Li SH, Thongklang N, Hyde KD (2020). Two new species of Termitomyces (Agaricales, Lyophyllaceae) from China and Thailand. Phytotaxa. 439: 231-242. 11646/PHYTOTAXA.439.3.5 Tibuhwa DD (2012). Termitomyces species from Tanzania, their cultural properties and unequalled basidiospores. J. Bio. Life Sci. 3: 2157-6076. http://dx.doi.org/10.5296/jbls.v3i1.1723 Usman M, Khalid AN (2020). Termitomyces acriumbonatus nov. (Lyophyllaceae, Agaricales) from Pakistan. Phytotaxa. 477: 217-228. Wei TZ, Tang BH, Yao YJ (2009). Revision of Termitomyces in China. Mycotaxon. 108: 257-285.

In May 2012 in the Coachella valley, Riverside County, California, the decline of vines in table grape (Vitis vinifera) vineyards was observed. Foliar symptoms consisted of shoot blight with wilting and necrosis of leaves and drying and shriveling of berries. In some cases, the entire vine collapsed in the middle of the growing season (apoplexia). Wood cankers in the spurs, cordons, and trunks of affected vines were also present. The nine isolates recovered from the cankers were identified as Neoscytalidium dimidiatum (Penz.) Crous & Slippers based on morphological characteristics and DNA sequence comparisons. Two isolates were grown on potato dextrose agar (PDA) medium and a total of 50 conidia were measured per isolate. Conidia were ellipsoid to ovoid, with a truncate base and an acutely rounded apex, initially aseptate, becoming brown and two-celled at maturity, 7.2 ± 1.2 μm × 3.8 ± 0.4 μm. The rDNA internal transcribed spacer (ITS), and β-tubulin (BT) loci were amplified using primer pairs and methods previously described (4). A total of five isolates were sequenced. The DNA sequences of one N. dimidiatum grapevine isolate (UCR-Neo1) were deposited in the GenBank database (ITS, KC937066; BT, KC937067). Pathogenicity tests were performed by inoculating 12 grape cuttings cv. Thompson Seedless with isolate UCR-Neo1 and 12 control cuttings with sterile medium using a technique previously described (1). The experiment was repeated twice. After 20 weeks of incubation period in the greenhouse, the lesions length produced by N. dimidiatum averaged 13.5 mm and was significantly longer (P < 0.05) from the control (average 3 mm). N. dimidiatum was reisolated from all the inoculated plants and identified by colony morphology. The incidence of N. dimidiatum in table grape vineyards of the Coachella valley has been estimated at 15%, with nine vines infected out of 60 vines total. This pathogen has been identified in California in walnut nursery causing the death of trees due to the development of canker at the graft union (2). N. dimidiatum has also been identified as the causal agent of shoot blight, canker, and gummosis on citrus in Italy (3). The crop is also being grown in the Coachella valley and these findings warrant further investigation in order to determine the host range, distribution, and incidence of this pathogen in the area. References: (1) K. Baumgartner et al. Plant Dis. 97:912, 2013. (2) S. F. Chen et al. Plant Dis. 97:993, 2013. (3) G. Polizzi et al. Plant Dis 93:1215, 2009. (4) J. R. Urbez-Torres et al. Plant Dis. 92:519, 2008.

- Wouter E.A. van Beek, Henri Maurier, Philosophie de L’Afrique Noire (2ème éd.), St. Augustin: Anthropos Institut, 1985. - Wouter E.A. van Beek, A.M. Hocart, Imagination and proof. Selected essays of A.M. Hocart, Edited and with an introduction by Rodney Needham, Tucson: University of Arizona Press, 1987. 130 pp. - Martin van Bruinessen, B.B. Hering, Studies on Indonesian Islam, Occasional Paper no. 19, Centre for Southeast Asian Studies, James Cook University of North Queensland, Townsville (Australia), 1986, 50 pp. - Martin van Bruinessen, B.B. Hering, Studies on Islam, Occasional Paper no. 22, Centre for Southeast Asian Studies, James Cook University of North Queensland, Townsville (Australia), 1987, 94 pp. - Martin van Bruinessen, L.B. Venema, Islam en macht: Een historisch-anthropolische perspectief, Assen/Maastricht: Van Gorcum, 1987. - H.J.M. Claessen, Colin Renfrew, Peer polity interaction and socio-political change, Cambridge: Cambridge University Press, 1986. 179 pp., maps, ills., index, bibl., John F. Cerry (eds.) - H. Dagmar, Fred R. Myers, Pintupi country, Pintupi self; Sentiment, place and politics among Western Desert aborigines, Washington etc.: Smithsonian Institution Press, Australian Institute of Aboriginal Studies. - Mies Grijns, Rosanne Rutten, Women workers of Hacienda Milagros; Wage labor and household subsistence on a Philippine sugar cane plantation. Publikatieserie Zuid- en Zuidoost-Azie no. 30, Amsterdam: Anthropologisch-Sociologisch Centrum, Universiteit van Amsterdam, 1982, x + 187 pp. - Mies Grijns, Ann Laura Stoler, Capitalism and confrontation in Sumatra’s plantation belt, 1870-1979, Newhaven: Yale University Press, 1985, xii + 244 pp. - Nico de Jonge, Rodney Needham, Mamboru. History and structure in a domain of Northwestern Sumba. Oxford: Clarendon Press, 1987, 202 pp. - Anton Ploeg, Kenneth E. Read, Return to the high valley. Coming full circle. Berkeley: University of California Press, 1986. xxi + 269 pp. - Rien Ploeg, Tom R. Zuidema, La Civilisation Inca au Cuzco, Collège de France, Essais et Conférences, Paris: Presses Universitaires de France, 1986. - Harry A. Poeze, E.E. van Delden, Klein repertorium; Index op tijdschriftartikelen met betrekking tot voormalig Nederlands-Indië, samengesteld door E. E. van Delden. Amsterdam: Koninklijk Instituut voor de Tropen. Deel 1, Tijdschrift voor het Binnenlandsch Bestuur 1887-1900, 1986, 79 pp. Deel 2, Tijdschrift voor het Binnenlandsch Bestuur 1900-1909, 1986 80 pp. Deel 3, Tijdschrift voor het Binnenlandsch Bestuur 1910-1917, 1987, 80 pp. - Harry A. Poeze, J.J.P. de Jong, Diplomatie of strijd; Een analyse van het Nederlands beleid tegenover de Indonesische revolutie 1945-1947. Amsterdam: Boom, 531 pp. - Harry A. Poeze, D.C.L. Schoonoord, De Mariniersbrigade 1943-1949; Wording en inzet in Indonesië. ‘s-Gravenhage: Afdeling Maritieme Historie van de Marinestaf. - R. de Ridder, Edmundo Magaña, Myth and the imaginary in the new world, Amsterdam: CEDLA, Latin America Studies no. 34, 1986. 500 pp. 64 ills., Peter Mason (eds.) - P.G. Rivière, Edmundo Magaña, Contribuciones al estudio de la mitología y astronomía de los indios de las Guayanas, Dordrecht-Providence: Foris Publications. 1987. - A. de Ruijter, P.E. de Josselin de Jong, Generalisatie in de culturele antropologie (Afscheidscollege ter gelegenheid van het neerleggen van het ambt van hoogleraar in de sociale wetenschappen aan de Rijksuniversiteit van Leiden op 12 juni 1987), 1987, Leiden: E.K. Brill. - Mary F. Somers Heidhues, Yoe-Sioe Liem, Überseechinesen - eine minderheit: Zur erforschung interethnischer vorurteile in Indonesien, Aachen: Edition Herodot im Rader-Verlag, 1986. - N.J.M. Zorgdrager, H. Beach, Contributions to circumpolar studies. Uppsala Research Reports in Cultural Anthropology no. 7, 1986. 181 pages.

В статье кратко изложены основные результаты и перспективные направления изучения ботайской культуры коллективом Международной комплексной казахстанско-британской археологической экспедиции. Особое внимание в статье уделено освещению большой работы, проведенной западными учеными под руководством Алана Оутрама на поселении Ботай по анализу археозоологических, химико-физических и биологических источников из культурного слоя памятника. Библиографические ссылки 1. Зайберт В.Ф. Ботайская культура. Алматы: «КазАкпарат», 2009. 576 с. 2. Захарук Ю.Н. Историзм: проблемы археологии и этнографии // Историзм археологии: методические проблемы: тез. докл. конф. М., 1976. С. 6-10. 3. Левин М. Истоки конного хозяйства на евразийской степи // Поздняя доисторическая эксплуатация евразийской степи. Левин М., Рассамакин Ю., Кисленко А., Татаринцева Н. (ред.). Кембридж: Институт Макдональда, 1999. С. 5-58. 4. Левин М. Изучение критериев раннего приручения лошадей // Следы предков: исследования в честь Колина Ренфрю. Джонс М. (изд.). Кембридж: Институт Макдональда, 2004. С. 115-26. 5. Массон В.М. Основные направления культурно-исторического процесса // Становление производства в эпоху энеолита и бронзы: по материалам Южного Туркменистана. М.: «Наука», 1981. С. 35-48. 6. Токарев С.А. Проблемы типов этнических общностей (к методологическим проблемам этнографии) // Вопросы философии. 1964. № 11. С. 48-59. 7. Хотинский Н.А. Голоцен Северной Евразии: опыт трансконтинентальной корреляции этапов развития растительности и климата (К X Конгрессу YNAUA (Великобритания, 1977); 8). М.: «Наука», 1977. С. 13-16. 8. Чубарьян А.О. Опыт мировой истории и идеологии обновления // Всеобщая история: дискуссии, новые подходы. М., 1989. Вып. 1. С. 7-17. 9. Arnaud F., Poulenard J., Giguet-Covex C., Wilhelm B., Révillon S., Jenny J.P., Revel M., Enters D., Bajard M., Fouinat L., Doyen E. Erosion under climate and human pressures: An alpine lake sediment perspective // Quaternary Science Reviews. 2016. 152. P. 1-18. 10. Bendrey R. New methods for the identification of evidence for bitting on horse remains from archaeological sites // JAS. 2007. 34 (7). P. 1036-1050. 11. French C., Kousoulakou M. Geomorphological and micromorphological investigations of palaeosols, valley sediments and a sunken floored dwelling at Botai, Kazakhstan // Levine M.A., Renfrew C., Boyle K.V. (eds). Prehistoric Steppe Adaptation and the Horse. Cambridge: McDonald Institute, 2003. P. 105-114. 12. Jones M.A., Hunt H.A., Kneale C.A., Lightfoot E.M., Lister D.I., Liu X.I., Motuzaite-Matuzeviciute G.I. Food globalisation in prehistory: The agrarian foundations of an interconnected continent // Journal of the British Academy. 2016. 4. P. 73-87. 13. O’Connell T., Levine M., Hedges R. The importance of fish in the diet of Central Eurasian peoples from the Mesolithic to the Early Iron Age // Levine M., Renfrew C., Boyle K. (eds) Prehistoric Steppe Adaptation and the Horse. Cambridge: McDonald Institute for Archaeological Research, 2003. P. 253-268. 14. Olsen S.A., Bradley B., Maki D., Outram A. Community organization among Copper Age sedentary horse pastoralists of Kazakhstan // Peterson D.L., Popova L.M., Smith A.T. (eds) Beyond the steppe and the sown: Proceedings of the 2002 University ofChicago Conference on Eurasian Archaeology. Leiden: Brill, 2006. P. 89-111. 15. Outram A.K., Stear N. A., Bendrey R., Olsen S., Kasparov A., Zaibert V., Thorpe N., Evershed R.P. The earliest horse harnessing and milking // Science. 2009. 323 (5919). P. 1332-1335. 16. Outram A.K. Animal Domestications // Oxford Handbook of the Archaeology and Anthropology of Hunter-Gatherers. Cumming V., Jordan P., Zvelebil M. (eds). Oxford: Oxford University Press, 2014. P. 749-763. 17. Outram A.K. Pastoralism // The Cambridge World History, Vol. II: A World with Agriculture, 12,000 BCE – 500 CE. Barker G., Goucher C. (eds). Cambridge: Cambridge University Press, 2015. P. 161-185. 18. Seetah K., Cucchi T., Dobney K., Barker G. A geometric morphometric re-evaluation of the use of dental form to explore population differences in horses (Equus caballus) and its potential zooarchaeological application // JAS. 2014. 41. P. 904-910. 19. Stear N.A. Changing patterns of animal exploitation in the prehistoric Eurasian steppe: an integrated molecular, stable isotope and archaeological approach. Unpublished PhD Thesis. University of Bristol, 2008.

Orchardgrass or cocksfoot (Dactylis glomerata L.) has been widely cultivated as a forage crop in many provinces of China (1). It is also a native perennial forage grass, which grows at the edge of forests, shrubs, and mountainous grasslands in Xinjiang and Sichuan (2). In September of 2007, signs of choke disease on orchardgrass were observed in a native grassland under birch woodland near Altai City, Xinjiang, China. Stromata, which formed on culms of diseased grass, enclosing the inflorescence and leaf sheath, were 4.5 to 5.5 mm long, smooth or wrinkled, white and later becoming yellowish or yellow, tuberculate, dry, and covered with perithecia. Inflorescences surrounded by fungal stromata were choked and failed to mature, thus restricting seed production. Pure cultures were obtained by directly scraping stromata from the surface and incubating it on antibiotic potato dextrose agar (PDA). The colonies were cottony, white on the upper surface, and white to yellow on the reverse. The growth rate was 13 to 21 mm per week at 25°C on PDA. Conidia were hyaline, lunate to reniform, and measured 4.1 ± 0.5 × 2.2 ± 0.5 μm. They accumulated in small globose heads at the tips of conidiogenous cells and were produced singly on conidiophores of 13 to 33 μm long and 2.7 to 4.1 μm wide at the base. Internal transcribed spacer (ITS) sequence by BLAST search had 99% similarity with an Epichloë typhina isolate of orchardgrass in Spain (GenBank Accession No. AM262420.1). Cultural characteristics, microscopic examination, and phylogenetic analysis showed that this choke disease on D. glomerata was caused by the fungus E. typhina (Pers.) Tul. & C. Tul. as described by White (4). To our knowledge, this is the first report of E. typhina causing choke disease on orchardgrass in China. The pathogen has been identified in France, England, Germany, Sweden, Switzerland, and the United States (3,4) with the same symptoms as those reported here. In 1997, choke disease was found in 70% of the fields in the Willamette Valley of Oregon, with disease incidences ranging from 0.05 to 28%. It was predicted to increase and spread under the prevailing climatic conditions (3). This new disease report is to provide observational and diagnostic information to help with recognition and prevention of disease spread in orchardgrass cultivation regions of China. References: (1) X. R. Chao et al. Shandong Agric. Sci. 1:7, 2005. (2) S. X. Jia, ed. China Forage Plant Flora. China Agriculture Press, Beijing, 1987. (3) W. F. Pfender and S. C. Alderman. Plant Dis. 83:754, 1999. (4) J. W. White. Mycologia 85:444, 1993.

Kashmiri is an Indo-Aryan language spoken predominantly in the state of Jammu and Kashmir, India and in some parts of Pakistan. Some phonological and morphological features of this language make it peculiar among Indo-Aryan languages. This write-up provides a phonological sketch of Kashmiri. The description of Vowels and Consonants is given in order to build a general idea of the phonological system of the language. The process of nasalization is phonemic in Kashmiri. The aim of this write-up is to describe and show all the phonological features of the language, particularly those that are uniquely found in this language. In addition, an attempt has been made to describe and explain the various phonological processes such as Palatalization, Epenthesis and Elision, which occur in Kashmiri. All such processes are described with appropriate examples and the data comprising of lexemes and sounds for examples is primary data used by the author who is a native speaker of the language. Given to the peculiar features of this language, the process of homonymy, which is homographic in nature, is described with appropriate examples. References Bhaskararao, P., Hassan, S., Naikoo, I. A., Wani, N. H., T. A., & Ganai, P. A. (2009). A Phonetic Study of Kashmiri Palatalization. In M. e. Minegishi, Field Research, Corpus Linguistics and Linguistic Informatics (pp. 1-17). Tokyo: Tokyo University of Foreign Studies. Bhat, R. N. (2008). Palatalization : a note on Kashmiri morphophonology. Retrieved 11 14, 2018, from Academia: https://www.academia.edu/6383970/Palatalization_A_Note_on_ Kashmiri_Morphophonology Chomsky, N., & Halle, M. (1968). The sound pattern of English. New York: Harper and Row . Crowley, T. (1997). An introduction to historical linguistics. Oxford: oxford University Press. Fussman, G. (1972). Atlas linguistique des pariers Dardes et Kafirs. Paris: Ecole Francaise d'Etreme-Orient. Grierson, G. A. (1973). A standard manual of Kashmiri language (Vol. 2). Rohtak: Light and Life Publishers. Grierson, G. A. (1919). Linguistic Survey of India. Calcutta: Superintendent Government Printing. Kachru, B. B. (1969). Kashmiri and other Dardic languages. (T. A. Sebeok, Ed.) Current Trends in Linguistics, 5, 284-306. Kak, A. A. (2002). Languange maintenance and language shift in Srinagar. New delhi: Un­pub­lished Phd dissertation, University of Delhi. Kak, A. A., & O. F. (2009). Nasality of Kashmiri vowels in Optimality theory. Nepalese Linguistics, 4, 61-68. Koul, O. N. (1996). On the standardization of Kashmiri script. In S. I. Hasnain (Ed.), Standardization and Modernization: Dynamics of Language Planning (pp. 269-278). New Delhi: Bahri Publications. Koul, O. N., & Wali, K. (2006). Modern Kashmiri grammar. Springfield: Dunwoody Press. Ladefoged, P., & Maddieson, I. (1996). The sounds of the worls's languages. Oxford: Blackwell. Lawrence, W. R. (1895). The valley of Kashmir. Srinagar: Kesar Publishers. Leech, G. (1974). Semantics. Middlesex: Penguin Books. Mir, F. A. (2014). Acquisition of deixis among Kashmiri speaking children of 4-5 years of age. Department of Linguistics Aligarh Muslim University, Aligarh. Aligarh: Unpublished M.Phil Thesis. Office of the Registrar General & Census Commissioner, India. (2018, 10 12). Census,2011. Retrieved 11 12, 2018, from censusindia: http://www.censusindia.gov.in/2011Census/C-16_25062018_NEW.pdf Pandey, P. (2018). Types of Phonological Processes. Retrieved from e-Pathshala: http://epgp.inflibnet.ac.in/epgpdata/uploads/epgp_content/linguistics/02.introduction_to_phonetics_and_phonology/21._types_of_phonological_processes-_i/et/7664_et_et_21.pdf. Shakil, M. (2012). Academia. Retrieved 11 15, 2018, from Languages of erstwhile state of Jammu and Kashmir: a preliminary study: https://www.academia.edu/6485567/Languages_of_ Erstwhile_State_of_Jammu_Kashmir_A_Preliminary_Study_?auto=download Wheeler, M. W. (2005). Cluster reduction: Deletion or Coalescence? Catalan Journal of Linguistics, 4, 57-82. Retrieved 11 2018, from https://www.raco.cat/index.php/Catalan Journal/article/view/39481

Grapevine leaf roll-associated viruses (GLRaVs) are a group of nine closely related viruses belonging to the Closteroviridae family that cause grapevine leaf roll disease in vineyards across the world (3). Within the continental United States, GLRaVs have been reported in the states of California, Michigan, Missouri, New York, Oregon, Washington, and Wisconsin, but not in Ohio (2,3). During 2012, grapevines with typical leaf roll symptoms were reported by owners of several Ohio vineyards. The symptoms included small, red leaves and downwardly rolled leaf margins, accompanied by tiny grape clusters with few fruits. A total of 20 symptomatic leaf samples were collected from two sites about 300 miles apart within Ohio, namely Valley Vineyards (cultivars Vidal Blanc and Fronterac) and South River Winery (cultivar Cabernet Franc). Total RNA was extracted from the samples using a previously reported procedure (1) and subjected to reverse transcription (RT)-PCR using specific primers for five known grapevine viruses including GLRaV-1 (1F: 5′-ACCTGGTTGAACGAGATCGCTT and 1R: 5′-GTAAACGGGTGTTCTTCAATTCTCT), GLRaV-2 [2F(FQ): 5′-GCTCCTAACGAGGGTATAGAAG and 2R(FQ): 5′-AGAGCGTACATACTCGCGAACAT], GLRaV-3 [3F(FQ): CAAGTGCTCTAGTTAAGGTCAG and 3R(FQ): 5′-CGGAACGTCGGTTCATTTAGA], Grapevine fan leaf virus (GFLVR1-F: 5′-TGAGATTAGTCATGGAGCAGCTT and GFLVR1-R: 5′-GGATAGACGTCTGGTTGATTTTG), and Tobacco ring spot virus (TRSVR1-1255F: 5′-GAGTGTTGTGCAATTATCT-GCATA and TRSVR1-1844R: 5′-CAAAGATGCCAAGAAAAGTTGCAAG). A 295-bp fragment of a grapevine actin cDNA (primers VvACT-F: 5′-ATCTCCATGTCAACCAAACTGAG and VvACT-R: 5′-GACAGAATGAGCAAGGAAATCAC) was used as a positive control for RT-PCR. The samples tested negative for GFLV, TRSV, or GLRaV-1 with our primer sets. However, four of the samples were positive for GLRaV-2, and 12 positive for GLRaV-3, as evidenced by the detection of PCR fragments of expected sizes (404 and 344 bp, respectively). All samples positive for GLRaV-2 were from a single field, whereas samples positive for GLRaV-3 were from both vineyards examined. The identities of GLRaV-2 and -3 were further confirmed by directly sequencing one GLRaV-2 and two GLRaV-3 (one from each location) PCR fragments from both ends. The 404 bp GLRaV-2-specific fragment shared 95 to 98% sequence identity with various GLRaV-2 isolates whose sequences were deposited at the GenBank. Similarly, the two 344-bp GLRaV-3 fragments share a 95 to 97% identity with known GLRaV-3 isolates. Notably, the sequences of the two GLRaV-3-specific fragments derived from two vineyards are not identical (97% identity), suggesting these two isolates might have different origins. As these viruses are known to be recalcitrant to mechanical transmission, we did not attempt to transmit these viruses to healthy plants. In summary, our results report for the first time the detection of GLRaV-2 and -3 in Ohio, suggesting that these two viruses are associated with the observed leaf roll symptoms, hence should be part of an effective management plan for grapevine viral diseases in the state. References: (1) C. Louime et al. Eur. J. Sci. Res. 22:232, 2008. (2) S. Lunden and W. Qiu. Plant Dis. 96:462, 2012. (3) A. M. Sharma et al. PLoS One 6:e26227, 2011.

International Journal of Statistics and Probability wishes to acknowledge the following individuals for their assistance with peer review of manuscripts for this issue. Their help and contributions in maintaining the quality of the journal is greatly appreciated. Many authors, regardless of whether International Journal of Statistics and Probability publishes their work, appreciate the helpful feedback provided by the reviewers. Reviewers for Volume 8, Number 1 Abdullah A. Smadi, Yarmouk University, Jordan Afsin Sahin, Gazi University, Turkey Ali Reza Fotouhi, University of the Fraser Valley, Canada Anna Grana, University of Palermo, Italy Carla J. Thompson, University of West Florida, USA Felix Almendra-Arao, UPIITA del Instituto Polit&eacute;cnico Nacional , M&eacute;xico Gabriel A. Okyere, Kwame Nkrumah University of Science and Technology, Ghana Gerardo Febres, Universidad Sim&oacute;n Bol&iacute;var, Venezuela Hui Zhang, St. Jude Children&rsquo;s Research Hospital, USA Ivair R. Silva, Federal University of Ouro Preto &ndash; UFOP, Brazil Krishna K. Saha, Central Connecticut State University, USA Man Fung LO, Hong Kong Polytechnic University, Hong Kong Olusegun Michael Otunuga, Marshall University, USA Philip Westgate, University of Kentucky, USA Qingyang Zhang, University of Arkansas, USA Sajid Ali, Quaid-i-Azam University, Pakistan Samir Khaled Safi, The Islamic University of Gaza, Palestine Shatrunjai Pratap Singh, John Hancock Financial Services, USA Sohair F. Higazi, University of Tanta, Egypt Subhradev Sen, Alliance University, India Vilda Purutcuoglu, Middle East Technical University (METU), Turkey Vyacheslav Abramov, Swinburne University of Technology, Australia Wei Zhang, The George Washington University, USA Weizhong Tian, Eastern New Mexico University, USA Zaixing Li, China University of Mining and Technology (Beijing), China Wendy Smith On behalf of, The Editorial Board of International Journal of Statistics and Probability Canadian Center of Science and Education

Heterobasidion annosum (Fr.:Fr.) Bref. sensu lato, one of the most damaging root and butt rot agents on conifers, was recently segregated into three species in Europe based on morphology, intersterility grouping (ISGs), and host preferences (3). These species include: H. annosum (Fr.) Bref. sensu stricto (ISG P) on Pinus, other conifers and some hardwoods; H. parviporum Niemelä & Korhonen (ISG S), primarily on Picea; and H. abietinum Niemelä & Korhonen (ISG F) on Abies. In the summer of 1998, a Swiss stone pine (Pinus cembra L.), growing at 1,900 m in a mixed spruce (Picea) and larch (Larix) forest in the Aosta Valley (northwest Italian Alps), was found infected by H. parviporum and H. annosum sensu stricto. The pine (approximately 14 m tall and at least 75 years old) was without crown symptoms, but the stem, stump, and all the main roots showed internal decay. Disks, 3 to 4 cm thick, were cut consecutively from the roots, stump, and stem, incubated, and examined for conidiophore production. After 8 days, 63 isolates were obtained from all disks taken from the stump and roots, and from disks taken up to 4 m above the collar in the stem. Isolates were identified by polymerase chain reaction (PCR) of mitochondrial and nuclear markers (2) and by sexual compatibility with testers of each European Heterobasidion spp. The stem and one root were colonized by H. parviporum while the other roots and most of the stump was colonized by H. annosum sensu stricto. Somatic incompatibility tests among conspecific isolates suggested that there was only one genet of each species. The coexistence of different Heterobasidion spp. (ISGs) in the same tree has been reported only in Pinus ponderosa Dougl. ex Laws. in California (1) and in Picea abies (L.) Karst. in Europe (4). To our knowledge, this is the first report of H. annosum sensu stricto on P. cembra and of a European pine to be simultaneously infected by more than one species of Heterobasidion. References: (1) M. Garbelotto et al. Phytopathology 86:543, 1996. (2) P. Gonthier et al. Can. J. Bot. 79:1057, 2001. (3) T. Niemelä and K. Korhonen. Taxonomy of the genus Heterobasidion. Pages 27–33 in Heterobasidion annosum, Biology, Ecology, Impact and Control. CAB International, Wallingford, UK, 1998. (4) R. Vasiliauskas and J. Stenlid. Can. J. Forest Res. 28:961, 1998.

From September to December 2010, mango (Mangifera indica L.) stems showing dieback symptoms were collected during a survey conducted in São Francisco Valley, northeastern Brazil. Small pieces (4 to 5 mm) of necrotic tissues were surface sterilized for 1 min in 1.5% NaOCl, washed twice with sterile distilled water, and plated onto potato dextrose agar (PDA) amended with 0.5 g liter–1 streptomycin sulfate. Plates were incubated at 25°C in the dark for 14 to 21 days and colonies that were morphologically similar to species of Botryosphaeriaceae were transferred to PDA. Colonies developed a compact mycelium that was initially white, but becoming gray dark after 4 to 6 days of incubation at 25°C in darkness. Identification was made using morphological characteristics and DNA based molecular techniques. Pycnidia were obtained on 2% water agar with sterilized pine needles as substratum after 3 weeks of incubation at 25°C under near-UV light. Pycnidia were large, multilocular, eustromatic, covered with hyphae; locule totally embedded without ostioles, locule walls consisting of a dark brown textura angularis, becoming thinner and hyaline toward the conidiogenous region. Conidia were hyaline, thin to slightly thickened walled, aseptate, with granular contents, bacilliform, straight to slightly curved, apex and base both bluntly rounded or just blunt, 15.6 to 25.0 (20.8) μm long, and 2.7 to 7.9 (5.2) μm wide, length/width = 4.00. According to these morphological characteristics, three isolates (CMM1364, CMM1365, and CMM1450) were identified as Pseudofusicoccum stromaticum (1,3,4). PCR amplification by universal primers (ITS4/ITS5) and DNA sequencing of the internal transcribed spacer (ITS1-5.8S-ITS2 rRNA gene cluster) were conducted to confirm the identifications through BLAST searches in GenBank. The isolates were 100% homologous with P. stromaticum (3) (GenBank Accession Nos. AY693974 and DQ436935). Representative sequences of the isolates were deposited in GenBank (Accession Nos. JF896432, JF966392, and JF966393). Pathogenicity tests were conducted with the P. stromaticum strains on 5-month-old mango seedlings (cv. Tommy Atkins). Mycelial plugs taken from the margin of actively growing colonies (PDA) of each isolate were applied in shallow wounds (0.4 cm in diameter) on the stem (center) of each plant. Inoculation wounds were wrapped with Parafilm. Control seedlings received sterile PDA plugs. Inoculated and control seedlings (five each) were kept in a greenhouse at 25 to 30°C. After 5 weeks, all inoculated seedlings showed leaf wilting, drying out of the branches, and necrotic lesions in the stems. No symptoms were observed in the control plants. P. stromaticum was successfully reisolated from symptomatic plants to fulfill Koch's postulates. P. stromaticum was described from Acacia, Eucalyptus, and Pinus trees in Venezuela (3,4), and there are no reports of this fungus in other hosts (2). To our knowledge, this is the first report of P. stromaticum causing mango dieback in Brazil and worldwide. References: (1) P. W. Crous et al. Stud. Mycol. 55:235, 2006. (2) D. F. Farr and A. Y. Rossman. Fungal Databases. Systematic Mycology and Microbiology Laboratory, ARS, USDA. Retrieved from http://nt.ars-grin.gov/fungaldatabases/ , 18 May 2011. (3) S. Mohali et al. Mycol. Res. 110:405, 2006. (4) S. R. Mohali et al. Fungal Divers. 25:103, 2007.

ADEQUAÇÃO DE MODELOS PROBABILÍSTICOS À EVAPOTRANSPIRAÇÃO DE REFERÊNCIA NO SUBMÉDIO DO VALE DO RIO SÃO FRANCISCO EDGO JACKSON PINTO SANTIAGO1; FRANK GOMES-SILVA 1; ANTONIO SAMUEL ALVES DA SILVA1; JOSÉ RAMON BARROS CANTALICE1; MOACYR CUNHA FILHO1 E JOSÉ DOMINGOS ALBUQUERQUE AGUIAR1 1 Departamento de Estatística e Informática-DEINFO, Programa de Pós-Graduação em Biometria e Estatística Aplicada-PPGBEA, Universidade Federal Rural de Pernambuco-UFRPE, Rua Dom Manoel de Medeiros s/n, Dois Irmãos, CEP: 52.171.900, Recife, Pernambuco, Brasil. edgoj@hotmail.com, franksinatrags@gmail.com, antonio.sasilva@ufrpe.br, cantalice21@hotmail.com, moacyr2006@gmail.com, aguiar.domingos@gmail.com. 1 RESUMO A evapotranspiração consiste no processo de perda de água do solo, da planta, e é fundamental para produção vegetal, constituindo uma das principais variáveis agrometeorológicas. Apesar disso, são escassos trabalhos que relacionam adequabilidade de distribuições de probabilidade a dados de evapotranspiração. O objetivo desse trabalho foi testar a aderência de diferentes distribuições de probabilidade à dados de evapotranspiração de referência, selecionando as mais adequadas para este fim. Esse estudo foi realizado com dados de evapotranspiração de referência obtidos pelas estações meteorológicas da Universidade Federal do Vale do São Francisco (UNIVASF) em Petrolina, PE e Juazeiro, BA. Foram ajustadas as distribuições Gama, Weibull, Log-Normal, Beta, Exponencial, Log-Logística e Log-Logística Exponenciada. Os maiores p-valores foram obtidos para as distribuições Log-Logística e Log-Logística Exponenciada, possivelmente devido à leve assimetria positiva destas aos dados de evapotranspiração. Pelo teste da razão de verossimilhanças, a distribuição Log-Logística Exponenciada adequou-se mais aos meses de janeiro, agosto e dezembro em Juazeiro e Petrolina, somando-se a esta última o mês de novembro. As distribuições Log-Logística e Log-Logística Exponenciada foram as mais adequadas para modelar a evapotranspiração. A partir dessas distribuições, foram estimados valores de evapotranspiração para diferentes níveis de probabilidade, sendo janeiro o mês com maior demanda hídrica provável. Palavras-chave: transpiração, evaporação, demanda hídrica, distribuição log-logística, irrigação. SANTIAGO, E. J. P.; GOMES-SILVA, F.; SILVA, A. S. A.; CANTALICE, J. R. B.; CUNHA FILHO, M.; AGUIAR, J. D. A. ADJUSTMENT OF PROBABILISTIC MODELS TO THE REFERENCE EVAPOTRANSPIRATION IN THE SUB-MEDIUM OF SÃO FRANCISCO RIVER VALLEY 2 ABSTRACT Evapotranspiration is the process of water loss from soil and plant surfaces, and it is essential for plant production, constituting one of the main agrometeorological variables. Nevertheless, there are few studies that relate the adequacy of probability distributions to evapotranspiration data. The objective of this work was to test the adherence of different probability distributions to reference evapotranspiration data by selecting the most suitable ones for this purpose. This study was carried out with daily evapotranspiration reference data obtained by the meteorological stations of the Federal University of Vale of São Francisco (UNIVASF) in Petrolina, PE and Juazeiro, BA. The Gamma, Weibull, Log-Normal, Beta, Exponential, Log-Logistics and Exponentiated Log-Logistics distribution were adjusted. The highest p-values ​​were obtained for the Log-Logistics and Exponentiated Log-Logistics distributions. The highest p-values were obtained for the Log-Logistics and Exponentiated Log-Logistics distributions, possibly due to the slight positive asymmetry of those to the evapotranspiration data. By testing the likelihood ratio, the Exponentiated Log-Logistics distribution was more suitable for the months of January, August and December in Juazeiro and Petrolina, adding to the latter the month of November. The Log-Logistics and Exponentiated Log-Logistics distributions were the most suitable to model evapotranspiration. From these distributions, evapotranspiration values ​​were estimated for different levels of probability, with January being the month with the highest probable water demand. Keywords: transpiration, evaporation, water demand, log-logistics distribution, irrigation.

Abstract: In Karang Tengah Hamlet, Karangwidoro Village, Dau District, Malang Regency, there is a dry cake business which is usually busy before Eid which was founded in 2013 and is marketed through neighbors and friends of the owner. Because in this village there are many residents from outside the area who are boarding houses, the author carried out a service, namely strengthening the WhatsApp Group network through boarding residents. This is done to expand the pastry marketing network, which can provide benefits to both parties. The seller can expand the marketing network and the boarding party can get additional income without having to make and package the product. The methods used are socialization, direct practice and evaluation. After one month, the results showed that cake marketing was increasingly spread to other areas and sales turnover increased.Keywords: Business Networking; WhatsApp Group; Marketing.Abstrak: Di Dusun Karang Tengah Desa Karangwidoro Kecamatan Dau Kabupaten Malang terdapat usaha kue kering yang biasanya ramai menjelang lebaran yang berdiri sejak tahun 2013 yang dipasarkan melalui tetangga maupun teman-teman pemilik. Karena di desa tersebut banyak terdapat warga dari luar daerah yang indekost, maka penulis melakukan pengabdian yaitu penguatan jaringan Grup WhatsApp melalui warga yang indekost tersebut. Hal ini dilakukan untuk memperluas jaringan pemasaran kue kering, yang dapat memberikan keuntungan pada kedua belah pihak. Pihak penjual dapat memperluas jaringan pemasaran dan pihak yang indekost mendapatkan penghasilan tambahan tanpa harus membuat dan mengemas produk. Metode yang digunakan yaitu dengan sosialisasi, praktik langsung dan evaluasi. Setelah satu bulan didapatkan hasil bahwa pemasaran kue semakin tersebar ke daerah lain dan omset penjualan meningkat.Kata Kunci: Jejaring Bisnis; Grup WhatsApp; Pemasaran. Andamisari, D. (2021). Penggunaan Status WhatsApp Sebagai Digital Marketing Warga Kecamatan Medan Satria Bekasi Di Era New Normal. LUGAS Jurnal Komunikasi, 5(1), 66–72. https://doi.org/10.31334/lugas.v5i1.1559Anggraini, W. F., Susanto, T., & Ahmad, I. (2022). Sistem Informasi Pemasaran Hasil Kelompok Wanita Tani Desa Sungai Langka Menggunakan Metode Design Sprint. Jurnal Teknologi Dan Sistem Informasi (JTSI), 3(1), 34–40. http://jim.teknokrat.ac.id/index.php/JTSIHasan, M., Dzakiyyah, A., Kumalasari, D. A., Safira, N., & Aini, S. N. (2021). Transformasi Digital UMKM Sektor Kuliner Di Kelurahan Jatinegara, Jakarta Timur. Jurnal Bisnis Dan Kewirausahaan; Vol 17 No 2 (2021): JBK-Jurnal Bisnis Dan Kewirausahaan DO -10.31940/Jbk.V17i2.2529.http://ojs.pnb.ac.id/index.php/JBK/article/view?path=Humaira, L. L., Syamsudin, & Isa, M. (2020). M-Wallet Adoption and SMEs Performance: The Mediating Role of Internal Process Collaboration. Proceedings of the International Conference on Business and Management Research (ICBMR 2020) M-Wallet, 160(Icbmr), 29–35.Julita, J., & Arianty, N. (2018). Pengaruh Komunikasi Dan Lingkungan Kerja Terhadap Kinerja Karyawan Pada PT. Jasa Marga (Persero) TBK Cabang Belmera Medan.Kaplan, A., & Haenlein, M. (2010). Users of the World, Unite! The Challenges and Opportunities of Social Media. Business Horizons, 53, 59–68. https://doi.org/10.1016/j.bushor.2009.09.003Kusuma, D. F., & Sugandi, M. S. (2019). Strategi Pemanfaatan Instagram Sebagai Media Komunikasi Pemasaran Digital Yang Dilakukan Oleh Dino Donuts. Jurnal Manajemen Komunikasi, 3(1), 18. https://doi.org/10.24198/jmk.v3i1.12963Lucas, H., Agarwal, R., Clemons, E., Sawy, O., & Weber, B. (2013). Impactful Research on Transformational Information Technology: An Opportunity to Inform New Audiences. MIS Quarterly, 37, 371–382. https://doi.org/10.25300/MISQ/2013/37.2.03Papadopoulos, T., Baltas, K. N., & Balta, M. E. (2020). The use of digital technologies by small and medium enterprises during COVID-19: Implications for theory and practice. International Journal of Information Management, 55, 102192. https://doi.org/https://doi.org/10.1016/j.ijinfomgt.2020.102192Perumal, I., Krisnan, U., & Halim, N. (2017). Social Media in Food and Beverages Industry: Case of Klang Valley, Malaysia. International Journal of Business and Management, 12, 121. https://doi.org/10.5539/ijbm.v12n6p121Purnomo, S. M., & Isharina, I. K. (2013). Pengaruh Twitter Account@ inibaruhidup sebagai social media terhadap loyalitas merek Nescafe Indonesia. Jurnal Ilmiah …. http://download.garuda.kemdikbud.go.id/article.php?article=188750&val=6467&title=PENGARUH TWITTER ACCOUNT IniBaruHidup SEBAGAI SOCIAL MEDIA TERHADAP LOYALITAS MEREK NESCAF INDONESIARachmadi, T. (2020). The Power of Digital Marketing. In E-book (pp. 6–8). https://www.google.co.id/books/edition/The_Power_Of_Digital_Marketing/RCzyDwAAQBAJ?Ri’aeni, I., Suci, M., Pertiwi, M., & Sugiarti, T. (2019). 9460-Article Text-22291-1-10-20190422.pdf. In Communications (Vol. 1, Issue 1, pp. 1–26). http://journal.unj.ac.id/unj/index.php/communications/article/view/9460/6798Saskia, Caroline. 2023. 15 Medsos Favorit Orang Indonesia, Nomor 1 Bukan Instagram.https://tekno.kompas.com/read/2023/02/14/10300097/15-medsos-favorit-orang-indonesiaVerhoef, P. C., Broekhuizen, T., Bart, Y., Bhattacharya, A., Qi Dong, J., Fabian, N., & Haenlein, M. (2021). Digital transformation: A multidisciplinary reflection and research agenda. Journal of Business Research, 122, 889–901. https://doi.org/https://doi.org/10.1016/j.jbusres.2019.09.022

Sugar beet (Beta vulgaris L.) and canola (Brassica napus L.) are major crops in North Dakota, with sugar beet production primarily in the eastern part of the state in the Red River Valley and canola production across the northern half of the state. Both crops are hosts of sugar beet cyst nematode (SBCN), Heterodera schachtii Schmidt. In April 2011, soil samples were collected from four sugar beet fields belonging to three growers who believed the fields were infested with SBCN. The fields were located in a 65-km2 area in the Yellowstone Valley of western North Dakota. Cysts were extracted by sieving and Heterodera-like cysts with eggs were observed in all four soil samples. Population densities in the four fields ranged from 100 to 1,750 eggs/100 cm3 soil. Sugar beet seedlings (cv. M832224) were grown in a potting mix for 6 weeks in the greenhouse and then transferred to conetainers (type D40; volume 656 ml) containing autoclaved river sand. Conetainers were placed in sand in plastic pots immersed in a water bath at 27°C. Three plants were each infested with 800 eggs from field No. 2. After 55 days of incubation, the average number of females was 115 per plant. A similar experiment was conducted with canola cvs. Hyclass 940, Caliber 30, and Westar, which were inoculated with 500 eggs each from field No. 2. After 53 days of incubation, there was an average of 39, 20, and 30 females for each respective cultivar. Flask-shaped cysts (n = 26) from canola roots were light to dark brown; the vulval cone was ambifinestrate with dark brown, molar-shaped bullae positioned underneath the vulval bridge. Body length (excluding neck) ranged from 600 to 850 μm (mean 701.2 μm); body width, 350 to 580 μm (mean 469.2 μm); and length/width ratio, 1.2 to 1.8 (mean 1.5). Second-stage juvenile (J2) (n = 21) body length ranged from 400 to 485 μm (mean 437.1 μm); stylet length was 25 μm (no variation) with forwardly directed knobs; conical tail with rounded tip ranged from 37.5 to 55.0 μm long (mean 46.6 μm) with hyaline region from 20.0 to 32.5 μm (mean 27.3 μm); and lateral field presented four incisures. These morphometrics were used to identify H. schachtii according to Subbotin et al. (4). Confirmation of identification was by amplification and sequencing of a 28S rDNA gene fragment (1) from individual females (GenBank Accession No. JQ040526), which was 100% identical to H. schachtii 28S rDNA sequence (GenBank Accession No. GU475088). To our knowledge, this is the first confirmed report of H. schachtii in North Dakota. A 1958 report of SBCN in North Dakota (2) was not subsequently confirmed (3). Because there is extensive canola production across the northern part of the state bordering western and eastern sugar beet- production areas, canola may serve as a bridge for movement of SBCN from west to east. SBCN is a potential threat to these two important crops. References: (1) A. Amiri et al. Eur. J. Plant Pathol. 108:497, 2002. (2) F. Caveness. J. Sugar Beet Res. 10:544, 1958. (3) P. Donald and R. Hosford. Plant Dis. 64:45, 1980. (4) S. A. Subbotin et al. Systematics of Cyst Nematodes (Nematoda: Heteroderinae). Nematology Monographs and Perspectives. Vol. 8B. Brill, The Netherlands. 2010.

APLICABILIDADE DO MODELO HIDROLÓGICO SWAT NA BACIA HIDROGRÁFICA DO RIO PARAIBUNA, SP - BRASIL CAIO VINICIUS FERREIRA MARMONTEL¹; TERESA CRISTINA TARLÉ PISSARRA²; MAURÍCIO RANZINI³ E VALDEMIR ANTONIO RODRIGUES4 ¹Departamento de Ciência Florestal, Faculdade de Ciências Agronômicas, Universidade Estadual Paulista “Júlio de Mesquita Filho”, Avenida Universitária, nº 3780, Altos do Paraíso, CEP 18610-034,Botucatu-SP, Brasil, caioomarmontel@gmail.com ²Departamento de Engenharia Rural, Faculdade de Ciências Agrárias e Veterinárias, Universidade Estadual Paulista “Júlio de Mesquita Filho”, Via de Acesso Profº. Paulo Donato Castellane s/n, Altos do Paraíso, CEP 18610-034, Jaboticabal-SP, Brasil, teresap1204@gmail.com ³Seção de Engenharia Florestal, Divisão de Dasonomia, Instituto Florestal do Estado de São Paulo, Rua do Horto, 931, Altos do Paraíso, CEP 18610-034, São Paulo-SP, Brasil, ranzini@gmail.com 4Departamento de Ciência Florestal, Faculdade de Ciências Agronômicas, Universidade Estadual Paulista “Júlio de Mesquita Filho”, Avenida Universitária, nº 3780, Altos do Paraíso, CEP 18610-034, Botucatu-SP, Brasil, valdemirrodrigues@fca.unesp.br 1 RESUMO A água disponível para o consumo humano vem se tornando cada vez mais escassa. Diante desse problema, uma possibilidade de melhorar a compreensão do comportamento hidrológico, é a utilização de tecnologias, em especial a integração do SIG com a modelagem hidrológica. O presente estudo teve como objetivo testar a aplicabilidade do modelo hidrológico SWAT para estimação de vazões em um trecho da bacia hidrográfica do rio Paraibuna - Vale do Paraíba, região da Mata Atlântica, um dos formadores do rio Paraíba do Sul. Os dados climáticos e fluviométricos foram coletados com uma série histórica de 22 anos. Na calibração e validação verificou-se boa aderência entre os dados simulados e observados, ou seja, os valores simulados reconheceram os picos e recessões dos valores observados. Os índices estatísticos (NS, PBIAS, RSR e R²) calculados foram qualificados como “muito bom” para a estimação das vazões. Os resultados confirmaram a aplicabilidade do modelo, dessa forma, pode servir como ferramenta para planejamento e gestão de políticas públicas dos recursos hídricos em bacias hidrográficas, na região da Mata Atlântica. O modelo hidrológico SWAT mostrou-se muito bom e apto para estimação de vazões e do balanço hídrico na área de estudo. Palavras-chave: água, calibração, mata atlântica, validação, vazão MARMONTEL, C. V. F.; PISSARRA, T. C. T.; RANZINI, M. E RODRIGUES, V. A. APPLICABILITY OF THE SWAT HYDROLOGICAL MODEL IN PARAIBUNA RIVER BASIN, SP – BRAZIL 2 ABSTRACT The water available for human consumption is becoming increasingly scarce. Faced with this problem, one possibility to improve the understanding of water behavior, is the use of technologies, particularly the integration of GIS with hydrological modeling. The present study is intended to test the applicability of SWAT hydrological model for flow estimation in the stretch of Paraibuna river basin - Paraiba Valley, in the Atlantic Forest region, in the state of São Paulo, one of the tributaries of Paraíba do Sul river. Climatic and fluviometric data were collected with a historical series of 22 years. In the calibration and validation, good adherence was observed across simulated and observed data, that is, the simulated values recognized the peaks and recessions of the observed values. The statistical indices (NS, PBIAS, RSR and R²) calculated were qualified as "very good" for the estimation of flows. The results confirmed the applicability of the model, so it can serve as a tool for planning and management of water resources public policies in watersheds, in the Atlantic Forest region. The SWAT hydrological model was very good and suitable for estimation of flow and water balance in the stretch of the Paraibuna river basin. Keywords: water, calibration, forest hydrology, atlantic forest, validation, discharge

Michael B. Katz. Reconstructing American Education. Cambridge and London: Harvard University Press, 1987. Pp. viii, 212. Cloth, $22.50; E. D. Hirsch, Jr. Cultural Literacy: What Every American Needs to Know. Boston: Houghton Mifflin Co., 1987. Pp. xvii, 251. Cloth, $16.45; Diana Ravitch and Chester E. Finn, Jr. What Do Our 17-Year-Olds Know? A Report on the First National Assessment of History and Literature. New York: Harper & Row, 1987. Pp. ix, 293. Cloth, $15.95. Review by Richard A. Diem of The University of Texas at San Antonio. Henry J. Steffens and Mary Jane Dickerson. Writer's Guide: History. Lexington, Massachusetts, and Toronto: D. C. Heath and Company, 1987. Pp. x, 211. Paper, $6.95. Review by William G. Wraga of Bernards Township Public Schools, Basking Ridge, New Jersey. J. Kelley Sowards, ed. Makers of the Western Tradition: Portraits from History. New York: St. Martin's Press, 1987. Fourth edition. Vol: 1: Pp. ix, 306. Paper, $12.70. Vol. 2: Pp. ix, 325. Paper, $12.70. Review by Robert B. Luehrs of Fort Hays State University. John L. Beatty and Oliver A. Johnson, eds. Heritage of Western Civilization. Englewood Cliffs, New Jersey: Prentice-Hall, Inc., 1987. Sixth Edition. Volume I: Pp. xi, 465. Paper, $16.00; Volume II: pp. xi, 404. Paper, $16.00. Review by Dav Levinson of Thayer Academy, Braintree, Massachusetts. Lynn H. Nelson, ed. The Human Perspective: Readings in World Civilization. New York: Harcourt Brace Jovanovich, 1987. Vol. I: The Ancient World to the Early Modern Era. Pp. viii, 328. Paper, $10.50. Vol. II: The Modern World Through the Twentieth Century. Pp, x, 386. Paper, 10.50. Review by Gerald H. Davis of Georgia State University. Gerald N. Grob and George Attan Billias, eds. Interpretations of American History: Patterns and Perspectives. New York: The Free Press, 1987. Fifth Edition. Volume I: Pp. xi, 499. Paper, $20.00: Volume II: Pp. ix, 502. Paper, $20.00. Review by Larry Madaras of Howard Community College. Eugene Kuzirian and Larry Madaras, eds. Taking Sides: Clashing Views on Controversial Issues in American History. -- Volume II: Reconstruction to the Present. Guilford, Connecticut: The Dushkin Publishing Groups, Inc., 1987. Pp. xii, 384. Paper, $9.50. Review by James F. Adomanis of Anne Arundel County Public Schools, Annapolis, Maryland. Joann P. Krieg, ed. To Know the Place: Teaching Local History. Hempstead, New York: Hofstra University Long Island Studies Institute, 1986. Pp. 30. Paper, $4.95. Review by Marilyn E. Weigold of Pace University. Roger Lane. Roots of Violence in Black Philadelphia, 1860-1900. Cambridge, Massachusetts, and London: Harvard University Press, 1986. Pp. 213. Cloth, $25.00. Review by Ronald E. Butchart of SUNY College at Cortland. Pete Daniel. Breaking the Land: The Transformation of Cotton, Tobacco, and Rice Cultures since 1880. Urbana and Chicago: University of Illinois Press, 1985. Pp. xvi, 352. Paper, $22.50. Review by Thomas S. Isern of Emporia State University. Norman L. Rosenberg and Emily S. Rosenberg. In Our Times: America Since World War II. Englewood Cliffs, New Jersey: Prentice-Hall, 1987. Third edition. Pp. xi, 316. Paper, $20.00; William H. Chafe and Harvard Sitkoff, eds. A History of Our Time: Readings on Postwar America. New York: Oxford University Press, 1987. Second edition. Pp. xiii, 453. Paper, $12.95. Review by Monroe Billington of New Mexico State University. Frank W. Porter III, ed. Strategies for Survival: American Indians in the Eastern United States. New York, Westport, Connecticut, and London: Greenwood Press, 1986. Pp. xvi, 232. Cloth, $35.00. Review by Richard Robertson of St. Charles County Community College. Kevin Sharpe, ed. Faction & Parliament: Essays on Early Stuart History. London and New York: Methuen, 1985. Pp. xvii, 292. Paper, $13.95; Derek Hirst. Authority and Conflict: England, 1603-1658. Cambridge: Harvard University Press, 1986. Pp. viii, 390. Cloth, $35.00. Review by K. Gird Romer of Kennesaw College. N. F. R. Crafts. British Economic Growth During the Industrial Revolution. New York: Oxford University Press, 1985. Pp. 193. Paper, $11.95; Maxine Berg. The Age of Manufactures, 1700-1820. New York: Oxford University Press, 1985. Pp. 378. Paper, $10.95. Review by C. Ashley Ellefson of SUNY College at Cortland. J. M. Thompson. The French Revolution. New York: Basil Blackwell, 1985 reissue. Pp. xvi, 544. Cloth, $45.00; Paper, $12.95. Review by W. Benjamin Kennedy of West Georgia College. J. P. T. Bury. France, 1814-1940. London and New York: Methuen, 1985. Fifth edition. Pp. viii, 288. Paper, $13.95; Roger Magraw. France, 1815-1914: The Bourgeois Century. New York and Oxford: Oxford University Press, 1985. Pp. 375. Cloth, $24.95; Paper, $9.95; D. M.G. Sutherland. France, 1789-1815: Revolution and Counterrevolution. New York and Oxford: Oxford University Press, 1986. Pp. 242. Cloth, $32.50; Paper, $12.95. Review by Fred R. van Hartesveldt of Fort Valley State College. Woodford McClellan. Russia: A History of the Soviet Period. Englewood Cliffs, New Jersey: Prentice-Hall, 1986. Pp. xi, 387. Paper, $23.95. Review by Pasquale E. Micciche of Fitchburg State College. Ranbir Vohra. China's Path to Modernization: A Historical Review from 1800 to the Present. Englewood Cliffs, New Jersey: Prentice-Hall, 1987. Pp. xiii, 302. Paper, $22.95. Reivew by Steven A. Leibo of Russell Sage College. John King Fairbank. China Watch. Cambridge and London: Harvard University Press, 1987. Pp. viii, Cloth, $20.00. Review by Darlene E. Fisher of New Trier Township High School, Winnetka, Illinois. Ronald Takaki, ed. From Different Shores: Perspectives on Race and Ethnicity in America. New York and Oxford: Oxford University Press, 1987. Pp. 253. Paper, $13.95. Review by Robert C. Sims of Boise State University.

This study aim to attempt mapping out the Land Use or Land Cover (LULC) status of Regional Project Coordination Committee (RPCC) between 2009-2019 with a view of detecting the land consumption rate and the changes that has taken place using RS and GIS techniques; serving as a precursor to the further study on urban induced variations or change in weather pattern of the cityn Rangpur City Corporation(RCC) is the main administrative functional area for both of Rangpur City and Rangpur division and experiencing a rapid changes in the field of urban sprawl, cultural and physical landscape,city growth. These agents of Land use or Land cover (LULC) varieties are responsible for multi-dimensional problems such as traffic congestion, waterlogging, and solid waste disposal, loss of agricultural land. In this regard, this study fulfills LULC changes by using Geographical Information Systems (GIS) and Remote Sensing (RS) as well as field survey was conducted for the measurement of change detection. The sources of data were Landsat 7 ETM and landsat 8 OLI/TIRS of both C1 level 1. Then after correcting the data, geometrically and radiometrically change detection and combined classification (supervised & unsupervised) were used. The study finds LULC changes built-up area, water source, agricultural land, bare soil in a change of percentage is 17.23, 2.58, -9.94, -10.19 respectively between 2009 and 2019. Among these changes, bare soil is changed to a great extent, which indicates the expansion of urban areas is utilizing the land to a proper extent. Keywords: Urban expansion; land use; land cover; remote sensing; geographic information system (GIS); Rangpur City Corporation(RCC). References Al Rifat, S. A., & Liu, W. (2019). Quantifying spatiotemporal patterns and major explanatory factors of urban expansion in miami metropolitan area during 1992-2016. Remote Sensing, 11(21) doi:10.3390/rs11212493 Arimoro AO, Fagbeja MA, Eedy W. (2002). The Need and Use of Geographic Information Systems for Environmental Impact Assessment in Africa: With Example from Ten Years Experience in Nigeria. AJEAM/RAGEE, 4(2), 16-27. Belal, A.A. and Moghanm, F.S. (2011).Detecting Urban Growth Using Remote Sensing and GIS Techniques in Al Gharbiya Governorate, Egypt.The Egyptian Journal of Remote Sensing and Space Science, 14, 73-79. http://dx.doi.org/10.1016/j.ejrs.2011.09.001 Dewan, A.M. and Yamaguchi, Y. (2009). Using Remote Sensing and GIS to Detect and Monitor and Use and Land Cover Change in Dhaka Metropolitan of Bangladesh during 1960-2005. Environmental Monitor Assessment, 150, 237- 249. Retrieved from http://dx.doi.org/10.1007/s10661-008-0226-5 Djimadoumngar, K.-N., & Adegoke, J. (2018). Satellite-Based Assessment of Land Use and Land Cover (LULC) Changes around Lake Fitri, Republic of Chad. Journal of Sustainable Development, 11(5), 71. doi:10.5539/jsd.v11n5p71 Edwards, B., Frasch, T., & Jeyacheya, J. (2019). Evaluating the effectiveness of land-use zoning for the protection of built heritage in the bagan archaeological zone, Myanmar—A satellite remote-sensing approach. Land use Policy, 88 doi:10.1016/j.landusepol.2019.104174 Fallati, L., Savini, A., Sterlacchini, S., & Galli, P. (2017). Land use and land cover (LULC) of the Republic of the Maldives: first national map and LULC change analysis using remote-sensing data. Environmental Monitoring and Assessment, 189(8). doi:10.1007/s10661-017-6120-2 Fučík, P., Novák, P., & Žížala, D. (2014). A combined statistical approach for evaluation of the effects of land use, agricultural and urban activities on stream water chemistry in small tile-drained catchments of south bohemia, czech republic. Environmental Earth Sciences, 72(6), 2195-2216. doi:10.1007/s12665-014-3131-y Elbeih, S. F., & El-Zeiny, A. M. (2018). Qualitative assessment of groundwater quality based on land use spectral retrieved indices: Case study sohag governorate, egypt. Remote Sensing Applications: Society and Environment, 10, 82-92. doi:10.1016/j.rsase.2018.03.001 Fasal, S. (2000). Urban expansion and loss of agricultural land – A GIS based study of Saharanpur City, India. Environment and Urbanization, 12(2), 133 – 149 He, S., Wang, X., Dong, J., Wei, B., Duan, H., Jiao, J., & Xie, Y. (2019). Three-dimensional urban expansion analysis of valley-type cities: A case study of chengguan district, lanzhou, china. Sustainability (Switzerland), 11(20) doi:10.3390/su11205663 Heimlich, R.E and W.D. Anderson. (2001). Development at the Urban Fringe and Beyond: Impacts on Agriculture and Rural Land. 803, Economic Research Service, U.S. Department of Agriculture, Washington D.C., pg 80 Im, N., Kawamura, K., Suwandana, E., & Sakuno, Y. (2014). Monitoring land use and land cover effects on water quality in cheung ek lake using ASTER images. American Journal of Environmental Sciences, 11(1), 1-12. doi:10.3844/ajessp.2015.1.12 Kalnay, E., & Cai, M. (2003). Impact of urbanization and land-use change on climate. Nature, 423(6939), 528-531. doi:10.1038/nature01675 Matlhodi, B., Kenabatho, P. K., Parida, B. P., & Maphanyane, J. G. (2019). Evaluating land use and land cover change in the gaborone dam catchment, botswana, from 1984-2015 using GIS and remote sensing. Sustainability (Switzerland), 11(19) doi:10.3390/su11195174 Uddin, M. M. M. (2015). Causal relationship between agriculture, industry and services sector for GDP growth in Bangladesh: An econometric investigation. Journal of Poverty, Investment and Development, 8. Mondal, I., Srivastava, V. K., Roy, P. S., & Talukdar, G. (2014). Using logit model to identify the drivers of landuse landcover change in the lower gangetic basin, india. Paper presented at the International Archives of the Photogrammetry, Remote Sensing and Spatial Information Sciences - ISPRS Archives, , XL-8(1) 853-859. doi:10.5194/isprsarchives-XL-8-853-2014 Navale, V. B., & Mhaske, S. Y. (2019). Land use/land cover changes in sangamner city by using remote sensing and GIS. International Journal of Recent Technology and Engineering, 8(2), 4614-4621. doi:10.35940/ijrte.B3386.078219 Nicolson, L.D. (1987). The Greening of the cities; Routledge and Kegan Paul, London Nong, D., Fox, J., Miura, T., & Saksena, S. (2015). Built-up Area Change Analysis in Hanoi Using Support Vector Machine Classification of Landsat Multi-Temporal Image Stacks and Population Data. Land, 4(4), 1213–1231. doi:10.3390/land4041213 Park, H., Fan, P., John, R., Ouyang, Z., & Chen, J. (2019). Spatiotemporal changes of informal settlements: Ger districts in ulaanbaatar, mongolia. Landscape and Urban Planning, 191 doi:10.1016/j.landurbplan.2019.103630 Rajeshwari D. (2006). Management of the Urban Environment Using Remote Sensing and Geographic Information Systems.J. Hum. Ecol., 20(4), 269-277. Retrieved from http://www.krepublishers.com/02_journals/JHE/ Rasul, A., Balzter, H., Ibrahim, G., Hameed, H., Wheeler, J., Adamu, B., … Najmaddin, P. (2018). Applying Built-Up and Bare-Soil Indices from Landsat 8 to Cities in Dry Climates. Land, 7(3), 81. doi:10.3390/land7030081 Risma, Zubair, H., & Paharuddin. (2019). Prediction of land use and land cover (LULC) changes using CA-Markov model in Mamuju Subdistrict. Journal of Physics: Conference Series, 1341, 082033. doi:10.1088/1742-6596/1341/8/082033 Schilling, K. E., Jha, M. K., Zhang, Y.-K., Gassman, P. W., & Wolter, C. F. (2008). Impact of land use and land cover change on the water balance of a large agricultural watershed: Historical effects and future directions. Water Resources Research, 44(7). doi:10.1029/2007wr006644 Copyright (c) 2019 Geosfera Indonesia Journal and Department of Geography Education, University of Jember This work is licensed under a Creative Commons Attribution-Share A like 4.0 International License

RESUMEN La bahía de Cádiz, donde desemboca el río Guadalete, en el suroeste de la península ibérica, es un espacio privilegiado para estudiar los cambios antrópicos y naturales a lo largo del tiempo, gracias a diversos procesos de transformación y una rica cartografía histórica. El Guadalete era navegable desde época romana, formando un amplio estuario que se fue colmatando paulatinamente. Para época medieval la documentación archivística testimonia la dificultad que tenían los barcos ligeros para remontar el río y alcanzar el puerto fluvial de El Portal, emplazamiento clave para la comercialización de vinos de Jerez de la Frontera. En este artículo modelamos el paisaje de la cuenca baja del Guadalete, analizando los procesos que influencian su cegamiento. Para ello, recurrimos a la creación de un modelo digital del terreno a partir de datos LiDAR (light detection and ranging). Proponemos un método para la restitución de la topografía en un momento histórico determinado, el uso de cartografía histórica para establecer la deriva del cauce del río y un análisis de los condicionantes naturales (geología, hidrología, mareas, eventos catastróficos) y antrópicos (molinos, salinas, lastre de los barcos) que condicionaron la navegabilidad. Palabras clave: navegación fluvial, SIG, LiDAR, modelado del paisajeTopónimos: río Guadalete, bahía de CádizPeriodo: siglos xv-xviii ABSTRACTThe Bay of Cadiz, where the Guadalete River flows into the southwest of the Iberian Peninsula, is a privileged area for studying anthropic and natural changes over time, thanks to various transformation processes and its rich historical cartography. The river was navigable from Roman times, forming a wide estuary that gradually silted up. In medieval times, archival documentation attests to the difficulty of crossing the river with light boats to reach El Portal Port, for the commercialization of Jerez de la Frontera wines. In this article, we model the landscape of the lower basin of the Guadalete, analysing the processes that influence its clogging. To do so, we resort to the creation of a Digital Terrain Model from LiDAR data. We propose a method for the restitution of the topography at a given historical moment, the use of historical cartography to establish the drift of the riverbed and an analysis of the natural (geology, hydrology, tides, catastrophic events) and anthropic (mills, salt works, ship ballast) factors that conditioned its navigability. Keywords: fluvial navigation, GIS, LiDAR, landscape modelling Place names: Guadalete River, Bay of CadizPeriod: 15th-18th centuries REFERENCIASAlonso Villalobos, C., Gracia Prieto, J., Rodríguez Polo, S., Martín Puertas, C. M. (2015): “El registro de eventos energéticos marinos en la bahía de Cádiz durante épocas históricas”. Cuaternario y geomorfología (2015), 29 (1-2), 95-117.Alonso, C., Gracia, F.J. y Rodríguez, S. (2014): “Modelo de evolución histórica de la flecha-barrera de Valdelagrana (bahía de Cádiz)”, XIII Reunión Nacional de Geomorfología, 584-587.Alonso, C., Gracia, F.J., y Benavente, J. (2009): “Evolución histórica de la línea de costa en el sector meridional de la bahía de Cádiz”, Revista Atlántica-Mediterránea de Prehistoria y Arqueología Social, 11, pp.13-37. Álvarez Rogel, Y., y Conesa García, C. (2018): “Georreferenciación de documentos cartográficos históricos para el análisis del trazado fluvial del bajo Segura, Vega Media (Murcia, España)”, Geofocus: revista internacional de ciencia y tecnología de la información geográfica, 21, 101-118.Arteaga O. y Schuldz, H.D. (2008): “Geoarqueología y proceso histórico en la bahía de Cádiz”. Revista de Prehistoria y Arqueología de la Universidad de Sevilla 10, 7-20.Astilleros, J.M. (2015): “Río Guadalete”, en J.M. Fernández-Palacios (dir.), Río Guadalete, Editado por la Consejería de Medioambiente y Ordenación del Territorio, Junta de Andalucía. Sevilla, 116-136.Aycart Luengo, J. (2015): “Hidrología de la cuenca del Guadalete”. en J.M. Fernández-Palacios (dir.), Río Guadalete, Editado por la Consejería de Medioambiente y Ordenación del Territorio, Junta de Andalucía, Sevilla.Borja F. y Díaz, F. (1994): “Paleogeografía posflandriense del litoral de Cádiz. Transformación protohistórica del paisaje de Doña Blanca”, en E. Roselló y A. Morales (Eds.), Castillo de Doña Blanca. Archaeo-environmental investigations in the Bay of Cádiz, Spain (750-500 B.C.), BAR International Series 593, Oxford, 185-200. Caballero Sánchez, M. (2008): “Las vistas de El Puerto de Santa María en 1567 de Antón Van den Wyngaerdepautas interpretativas y análisis de contenidos”, Revista de historia de El Puerto, 41, 109-147.Caporizzo, C, Gracia, F.J. y Aucelli, P.P.C., et alii (2021): “Late-Holocene evolution of the Northern Bay of Cádiz from geomorphological, stratigraphic and archaeological data”, Quaternary International, 602, pp. 92-109.Casarotto, A., Stek, T., Pelgrom, J., van Otterloo, R.H. y Sevink, J. (2018): “Assessing visibility and geomorphological biases in regional field surveys: The case of Roman Aesernia”, Geoarchaeology, 33(2), 177-192.Cascón Katchadourian, J. y Alberich Pascual, J. (2021): La geoerreferenciación de cartografía antigua en los sistemas de información geográficos (SIG): Revisión, análisis y estudio comparativo de softwares de georreferenciación. Revista General de Información y Documentación, 31.Catalán González, F. (2021): “El paisaje socio-natural de la bahía de Cádiz: análisis histórico de su formación”, Tesis Doctoral, Universidad de Cádiz, pp. 375.Cerrillo Cuenca, E. (2017): “An approach to the automatic surveying of prehistoric barrows through LiDAR”, Quaternary International, 435, 135-145.Chic, G. (2004): “La ordenación territorial en la bahía de Cádiz durante el Alto Imperio romano”, Revista de Historia de El Puerto, 33, 11-50. Chica, A. (2011): “Aproximación a los paisajes de la bahía de Cádiz”, El paisaje rural en Andalucía Occidental durante los siglos bajomedievales: actas de las I Jornadas Internacionales sobre Paisajes Rurales en Época Medieval, Cádiz, 1 y 2 de abril de 2009. Servicio de Publicaciones de la Universidad de Cádiz, pp. 17-30.Clemente Carrillo, M., (2015): Proceso de construcción de la carabela Niña, Proyecto fin de carrera Universidad Politécnica de Cartagena. Costa García, J.M., Casal García, R., (2015): Fotografía aérea histórica, satelital moderna y lidar aéreo en algunos recintos militares romanos de Castilla y León. Portvgalia, Nova Série,36, 143-158.Dávila, F. (1648): Discurso demostrable en desengaño de las causas que dieron motiuo, a abrir la comunicacion de el Salado al rio Guadalete: estado del suceso euidencias de lo conueniente segun el parecer del Gouernador Don Francisco Dauila y Lugo, que le dio a pedimento de la ... ciudad de Xerez de la Frontera y en virtud de auto del Señor Don Pedro Fernandez de Contreras y Miñano ... para que su Magestad y su Conseio Supremo de Castilla sean informados en este caso con certeza, Consultado en http://buslab.us.es/pdfs/A10913716.pdf, el 15/04/2018. Fernández-Palacios, J.M (dir.), (2015): Río Guadalete, Editado por la Consejería de Medioambiente y Ordenación del Territorio, Junta de Andalucía. Sevilla.Fernández, J. y Gutiérrez, G. (2016): “Improving archaeological prospection using localized UAVs assisted photogrammetry: An example from the Roman Gold District of the Eria River Valley (NW Spain)”, Journal of Archaeological Science: Reports, 5, 509-520. García, J., García, C.M, y Álvarez, O. (2008): “Vegetación de las marismas de Aletas-Cetina (Puerto Real). Identificación de hábitats de interés comunitario y estimaciones preliminares de posibles efectos de su inundación”, Revista de la Sociedad Gaditana de Historia Natural, 5, 11-37.Gómez, C., et alii (1997): “Primeras fases de la evolución de la flecha litoral de Valdelagrana (El Puerto de Santa María, Cádiz). Datos arqueológicos”, Cuaternario ibérico, J. Rodríguez Vidal (Ed.) AEQUA,165-167. González del Tánago, M., Román, M., García de Jalón, D. y Mayoral, C. (2010): Evolución del territorio fluvial del río Guadalete y propuestas para la mejora de su funcionamiento hidro-morfológico, Fundación Conde del Valle de Salazar, Madrid.Gracia, F.J., Gutiérrez, J.M., Domínguez, S., Alonso, C., y Sánchez, A. (2016): “Evolución de la bahía de Cádiz en el transcurso de los tiempos geológicos. Celebración Geológica del Bicentenario de 1812”, Cuaderno de campo Geología 12 Cádiz, pp. 1-21. Gutiérrez, J.M., Domínguez, S., Algarra, A.M. y Moral, J.P. (1991): Introducción a la geología de la provincia de Cádiz. Servicio de Publicaciones de la Universidad de Cádiz. Hermon, E. y Watelet, A. (1991): (dir.), Riparia, un patrimoine culturel. La gestión intégrée des bords de l’eau. Actes de l’atelier Savoirs et pratiques de gestion intégrée des bords de l’eau, Oxford, 2012.Kirchner, H. y Virgili, A. (2021): Islas fluviales en el Bajo Ebro en época medieval (siglos xii y xiii)”, Anales de la Universidad de Alicante. Historia Medieval, 22, 27-55.Lagóstena Barrios, L. (2013): “Riparia: conceptualización histórica, función territorial y aprovechamientos de los humedales en la Bética Romana”, en L. Borau, A. Borlenghi. Aquae Ductus: actualité de la recherche en France et en Espagne. Actes du coloque international de Toulouse, Bordeaux: Aquitania, 33.Lallias-Tacon, S., Liébault, F., Piégay, H. (2016): “Use of airborne LiDAR and historical aerial photos for characterising the history of braided river floodplain morphology and vegetation responses”, Catena, Volume 149, 742- 759, ISSN 0341-8162.Llave, E., Hernández, F.J., Alonso, C., Gallardo, M., Vázquez, J.T. y López, F. (1999): “Caracterización y evolución del paleocauce del río Guadalete en la bahía de Cádiz durante el Cuaternario terminal”, Geogaceta, 26, 43-46. López López, A., Cerrillo Cuenca, E., (2016): “Arqueología aérea y fuentes de datos libres. Posibilidades y límites”. Revista Otarq: otras arqueologías, 1: 181-193.Lomas Salmonte, F.J., Sánchez Saus, R., Bustos Rodríguez, et alii (2005): Historia de Cádiz, Sílex Ediciones, Madrid.Márquez, L., Alonso, L., y Benítez, D. (2016): “El patrimonio cultural marítimo de la bahía de Cádiz según la visión de un hidrógrafo de Napoleón: El vicealmirante Rosily”, Revista de Historia de El Puerto, (56), 31-60. Martín Gutiérrez, E. (2012): “En los bosques andaluces: los carboneros a finales de la Edad Media”, Mundos medievales: espacios, sociedades y poder: homenaje al profesor José Ángel García de Cortázar y Ruiz de Aguirre, Vol. 2, 1561-1572.— (2015): Paisajes, ganadería y medioambiente en las comarcas gaditanas. Siglos xiii al xvi, Cádiz, Universidad de Cádiz-Universidad de Extremadura.— (2018): “Entre la costa y la sierra gaditanas. De los paisajes rurales a la interacción sociedad- medioambiente en el siglo xv”, Arqueología y Territorio Medieval 25, 227-259.— (2019): “Los paisajes costeros interpretados desde la riparia. Reflexiones sobre el Golfo de Cádiz a finale de la Edad Media”, Riparia, 2, 47-79.Martín Gutiérrez, E. y Ruiz Pilares (2019): El viñedo en Jerez durante el siglo xv: un mercado de trabajo en torno al vino, Peripecias Libros, Jerez de la Frontera. Ménanteau, L. (2015): “L’influence des facteurs naturels et anthropiques sur l’évolution des ports de Basse Andalousie (xiiie- xvie siècles): études de cas (Palos de la Frontera, Séville et Sanlúcar de Barrameda”. En Bochaca, M. y Sarrazin, J.L. (Eds), Ports et littoraux de l’Europe atlantique. Transformations naturelles et aménagements humains (XIVe-XVIe siècles), Rennes: Presses Universitaires, 167-187.Miraglia, M. (2016): “Aplicaciones de la cartografía histórica y las tecnologías de la información geográfica en la historia ambiental”, Revista de Histórica Regional, 24, 1, 24-41.Monterroso, A., (2019): “Geoarchaeological Characterisation of Sites of Iberian and Roman Cordoba Using LiDAR Data Acquisitions”, Geosciences, 9(5), 205, 1-17.Nuninger, L., Fruchart, C. y Opitz, R. (2010): “LiDAR: quel apport pour l’analyse des paysages?”, Bulletin AGER, 34-43. Olivella Puig, J. (1994): Teoría del buque. Flotabilidad y estabilidad, Ediciones UPC, Barcelona. Ortega Calderón, I. y Olmedo Granados, F. (2015): “La navegación en el bajo Guadalete y un proyecto inédito de 1888”. Río Guadalete, Editado por la Consejería de Medioambiente y Ordenación del Territorio, Junta de Andalucía, 163-174Pérez Fernández, E. (2018): “Las intervenciones antrópicas en el curso bajo del Guadalete y en San Pedro durante la Edad Moderna”, Riparia 4, 146-190.Remesal, J. (2011): La bética en el concierto del Imperio romano: discurso, leído el día 13 de marzo de 2011 en el acto de recepción pública; y contestación por José María Blázquez Martínez, Real Academia de la Historia. Romero Medina, R. (2016): “Documentos inéditos para el estudio de la temprana Edad Moderna en El Puerto de Santa María (1515-1525)”, en A. Aguayo Cobo (dir.), El legado de Jano: actas de las I Jornadas de Historia: conmemoración del 50 aniversario del fallecimiento de don Hipólito Sancho, pp. 155-175. Ruiz Gil, J.A., Lagóstena Barrios, L., Pérez Marrero, et alii (2019): “Villae y Figlinae a orillas del Lacus Ligustinus. Análisis GIS y prospección geofísica en el territorium ribereño de Hasta Regia”, en J. Remesal Rodríguez, et alii. (eds.), Paisajes productivos y redes comerciales en el Imperio romano, Instrumenta 65, 115-138.Ruiz Pilares, E. J. (2013-2014): “La política viaria municipal a finales de la Edad Media (1430-1530): el caso de Jerez de la Frontera”; Norba: revista de Historia, 25-26, 207-226. — (2017): El poder en el concejo de Jerez de la Frontera durante el reinado de los Reyes Católicos: espacios, ámbitos y recursos, Tesis doctoral inédita, Universidad de Cádiz: Cádiz. — (2018): “El paisaje pesquero de Jerez de la Frontera a finales de la Edad Media: caladero, flota, distribución y consumo”, Historia. Instituciones. Documentos, 45, 377-405. — (2019): “El paisaje portuario en la bahía de Cádiz a finales de la Edad Media: los muelles fluviales”, Riparia, Suplemento 2, pp. 173-210. — (2020): “Las relaciones comerciales entre Canarias y la bahía de Cádiz tras la conquista castellana (1496-1520). Una aproximación a partir de la documentación notarial jerezana”, en G. Rodríguez, V. Muñoz y L. Carbó. (eds.), Fronteras atlánticas de la Edad Media a la contemporaneidad: experiencias, narraciones y representaciones desde Europa y América, págs. 131-158.Said, H. (2019): “Demarcación hidrográfica de las cuencas mediterráneas andaluzas y demarcación hidrográfica del Guadalete-Barbate”, Consejería de medioambiente y Ordenación del Territorio. Dirección General de Infraestructuras y Explotación del Agua. Junta de Andalucía, 1-35. Trapero Fernández, P. (2019): “Conectividad en el estuario del Guadalquivir entre Turris Caepionis y Nabrissa Venera. Aprovechamientos económicos, comunicaciones, embarcaderos y zonas navegables. Economía de los humedales”. Prácticas sostenibles y aprovechamientos históricos. Colección Instrumenta, Universidad de Barcelona, pp. 179-195.Van der Meulen, B., Cohen, K.M., Pierik, H.J., Zinsmeister, J.J., Middelkoop, H. (2020): “LiDAR-derived high-resolution palaeo-DEM construction workflow and application to the early medieval Lower Rhine valley and upper delta”, Geomorphology, Volume 370, 1-18.Vidal y Domínguez, F. (1888): Proyecto para mejorar la navegación del río Guadalete. Zurita, F., Lara, M.M., San Martín, M., et alii. (2014): Localización de zonas idóneas para el desarrollo de la acuicultura marina en Andalucía, Junta de Andalucía, Consejería de Agricultura, Ganadería, Pesca y Desarrollo Sostenible, Sevilla, 49-88.

Bioclimatology is applied for growing tea in the West of Nghe An province, where the tea is considered as a high economic efficient plant to be priorly cultivated for reducing poverty and getting rich. Based on the bioclimatic characteristics of tea plant and regional climatic data from 1980 to 2014, the bioclimatic diagrams are built and the tea cultivability is mapped in term of annual average temperature and total precipitation, for this region with regarding its district of Con Cuong as an analytical key. The climate, including both temperature and precipitation, in Con Cuong is relatively suitable for the tea plantation. The Western Nghe An, a land of approx. 1.4 million ha, could be classified in five areas with different suitability for tea plant. The unfavorable area occupies only 1% of total region and the four favorable rests account for 99% of total, in which, the most favorable area is largest with about 746,355 ha, i.e. over 50% of whole region. The three other areas are cultivable but they are less favorable in terms of either temperature or precipitation. Growing tea in Western Nghe An, even in favorable areas, it should be taken into account of the weather disadvantages in certain moments of the year such as extreme dry, cold, hot and rainy events.ReferencesAhmed S., 2014. Tea and the taste of climate change, www.herbalgram.org, issue, 103, 44–51.Ahmed S., Stepp J.R., Orians C., Griffin T., Matyas C., 2014. Effects of extreme climate events on tea (Camellia sinensis) functional quality validate indigenous farmer knowledge and sensory preferences in tropical China. PloS one, 9(10), e109126.Bhagat R.M., Deb Baruah R., Safique S., 2010. climate and tea [camellia sinensis (l.) o. kuntze] Production with Special Reference to North Eastern India: A Review. Journal of Environmental Research And Development, 4(4), 1017–1028.Carr M., 1972. The Climatic Requirements of the Tea Plant: A Review. Experimental Agriculture, 8(01), 1–14. https://doi.org/10.1017/S0014479700023449.Carr M.K.V., Stephen W., 1992. Climate, weather and the yield of tea. In: Tea Cultivation to consumtpion. K.C. Wilson and M.N. Clifford (Eds). Chapman and Hall, 87–135.Daleen Lotter, David le Maitre, 2014. Modeling the distribution of Aspalathus linearis (Rooibos tea): implications of climate change for livelihoods dependent on both cultivation and harvesting from the wild. Ecology and Evolution, 4(8), 1209–1221.Ducan J.M.A., Saikia S.D., Gupta N., Biggs E.M., 2016. Observing climate impacts on tea yield in Assam, India. Applied Geogr., 77, 64–71.Institute of Geography, 2016. Department of Climatically Geography. The precipitation and temperature data at meteorological measuring stations in the West of Nghe An Province between 1984 and 2014. Data stored at Department of Climatically Geography, Institute of Geography, Ha Noi, 46p.Gaussen H., 1954. 8 ème Congrès international de Botanique. Section 7 et 3. Paris.Hadfield W., 1976. The effect of high temperature on some aspects of the physiology and cultivation of tea bush (Camellia sinensis) in North East India. In: Light as an Ecological factor. G.C. Evans, R. Bainbridge and O. Rackham (Eds.) Blackwel Sci. Publ., London, 477–495.Hoang Luu Thu Thuy, 2012. The comprehensive assessment of natural, socio-economic and environmental conditions for environmental protection planning in Nghe An Province. Doctoral Thesis. Institude of Geography, Hanoi, 150p.Huang Shoubo, 1989. Meteorology of tea plants in China: a review. Agri. Forest Meteorol., 47, 19–30.Huang Shoubo, 1991. A study on the ecological climates of some famous tea growing areas in high mountainous regions of China. Chinese Geographical Science, 1(2), 121–128.International Center for Tropical Agriculture, 2017. Identification of suitable tea growing areas in Malawi under climate change scenarios. Ciat report, Cali, Colombia, 39p.Kabir S.E., 2001. A study on Ecophysiology of Tea (Camellia sinensis) with special reference to the influence of climatic factors on physiology of a few selected Tea clones of Darjeering. International Journal of Tea Science, 1(4), 1–9.Kandiah S., Thevadasan T., 1980. Quantification of weather parameters to predict tea yields. Tea Q., Srilanka, 49(1), 25–33.Kaye L., 2014. Climate change threatens Sri Lanka’s tea industry. Triple Pundit: People, Planet, Profit. Available at: www.triplepundit.com/2014/06/climate-changethreatens-sri-lanka-tea-industry. Accessed July 25, 2014.Nakayama A., Harada S., 1962. Studies on the effect on the growth of tea plant. IV. The effect of temperature on the growth of young plants in summer. Bull. Tea Res. Station, Japan, 1, 28–40.Nguyen Bao Ve, 2005. The syllabus of industrial trees. Hanoi Argricultural Publishing House, 224p.Nguyen Dai Khanh, 2003. The assessment of agricultural climatic conditions for tea’s growth in major tea regions of Vietnam. Doctoral Thesis. Institute of Meteorology and Hydrology, 149p.Nguyen Khanh Van, Nguyen Thi Hien, Phan Ke Loc, Nguyen Tien Hiep, 2000. The bioclimatic diagrams of Vietnam. Vietnam National University Publishing House, Ha Noi, 126p.Nguyen Van Hong, 2017. Analyzing, assessing landscape for agriculture, forestry development and biodiversity conservation in the southwestern border districts in Nghe An province. Doctoral thesis. Vietnam National University, Hanoi, 150p.Nguyen Van Tao (ed.), 2004. Completing the asexual propagation process of LDP1 and LDP2 cultivars by cuttings in order to transfer to production. State Project of production pilot, coded KC.06.DA.09.NN. Institute of Tea Research, Phu Tho, 50p.Nkomwa E.C., Joshua M.K., Ngongondo C., Monjerezi M., Chipungu F., 2014. Assessing indigenous knowledge systems and climate change adaptation strategies in agriculture: A case study of Chagaka Village, Chikhwawa, Southern Malawi. Physics and Chemistry of the Earth, Parts A/B/C, 67–69, 164–172.Pham Hoang Ho, 2003. An Illustrated Flora of Vietnam, 2, 430–434. Youth Publishing House, 952p.Rebecca Boehm, Sean B. Cash, Bruce T. Anderson, Selena Ahmed, Timothy S. Griffin, Albert Robbat Jr., John Richard Stepp, Wenyan Han, Matt Hazel and Colin M. Orians, 2016. Association between Empirically Estimated Monsoon Dynamics and Other Weather Factors and Historical Tea Yields in China: Results from a Yield Response Model. Climate, 4, 20; doi:10.3390/cli4020020. www.mdpi.com/journal/climate.Schepp K., 2014. Strategy to adapt to climate change for Michimikuru tea farmers in Kenya. Adap CC Report. 2008. Available at: www.adapcc.org/en/kenya.htm. Accessed July 25, 2014.Sen A.R., Biswas A.K., Sanyal D.K., 1966. The Influence of Climatic Factors on the Yield of Tea in the Assam Valley, J. App. Meteo., 5(6), 789–800.Statistics Office of Nghe An Province, 2016. The annual abstracts of statistics 2015. Nghe An Publishing House, Nghe An, 453p.Tanton T.W., 1982. Environmental factors affecting yield of tea (camellia sinensis). Effect of air temperature. Expl. Agri., 18, 47–52.The People’s Committee of Nghe An Province, 2013. The Decision No. 448/QĐ-UBND dated 31/01/2013 to approve the hi-tech agriculture planning on the production of tea in Nghe An Province.The People’s Committee of Nghe An Province, 2013. The Decision No. 6290/QĐ-UBND dated 24/12/2013 to approve the adjustments and supplements for the development of Nghe An tea Industrial zone planning in 2013–2020.Walter H, Lieth, 1967. Klimadiagram - Weltatlas. Veb Gustav Fischer Verlag Jena.Wijeratne M.A., 1996. Vulnerability of Sri Lanka tea production to global climate change. Water, Air and Soil Pollution, 92(1-2), 87–94.Wijeratne M.A., Anandacoomaraswamy A., Amarathunga M., Ratnasiri J., 2007. Assessment of impact of climate change on productivity of tea (Camellia sinensis L.) plantations in Sri Lanka, 119–126.http://nghean.gov.vn, 05/06/2015. Many crops are withered in Con Cuong.http://baonghean.vn, 25/03/2013. Drought threaten rice and tea in Con Cuong. http://baonghean.vn/con-cuong-han-han-de-doa-lua-che-44581.html.

FITOEXTRAÇÃO DE SAIS DO SOLO POR CAPIM-ANGOLA IRRIGADO NO VALE DO SÃO FRANCISCO, PERNAMBUCO JOSÉ NUNES FILHO1; SERVULO MERCIER SIQUEIRA E SILVA2; ANTÔNIO RAIMUNDO DE SOUSA2; MINA KARASAWA2 E VENÉZIO FELIPE DOS SANTOS3 1Instituto Agronômico de Pernambuco (IPA), Estação Experimental Lauro Ramos Bezerra, CEP 56700-000, Serra Talhada-PE. E-mail: nunes.filho@ipa.br2Instituto Agronômico de Pernambuco (IPA), Sede, Av. Gal San Martin, 1371, Bongi, CEP 50761-000, Recife-PE. E-mail: servulo.siqueira@ipa.br, antonio.raimundo@ipa.br, mina.karasawa@ipa.br3Instituto Agronômico de Pernambuco (IPA), Sede, Av. Gal San Martin, 1371, Bongi, CEP 50761-000, Recife-PE. E-mail: venezio.felipe@ipa.br 1 RESUMO Este estudo teve como objetivo avaliar a extração de sais do solo pelo capim-angola irrigado, submetido a três sistemas de preparo do solo: gradagem, gradagem + subsolagem e gradagem + subsolagem + gessagem. O trabalho foi conduzido na Estação Experimental de Belém do São Francisco do IPA-PE, durante o período de janeiro/2013 a dezembro/2014. A irrigação foi por aspersão fixa com turno de rega de dois dias, aplicando-se 4,0 mm.dia-1. Os valores de produtividade de matéria seca foram maiores para o preparo do solo gradagem + subsolagem, totalizando 50,9 t ha-1ano-1 em seis cortes, realizados a cada 60 dias, assim como o teor de sódio (Na+) na matéria seca total da parte aérea que foi de 1,67%, superando os demais sistemas de preparo. A quantidade de sais extraídas do solo (762,8 kg ha-1ano-1) superou em 3,5 e 2,1 vezes as áreas com gradagem e gradagem + subsolagem + gessagem, respectivamente. A qualidade da forragem produzida expressa pela percentual de proteína total foi melhor com o preparo gradagem + subsolagem. O pH do solo aumentou, de modo geral, depois do cultivo com capim-angola, onde na profundidade 0 a 30 cm, passou de ligeiramente ácido pH = 5,8 para pH = 6,7, com maior neutralização no preparo de solo gradagem + subsolagem, atingindo pH = 7,0. No sistema de preparo de solo gradagem e gradagem + subsolagem o capim-angola propiciou as maiores reduções na salinidade do solo com valores de 88,0 e 86,1%, respectivamente, em relação à salinidade antes do cultivo. Houve uma melhoria expressiva do nível de sais solúveis que antes era fortemente salino, para 2,4 dS m-1, ligeiramente salino, depois do cultivo desta forrageira. Palavras-chave: Brachiaria mutica, recuperação, solos salinos. NUNES FILHO, J., SILVA, S. M. S. e; SOUSA, A. R.; KARASAWA, M; SANTOS, V. F. dosPHYTOEXTRACTION OF SALT IN SOIL BY ANGOLA GRASS IRRIGATED IN SÃO FRANCISCO VALLEY, PERNAMBUCO STATES, BRAZIL 2 ABSTRACT This study aimed to evaluate the extraction of soil salts in angola grass irrigated, under three soil preparation systems: disking, disking + subsoiling and disking + subsoiling + gypsum. The work was conducted in Experimental Station of Belém São Francisco IPA-PE during the period January/2013 to December/2014. Was used the sprinkler irrigation with two days irrigation interval, applied 4.0 mm/day. The dry matter yields were higher for soil preparation disking + subsoiling, totaling 50.9 t/ha/year in 06 cuts, every 60 days, as well as the sodium (Na+) in the dry matter of the shoot plant which was 1.67%, exceeding the other soil preparation systems. The amount of salts extracted from the soil (762.8 kg/ha/year) was higher by 3.5 and 2.1 times the areas with disking and disking + subsoiling + gypsum, respectively. The quality of forage produced expressed by the percentage of total protein was better with the disking + subsoiling preparation. The pH of the soil increased, in general, after the growing angola grass, where the depth 0 to 30 cm, was a slightly acid pH = 5.8 to pH = 6.7 with greater neutralization the soil preparation system of disking + subsoiling, reaching pH = 7.0. In the preparation disking + subsoiling the Angola grass provided the greatest reductions in soil salinity with 88.0 and 86.1% values, respectively, in relation to salinity before cultivation. There was a significant improvement of soluble salts level that was once strongly saline for 2.4 dS.m-1, slightly saline, after the cultivation of this grass. Keywords: Brachiaria mutica, recuperation, saline soils.

SIMILARIDADE DE SOLOS QUANTO A SALINIDADE NO VALE PERENIZADO DO RIO TRUSSU, CEARÁ JOSÉ RIBEIRO DE ARAÚJO NETO1; FRANCISCO EMANOEL FIRMINO GOMES2; HELBA ARAÚJO DE QUEIROZ PALÁCIO1; ELDIR BANDEIRA DA SILVA2 E PAULILO PALÁCIO BRASIL2 [1] Instituto Federal de Educação, Ciência e Tecnologia do Ceará - IFCE, Campus Iguatu, Departamento de Tecnologia em Irrigação e Drenagem. Endereço: rodovia Iguatu-Várzea Alegre, Km 05, s/n, CEP: 63.500-000, Iguatu, Ceará, Brasil. E-mail: juniorifcelabas@gmail.com; helbaraujo23@yahoo.com.br.2 Departamento de Engenharia Agrícola, Centro de Ciências Agrárias, Universidade Federal do Ceará, Fortaleza, Ceará, Brasil. E-mail: emanoelfg@hotmail.com; eldir_2005@hotmail.com; paulilopalacio@gmail.com. 1 RESUMO O objetivo foi avaliar os impactos da irrigação na adição de sais em solos de duas áreas irrigadas no trecho perenizado do rio Trussu, Iguatu, Ceará, localizado no semiárido brasileiro, aplicando a técnica de estatística multivariada, análise de agrupamento, como ferramenta para identificar a similaridade das áreas no tempo e no espaço. As coletas foram realizadas em 3 áreas, uma com mata de regeneração, uma cultivada com pastagem irrigada e outra com goiaba irrigada. As coletas de solo foram realizadas bimestralmente, de maio/2013 a abril/2014, nas camadas de 0-30 cm; 30-60 cm; 60-90 cm. Foram considerados os seguintes atributos: Condutividade Elétrica do estrato de saturação (CE), pH, PST (percentual de sódio trocável), RAS (razão de adsorção do sódio) e os íons solúveis Ca2+, Mg2+, Na+, K+, Cl-. O grupo 1 foi formado pelos solos que apresentaram as menores concentrações médias de sais, composto por todas as coletas realizadas nos solos da mata de regeneração, sete oriundas da área com pastagem e seis da área com goiaba, independentemente da camada amostrada ou da época de coleta. O grupo 2 expressa uma completa dissimilaridade das informações da mata de regeneração, visto que nenhuma informação desta área se faz presente neste grupo. As maiores concentrações de sais no grupo 2 indicam que houve uma acumulação de íons no solo nas áreas irrigadas, mas ainda não em nível que comprometa o crescimento das plantas e coloquem em risco os solos quanto a salinidade. A separação destes solos em grupos contendo solos similares quanto à salinidade pode contribuir para estratégias de manejo a serem adotadas para cada grupo de solo formado. Palavras-chaves: sais no solo, irrigação, estatística multivariada. ARAÚJO NETO, J. R. de; GOMES, F. E. F.; PALÁCIO, H. A. de Q.; SILVA, E. B. da; BRASIL, P. P.SIMILARITY OF SOILS WITH REGARD TO SALINITY IN THE PERENNIAL VALLEY OF TRUSSU RIVER, CEARÁ 2 ABSTRACT The goal was to evaluate the impacts of irrigation with addition of salts on soils of two irrigated areas in the perennial stretch of Trussu River, Iguatu, Ceará, located in the Brazilian semiarid, by applying the multivariate statistical technique, and clustering analysis, as a tool to identify the similarity of the areas in time and space. Samples were collected in three areas: one with forest regeneration, cultivated with irrigated pasture and another with irrigated guava. Soil samples were collected every two months from May/2013 to April/2014 in 0-30 cm; 30-60 cm; 60-90 cm layers. The following attributes were considered: Electrical Conductivity of the saturation extract (EC), pH, PES (percentage of exchangeable sodium), SAR (sodium adsorption ratio) and soluble ions Ca2+, Mg2+, Na+, K+, Cl-. Group 1 was formed by soils presenting the lowest salts concentration average, composed for all samples taken in the regeneration forest soils, seven originating from areas with pasture and six from areas with guava, regardless of the sampled layer or collection time. Group 2 expresses a complete dissimilarity of information on the regeneration forest, since no information on this area is present in this group. The largest salt concentrations in Group 2 indicates that there was an accumulation of ions in the soil in the irrigated areas, but not at a level that could compromise plant growth and jeopardize both soils as salinity. The separation of these soils into groups containing similar soil in salinity can contribute to management strategies to be adopted for each soil group formed. Keywords: salts in the soil, irrigation, multivariate statistics.

In 2005, a group of objects was ploughed up, comprising a bronze openwork belt, bronze belt parts in the form of a four-spoked wheel, a bronze bell-shaped pendant, the arc of a bimetal fibula, fragment(s) of an iron sword, and part(s) of a horse's iron bit, at the Kalnica site in the village of Nisevac. According to the finder, while ploughing a field, his plough dug up several larger slab-shaped stones, beneath which were found the above objects, as well as fragments of human bones. The most important finds from the Kalnica grave are three parts of a bronze openwork belt (fig. 3a-c) and three bronze belt parts in the form of a four-spoked wheel. According to the finder, the belt was composed of three more belt links, two or three parts in the form of a wheel, and a final segment with a larger round buckle. The links of the belt were cast, with dimensions of 4.2-4.3 cm (length), 2-2.1 cm (height) and 0.6-0.7 cm (width). All three links were made in the same mold, after which they were decorated with perforations, incisions, and points in an identical manner. The circular bronze parts of the belt in the shape of a four-spoked wheel (fig. 3d-f) were cast, with a diametar of 2-2.1 cm, and their height precisely matches the links of the belt. All three circular parts were made in the same mold and then decorated with perforations, incisions, and points. One more item from this group of finds that probably belongs to the belt collection, is a bronze bell-shaped pendant (fig. 4/a), with a height of 4 cm and a diameter of 1.7-1.8 cm. A larger arc of a bimetal fibula was discovered in the grave, with its foot in the shape of an hourglass. The arc is 5.5 cm in width, decorated with dense small ribs. Part of a damaged horse's iron bit 11 x 4.3 cm in dimension was also found in the grave (fig. 4/c). The last find in this collection comprises part of a bent single-bladed iron sword, 11.9 x 4.4 cm (fig. 4/d). In this kind of bent sword, a so-called T end is usually found at the end of the handle/hilt, so we suppose that this sword had such an end. Bearing in mind the chronological classification of all finds from this destroyed grave (fig. 5), the openwork belt from Kalnica could be dated to the end of the VII or the very beginning of the VI centuries BC at the earliest. Such dating in principle agrees with the Ha C2/D1 central-European period, i.e. horizontal 2 according to R. Vasic, since other finds of openwork belts were dated to this period by the same author. Nevertheless, the type II iron bit does raise a slight doubt regarding the dating of the Kalnica belt, since according to M. Werner such belts were dominant in the Ha D2/3 period, i.e. at the end of the first half of the Vth century BC. The find of the composite belt from Kalnica raises several interesting observations. Firstly, the belt differs from most examples previously discovered on the territory of south-eastern Europe in that most belt link sets were formed in the shape of a square, with less frequent deviation regarding link dimensions, while those of the belt from Kalnica are relatively elongated. Links similar to the Kalnica elongated links have only be discovered in north Macedonia and in grave 5 of tumulus I in the Kenete site in Albania. The difference in the decoration of the belt from Kalnica compared with other belts is interesting. They are decorated with pierced triangles and perforated concentric circles, with a central point, repeated in countless combinations. Half-elliptical perforations appear for the first time on the belt from Kalnica, to some extent inexpertly carried out. Openwork belts have been discovered throughout the territory between the Timok river in Serbia and the Isker in Bulgaria, although according to recently published finds from the Trojan region in Bulgaria, that area could be extended eastward to the Rosica river. Outside these territories, more significant groupings are visible in the Vardar valley in Macedonia, as well as in an early Iron Age necropolis in the Donja dolina in northern Bosnia. The production center of these belts is connected with the Zlot group (Zlot-Sofronijevo), or with the Triballi tribe, but it could be said that in the VII and VI centuries BC such belts were also worn among their neighbors.

CE Information Activity Available Online: To access the article, post-test, and evaluation online, go to https://www.highmarksce.com/mscare. Target Audience: The target audience for this activity is physicians, physician assistants, nursing professionals, and other health care providers involved in the management of patients with multiple sclerosis (MS). Learning Objectives: 1) Describe what constitutes a registry. 2) Discuss the difference(s) between clinician-driven and patient-driven registries, including potential advantages of patient-driven registries. Accreditation Statement: In support of improving patient care, this activity has been planned and implemented by the Consortium of Multiple Sclerosis Centers (CMSC) and Delaware Media Group. The CMSC is jointly accredited by the Accreditation Council for Continuing Medical Education (ACCME), the Accreditation Council for Pharmacy Education (ACPE), and the American Nurses Credentialing Center (ANCC), to provide continuing education for the healthcare team. Physician Credit: The CMSC designates this journal-based activity for a maximum of 1.0 AMA PRA Category 1 Credit(s)™. Physicians should claim only the credit commensurate with the extent of their participation in the activity. Nurse Credit: The CMSC designates this enduring material for 1.0 contact hour of nursing continuing professional development (NCPD) (none in the area of pharmacology). Disclosures: Francois Bethoux, MD, Editor in Chief of the International Journal of MS Care (IJMSC), has served as Physician Planner for this activity. He has disclosed relationships with Springer Publishing (royalty); Qr8 (receipt of intellectual property rights/patent holder); Biogen (receipt of intellectual property rights/patent holder, speakers’ bureau); MedRhythms (consulting fee, contracted research); GW Pharmaceuticals, Genentech, Helius Medical Technologies, Osmotica, Ipsen (consulting fee); and Adamas Pharmaceuticals (contracted research). Ruth Ann Marrie, MD, PhD, has disclosed being a co-investigator on a study funded by Biogen and Roche. Gary R. Cutter, PhD, has disclosed serving on the data/safety monitoring committees for AstraZeneca, Avexis Pharmaceuticals, BioLineRx, BrainStorm Cell Therapeutics, Bristol Myers Squibb/Celgene, CSL Behring, Galmed, Green Valley Pharma, Mapi Pharmaceuticals, Merck, Merck/Pfizer, Mitsubishi Tanabe, OPKO Biologics, Neurim, Novartis, Orphazyme, Sanofi, Reata, Teva, Viela Bio, the National Heart, Lung, and Blood Institute (Protocol Review Committee), and the Eunice Kennedy Shriver National Institute of Child Health and Human Development (Obstetric-Fetal Pharmacology Research Unit Oversight Committee); serving on consulting/advisory boards for Alexion, Antisense Therapeutics, Biodelivery Sciences International, Biogen, Clinical Trial Solutions LLC, Genzyme, Genentech, GW Pharmaceuticals, Immunic, Klein Buendel, MedImmune/Viela Bio, MedDay, Merck/Serono, Neurogenesis Ltd, Novartis, Osmotica, Perception Neuroscience, Protolix Biotherapeutics, Recursion/Cerexis Pharmaceuticals, Regeneron, Reckover Pharmaceuticals, Roche, SAB Biotherapeutics, and TG Therapeutics; and being president of Pythagoras, Inc, a private consulting company. Robert J. Fox, MD, MSc, has disclosed receiving consulting fees from AB Science, Biogen, Celgene, EMD Serono, Genentech, Genzyme, Immunic, Janssen, Novartis, Sanofi, and TG Therapeutics; research funding from Biogen, Novartis, and Sanofi; and royalties from Demos Publishing. Timothy Vollmer, MD, has disclosed receiving compensation for lectures and consultancy from Biogen, Genentech/Roche, Viela Bio, Celgene, EMD Serono, and Novartis; and research support from Rocky Mountain Multiple Sclerosis Center, Celgene, Biogen, Anokion, Genentech, F. Hoffmann-La Roche Ltd, GW Pharmaceuticals, and TG Therapeutics Inc. Tuula Tyry, PhD, has disclosed no relevant financial relationships. Amber Salter, PhD, has disclosed serving as a statistical editor for Circulation: Cardiovascular Imaging. The staff at IJMSC, CMSC, and Delaware Media Group who are in a position to influence content have disclosed no relevant financial relationships. Laurie Scudder, DNP, NP, Continuing Education Director CMSC, has served as Reviewer for this activity. She has disclosed no relevant financial relationships. One peer reviewer for IJMSC has disclosed relationships with Alexion (consulting fee, speakers’ bureau); Biogen, Bristol Myers Squibb, EMD Serono, Genentech (consulting fee, speakers’ bureau, contracted research); Celgene, Novartis, Sanofi Genzyme (consulting fee, contracted research); Viela Bio (consulting fee); National MS Society, PCORI, Atara Biotherapeutics, Roche (contracted research); and Taro Pharmaceuticals, AstraZeneca, Pfizer, Johnson & Johnson, Inovio, GlaxoSmithKline, Viatris, Gilead, Altimmune Inc, CytoDyn Inc (ownership interest [common stocks]). The other peer reviewer has disclosed relationships with Celgene (speakers’ bureau, contracted research); and Merck, EMD Serono, Roche, AbbVie (contracted research). Note: Financial relationships may have changed in the interval between listing these disclosures and publication of the article. Method of Participation: Release Date: December 1, 2021 Valid for Credit Through: December 1, 2022 In order to receive CME/NCPD/CPE credit, participants must: 1) Review the continuing education information, including learning objectives and author disclosures.2) Study the educational content.3) Complete the post-test and evaluation, which are available at https://www.highmarksce.com/mscare. Statements of Credit are awarded upon successful completion of the evaluation and the post-test with a passing score of &gt;70%. The post-test may be retaken if necessary. There is no fee to participate in this activity. Disclosure of Unlabeled Use: This educational activity may contain discussion of published and/or investigational uses of agents that are not approved by the FDA. The CMSC and Delaware Media Group do not recommend the use of any agent outside of the labeled indications. The opinions expressed in the educational activity are those of the faculty and do not necessarily represent the views of the CMSC or Delaware Media Group. Disclaimer: Participants have an implied responsibility to use the newly acquired information to enhance patient outcomes and their own professional development. The information presented in this activity is not meant to serve as a guideline for patient management. Any medications, diagnostic procedures, or treatments discussed in this publication should not be used by clinicians or other health care professionals without first evaluating their patients’ conditions, considering possible contraindications or risks, reviewing any applicable manufacturer’s product information, and comparing any therapeutic approach with the recommendations of other authorities.

El texto aborda la evolución del análisis historiográfico que se ha llevado a cabo sobre la Cataluña moderna entre finales del siglo XVI y principios del XVIII. Aunque la frontera moderna de Cataluña puede ser múltiple, nos centramos esencialmente en aquella que va desde el Valle de Arán hasta el Mediterráneo. El texto abre con una primera reflexión sobre el camino hacia el cambio de modelo, luego evoca los efectos de las guerras con Francia, con algunos ejemplos concretos, como el de Cerdaña, y, por último, expone la realidad percibida y llevada a cabo con la nueva “fortificación” de la frontera catalana a finales del siglo XVII, cuando el control de Francia se hace evidente. Palabras clave: Frontera, fronterización, fortificaciónTopónimos: Francia, España, Cataluña,Período: época moderna ABSTRACTThe text addresses the evolution of the historiographical analysis that of modern Catalonia between the end of the 16th and the beginning of the 18th century. Although the modern border of Catalonia may be multiple, the focus will essentially be upon the border that runs from the Arán Valley to the Mediterranean. The text opens with an initial reflection on the path towards a change of model, before evoking the effects of the wars with France, with some specific examples, such as that of Cerdanya, and finally presenting the reality perceived and manifested with the new “fortification” of the Catalan border at the end of the 17th century, when French control became evident. Keywords: Border, bordering, fortificationPlace names: France, Spain, CataloniaPeriod: modern era REFERENCIASAyats, A., Louis XIV et les Pyrénées catalanes de 1659 à 1681. Frontière politique et frontières militaires, Trabucaire, Canet, 2002.Bély, L., “La representación de la frontera en las diplomacias durante la Época Moderna”, Manuscrits, 26, (2008), pp. 35-51.— “Westphalie, Pyrénées, Utrecht: trois traités pour redessiner l'Europe”, en O. Jané (ed.), Del Tractat dels Pirineus a l'Europa del segle XXI: un model en construcció, Museu d'Història de Catalunya-Generalitat de Catalunya, Barcelona, 2010, pp. 13-21.Bourret, C., Les Pyrénées centrales du ixe au xixe siècle. La formation progressive d’une frontière, Pyrégraph, Aspet, 1995.Brunet, S., Les prêtres des montagnes. La vie, la mort, la foi dans les Pyrénées centrales sous l'Ancien Régime (Val d'Aran et diocèse de Comminges), PyréGraph, Aspet, 2001.Cámara, A., Fortificación y ciudad en los reinos de Felipe II, ed. NEREA, Madrid, 1998.Camiade, M., Genís, M.T. y Lacombe-Massot, J.-P., “Les mirades en el territori: les fortificacions al massís de l’Albera, el vessant més oriental dels Pirineus”, en Fronteres: una visió des de l'Empordà, Annals de l’Institut d’Estudis Empordanesos, 2011, pp. 491-502.Caner, P. y Vilar, L., “Castells i cases fortificades de Calonge”, Annals de l'Institut d'Estudis Gironins, 23, (1976), pp. 279-320.Capponi, N., “Le strade dell’ invasore. Strategia, fortezze e sistema difensivi nella Toscana dei secoli XVI-XVII”, en Frontiere e fortificazioni di frontera, Edizioni Firenze, Florencia, 2001, pp. 147-164.Carrió Arumí, J., “La política militar hispànica i la persecució de bandolers a Catalunya en els segles XVI-XVII”, Recerques: història, economia, cultura, 69, (2014), pp. 99-130.— Catalunya en l’estructura militar de la Monarquia Hispànica (1556-1640). Tres aspectes: les fortificacions, els soldats i els allotjaments, Tesis doctoral, UB, Barcelona, 2008.Casals, A., “Estructura defensiva de Catalunya a la primera meitat del segle XVI: els comtats de Rosselló i Cerdanya”, en El poder real de la Corona de Aragón: (siglos XIV-XVI),Gobierno de Aragón, Zaragoza, 1996, pp. 83-94.Colás Latorre, G. y Salas Ausens, J. A., Aragón en el siglo XVI. Alteraciones sociales y conflictos políticos, Universidad de Zaragoza, Zaragoza, 1982.Conesa, M., D’herbe, de terre et de sang: La Cerdagne du XIVe au XIXe siècle, Presses universitaires de Perpignan, Perpiñán, 2018.Cornette, J., Le roi de guerre. Essai sur la souveraineté dans la France du Grand Siècle, Editions Payot Rivages, París, 2000, p. 43Cortada, L., Estructures territorials, urbanisme i arquitectura poliorcètics a la Catalunya preindustrial, IEC, Barcelona, 1998, 2 vols.Díaz Capmany, C., “La construcció de la plaça forta de Sant Ferran a Figueres”, AIEE, 36, (2003), pp. 265-295.Dubost, J.-F., “Absolutisme et centralisation en Languedoc au XVIIe siècle (1620-1690)”, Revue d’histoire moderne et contemporaine, 37-3, (1990), pp. 369-397.Dubost, J.-F.y Sahlins, P., Et si on faisait payer les étrangers? Louis XIV. Les immigrés et quelques autres, Flammarion, París, 1999.Espino López, A., Cataluña durante el reinado de Carlos II: política y guerra en la frontera catalana, 1679-1697, Monografies Manuscrits, Bellaterra, 1999.— Las guerras de Cataluña. El Teatro de Marte, 1652-1714, Edaf, Madrid, 2014.— “Entre Francia y España. Conflicto político y defensa hispánica de la frontera en la Cerdaña, 1659-1672”, Hispania, vol. LXXVII, 257, (2017), pp. 705-733.— La Cerdaña en armas. Conflicto e identidad en la frontera catalana, 1637-1714, Ed. Milenio, Lleida, 2017.— Fronteras de la monarquía. Guerra y decadencia en tiempos de Carlos II, Ed. Milenio, Lleida, 2019.— “La nueva frontera militar en la Cerdaña. Las defensas de Puigcerdà (1659-1683)”, Chronica Nova, 47, (2021), pp. 213-242.Espino López, A. y Jané Checa, O. (eds.), Guerra, frontera i identitats, Ed. Afers, Catarroja-Barcelona, 2015.Estanyol, V., El pactisme en guerra (L'organització militar catalana als inicis de la guerra de separació, 1640-1642), Ed. Dalmau, Barcelona, 1999.Ferrier-Caverivière, N., “La guerre dans la littérature française de 1672 à 1715”, en Guerre et pouvoir en Europe au XVIIe siècle, H. Veyrier, Saint-Etienne, 1991, pp. 105-128.Gascón, J., Alzar banderas contra su rey. La rebelión aragonesa de 1591 contra Felipe II, Prensas Universitarias de Zaragoza, Zaragoza, 2010.Gil Pujol, X., De las alteraciones a la estabilidad. Corona, fueros y política en el Reino de Aragón, 1585-1648, Universitat de Barcelona, Barcelona, 1989.Jané Checa, O., Catalunya i França al segle XVII. Identitats, contraidentitats i ideologies a l’època moderna (1640-1700), Afers, Catarroja, 2006.— La identitat de la frontera pirinenca. Efectes socials i polítics al nord de Catalunya des de la creació de Montlluís (1677-1698), Diputació de Girona, Girona, 2008.— Catalunya sense Espanya. Ramon Trobat, ideologia i catalanitat a l’empara de França, Ed. Afers, Catarroja-Barcelona, 2009.— “The boundaries between France and Spain in the Catalan Pyrenees: Elements for the construction and invention of borders”, en K. Stoklosa G. Besier (eds.), European Border Regions in Comparison: Overcoming Nationalistic Aspects or Re-Nationalization?, Routledge, New York-Oxford, 2014, pp. 39-57La Fuente, P. de, “La fortificació del litoral cadaquesenc al segle XVI”, Annals de l’Institut d’Estudis Empordanesos, 34, (2001), pp. 379-400.— “Anàlisi d’alguns aspectes sobre la concepció teòrica del projecte del castell de Sant Ferran”, Annals de l’Institut d’Estudis Empordanesos, 29, (1996), pp. 177-190.— La ciudad como problema militar: Perpiñán y los ingenieros de la monarquía española (ss. XVI-XVII), Tesis Doctoral, UNED, Madrid, 1995 (publicada por el Ministerio de Defensa en 1999).Macías Cordero, N., Tiburzio Spannocchi: su contribución a la fortificación aragonesa, TFG-Arquitectura, UPM, 2020.Martí Escayol, M. A. y Espino López, A., Catalunya abans de la Guerra de Successió: Ambrosi Borsano i la creació d'una nova frontera militar, 1659-1700, Ed. Afers, Catarroja-Barcelona, 2013.Martínez Latorre, D., Giovan Battista Calvi, ingeniero de las fortificaciones de Carlos V y Felipe II (1552-1565), Tesis Doctoral, Ministerio de Defensa, Barcelona, 2002.Muchembled, R., Le temps des supplices. De l’obéissance sous les rois absolus. XVe-XVIIIe siècles, Armand Colin, París, 1992.Nordman, D., Frontières de France, de l’espace au territoire (xvie-xixe siècles), Gallimard, París, 1998.— “La frontera: teories i lògiques territorials a França (segles XVI-XVIII), Manuscrits, 26, (2008), pp. 21-33.Paillissé, M.-A., Mont-Louis place forte et nouvelle (1679-1740), Mémoire de maîtrise, Université Paul-Valéry, Montpellier, 1982.Pernot, J.-F., “Guerre de siège et places fortes”, Guerre et pouvoir en Europe au XVIIe siècle, H. Veyrier, Kronos, Saint-Etienne, 1991, pp.129-150.Peytaví, J., “Salses”, en A. Catafau (ed.), Les celleres et la naissance du village en Roussillon (Xe-XVe siècles), Presses Universitaires de Perpignan, Perpiñán, 2014, pp. 591-601.Porras Gil, C., La organización defensiva española en los siglos XVI-XVII desde el río Eo hasta el Valle de Arán, Publicaciones Universidad de Valladolid, Salamanca, 1995.Poujade, P., Une vallée frontière dans le Grand siècle. Le Val d’Aran entre deux monarchies, Pyrégraph, Aspet, 1998.— “Comunicació i divisió a la frontera septentrional de Catalunya entre els segles XV i XVIII”, Catalan Historical Review, 11, (2018), pp. 137-149.Sahlins, P., Boundaries: the making of France and Spain in the Pyrenees, University of California Press, Berkeley, 1989.Sancho, M., “Apunts per una arqueologia dels castells i fortificacions pre-feudals a l’Alt Pirineu (Urgell, Pallars i Ribagorça), segles VI-X”, Treballs d’Arqueologia, 22, (2018), pp. 5-28.Sanllehy, M.A., “Le Val d’Aran: la frontière et les frontières (XVII et XVIIIe siècles)”, en Pays pyrénéens et Pouvoirs centraux (XVIe-XXe s.), Actes du Colloque International de Foix, Association des Amis des Archives de l’Ariège, Foix, 1993, pp. 467-478.— Comunitats, veïns i arrendataris a la Val d'Aran (S. XVII-XVIII), Garsineu, Tremp, 2 vols., 2007.Sanz Camañes, P., “Fronteras, poder y milicia en la España Moderna. Consecuencias de la administración militar en las poblaciones de la frontera catalano-aragonesa durante la Guerra de Secesión Catalana (1640-1652)”, Manuscrits, 26, (2008), pp. 53-77.— Estrategias de poder y guerra de frontera. Aragón en la Guerra de Secesión catalana (1640-1652), CEMCM, Huesca, 2001.Simon, E. y Obiols, L. (eds.), La Cerdanya de 1603: El Tractat del comtat de Cerdanya de Joan Trigall, Anem Editors, Andorra, 2020.Stopani, A., La production des frontières. Etat et communautés en Toscane (XVIe-XVIIe siècles), École Française de Rome, Roma, 2008.Takayanagi, S., “On projects of citadels in four spanish cities by Tiburzio Spannocchi”, Journal of Architecture and Planning, 81-719, (2016), pp. 225-235.Vivar Lombarte, G., “La fortificació de Catalunya: la introducció de les noves teories europees sobre el bastió (1675-1733)”, Pedralbes, 18-2, (1998), pp. 539-547.

Trace elements investigated by electron microprobe analysis (EMPA) have been combined with oxygen isotopic composition of pink, red and other colored spinels (blue, purple, brown, orange, lavender) hosted by marbles and found in placers from Luc Yen and An Phu deposits, Yen Bai province, North Vietnam. The deposits are those from Nuoc Ngap, Cong Troi, Bai Son and different placers from the An Phu area. Trace elements such as Fe-Zn-Cr-V in red and pink gem spinels permit to separate those from Cong Troi and those from the others deposits of the An Phu area. Spinels from Cong Troi have low to extremely low Zn (< 500 ppm) and high Fe contents (3,000 to 16,000 ppm) while those from An Phu area are Zn-rich (up to 11,000 ppm). Iron is the dominant element for the other colored spinels whereas Zn, Cr and V contents are extremely variable. The Bai Son blue spinel is Fe-rich (5,000 to 7,200 ppm) with some V (950 to 1,830 ppm), Cr (270 to 480 ppm), Co (240 to 400 ppm) and Ni (550 to 950 ppm). The O-isotope composition of the whole spinels ranges between 12.1 and 24.2‰ (n = 25). Within each deposit, the range of δ18O values for red, pink and colored spinels is usually similar. However, the red and pink spinels from An Phu present two distinct sets of δ18O values, respectively between 13.2 to 17.0‰ (n = 7) and 22.5< δ18O < 24.2 (n = 5). Those from Cong Troi are from 14.8 to 17.7‰ (n = 3) and their range overlaps that of An Phu. The use of O-isotopes is not useful for distinguishing between the deposits, but the low to extremely low Zn content of the Cong Trois spinels is a discriminant. The variation of δ18O values (12.1 <δ18O < 24.2‰) of the whole spinels indicates that the oxygen isotopic compositions of the metamorphic fluids were probably buffered by the local δ18O values of the impure host marbles.ReferencesChauviré B., Rondeau B., Fritsch E., Ressigeac Ph., Devidal J.-L., 2015. Blue spinel from the Luc Yen district of Vietnam. Gems & Gemology, 51, 2-17.D'Ippolito V., Andreozzi G.B., Hålenius H., Skogby H., Hametner K., Günther D., 2015. Colour mechanisms in spinel: cobalt and iron interplay for the blue colour. Physics and Chemistry of Minerals, 42, 431-439.Garnier V., 2003. Les gisements de rubis associés aux marbres de l’Asie Centrale et du Sud-est: genèse et caractérisation isotopique. PhD thesis INPL, Nancy, France, 373p.Garnier, V., Ohnenstetter, D., Giuliani, G., Maluski, H., Deloule, E., Phan Trong Trinh, Pham Van Long, Hoang Quang Vinh, 2005. Age and significance of ruby-bearing marbles from the Red River shear zone, northern Vietnam. The Canadian Mineralogist, 43, 1315-1329.Garnier V., Giuliani G., Ohnenstetter D., Fallick A.E., Dubessy J., Banks D., Hoang Quang Vinh, Lhomme Th., Maluski H., Pêcher A., Bakhsh K.A., Pham Van Long, Phan Trong Trinh, Schwarz D., 2008. Marble-hosted ruby deposits from central and Southeast Asia: towards a new genetic model. Ore Geology Reviews, 34, 169-191.Giuliani G., Fallick A.E., Garnier V., France-Lanord Ch., Ohnenstetter D., Schwarz D., 2005. Oxygen isotope composition as a tracer for the origins of rubies and sapphires. Geology, 33(4), 249-252.Giuliani G., Fallick A.E., Boyce A.J., Pardieu V., Pham Van Long, 2017. Pink and red spinels in marble: trace elements, oxygen isotopes, and sources. The Canadian Mineralogist, 55, 743-761.Hauzenberger C.A., Häeger T., Baumgartner L.P., Hofmeister W., 2001. High-grade metamorphism and stable isotope geochemistry of N-Vietnamese gem-bearing rocks. In: Proceedings of the Workshop on gems and minerals of Vietnam, Hanoi, 124-138.Hauzenberger C.A., Bagola C., Häeger T., Muellen C., Nguyen Ngoc Khoi, Le Thi Thu Huong, 2014. Mineralogy and petrology of the An Phu marble hosted spinel and corundum deposit, Luc Yen, N-Vietnam. In Proceedings of the 4th International Gem and Jewelry Conference, Chiang Mai, Thailand, 76-78.Kleišmantas A., Daukšyte A., 2016. The influence of Vietnam and Sri Lanka spinel mineral chemical elements on colour. Chemija, 27, 45-51.Kretz R., 1983. Symbols for rock-forming minerals. American Mineralogist, 68, 277-279.Le Thi Thu Huong, Häeger T., Hofmeister W., Hauzenberger C., Schwarz D., Pham Van Long, Wehmeister U., Nguyen Ngoc Khoi, Nguy Tuyet Nhung, 2012. Gemstones from Vietnam: An update. Gems & Gemology, 48, 158-176.Malsy A., Klemm L., 2010. Distinction of gem spinels from the Himalayan mountain belt. Chimia, 64(10), 741-746.Malsy A., Karampelas S., Schwarz D., Klemm L., Armbruster T., Tuan Do Anh, 2012. Orangey-red to orangey-pink gem spinels from a new deposit at Lang Chap (Tan Huong - Truc Lau), Vietnam. The Journal of Gemmology, 33, 19-27.Pham Van Long, Hoang Quang Vinh, Garnier V., Giuliani G., Ohnenstetter D., Lhomme,T., Schwarz D., Fallick A.E., Dubessy J., Phan Trong Trinh, 2004. Gem corundum deposits in Vietnam. Journal of Gemmology, 29, 129-147.Pham Van Long, Pardieu V., Giuliani G., Nguy Tuyet Nhung, Pham Thi Thanh Hien, Pham Duc Anh, Nguyen Ngoc Khoi, Hoang Quang Vinh, 2014. Gemmological characteristics of spinel from Luc Yen, Yen Bai. Journal of Geology, 340, 29-36.Pham Van Long, Pardieu V., Giuliani G., 2014. Update on gemstone mining in Luc Yen, Vietnam. Gems & Gemology, 49, 233-245.Pouchou J.L., Pichoir F., 1991. Quantitative analysis of homogeneous or stratified microvolumes applying "PAP" In Electron Probe Quantification (K.F.J. Heinrich & D.E. Newbury eds.). Plenum Press, New York, USA, 31-75.Valley J.W., 1986. Stable isotope geochemistry of metamorphic rocks. Reviews in Mineralogy, 16, 445-481.Yui T.F., Khin Zaw, Wu C.-M., 2008. A preliminary stable isotope study on Mogok ruby, Myanmar. Ore Geology Reviews, 34, 182-199.

The floodplain tall-herb forests occur in insular part of northeastern Asia along about 2 000 km the latitude gradient from temperate forest zone of Hokkaido (Japan) to boreal zone of central Kamchatka (Russia), including Sakhalin and the Kuril Islands. The climate is oceanic or suboceanic, and monsoons are expressed. Spring snowmelt and abundant rainfall during tropical cyclones cause flooding (Vasilyev, 1979). Climatic and landscape conditions allow tall herbs (also called “giant herbs”) to form herb communities (ass. Cirsio kamtschaticae–Polygonetum sachalinensis (Ohba 1973) Ohba et Sugawara 1982,class Filipendulo–Artemisietea montanae Ohba 1973) as well, and herb layer in forests (Ohba, Sugawara, 1982; Morozov, 1994). The aim of our research is to describe floodplain tall herb forests on Sakhalin Isl. and identify their syntaxonomic position in phytosociological system of northeastern Asia. The field work was carried out in 2015–2017 in the floodplains of 24 rivers (the basin of 15 river systems) in Central and South Sakhalin. In total 81 relevés were completed at 10×10 m and 5×20 m sample plots. The plant cover (in percent) was determined visually. The following scale was used to transfer these figures into abundance scores for Table format: 7 —76–100 %, 6 — 51–75 %, 5 — 26–50 %, 4 — 11–25 %, 3 — 6–10 %, 2 — 2–5 %, 1 — 1 %, + — <1 %, r — <0.1 %. Clustering (flexible-beta, -0.25) was used for grouping with Bray-Curtis dissimilarity in JUICE 7.0. Only vascular plant species were involved in the analysis, because bryophytes were not identified in the each rele­vé. 22 relevés were removed from analysis, because they did not clearly belong to homogeneous vegetation groups. After clustering 6 groups of relevés were recognized, which were interpreted in a rank of subassociations. We made synoptic Table with the original vegetation data of Sakhalin and 16 published relevés from Kamchatka (Neshatayeva, 2009), and 19 from Hokkaido (Vegetation…, 1988). We describe the new alliance Filipendulo camtschaticae–Salicion udensis (holotypus — the ass. Petasito ampli–Salicetum udensis, Table 2) of class Salicetea sachalinensis Ohba 1973 (syn. Salicetea schwerinii Achtyamov 2001). The alliance includes tall herb forest communities of the insular part of northeastern Asia with Salix spp., Alnus hirsuta, and Populus suaveolens dominance. Differential species combination: Carex dispalata, Cirsium kamtschaticum, Filipendula camtschatica, Heracleum lanatum, Senecio cannabifolius, Urtica platyphylla. Main dominant species: A. hirsuta, Salix udensis, Filipendula camtschatica, Matteuccia struthiopteris, Urtica platyphylla. Communities of the ass. Petasito ampli–Salicetum udensis (holotypus — relevé 20, Table 2) occur in the southern part of Sakhalin Isl., Southern Kuril Islands, and Hokkaido in floodplain habitats on the alluvial soils and occasionally on wet slopes. The dominant species in tree layer are Alnus hirsuta and Salix udensis (median height is 12–13 m, canopy cover is 55 %). The shrub layer is absent or moderately developed (cover is 2 %). The main shrub species is Sambucus racemosa. The tall herbs often suppress the growth of shrubs. The herb layer consist of three sublayers (total cover is 100 %). The moss layer is not deve­loped (co­ver less 1 %). Differential species combination: Alnus hirsuta, Angelica ursina, Parasenecio hastatus subsp. orientalis, Petasites amplus, Salix udensis, Symplocarpus renifolius. The subass. Petasito ampli–Salicetum udensis lysichitonetosum camtschatcensis (holotypus — relevé 3, Table 2) includes communities with Lysichiton camtschatcense, Caltha fistulosa, and Carex rhynchophysa (differential species combination) on the wettest sites of the rivers’ valleys and along the banks of tributary streams on alluvial groundwater and hydromorphic soils. The subass. Petasito ampli–Salicetum udensis ulmetosum laciniatae is described as nomen provisorium. We found communities on the rarely flooding sites of river terraces in the mountain river valleys in South Sakhalin. Ulmus laciniata dominates in tree layer together with Alnus hitsuta and Salix udensis. Eleutherococcus senticosus and Actinidia kolomikta (shrub form) occasionally form the shrub layer. The communities are similar to those of Japanese azonal union Ulmion davidianae Suz.-Tok. 1954, azonal order Fraxino-Ulmetalia Suz.-Tok. 1967 of zonal deciduous temperate forest class Fagetea crenatae Miyawaki, Ohba et Murase 1964. Differential species combination: Actinidia kolomikta, Eleutherococcus senticosus, Ulmus laciniata. The communities of the ass. Filipendulo palmatae–Salicetum udensis (holotypus — relevé 4, Table 3) are distributed in the central part of Sakhalin Isl. We found them in the basins of the two largest Sakhalin rivers — Tym and Poronay, and in small river valleys in the East Sakhalin Mountains. The tree layer consist of Alnus hirsuta and Salix udensis (height is 11–14 m, canopy density is 60 %), and with Chosenia arbutifolia, Populus suaveolens, Fraxinus mandshurica, Ulmus japonica in phytosociological units of the lower rank. Padus avium, Rosa amblyotis, Swida alba, Sorbaria sorbifolia, Sambucus racemosa are more or less abundant in the shrub layer (cover is 13 %). The herb layer consists of two or three sublayers (cover is 65 %). The cover of bryophytes is uneven, median cover is less 1 %. Differential species combination: Carex sordida, Filipendula palmata, Fimbripetalum radians, Ligularia fischeri, Padus avium, Parasenecio hastatus, Rosa amblyotis. Differential species combination of the subass. Filipendulo palmatae–Salicetum udensis typicum: Aconitum karafutense, Galium triflorum, Lactuca sibirica, Parasenecio auriculatus, Trautvetteria japonica, Trientalis europaea, Viola epipsiloides. The subass. Filipendulo palmatae–Salicetum udensis populetosum suaveolentis (holotypus — ­relevé 21, Table 3) unites the forests with Chosenia arbutifolia and Populus suaveolens. They can be renewed on alluvial pebble beds. The mature forest stands are often located in the middle part of the floodplains between the abandoned channels. Differential species combination: Chosenia arbutifolia, Crataegus chlorosarca, Populus suaveolens, Sorbaria sorbifolia. Subass. Filipendulo palmatae–Salicetum udensis ulmetosum japonicae is described as nomen provisorium. The communities are developed in the Tym River valley on the high, rarely flooding river benches. The location of the communities is nearby to the northeastern area distribution of broad-leaved trees. Fraxinus mandshurica and Ulmus japonica form tree canopy with Alnus hirsuta, Salix rorida, and Salix udensis. The syntaxonomical position of the subassociation could be changed after getting more data. Diffe­rential species combination: F. mandshurica, Salix rorida, U. japonica. We describe the ass. Phalarido arundinaceae–Salicetum schwerinii (holotypus — relevé 23, table 20 in Vegetation…, 1988; tables are attached to the original publication in a form of separate sheets without page numbers) instead of Salicetum petsusu–sachalinensis subass. von Phalaris arundinacea Okuda in Miyawaki 1988 nom. inval. (2d, 3o) (union Salicion subfragilis Okuda 1978, order Sedo–Salic­etalia subfragilis Okuda 1978, class Salicetea sacha­linensis). After analysis of phytosociological data, we’ve reached the conclusion, that the earlier described original names Salicetum petsusu–sachalinensis ­subass. typicum Okuda in Miyawaki 1988 nom. inval. and subass. von Angelica ursina Okuda in Miyawaki 1988 nom. inval. (relevés 24–34, Table 20; Vegetation…, 1988) have to be considered as subass. Petasito ampli–Salicetum udensis typicum. These communities do not contain Salix nipponica (= S. subfragilis auct. Fl. Japon., non Andersson) — diagnostic species of the alliance Salicion subfragilis Okuda 1978 and the order Sedo-Salicetalia subfragilis Okuda 1978.

Atkinson, Michael and WilliamColleman, 1989, “Strong States and Weak States: Sectoral Policy Networks in Advanced Capitalist Economies”, British Journal of Political Science.Axelrod, R. 1997. The Complexity of Cooperation: Agent-Based Models of Competition and Collaboration. New Jersey: Princeton Univ. Press.Birner, R., and H. Wittmer. 2003. Using Social Capital to Create Political Capital: How Do Local Communities Gain Political Influence? A Theoretical Approach and Empirical Evidence from Thailand. In: Dolsak, N., and E. Ostrom (Eds.), The Commons in the New Millennium, Challenge and Adaptation. MIT Press, Cambridge and London, pp. 291-334.Carlsson, Lars, 2000, Policy Networks as Collective Action, Policy Studies Journal, Vol. 28, No. 3, p. 502-520.Carlson, Lars. 2000. Policy Network as Collective Action, Policy Studies Journal, Vol. 28, No. 3: 502-520.Coe, Benjamin P. 1992. “Progress Through Cooperation in a Rural Region”. National Civic Review 81, (4):449-65.Cooper, Donald R. and Pamela S. Schlinder. 2008. Business Research Methods. McGraw-Hill. New York.Creswell, John W. 2004. Research Design: Qualitative, Quantitative, and Mixed Methods Approaches. London: SAGE Publications.Fukuyama F. 1995. Trust: The Social Virtues and The Creation of Prosperity. New York: Free Press.Graham, Grath, 2005, “Community Networking as Radical Practice”, The Journal of CInformatics, Vol. 1, No. 3, p. 1-11.Grell, J. and Gary Gappert. 1993. The New Civic Infrastructure: Intersectoral Collaboration and the Decision-Making Process. National Civic Review 82(2):140148.Hanf and FW Scharpf 1978. (eds) Interorganizational Policy Making. London: Sage. Hershberg, T., Pam Magidson, and Mary L. Werneeke. 1992. “Regional PromotionCooperation in Southeastern Pennsylvania". National Civic Review 81(4):418-34.Hidayat, Aceng, 2007, Introduction to Institutional Economics, Course Modules, Department of Economic Resources and Environment, Bogor, FEM-IPB.Hjern, B. and Porter, DO 1983.'Implementation Structures: A New Unit for Administrative Analysis. Organizational Studies, 3 pp211–37.Howlett, Michael and M. Ramesh. 1995. Studying Public Policy: Policy Cycles and Policy Subsystems. Oxford University Press, Oxford.Howlett, Michael and M. Ramesh. 1995. Studying Public Policy: Policy Cycles and Policy Subsystems. Oxford University Press, Oxford.Huggins, M. 1992. “Momentum 21: Regional Cooperation in the Chippewa Valley”. National Civic Review 81(4): 418-34.Other sources:Profile of the Pasir Batang Multipurpose Services Cooperative Cooperative.Prosperous

Impatiens necrotic spot virus (INSV; family Tospoviridae, genus Orthotospovirus) is a thrips-borne pathogen that infects a wide range of ornamental and vegetable crops. INSV was first reported in lettuce (Lactuca sativa) in the Salinas Valley of CA (Monterey County) in 2006 (Koike et al. 2008). Since then, the pathogen has continued to impact lettuce production in the region, causing severe economic losses with increasing incidence and severity in recent years. Tomato spotted wilt virus (TSWV), another tospovirus, also infects lettuce, but its occurrence is much less frequent than INSV (Kuo et al. 2014). While INSV has not been reported in the desert areas of CA and AZ, there are concerns that the virus could become established in this region. In early March 2021, symptoms resembling those caused by orthotospovirus infection were observed in several romaine and iceberg lettuce fields in the Yuma and Tacna regions of Yuma County, AZ. Symptoms included leaves that exhibited tan to dark brown necrotic spots, distorted leaf shapes, and stunted plant growth. Similar symptoms were also reported in romaine fields and one green leaf and iceberg lettuce field in the neighboring Imperial and Riverside Counties of CA. A total of 14 samples (5 from Tacna, 4 from Yuma, 4 from Imperial, 1 from Riverside) were tested using ImmunoStrips (Agdia, Elkhart, IN) for INSV and TSWV. Results confirmed the presence of INSV in 13 out of 14 samples, and the absence of INSV in one sample originating from Yuma. All 14 samples tested negative for TSWV. The 13 INSV positive samples were processed for RT-PCR validation. Total RNA was extracted from each sample using the RNeasy Plant Mini Kit (Qiagen, Valencia, CA). RT-PCR was performed with OneStep Ahead RT-PCR Kit (Qiagen) with primers to the N gene of INSV S RNA (Accession KF745140.1; INSV F = CCAAATACTACTTTAACCGCAAGT; INSV R = ACACCCAAGACACAGGATTT). All reactions generated a single amplicon at the correct size of 524 bp. One sample each from Yuma, Tacna, and Brawley (Imperial County), as well as a romaine lettuce sample collected from the Salinas Valley in March 2021, were sent for Sanger bi-directional sequencing (Eton Biosciences, San Diego, CA). Sequence analysis revealed that all three desert samples (Yuma, Tacna, and Brawley with Accessions OK340696, OK340697, OK340698, respectively) shared 100% sequence identity and 99.43% identity to the Salinas Valley 2021 sample (SV-L2, Accession OK340699). Additionally, all desert samples shared 99.24% sequence identity to the Salinas Valley lettuce isolate previously described in 2014 (SV-L1, Accession KF745140.1; Kuo et al. 2014), while the SV-L2 and SV-L1 sequences shared 99.43% identity. By the end of the season (April 2021) a total of 43 lettuce fields in Yuma County, AZ, and 9 fields in Imperial and Riverside Counties, CA were confirmed to have INSV infection using ImmunoStrips. Impacted fields included romaine, green leaf, red leaf, and head lettuce varieties, and both direct-seeded and transplanted lettuce, under conventional and organic management regimes. In AZ, INSV incidence in fields ranged between 0.2% and 33%, while in Imperial and Riverside Counties, CA, field incidence remained low at less than 0.1%. It is possible that INSV was introduced from the Salinas Valley of CA through the movement of infected lettuce transplants and/or thrips vectors. To our knowledge, this is the first report of INSV infecting lettuce in Arizona and the southern desert region of California.

This study determined the seasonal variability of free-living nematode communities structure (genus/family level) in organic shrimp farms ponds in Tam Giang commune, Nam Can district, Ca Mau province. Based on the result of SIMPER analysis, the average similarity in nematode communities at genus level was low with 30.75% and 30.81% (in dry and rainy season, respectively). However, the average dissimilarity between seasons was considerably high with 71.75%. Terschellingia, Daptonema, and Parodontophora were main genera contributing to similarity/dissimilarity between seasons. At the family level, results of SIMPER analysis showed that the average similarity was low with 37.12% and 39.02% (dry and rainy, respectively). Additionally, the average dissimilarity between dry and rainy season was fairly high with 64.06%. Specifically, four families such as Linhomoeidae, Xyalidae, Axonolaimidae, and Chromadoridae were the main families contributing to similarity/dissimilarity between seasons. Differences in sediment environmental characteristics between dry and rainy season are the reason for dissimilarity in the nematode communities structure. The high abundance of genus Terschellingia, Daptonema, Parodontophora may be indicative of organic enrichment conditions in shrimp pond sediment in both seasons. Nematodes with their rapid adaptation to changing environments can be used as a potential tool for bio-indicator. Keywords Bio-indicator, Ca Mau province, nematode communities, organic shrimp farms ponds, simper analysis References [1] Lin, F. Y., Vo, A. H., Phan, V. B., Nguyen, T. T., Bryla, D., Tran, C. T., ... & Robbins, J. B., The epidemiology of typhoid fever in the Dong Thap Province, Mekong Delta region of Vietnam, The American journal of tropical medicine and hygiene 62(5) (2000) 644-648.[2] Semprucci F, Moreno M, Sbrocca S, Rocchi M, AlbertelliG, Balsamo, M., The nematode assemblage as a tool for the assessment of marine ecological quality status: a case-study in the Central Adriatic Sea, Mediterranean Marine Science 14(1) (2013) 48-57.[3] Ngo, Q. X., Nguyen, N. C., Nguyen, D. T., & Vanreusel, A., Distribution pattern of free living nematode communities in the eight Mekong estuaries by seasonal factor, Journal of Vietnamese Environment 4(1) (2013) 28-33.[4] Heip, C., Vincx, M., Vranken G., The ecology of marine nematodes, Oceanography and Marine Biology: An Annual Review 23 (1985) 399-489.[5] Hodda, M., Nicholas, W.L., Nematode diversity and industrial pollution in the Hunter River Estuary, NSW, Australia, Marine Pollution Bulletin 17 (1986) 251-255.[6] Alongi D.M., Intertidal zonation and seasonality of meiobenthos in tropical mangrove estuaries, Marine Biology 95 (1987) 447-458.[7] Tudorancea, C., & Zullini, A., Associations and distribution of benthic nematodes in the Ethiopian Rift Valley lakes, Hydrobiologia, 179(1) (1989) 81-96.[8] Hodda M., Nicholas W.L., Production of meiofauna in an Australian estuary, Wetland 9 (1990) 41-48.[9] Beier, S., & Traunspurger, W., Seasonal distribution of free-living nematodes in the Körsch, a coarse-grained submountain carbonate stream in southwest Germany, Nematology 5(4) (2003) 481-504.[10] Hourston, M., Potter, I. C., Warwick, R. M., Valesini, F. J., & Clarke, K. R., Spatial and seasonal variations in the ecological characteristics of the free-living nematode assemblages in a large microtidal estuary, Estuarine, Coastal and Shelf Science 82(2) (2009) 309-322.[11] Tran, T.T., Pham, T.L., Nguyen, T., Ngo, X. Q., Relationship of free-lingving nematode communities to some environmental characteristics in the organic shrimp farms, Ca Mau province, Vietnam Journal of Science and Technology 56(5) (2018).[12] Tran, T. T., Nguyen, T. M. Y., Nguyen, T., Ngo, X. Q., Meiofauna in the mangrove–shrimp farms ponds, Ca Mau province, Vietnam Journal of Science and Technology 55(3) (2017) 271.[13] El Hag E. A., Food and food selection of the Penaeid prawn Penaeus monodon (Fabricius), In Limnology and Marine Biology in the Sudan, Springer Netherlands, (1984) 213-217.[14] Chong V. C., Sasekumar A., Food and feeding habits of the white prawn Penaeus merguiensis, Marine ecology progress series 5 (20) (1981) 185-191.[15] Nguyen Thi My Yen, Tran Thanh Thai, Nguyen Tan Duc, Ngo Xuan Quang, Free living nematode communities as fundamental food for shrimps in the ecological - model of mangrove - shrimp farming ponds, Nam Can district, Ca Mau province, Vietnam Journal of Biotechnology, 16(3) (2018), 581 -588.[16] Clarke, K.R. and Gorley, R.N., PRIMER v6: User Manual/Tutorial PRIMER-E: Plymouth (2006).[17] Ingels, J., Tchesunov, A. V. and Vanreusel, A., Meiofauna in the Gollum Channels and the Whittard Canyon, Celtic Margin—how local environmental conditions shape nematode structure and function, PLoS One 6(5) (2011) e20094.[18] Cai, L., Fu, S., Yang, J. and Zhou, X., Distribution of meiofaunal abundance in relation to environmental factors in Beibu Gulf, South China Sea, Acta Oceanologica Sinica 31(6) (2012) 92-103.[19] Ngo, X. Q., Smol, N. and Vanreusel, A., The meiofauna distribution in correlation with environmental characteristics in 5 Mekong estuaries, Vietnam, Cahiers de Biologie Marine 54 (2013) 71 -83.[20] Górska, B., Grzelak, K., Kotwicki, L., Hasemann, C., Schewe, I., Soltwedel, T. and W łodarska-Kowalczuk, M., Bathymetric variations in vertical distribution patterns of meiofauna in the surface sediments of the deep Arctic ocean (HAUSGARTEN, Fram strait), Deep Sea Research Part I: Oceanographic Research 91 (2014) 36-49.[21] Mueller, M., Pander, J., & Geist, J., The effects of weirs on structural stream habitat and biological communities, Journal of Applied Ecology 48(6) (2011) 1450-1461.[22] Schratzberger, M., Warr, K., Rogers, S. I., Patterns of nematode populations in the southwestern North Sea and their link to other components of the benthic fauna, Journal of Sea Research 55 (2006) 113–127.[23] Moreno, M., Albertelli, G., and Fabiano, M., Nematode response to metal, PAHs and organic enrichment in tourist marinas of the mediterranean sea, Marine Pollution Bulletin 58(8) (2009) 1192-1201.[24] Alves, A. S., Adão, H., Ferrero, T. J., Marques, J. C., Costa, M. J., & Patrício, J., Benthic meiofauna as indicator of ecological changes in estuarine ecosystems: the use of nematodes in ecological quality assessment, Ecological Indicators 24 (2013) 462-475.[25] Moreno, M., Semprucci, F., Vezzulli, L., Balsamo, M., Fabiano, M., & Albertelli, G., The use of nematodes in assessing ecological quality status in the Mediterranean (2) (2011) 328-336.

Бұл мақалада аутистік спектр бұзылысы бар балалардың сөздік қорын дамыту мәселелері қарас- тырылды. Аутистік спектр бұзылысы бар балалардың санының артуы мен оларды түзету әдістерінің Отандық әдістемесінің жеткіліксіздігі аталған тақырыптың өзектілігін негіздеуге себеп болады. Аутистік спектр бұзылысы – ерік-жігер саласының бұзылыстары арқылы көрінетін ерекше білімді қажет ететін балалар тобының бірі. Бұл балаларда ерік-жігер саласының теңгерімсіздігі, сөйлеу тілінің бұзылыстары және мінез-құлықтың қиындықтары байқалады. Аутистік спектр бұзылысы бар балаларды Р.Каннердің жеке аңғарым ретінде қарастырылуы мен бүгінгі күнгі зерттеулерге дейінгі аралықта көптеген ғылым еңбектер жазылып, зерттеу жұмыстары жүргізілді. Алайда, Отандық ғылымда аталған тақырып әлі күнге дейін жеткілікті түрде зерттелмеген. Шет елдік әдебиеттер мен зерттеу жұмыстары бүгінгі таңда аутистік спектр бұзылысы бар балалардың мінез-құлық бұзылыстарын түзетудің ең оңтайлы әдісі АВА терапия екендігін дәлелдеп отыр. Сол себепті, зерттеу барысында аутистік спектр бұзылысы бар балалардың сөздік қорының дамуын зерттеу мен оны АВА – терапия арқылы дамыту жұмысының педагогикалық шарттары анықталды. Педагогикалық шарттарды логопедиялық жұмыста қолдану баланың сөйлеу тілін дамытып қана қоймай, оның жағымсыз мінез-құлқының деңгейінің азаюына да ықпал етеді. Американдық психиатр И.Ловаастың «жеке блоктар арқылы оқыту» әдісі және Ф.С. Скиннердің «мінез-құлықты қолданбалы талдау» әдістерінің және Л.С. Выготскийдің концепциялары негізінде жасақталған қағидаларды логопедия қағидаларымен ұштастыра отырып, сөздік қорын дамыту жұмысы- ның траекториясы ұсынылды. Ұсынылған жұмыстарды логопедиялық сабақтарда қолдану және сәтті енгізу болжануда. Кілттік сөздер: аутистік спектр бұзылысы, сөздік қоры, логопедия, АВА – терапия, қолданбалы талдау, мінез-құлық. В данной статье были рассмотрены вопросы развития словарного запаса у детей с расстройствами аутистического спектра. Увеличение числа детей с расстройствами аутистического спектра и недостаточ- ная отечественная методика методов их коррекции обусловливают обоснование актуальности данной темы. Расстройство аутистического спектра – одна из групп детей, нуждающихся в особых знаниях, проявляющихся в нарушениях сферы воли. У этих детей наблюдается дисбаланс в области воли, нарушения речи и трудности в поведении. Детей с расстройствами аутистического спектра, в период от рассмотрения Р. Каннером как личной долины до современных исследований, было написано много научных трудов и проведено исследование. Однако в отечественной науке данная тема до сих пор недостаточно изучена. Зарубежная литература и исследовательские работы доказывают, что на сегодняшний день самым оптимальным методом коррекции поведенческих расстройств у детей с расстройствами аутистического спектра является АВА – терапия. Поэтому в ходе исследования были выявлены педагогические условия работы по изучению развития словарного запаса детей с расстройствами аутистического спектра и его развитию с помощью АВА – терапии. Применение педагогических условий в логопедической работе способствует не только развитию речи ребенка, но и снижению уровня его негативного поведения. Предложена методика американского психиатра И. Ловааса «обучение через отдельные блоки» и траектория работы по развитию словарного запаса в сочетании с принципами логопедии, разработанными на основе методов «прикладного анализа поведения» Ф. С. Скиннера и концепций Л. С. Выготского. Предполагается использование и успешное внедрение предложенных работ на логопедических занятиях. Ключевые слова: расстройство аутистического спектра, словарный запас, логопедия, АВА – терапия, прикладной анализ, поведение. In this article, the issues of vocabulary development in children with autism spectrum disorders were considered. The increase in the number of children with autism spectrum disorders and the insufficient domestic methodology of methods of their correction determine the justification of the relevance of this topic. Autism spectrum disorder is one of the groups of children in need of special knowledge, manifested in violations of the sphere of will. These children have an imbalance in the will, speech disorders and difficulties in behavior. Children with autism spectrum disorders, in the period from R. Kanner's consideration as a personal valley to modern research, many scientific papers were written and a study was conducted. However, this topic is still insufficiently studied in Russian science. Foreign literature and research works prove that today the most optimal method of correcting behavioral disorders in children with autism spectrum disorders is ABA therapy. Therefore, in the course of the study, pedagogical conditions were identified for studying the development of the vocabulary of children with autism spectrum disorders and its development with the help of ABA therapy. The use of pedagogical conditions in speech therapy work contributes not only to the development of the child's speech, but also to a decrease in the level of his negative behavior. The method of the American psychiatrist I. Lovaas "learning through separate blocks" and the trajectory of work on vocabulary development in combination with the principles of speech therapy developed on the basis of the methods of "applied behavior analysis" by F. S. Skinner and the concepts of L. S. Vygotsky are proposed. It is assumed that the proposed works will be used and successfully implemented in speech therapy classes. Keywords: autism spectrum disorder, vocabulary, speech therapy, ABA therapy, applied analysis, behavior.

IntroductionFor both consumers and creators, Web series have been viewed for some time as an appealing alternative to television series. As Alice explains, creating content for the Web was once seen as “a last resort” for projects that were unable to secure funding for television production (59). However, the Web has, in recent years, become a “legitimized” space, allowing Web series to be considered a media platform capable of presenting narratives of various genres (Alice 59). Moreover, due to the lack of restrictions and overheads placed on Web producers, it is argued that there is more capacity to take risks in Web series and thus depict “a broader array of stories” (Christian, “The Web” 352). Nevertheless, television still remains the traditional mode of storytelling, and for many producers, it is still an “object of desire” (Christian, “The Web” 352). Emerging producers still see television as the ultimate “end goal”, leaving the Web as a sufficient platform that will allow them to create something. Alternatively, for many established creators, the Web is understood to be a stage upon which they can tell stories television would perhaps never consider. Regardless of why creators are attracted to the Web, the platform has indeed cemented its place as an alternative in the television media landscape. For Abbi Jacobson and Ilana Glazer, the Web, or more specifically, YouTube, provided an unbridled space for their creativity when nowhere else would. The two comediennes co-wrote and starred in their Web series, Broad City, back in 2009, and it has since been picked up by Comedy Central and successfully turned into a television series. The fourth season is set to air in August 2017. Both versions of the series follow two twenty-something women, Abbi Abrams and Ilana Wexler (played by Jacobson and Glazer respectively), as they explore themselves, and New York City. Broad City is one of the few Web series to be picked up as a television series and maintain its success; an impressive accomplishment, no matter how legitimate Web series have become. However, the unwavering devotion maintained by the television series to continue depicting millennial women in the same fashion as the Web series is, arguably, more impressive. With a focus on Broad City’s depiction of its two eccentric protagonists, this article explores how the transitions from Web to television are negotiated. In the case of Broad City, I contend that its unconventional start as a web series is what allows the television series to continue depicting contemporary womanhood honestly. Taking the Alternate Path: YouTubeDefined as “scripted, episodic and experimental videos made for the internet”, Web episodes (or Webisodes) hold many advantages to the traditional television medium (Kornblum; Peirce 317). Aware of these advantages and struggling to be noticed naturally for their work in the sketch comedy group, Upright Citizens Brigade (UCB), Glazer and Jacobson took to the Internet to write and create their own series, Broad City. This trend arose in 2007 during the difficult phase American television when the Writers Guild of America began its fifteen-month strike (De Moraes). During this time, Peirce states that producing a new program for television proved “almost impossible” (315). There was a level of uncertainty plaguing the future of prime-time television, and with budgets being refashioned, reality programs were filling television line-ups more than any other genre of show (Peirce 315). Within this climate, it is unsurprising that the Google-owned video-sharing website, YouTube, quickly became the frontrunner in online video (Christian, “The Web” 351). YouTube is argued to be responsible for opening the doors to the next wave of entertainment media, after pledging to give users their own personal video network. Suddenly, amateurs, independents and corporations alike were, for the first time, able to compete against each other in shaping this post-network era of television (Christian, “The Web” 351). Moreover, the premise of “anyone can upload” meant that this era allowed for a new variety of television, in a range of genres and storytelling modes that were once considered untouchable to television networks (Christian, “The Web” 351). Evidently, such freedom is appealing to all kinds of online content creators, no matter their status. Established actor, comedian, and writer Louis C.K. most recently joined the Web series movement with his creation Horace and Pete (2016-). The dark comedy is written, directed, and produced entirely by C.K. and he plays the main protagonist, Horace. However, the appeal was not so much the control he would potentially have over the product, but more how the viewers could access it. Upon the release of the pilot episode, C.K. released a statement clarifying why he made a series outside of the television studio system. He explains that he was intrigued by the idea of providing viewers with the newly made show “directly and immediately”, with each episode being posted onto his Website as soon as it is shot. Additionally, C.K. also sought to create a show “without the usual promotion” that, he states, tells the viewer “what the show feels and looks like before you get to see it yourself” (C.K.). It is clear that the unique nature of the modern medium provides benefits to creators at all levels. For the Broad City duo, who unlike C.K., had yet to be noticed, YouTube was appealing because it provided them with an outlet through which they could control the product themselves. Jacobson states, “After a while, we thought, ‘why are we trying to be on something that someone else controls?’” (Paumgarten). The Web series commenced in late 2009 and ran until 2011, with each episode ranging anywhere between one and eight minutes. In the thirty-three episodes created, Abbi and Ilana consistently find themselves in awkward and comedic situations while they try to navigate their lives in New York City. These awkward situations vary in their complexity. One episode simply looks at the two protagonists trying to survive riding the subway, while another looks at the issue of being catcalled and objectified by strangers. There is no narrative arc in either season, the storylines are simply extracted from the lives of the creators. Glazer and Jacobson have discussed this in various interviews, explaining that these characters are essentially exaggerations of themselves and the show is a “heightened version” of their dynamic (Amy Poehler’s Smart Girls, 2014; Justin; Matthews). As such, Broad City contributes to a well-established trend of comedians impersonating younger, lazier, and poorer versions of themselves. However, since the Web series’ thematic relies so heavily on the experiences and personality traits of the writers, Glazer and Jacobson are more like the characters they portray than the likes of Tina Fey’s Liz Lemon (30 Rock, 2007-2013) or Lena Dunham’s Hannah Horvath (Girls, 2012-), for example. A result is that the Web series does not seek to provide its viewers with neat conclusions, or have the protagonists grow and evolve over the span of a season. This freedom is only designated to the Web series format, as television viewers – despite not always getting it – yearn for a heartier resolution (DeFino 99). Another attribute of video-sharing sites like YouTube is that they allow anyone to share anything they create, regardless of the budget. The two seasons of Broad City, the Web series, are written, created, and produced by Glazer and Jacobson primarily. As they were still undiscovered, both women were working on the series with very limited funds, and were therefore only able to have friends or family assist them in the production. This results in a series which feels authentically home-made in its aesthetic; features which eventually become characteristics essential to the transferral from Web to television. Glazer and Jacobson resolved to make the Web series from a more professional standpoint by the second season by following a production schedule and choosing to treat the vignettes as if they were real television shorts. As Glazer states, the pair “just had a new attitude”, and suddenly the aim shifted from producing webisodes as a creative outlet, to pitching the show in Los Angeles (Kameir). By the time the final episode was set to go into production, the two creators believed that the chances of having the series picked up by a network would increase if the episode featured a guest star. Because of their involvement in the UCB, Glazer and Jacobson approached one of the founders of the sketch group, Amy Poehler, to make a brief cameo. The Web series as a whole had garnered half a million hits, but the finale in which Poehler plays herself, received almost seventy-five thousand (Paumgarten). Poehler agreed to work with the Broad City duo following her appearance in the finale, and signed on to be Executive Producer should the show ever be made into a television series. The star power held by Poehler is undoubtedly a lead contributor to the success in Broad City’s transfer between the media. Poehler states that she felt a kinship towards the project because of her work in translating UCB sketches to television. In a roundtable interview, she says “Feeling very protective about the material, but wanting to bring it to a bigger audience…I related to that and understood it” (The Paley Centre for Media). On the difficult business of bringing Web series to television, Poehler compares it to that of an organ transplant, explaining “You have to move fast. You have to keep it on ice and be careful not to harm it in any way. A lot of things can go wrong. Sometimes the best way to get a heart or a kidney to a recipient is to get people to move out of the way” (Paumgarten). With Poehler’s assistance, the concept of Broad City as a television series was introduced to various networks before being successfully picked up by Comedy Central. From January of 2014, the network aired Broad City’s first season, comprised of ten, twenty-two-minute-long episodes. Averaging 1.2 million viewers per episode, season one of Broad City became one of Comedy Central’s highest rated shows since 2012 (Ng). From Web to TV: Alternative Ideas of Millennial Women in Broad CityThe factors behind why certain texts effectively transfer from Web to television and others fail continues to be debated within academic and popular culture circles. Series such as Quarterlife (2007), The CollegeHumor Show (2009), and the more recent Haters Back Off (2016-) - all texts which were originally made for online consumption only - were each met with criticism when translated for television (Peirce 317; Lowry; Christian, “How” ). This does not necessarily mean that a Web series is undeserving of a place in commercial or network television. Obviously, it comes down to multiple factors, but often it is because the television series comes across as out of touch, compared to its online version. As Alice points out, with the speed of online release, and the “virality” that accompanies this kind of media, writers have the ability to be “guided by and to capitalise on what and how the viewer public feels” (60). Television series are often seen commenting on outside criticism within episodes, but there is extensive lagging due to the time it takes to produce a season. Broad City was set to have an easier time on television, what with its impressive following, and “Celebrity Shepherd”, Amy Poehler - Poehler presented as a necessity when making the jump from Web to TV, according to Christian (“The Web”). But there appears to be a fine line when shifting between the platforms: in staying too close to the original, a series could come off as unoriginal and therefore unnecessary. Or, alternatively, a series could add too many other storylines in order to fill the time slot, and ruin the simplicity of the premise. Adaptation theorist, Linda Hutcheon, contends that a successful translation occurs when a text remains loyal to the original, but brings creativity to the reimagining (21). If investigating the transferral within the realm of adaptation theory, Broad City’s success as a television series is arguably due to it following this formula. Hutcheon writes that to adapt is not to slavishly copy, but rather, is the process of reclaiming the adapted material. “What one does with the text” is where the novelty is found (21). In looking at what Broad City, the television series, has done with Broad City, the Web series, there is clear loyalty shown to the original. This is seen most significantly in the treatment of the same two protagonists, and the dynamic of their friendship. In both versions of Broad City, Abbi is the older of the two and the more responsible one, to a degree. While she still enjoys smoking marijuana with Ilana, Abbi is also constantly striving to reach traditional goals in her life such as having a career she enjoys, or maintaining a healthy relationship. Ilana, on the other hand, is a proud marijuana enthusiast who occasionally shows up for her job, but cares more for smoking weed, enjoying casual sex, and being with her friends (primarily Abbi). Neither the Web series nor the television series explicitly states how the two characters met, but it is implied that they have built a strong, sister-like relationship with one another. Often Ilana comments on her sexual attraction to Abbi, but it is always seen as comedic rather than as a hint towards a possible coupling in future episodes. In the Web series’ second season, the episode Valentine’s Day, introduces this satirical take on female friendships for the first time. The three-minute episode shows brief cuts of Abbi and Ilana doing various activities in the city, all of which are stereotypically featured in films of the romantic comedy genre. As they play in the snow, ride a ferry, and watch couples ice-skate at the Rockefeller Centre, the clarinet music playing over the sequence builds momentum. However, the scene is suddenly halted as Ilana goes in to kiss Abbi and, unlike in said romantic film montages, Abbi quickly jolts back and cries “Ilana, what the fuck? How many times do I have to fucking tell you?” This is the first line of audible dialogue in the scene thus far, to which a frustrated Ilana responds, “I’m trying to seal the night with a kiss.” Following this is a heated debate regarding how each character viewed the intention of the day, with Ilana thinking it was a really “romantic day”, despite knowing that Abbi is decidedly heterosexual. This kind of satirical angle taken towards the trope of female friendship is carried over to the television series and made just as prominent, with almost every single episode making a joke at Ilana’s romantic desire for Abbi. Alongside the sexual attraction, the closeness of the two female leads remains unchanged between the two media. In the television series, for example, jokes about Ilana’s love for Abbi are scattered throughout, and as in the original series, they remain brief and inconsequential. In the television pilot, What a Wonderful World, the episode opens to a typical scene of the two characters having a V-chat (a nod to a favoured motif in the Web series). While chatting to Abbi, it initially appears as though Ilana is bopping up and down to the music of Lil Wayne. However, it is quickly revealed when Ilana shifts her laptop screen down, that she is actually having sex with her casual partner, Lincoln (Hannibal Buress). The sequence cuts to Abbi looking outraged at her laptop, asking “Oh my god, is that Lincoln?”. Lincoln then replies, “Yep”, just before the camera cuts to him lying on the bed, with Ilana’s laptop on his stomach. When Abbi asks if they are having sex, Ilana casually replies “I’m just keeping it warm”, forcing Abbi to once again have a discussion about boundaries. Once they close the V-chat, the scene stays on a low angle shot of Ilana as she says to Lincoln, “That was like a threesome”, reassuring the audience that she has learned nothing. This is a strong opening scene as it reinforces the understanding that the relationship between the two characters is unchanged. Furthermore, it proves to audiences that although Broad City has moved into a television landscape, it will not be tamed. The result of refusing to be tamed in its new environment is that Broad City can continue representing female friendship in more honest ways, as well as offer new ideas of what it is to be a millennial woman today.Conclusion In an interview, Glazer explains how television has a history of never being honest in its representation of women, arguing, “Nothing’s real on TV” (Miller). Jacobson follows on from this, stating “When we write for these characters… I think the thing we talk about the most is like, well, what would we really do? It’s just real” (Miller). In abiding by this sentiment throughout the web series and the television series, Broad City effectively offers the idea that depicting diversity is possible on both platforms. With various Web series still unable to successfully make the jump to television today, it becomes more obvious that Broad City’s decision to continue showcasing bold female narratives is what allows it to maintain its popularity. Starting in such an uninhibited environment has proven a burden for other texts when it comes to transferring creativity to the more traditional medium of television. For Broad City, however, the alternative storytelling platform allowed the show to create its strong foundation and dedicated fan base. One that has willingly followed Broad City across the platforms, but will only stay tuned if it stays true to representing millennial women honestly, regardless of whether mainstream television is ready.ReferencesAlice, Jessica. “Clicking with Audiences: Web Series and Diverse Representations.” Metro Magazine: Media and Education 187 (2016): 58-63.Angelo, Megan. “The Sneak Attack Feminism of Broad City.” Wall Street Journal, 2011. 17 Dec. 2016 <http://blogs.wsj.com/speakeasy/2011/02/14/the-sneak-attack-feminism-of-broad-city/>. Blay, Zeba, “How Feminist TV Became the New Normal.” Huffington Post, 2015. 15 Dec. 2016. <http://www.huffingtonpost.com.au/entry/how-feminist-tv-became-the-new-normal_n_7567898>. Broad City. Comedy Central. New York City. 22 Jan. 2014. Television.“Broad City: Smart Girls w/ Amy Poehler.” YouTube. Uploaded by Amy Poehler’s Smart Girls, 17 May 2013. 15 Dec. 2016 <https://www.youtube.com/watch?v=gd0Lovd4Xv0>.Christian, Aymar Jean. “How Does a Web Series Jump to TV?” IndieWire 2014. 2 Dec. 2016. 15 Dec. 2016 <http://www.indiewire.com/2014/02/how-does-a-web-series-jump-to-tv-29618/>. ———. “The Web as Television Reimagined? Online Networks and the Pursuit of Legacy Media.” Journal of Communication Enquiry 36.4 (2012): 340-356.C.K., Louis. “On Horace and Pete.” LouisCK 2016. 2 Jan. 2017 <https://louisck.net/news/about-horace-and-pete>. DeFino, D.J. The HBO Effect. Sydney: Bloomsbury Academic, 2014. De Moraes, L. "Score One for Old Media." Washington Post, 27 Feb. 2008. 28 Dec. 2016 <www.washingtonpost.com/wp-dyn/content/article/2008/02/27/AR2008022703374.html>. Girls. HBO Time Warner. New York City. 15 Apr. 2012. Television. Haters Back Off. Netflix. Scotts Valley. 14 Oct. 2016. Television. Hutcheon, L. A Theory of Adaptation. 2nd ed. New York: Routledge, 2013. Kameir, R. “7 Tips for Making a Hit TV Show, According to the Creators of Broad City.” Fader 22 May 2015. 1 Aug. 2016 <http://www.thefader.com/2015/05/22/7-tips-for-making-a-hit-tv-show-according-to-the-creators-of-broad-city>. Kornblum, Janet, “Check Out These Episodes of Webisodes.” USA Today 12 Dec. 2007. 16 Dec. 2016 <http://www.usatoday.com/life/2007-11-12-webisodes-side_N.htm>.Lowry, Brian, “’Haters Back Off’ Doesn’t Earn Much Love on Netflix.” CNN 12 Oct. 2016. 2 Dec. 2016 <http://edition.cnn.com/2016/10/12/entertainment/haters-back-off-review/>.Miller, B. “Broad City Talks Friendship, Feminism, and F*ck/Marry/Kill.” Bust Magazine 2015. 17 Nov. 2016 <http://bust.com/tv/13755-broad-city-talks-friendship-feminism-and-f-ck-marry-kill.html>.Ng, P. “Comedy Central Renews ‘Broad City’ for Second Season.” Hollywood Reporter 2014. 1 Aug. 2016 <http://www.hollywoodreporter.com/live-feed/broad-city-renewed-season-2-683083>.Paley Center for Media. “Broad City – Ilana Glazer, Abbi Jacobson, Amy Poehler, and Seth Rogen.” YouTube. Uploaded by The Paley Center for Media, 16 Dec. 2014. 15 Dec. 2016 <https://www.youtube.com/watch?v=4Ab9AmSk8Yg>.Pierce, Meghan L. “Remediation Theory: Analyzing What Made Quarterlife Successful as an Online Series and Not a Television Series.” Television & New Media 12.4 (2011): 314-325. Quarterlife. NBC. Los Angeles. 26 Feb. 2008. Television.The CollegeHumor Show. MTV. New York City. 8 Feb. 2009. Television. 30 Rock. NBC. Los Angeles. 3 Dec. 2007. Television. “Valentine’s Day.” YouTube. Uploaded by Broad City, 12 Feb. 2011. 15 Dec. 2016 <https://www.youtube.com/watch?v=JcoJW2BOs6g&index=1&list=PLA51423997CDEA1DA>. “What a Wonderful World.” Broad City. Comedy Central, 22 Jan. 2014. Television.

Introduction -- Making Sense of the (Virtual) World Computer games are never "just games". Computer games are models of reality and if they were not, we would never be able to understand them. Models serve three functions; they capture important, critical features of that which is to be represented while ignoring the irrelevant, they are appropriate for the person and they are appropriate for the task -- thereby enhancing the ability to make judgements and discover relevant regularities and structures (Norman 1993). Despite the inherently unvisualisable nature of computer code -- the flexible material of which all software constructs are built -- computer code is still the most "salient" ingredient in computer games. Less salient are those assumptions that are "built into" the software. By filtering out those parts of reality that are deemed irrelevant or unnecessary, different sorts of assumptions, different sorts of bias are automatically built into the software, reified in the very computer code (Friedman 1995, Friedman and Nissenbaum 1997). Here I will analyse some of the built-in structures that constitute the fabric of a special sort of game, a MUD. A MUD is an Internet-accessible "multi-participant, user-extensible virtual reality whose user interface is entirely textual" (Curtis, 1992). The specific MUD in question is a nine-year old Swedish-language adventure MUD called SvenskMUD ("SwedishMUD") that is run by Lysator, the academic computer club at Linköping University, Sweden. I have done field studies of SvenskMUD over a period of three and a half years (Pargman, forthcoming 2000). How is the SvenskMUD adventure world structured and what are the rules that are built into the fabric of this computer game? I will describe some of the ways in which danger and death, good and evil, courage, rewards and wealth are handled in the game. I will conclude the paper with a short analysis of the purpose of configuring the player according to those structures. Revocable Deaths Characters (personae/avatars) in SvenskMUD can be divided into two categories, players and magicians. Making a career as a player to a large part involves solving quests and killing "monsters" in the game. The magicians are all ex-players who have "graduated" and gone beyond playing the game of SvenskMUD. They have become the administrators, managers and programmers of SvenskMUD. A watchful eye is kept on the magicians by "God", the creator, owner and ultimate custodian of SvenskMUD. My own first battle in the game, in a sunlit graveyard with a small mouse, is an example of a bit-sized danger suitable for newcomers, or "newbies". I correctly guessed that the mouse was a suitably weak opponent for my newborn character, but still had to "tickle" the mouse on its belly (a euphemism for hitting it without much force) 50 times before I managed to kill it. Other parts of this epic battle included 45 failed attempts of mine to "tickle" the mouse, 39 successful "tickles" of the mouse and finally a wild chase around the graveyard before I caught up with the mouse, cornered it and managed to kill it and end the fight. Although I was successful in my endeavour, I was also more than half dead after my run-in with the mouse and had to spend quite some time engaged in more peaceful occupations before I was completely healed. It was only later that I learned that you can improve your odds considerably by using weapons and armour when you fight... Should a SvenskMUD player fail in his (or less often, her) risky and adventurous career and die, that does not constitute an insurmountable problem. Should such a thing pass, the player's ghost only has to find the way back to a church in one of the villages. In the church, the player is reincarnated, albeit with some loss of game-related abilities and experience. The way the unfortunate event of an occasional death is handled is part of the meta-rules of SvenskMUD. The meta-rules are the implicit, underlying rules that represent the values, practices and concerns that shape the frame from which the "ordinary" specific rules operate. Meta-rules are part of the "world view that directs the game action and represents the implicit philosophy or ideals by which the world operates" (Fine 1983, 76). Despite the adventure setting with all its hints of medieval lawlessness and unknown dangers lurking, SvenskMUD is in fact a very caring and forgiving environment. The ultimate proof of SvenskMUD's forgiveness is the revocable character of death itself. Fair Dangers Another SvenskMUD meta-rule is that dangers (and death) should be "fair". This fairness is extended so as to warn players explicitly of dangers. Before a dangerous monster is encountered, the player receives plenty of warnings: You are standing in the dark woods. You feel a little afraid. East of you is a small dark lake in the woods. There are three visible ways from here: east, north and south. It would be foolish to direct my character to go east in this situation without being adequately prepared for encountering and taking on something dangerous in battle. Those preparations should include a readiness to flee if the expected danger proves to be superior. If, in the example above, a player willingly and knowingly directs a character to walk east, that player has to face the consequences of this action. But if another player is very cautious and has no reason to suspect a deadly danger lurking behind the corner, it is not considered "fair" if that player's character dies or is hurt in such a way that it results in damage that has far-reaching consequences within the game. The dangerous monsters that roam the SvenskMUD world are restricted to roam only "dangerous" areas and it is considered good manners to warn players in some way when they enter such an area. Part of learning how to play SvenskMUD successfully becomes a matter of understanding different cues, such as the transition from a safe area to a dangerous one, or the different levels of danger signalled by different situations. Should they not know it in advance, players quickly learn that it is not advisable to enter the "Valley of Ultimate Evil" unless they have reached a very high level in the game and are prepared to take on any dangers that come their way. As with all other meta-rules, both players and magicians internalise this rule to such an extent that it becomes unquestionable and any transgression (such as a dangerous monster roaming around in a village, killing newbie characters who happen to stray its way) would immediately render complaints from players and corresponding actions on behalf of the magicians to rectify the situation. Meta-Rules as "Folk Ideas" Fine (1983, 76-8) enumerates four meta-rules that Dundes (1971) has described and applies them to the fantasy role-playing games he has studied. Dundes's term for these meta-rules is "folk ideas" and they reflect existing North American (and Western European) cultural beliefs. Fine shows that these folk ideas capture core beliefs or central values of the fantasy role-playing games he studied. Three of Dundes's four folk ideas are also directly applicable to SvenskMUD. Unlimited Wealth The first folk idea is the principle of unlimited good. There is no end to growth or wealth. For that reason, treasure found in a dungeon doesn't need a rationale for being there. This folk idea is related to the modernist concept of constant, unlimited progress. "Some referees even 'restock' their dungeons when players have found a particular treasure so that the next time someone enters that room (and kills the dragon or other beasties guarding it) they, too, will be rewarded" (Fine 1983, 76). To restock all treasures and reawaken all killed monsters at regular intervals is standard procedure in SvenskMUD and all other adventure MUDs. The technical term is that the game "resets". The reason why a MUD resets at regular intervals is that, while the MUD itself is finite, there is no end to the number of players who want their share of treasures and other goodies. The handbook for SvenskMUD magicians contains "design guidelines" for creating quests: You have to invent a small story about your quest. The typical scenario is that someone needs help with something. It is good if you can get the story together in such a way that it is possible to explain why it can be solved several times, since the quest will be solved, once for each prospective magician. Perhaps a small spectacle a short while after (while the player is pondering the reward) that in some way restore things in such a way that it can be solved again. (Tolke 1993, my translation) Good and Evil The second folk idea is that the world is a battleground between good and evil. In fantasy literature or a role-playing game there is often no in-between and very seldom any doubt whether someone encountered is good or evil, as "referees often express the alignment [moral character] of nonplayer characters through stereotyped facial features or symbolic colours" (Fine 1983, 77). "Good and evil" certainly exists as a structuring resource for the SvenskMUD world, but interestingly the players are not able to be described discretely in these terms. As distinct from role-playing games, a SvenskMUD player is not created with different alignments (good, evil or neutral). All players are instead neutral and they acquire an alignment as they go along, playing SvenskMUD -- the game. If a player kills a lot of mice and cute rabbits, that player will turn first wicked and then evil. If a player instead kills trolls and orcs, that player first turns good and then saint-like. Despite the potential fluidity of alignment in SvenskMUD, some players cultivate an aura of being good or evil and position themselves in opposition to each other. This is most apparent with two of the guilds (associations) in SvenskMUD, the Necromancer's guild and the Light order's guild. Courage Begets Rewards The third folk idea is the importance of courage. Dangers and death operate in a "fair" way, as should treasures and rewards. The SvenskMUD world is structured both so as not to harm or kill players "needlessly", and in such a way that it conveys the message "no guts, no glory" to the players. In different places in the MUD (usually close to a church, where new players start), there are "easy" areas with bit-sized dangers and rewards for beginners. My battle with the mouse was an example of such a danger/reward. A small coin or an empty bottle that can be returned for a small finder's fee are examples of other bit-sized rewards: The third folk idea is the importance of courage. Dangers and death operate in a "fair" way, as should treasures and rewards. The SvenskMUD world is structured both so as not to harm or kill players "needlessly", and in such a way that it conveys the message "no guts, no glory" to the players. In different places in the MUD (usually close to a church, where new players start), there are "easy" areas with bit-sized dangers and rewards for beginners. My battle with the mouse was an example of such a danger/reward. A small coin or an empty bottle that can be returned for a small finder's fee are examples of other bit-sized rewards: More experienced characters gain experience points (xps) and rise in levels only by seeking out and overcoming danger and "there is a positive correlation between the danger in a setting and its payoff in treasure" (Fine 1983, 78). Just as it would be "unfair" to die without adequate warning, so would it be (perceived to be) grossly unfair to seek out and overcome dangerous monsters or situations without being adequately rewarded. And conversely, it would be perceived to be unfair if someone "stumbled over the treasure" without having deserved it, i.e. if someone was rewarded without having performed an appropriately difficult task. Taken from the information on etiquette in an adventure MUD, Reid's quote is a good example of this: It's really bad form to steal someone else's kill. Someone has been working on the Cosmicly Invulnerable Utterly Unstoppable Massively Powerful Space Demon for ages, leaves to get healed, and in the interim, some dweeb comes along and whacks the Demon and gets all it's [sic] stuff and tons of xps [experience points]. This really sucks as the other person has spent lots of time and money in expectation of the benefits from killing the monster. The graceful thing to do is to give em [sic] all the stuff from the corpse and compensation for the money spent on healing. This is still a profit to you as you got all the xps and spent practically no time killing it. (Reid 1999, 122, my emphasis) The User Illusion An important objective of the magicians in SvenskMUD is to describe everything that a player experiences in the SvenskMUD world in game-related terms. The game is regarded as a stage where the players are supposed to see only what is in front of, but not behind the scenes. A consistent use of game-related terms and game-related explanations support the suspension of disbelief and engrossment in the SvenskMUD fantasy world. The main activity of the MUD users should be to enter into the game and guide their characters through a fascinating (and, as much as possible and on its own terms, believable) fantasy world. The guiding principle is therefore that the player should never be reminded of the fact that the SvenskMUD world is not for real, that SvenskMUD is only a game or a computer program. From this perspective, the worst thing players can encounter in SvenskMUD is a breakdown of the user illusion, a situation that instantly transports a person from the SvenskMUD world and leaves that person sitting in front of a computer screen. Error messages, e.g. the feared "you have encountered a bug [in the program]", are an example of this. If a magician decides to change the SvenskMUD world, that magician is supposed to do the very best to explain the change by using game-related jargon. This is reminiscent of the advice to "work within the system": "wherever possible, things that can be done within the framework of the experiential level should be. The result will be smoother operation and greater harmony among the user community" (Morningstar and Farmer 1991, 294). If for some reason a shop has to be moved from one village to another, a satisfactory explanation must be given, e.g. a fire occurring in the old shop or the old shop being closed due to competition (perhaps from the "new", relocated shop). Explanations that involve supernatural forces or magic are also fine in a fantasy world. Explanations that remind the player of the fact that the SvenskMUD world is not for real ("I moved the shop to Eriksros, because all magicians decided that it would be so much better to have it there"), or even worse, that SvenskMUD is a computer program ("I moved the program shop.c to another catalogue in the file structure") are to be avoided at all costs. Part of socialising magicians becomes teaching them to express themselves in this way even when they know better about the machinations of SvenskMud. There are several examples of ingenious and imaginative ways to render difficult-to-explain phenomena understandable in game-related terms: There was a simple problem that appeared at times that made the computer [that SvenskMUD runs on] run a little slower, and as time went by the problem got worse. I could fix the problem easily when I saw it and I did that at times. After I had fixed the problem the game went noticeably faster for the players that were logged in. For those occasions, I made up a message and displayed it to everyone who was in the system: "Linus reaches into the nether regions and cranks a little faster". (Interview with Linus Tolke, "God" in SvenskMUD) When a monster is killed in the game, it rots away (disappears) after a while. However, originally, weapons and armour that the monster wielded did not disappear; a lucky player could find valuable objects and take them without having "deserved" them. This specific characteristic of the game was deemed to be a problem, not least because it furthered a virtual inflation in the game that tended to decrease the value of "honestly" collected weapons and loot. The problem was discussed at a meeting of the SvenskMUD magicians that I attended. It was decided that when a monster is killed and the character that killed it does not take the loot, the loot should disappear ("rot") together with the monster. But how should this be explained to the players in a suitable way if they approach a magician to complain about the change, a change that in their opinion was for the worse? At the meeting it was suggested that from now on, all weapons and shields were forged with a cheaper, weaker metal. Not only would objects of this metal "rot" away together with the monster that wielded them, but it was also suggested that all weapons in the whole game should in fact be worn down as time goes by. (Not to worry, new ones appear in all the pre-designated places every time the game resets.) Conclusion -- Configuring the Player SvenskMUD can easily be perceived as a "blooming buzzing confusion" for a new player and my own first explorations in SvenskMUD often left me confused even as I was led from one enlightenment to the next. Not everyone feels inclined to take up the challenge to make sense of a world where you have to learn everything anew, including how to walk and how to talk. On the other hand, in the game world, much is settled for the best, and a crack in a subterranean cave is always exactly big enough to squeeze through... The process of becoming part of the community of SvenskMUD players is inexorably connected to learning to become an expert in the activities of that community, i.e. of playing SvenskMUD (Wenger 1998). A player who wants to program in SvenskMUD (thereby altering the fabric of the virtual world) will acquire many of the relevant concepts before actually becoming a magician, just by playing and exploring the game of SvenskMUD. Even if the user illusion succeeds in always hiding the computer code from the player, the whole SvenskMUD world constitutes a reflection of that underlying computer code. An implicit understanding of the computer code is developed through extended use of SvenskMUD. The relationship between the SvenskMUD world and the underlying computer code is in this sense analogous to the relationship between the lived-in world and the rules of physics that govern the world. All around us children "prepare themselves" to learn the subject of physics in school by throwing balls up in the air (gravity) and by pulling carts or sledges (friction). By playing SvenskMUD, a player will become accustomed to many of the concepts that govern the SvenskMUD world and will come to understand the goals, symbols, procedures and values of SvenskMUD. This process bears many similarities to the "primary socialisation" of a child into a member of society, a socialisation that serves "to make appear as necessity what is in fact a bundle of contingencies" (Berger and Luckmann 1966, 155). This is the purpose of configuring the player and it is intimately connected to the re-growth of SvenskMUD magicians and the survival of SvenskMUD itself over time. However, it is not the only possible outcome of the SvenskMUD socialisation process. The traditional function of trials and quests in fantasy literature is to teach the hero, usually through a number of external or internal encounters with evil or doubt, to make the right, moral choices. By excelling at these tests, the protagonist shows his or her worthiness and by extension also stresses and perhaps imputes these values in the reader (Dalquist et al. 1991). Adventure MUDs could thus socialise adolescents and reinforce common moral values in society; "the fantasy hero is the perfectly socialised and exemplary subject of a society" (53, my translation). My point here is not that SvenskMUD differs from other adventure MUDs. I would imagine that most of my observations are general to adventure MUDs and that many are applicable also to other computer games. My purpose here has rather been to present a perspective on how an adventure MUD is structured, to trace the meaning of that structure beyond the game itself and to suggest a purpose behind that organisation. I encourage others to question built-in bias and underlying assumptions of computer games (and other systems) in future studies. References Berger, P., and T. Luckmann. The Social Construction of Reality: A Treatise in the Sociology of Knowledge. London: Penguin, 1966. Curtis, P. "MUDding: Social Phenomena in Text-Based Virtual Realities." High Noon on the Electronic Frontier. Ed. P. Ludlow. Cambridge, MA: MIT P, 1996. 13 Oct. 2000 <http://www.ibiblio.org/pub/academic/computer-science/virtual-reality/communications/papers/muds/muds/Mudding-Social-Phenomena.txt>. Dalquist, U., T. Lööv, and F. Miegel. "Trollkarlens lärlingar: Fantasykulturen och manlig identitetsutveckling [The Wizard's Apprentices: Fantasy Culture and Male Identity Development]." Att förstå ungdom [Understanding Youth]. Ed. A. Löfgren and M. Norell. Stockholm/Stehag: Brutus Östlings Bokförlag Symposion, 1991. Dundes, A. "Folk Ideas as Units of World View." Toward New Perspectives in Folklore. Ed. A. Paredes and R. Bauman. Austin: U of Texas P, 1971. Fine, G.A. Shared Fantasy: Role-Playing Games as Social Worlds. Chicago: U of Chicago P, 1983. Friedman, B. and H. Nissenbaum. "Bias in Computer Systems." Human Values and the Design of Computer Technology. Ed. B. Friedman. Cambridge, UK: Cambridge UP, 1997. Friedman, T. "Making Sense of Software: Computer Games and Interactive Textuality." Cybersociety: Computer-Mediated Communication and Community. Ed. S. Jones. Thousand Oaks, CA: Sage, 1995. Morningstar, C. and F. R. Farmer. "The Lessons of Lucasfilm's Habitat." Cyberspace: The First Steps. Ed. M. Benedikt. Cambridge: MA, MIT P, 1991. 13 Oct. 2000 <http://www.communities.com/company/papers/lessons.php>. Norman, D. Things That Make Us Smart: Defending Human Attributes in the Age of the Machine. Reading, MA: Addison-Wesley, 1993. Pargman, D. "Code Begets Community: On Social and Technical Aspects of Managing a Virtual Community." Ph.D. dissertation. Dept. of Communication Studies, Linköping University, Sweden, forthcoming, December 2000. Reid, E. "Hierarchy and Power: Social Control in Cyberspace." Communities in Cyberspace. Ed. M. Smith and P. Kollock. London, England: Routledge, 1999. Tolke, L. Handbok för SvenskMudmagiker: ett hjälpmedel för byggarna i SvenskMUD [Handbook for SvenskMudmagicians: An Aid for the Builders in SvenskMUD]. Printed and distributed by the author in a limited edition, 1993. Wenger, E. Communities of Practice: Learning, Meaning and Identity. Cambridge, UK: Cambridge UP, 1998. Citation reference for this article MLA style: Daniel Pargman. "The Fabric of Virtual Reality -- Courage, Rewards and Death in an Adventure MUD." M/C: A Journal of Media and Culture 3.5 (2000). [your date of access] <http://www.api-network.com/mc/0010/mud.php>. Chicago style: Daniel Pargman, "The Fabric of Virtual Reality -- Courage, Rewards and Death in an Adventure MUD," M/C: A Journal of Media and Culture 3, no. 5 (2000), <http://www.api-network.com/mc/0010/mud.php> ([your date of access]). APA style: Daniel Pargman. (2000) The Fabric of Virtual Reality -- Courage, Rewards and Death in an Adventure MUD. M/C: A Journal of Media and Culture 3(5). <http://www.api-network.com/mc/0010/mud.php> ([your date of access]).

Introduction This article reports on the emerging findings from a study undertaken as part of an international research collaboration (Australia, Belgium, Italy, UK; DP180103922) exploring the benefits and risks of the Internet of Toys (IoToys). IoToys builds upon technological innovations such as smartphone apps that remotely control home-based objects, and wearable technologies that measure sleep patterns and exercise regimes (Holloway and Green). Mascheroni and Holloway summarise the features of IoToys as entities that users can program, with human-toy interactivity, and which have network connectivity. In this discussion we focus on children’s play with a small programmable robot named Cozmo (fig. 1). The robot also has an ‘explorer mode’ in which children can view the world through the eyes of Cozmo, and a camera which can film the robot’s view, accessed through the mobile app. Children are encouraged to personify Cozmo, including feeding the robot and keeping it tuned up. Cozmo also has numerous functions including tricks, a coding lab, and games that utilise three provided ‘Power Cubes’ that encourage child-robot interaction: Keep Away – the player slides the cube closer to Cozmo then pulls away quickly when Cozmo ‘pounces’ – the aim of the game is to ensure Cozmo misses the cube. Quick Tap – a colour matching game which involves hitting the cubes (before Cozmo) when the colours match. Memory Match – Cozmo shows a pattern of colours, and the player then taps the cubes in the right colour order – each round the pattern gets longer. Fig. 1: Cozmo Whilst the toy uses Wi-Fi rather than connecting directly to the Internet, Cozmo was chosen as a focus for the study because many of its characteristics are typical of IoToys, including connectivity, programmability, and the human-toy connection (Mascheroni and Holloway). Children’s play lives have been changed through the development of digital technologies including smartphones, tablets, laptops, and games consoles (Marsh et al.) and inevitably, children’s play experiences now cross a range of boundaries including the “virtual/physical world, online/offline and digital/nondigital” (Marsh 5). As IoToys become more prevalent in the toy market, there is an increasing need to understand how these connected toys transcend digital-material boundaries between toy and media technology. Whilst toys such as Cozmo share similar traits with traditional toys, they also increasingly share characteristics with computing devices (i.e., video games, mobile apps) and domestic media (i.e., Amazon Alexa; Berriman and Mascheroni). The combination of the traditional and digital adds a layer of complexity to children’s play experiences as the interaction between the child and the robot is ‘reconfigured as a bidirectional, multidimensional, multisensory experience’ (Mascheroni and Holloway 5). By asking ‘what types of play does an Internet-enabled toy engender?’, this article examines the capabilities and limitations of Cozmo for children’s play experiences. Currently, there is little reliable information about children’s IoToy use despite the media attention the subject attracts. Many assumptions are made regarding how technological devices offer restricted opportunities for play (see Healey et al.), and therefore it is vital to investigate the benefits and limitations of these new-generation technologies for parents and children. This article contributes to ongoing debates focussing on children’s playful engagement with digital technology and the importance of engaging parents in discussions on different types of play and children’s development. Methodology This international study involved thirteen families across four countries (Australia, Belgium, Italy, UK; Appendix 1). Ethical clearance was obtained prior to the commencement of the study. Consent was gained from both the children and the parents, and the children were specifically asked if they could be audio-recorded and photographed by the researchers. Pseudonyms have been used in this article. Families were visited twice by a researcher, with each visit lasting around an hour. Firstly, the children were interviewed about their favourite toys, and the parent was interviewed about their thoughts on their children’s (digital) play practices. This provided background information about the child’s play ecologies, such as the extent to which they were familiar with IoToys. Cozmo was also introduced to the children during the first visit and researchers ensured they were confident using the toy before leaving. Cozmo was left with the children to use for a period of between one and three months before the researcher returned for the second visit. Families were reinterviewed, with a focus on what they thought about Cozmo, and how the children had engaged with the toy in their play. Data were deductively analysed using a revised version of Hughes’s taxonomy of play that takes account of the digital aspect of children’s play contexts. Hughes’s original framework, identifying the types of play children engage in, was developed before the rise of digital media. The revised taxonomy was developed by Marsh et al. (see Appendix 2) in a study that examined how apps can promote children’s play and creativity. Data emerging from this study illuminated how Hughes’s taxonomy can be applied in digital contexts, demonstrating that “what changes in digital contexts is not so much the types of play possible, but the nature of that play” (Marsh et al. 250). The adapted framework was applied to the data as a way of analysing play with Cozmo across digital and non-digital spaces, and selections from the transcripts were chosen to illustrate the categories, discussed in the next section. Framing Children’s Digital and Non-Digital Play Practices The findings from the data highlight numerous digital play types (Marsh et al.) that occurred during the children’s interactions with the robot, primarily: Imaginative play in a digital context in which children pretend that things are otherwise. Exploratory play in a digital context in which children explore objects and spaces through the senses to find out information or explore possibilities. Mastery play in digital contexts in which children attempt to gain control of environments. Communication play using words, songs, rhymes, poetry in a digital context. Other types of play that were observed include: Virtual Locomotor play involving movement in a digital context e.g., child may play hide and seek with others in a virtual world. Object play in which children explore virtual objects through vision and touch. Social play in a digital context during which rules for social interaction are constructed and employed. Imaginative Play “Imaginative play” was prevalent in all the case study families, in particular anthropomorphic/zoomorphic play. Anthropomorphic/zoomorphic play can be categorised as imaginative play when children are aware that the object is not real; they display a willing suspension of disbelief. The morphology of social robots is often classified into anthropomorphic (i.e., human-like) and zoomorphic (i.e., animal-like) and different morphologies can elicit differences in how users perceive and interact with robots (Barco et al.). This was the case for the children in this research, who all referred to the fact that the toy was a robot but often described Cozmo as having human/animal attributes. Across the sample, the children talked about Cozmo as if it was a fellow human being or pet. Eleanor (aged 8) stated that “I feel like he’s one of my family”, while Emma (aged 8) said “we sometimes call him ‘brother’ because he is a little bit like family”. Martina (aged 8) observed that Cozmo sometimes has “hiccups'' that prevent him from responding to her queries, reasoning that “it happens by itself because it eats too much”. Louis (aged 9) did not refer to Cozmo as being human, although he did attribute emotions to the toy, mentioning that Cozmo runs in circles whenever he is happy. Sofia’s mother stated that “one thing that made me laugh is that for Sofia it is a puppy. So, she would pet it, give it kisses”. The mother of Aryana (aged 9) commented that “they tried to like treat it like a living thing, not like toy, like a pet . ... They treat it not like something dead or something frozen, something live”. Epley et al. suggest that anthropomorphisation occurs because knowledge that individuals have about humans is developed earlier than knowledge about non-human entities. Therefore, the knowledge children have of being human is drawn upon when encountering objects such as robots. It may be of little surprise that children react like this because, as Marsh (Uncanny Valley 58) argues, “younger children are likely to possess less knowledge about both human and non-human entities than older children and adults, and, therefore, are more likely to anthropomorphise”. Severson and Woodard (2) argue that even in cases where children know the object is not real, the children ascribe feelings, thoughts, and desires to objects in such a serious manner that anthropomorphism is a “pervasive phenomenon that goes beyond mere pretense”. Robot toys such as Cozmo are specifically designed to stimulate anthropomorphism/zoomorphism. Beck et al. have shown that head movements help children identify emotions in robots. Cozmo is programmed to recognise faces and learn names, which inevitably contributes to children feeling an emotional connection. For example, Eleanor (aged 8) remarked that “he was always looking at me and it looked like he was listening to me when I was talking”. The desire for a connection with the robot was so strong for Oscar (aged 7) that he deliberately programmed the robot to respond to him, saying “I can make him do happy stuff which makes me feel like he likes me”. Emma’s mother stated that whenever Emma (aged 8) did something that seemed to make Cozmo happy, she would do those things repeatedly. Emma also referred to Cozmo as having agency, for example, when Cozmo built towers or turned himself into a bulldozer. Even though she made those commands herself via the app, Emma attributed the idea and action to Cozmo. Overall, the children implemented imaginative play practices through the pretence of Cozmo’s ‘human-like’ attributes such as knowing their name, “looking at” and “listening to” them, and displaying different emotions such as love, anger, and happiness. Exploratory Play “Exploratory play” usually occurred when the children first received the toy and most of the children immediately wanted to get to know Cozmo’s features and possibilities. Arthur’s father stated that the first thing Arthur (aged 8) did was grab the remote and start clicking buttons to find out what would happen. Oscar’s mother was amazed that her child had played initially for five hours using Cozmo when he did not spend this long with other toys. She explained that he had been exploring what the toy could do: “he was getting it to choose blocks, pick up blocks, do tricks, make faces, and do dances … . He really enjoyed that”. Controlling Cozmo to travel between rooms was an example of “Virtual Locomotor play”, although the robot could also lead to locomotor play in the physical world as children chased after Cozmo or danced with it. Further examples of virtual locomotor play occurred when the robot followed and chased children if they moved from the play area. Oscar (aged 7) enjoyed using this mode to set the robot on a course which led to it ‘spying’ on his younger sister. His mother noted that: because their bedrooms are opposite sides of the hallway, he kept sending Cozmo to go and watch what she was doing and waiting and seeing how long it took her to realise he was there. Jacob (aged 10) also swiftly realised Cozmo’s surveillance potential as he referred to the robot as a “spying machine”. Louis (aged 9) stated that after he had explored all the options Cozmo offers, playing with it became dull. To him, all the fun was in the exploratory play. Other children across the sample also reported that they stopped playing with Cozmo after a while when they felt like there was nothing new to explore. Mastery Play “Exploratory play” was also connected to “Mastery play” through programmatic sequencing which enabled the robot to move and follow different directions as requested by the children. For example, Eleanor (aged 8) commented, “I liked to play games with him ... . I liked doing the acting thing”. This involved programming the toy to undertake a series of actions that were sequenced in a performance. For Ebrahim (aged 7), the explorer mode also led to mastery play, as he set up an obstacle course for Cozmo using his toy soldiers, explaining that “I took a couple of my soldiers in here and made them out in a specific order and then I tried to get past them in explorer mode”. Arthur (aged 8) would continuously try to find ways to make Cozmo go through obstacle courses faster. He especially liked the coding and programming aspect of the toy, and his father would challenge him to think his decisions through to get better results. Children also utilised other objects in their exploratory and mastery play. Louis (aged 9) would put up barricades so that Cozmo could not escape, and Matteo (aged 9) constructed “high towers” and operated “stability tests” by using Cozmo’s explorer mode and constructing pathways through furniture and other objects. The blurring of physical/virtual and material/digital play, which is prevalent in contemporary play landscapes (Marsh et al., Children, Technology and Play), is highlighted during these episodes in which the children incorporated their own interests linked to their personal environments into their play with Cozmo. Mastery play inevitably involved “Object play”, as children played around with icons on the app to investigate their properties. Cozmo offers a variety of games which stimulate various abilities and can be played via the app or remote. Available games allow both child-robot interaction by means of the ‘Power Cubes’ provided with the robot, and programming games with different difficulty levels. Physical contact between the child and Cozmo, and the robot’s responses, encouraged anthropomorphism, as Jacob (aged 10) switched from referencing Cozmo as ‘it’ to ‘him’ as the discussion progressed: Interviewer: (to Jacob) We got a robot interfacing this time. (To Cozmo) Hello, are you still looking at me? That’s great. (To Jacob) So, do you want to show us your fist bumps that you coded? Jacob: Oh, I didn’t code it. Well, I did code it. Go to tricks. Do you want to fist bump him? Interviewer: Yeah, can I fist bump him? Jacob: Just put your fist near him like close, close, like that. In addition to the fist bump game, Dylan (aged 9) unlocked the Fist Bump app icon on his tablet enabling him to receive rewards by alternating physical fist bumps with himself and virtual fist bumps between Cozmo and the iPad. These object and exploratory play types were positioned as stimulating the robot’s feelings and emotions through musical sounds (like a robot “purring”) that seem to be designed to foster a stronger connection between the child and Cozmo. All the children in the research played Cozmo’s games; the tapping game and the building games with blocks were popular. A clear connection between mastery and object play is shown in those situations where children explore objects to gain control of their environment. While children pointed out that winning the games against Cozmo was almost impossible, some tried to change the game in their favour. Arthur (aged 8), for example, would move the blocks during games to slow down Cozmo. Whenever Emma (aged 8) became impatient with the games, she would move the blocks closer to Cozmo to finish certain games faster. Mastery play was valued by parents because of its interactivity and educational potential. Arthur’s father praised Cozmo’s programming and coding possibilities and valued the technical insight and problem-solving skills it teaches children. Oscar’s mother also valued the educational potential of the toy, but did not appear to recognise that the exploratory play he engaged in involved learning: I liked the fact that it had all these sorts of educational aspects to it. It would have been nice if we’d have got to use them. I like the idea that it could code, and it would teach coding ... but it wasn’t to be. There was some disappointment with the lack of engagement with the coding capabilities of Cozmo. Parents lamented that their children did not engage with coding activities but accepted that this was due to the level of difficulty or technical issues (i.e., Cozmo shutting down frequently), as well as their children’s inability to navigate coding activities (i.e., due to their age). Communication Play “Communication play” was observed as the English-speaking children learnt how to write things into Cozmo that the robot would then say. Ebrahim (aged 7) explained “you can type whatever you want him to say, like, I typed this, ‘I play with Monica’”. Emma (aged 8) made up entire stories for Cozmo to tell, and Arthur (aged 8) made up plays for Cozmo to perform. Oscar (aged 7) felt that the app had helped him learn to read: when asked how it helped him to read, he said “by me typing it in and him saying the words back to me so then I can hear what it says”. This highlights how IoToys can facilitate a playful approach to literacy and supports the work of Heljakka and Ihamäki (96), who assert a need to “widen understandings of toy literacy into multiple directions”. As such, the potential to support aspects of children’s literacy and digital learning in a way that is engaging and playful illuminates the benefits that these types of toys can provide. In contrast, Italian and Belgian children faced more difficulties in communicating with Cozmo as they did not speak English. However, this did not limit the possibility to interact and communicate with Cozmo, for example, through parental mediation or by referring to recognisable symbols (sounds, icons, and images in the app). Other Types of Play The data indicated that four play types (imaginative, exploratory, mastery, and communication play) were the most prevalent among the participating families, although there was also evidence of “Locomotor play” (during exploratory play), and “Object play” (during mastery play). “Social play” was also reported, for instance, when children played with the robot with siblings or friends. All the children wanted to show Cozmo to friends and family. Arthur (aged 8) even arranged with his teacher that he could bring Cozmo to school and show his classmates what Cozmo could do during a class presentation. “Creative play” (play that enables children to explore, develop ideas, and make things in a digital context) was limited in the data. Whilst there was some evidence of this type of play – for example, Oscar (aged 7) and Matteo (aged 9) built ramps and obstacle courses for Cozmo –, in general, there was limited evidence of children playing in creative ways to produce new artefacts with the robot. This is despite the toy having a creative mode, in which children can use the app to code games and actions for Cozmo. For Eleanor, it seemed that the toy did not foster open-ended play. Her mother noted that Eleanor normally enjoyed creative play, but she appeared to lose interest in the toy after displaying initial enthusiasm: “I don’t think it was creative enough, I think it’s not open-ended enough and that’s why she didn’t play with it, would be my guess”. Oscar (aged 7) also lost interest in the toy after the first few weeks of use, which his mother put down to technical issues: I think if it worked flawlessly every time he’d gone to pick it up then he would have been quite happy ... but after a couple of negative experiences where it wouldn’t load up and it’s very frustrating, maybe it just put him off. Other families also talked about how the battery was quick to drain and slow to charge, which impacted on the nature of the play. Emma’s mother stated that the WiFi settings needed to be changed to play with Cozmo which Emma (aged 8) could not do by herself. Therefore, she was only able to play with Cozmo when her mother was around to help her. According to the parents of Arthur and Emma (both aged 8), Cozmo often showed technical errors and did not perform certain games, which caused some frustration with the children. The mother of Aryana (aged 9) also reported a loss of interest in Cozmo, but not particularly related to technical reasons: “she lost interest all the time, so she didn’t follow the steps to the end, she just play a little bit and she'd say, ‘Oh I'm bored, I want to do something’ … mostly YouTube”. Such hesitant engagement may be due to technical issues but might also be due to the limitations regarding creative play identified in this study. Conclusion This study indicates that the Cozmo robot led to a variety of types of play, and that the adaptation of Hughes’s framework by Marsh et al. offered a useful index for identifying changing practices in children's play. As highlighted, children’s play with Cozmo often transcended the virtual and physical, online and offline, and digital and material, as well as providing a vehicle for learning. This analysis thus challenges the proposition that electronic objects limit children’s imagination and play. Prevalent in the findings was the willingness of children to suspend disbelief and engage in anthropomorphic/zoomorphic play with Cozmo by applying human-like attributes to the toy. Children related to the emotional connection with the robot much more than the technical aspects (i.e., coding), and whilst the children understood the limitations of the robot’s agency, there are studies to suggest that caution should be applied by robot developers to ensure that, as technology advances, children are able to maintain the understanding that robots are different from human beings (van den Berghe et al.). This is of particular importance when existing literature highlights that younger children have a less nuanced understanding of the ‘alive’ status of a robot than older children (Nijssen et al.). Children often incorporated more traditional toys and resources into their play with Cozmo: for instance, the use of toy soldiers and building blocks to create obstacle courses demonstrates the digital-material affordances of children’s play. All the children enjoyed the pre-programmed games that utilised the ‘Power Cubes’, and there was an element of competitiveness for the children who demonstrated an eagerness to ‘beat’ the toy. Importantly, parents reported that the app supported children’s literacy development in a playful way, although this was more beneficial for the children whose first language was English. The potential for children’s literacy development through playful child-robot interaction presents opportunities for further study. One significant limitation of the toy that emerged from the findings was the capacity to encourage children’s creative play. Kahn Jr. et al.'s earlier research showed that children endowed less animation to robot toys than to stuffed animals, as if children believe that toy robots have some agency and do not need assistance. Therefore, it is possible that children are less inclined to play in creative ways because they expect Cozmo to control his own behaviour. The research has implications for work with parents. The parents in this study emphasised the value of mastery play for education, but at times overlooked the worth of other types of play for learning. Engaging parents in discussion of the significance that different types of play have for children’s development could be beneficial not just for their own understanding, but also for the types of play they may then encourage and support. The study also has implications for the future development of IoToys. The producers of Cozmo promote types of play through the activities they support in the app, but a broader range of activities could lead to a wider variety of types of play to include, for example, fantasy or dramatic play. There are also opportunities to promote more creative play by, for example, enabling children to construct new artefacts for the robot toy itself, or providing drawing/painting tools that Cozmo could be programmed to use via the app. Broadening play types by design could be encouraged across the toy industry as a whole but, in relation to the IoToys, the opportunities for these kinds of approaches are exciting, reflecting rapid advances in technology that open up possible new worlds of play. This is the challenge for the next few years of toy development, when the first possibilities of the IoToys have been explored. Acknowledgement This research was funded by ARC Discovery Project award DP180103922 – The Internet of Toys: Benefits and Risks of Connected Toys for Children. The article originated as an initiative of the International Partners: Dr Louise Kay and Professor Jackie Marsh (University of Sheffield, UK), Associate Professor Giovanna Mascheroni (Università Cattolica, Italy), and Professor Bieke Zaman (KU Leuven, Belgium). The Australian Chief Investigators on this grant were Dr Donell Holloway and Professor Lelia Green, Edith Cowan University. Much of this article was written by Research Officers who supported the grant’s Investigators, and all parties gratefully acknowledge the funding provided by the Australian Research Council for this project. References Barco, Alex, et al. “Robot Morphology and Children's Perception of Social Robots: An Exploratory Study.” International Conference on Human-Robot Interaction, 23-26 Mar. 2020, Cambridge. Beck, Aryel, et al. “Interpretation of Emotional Body Language Displayed by a Humanoid Robot: A Case Study with Children.” International Journal of Social Robotics 5.3 (2013). 27 Jan. 2023 <https://doi.org/10.1007/s12369-013-0193-z>. Berriman, Liam, and Giovanna Mascheroni. “Exploring the Affordances of Smart Toys and Connected Play in Practice.” New Media & Society 21.4 (2019). 27 Jan. 2023 <https://doi.org/10.1177/1461444818807119>. Brito, Rita, et al. “Young Children, Digital Media and Smart Toys: How Perceptions Shape Adoption and Domestication.” British Journal of Educational Technology 49.5 (2018). 27 Jan. 2023 <https://doi.org/10.1111/bjet.12655>. Epley, Nicholas, et al. "On Seeing Human: A Three-Factor Theory of Anthropomorphism". Psychological Review 114.4 (2007): 864-886. Healey, Aleeya, et al. “Selecting Appropriate Toys for Young Children in the Digital Era.” Pediatrics 143.1 (2019). 27 Jan. 2023 <https://doi.org/10.1542/peds.2018-3348>. Holloway, Donell, and Lelia Green. "The Internet of Toys." Communication Research and Practice 2.4 (2016): 506-519. Hughes, Bob. A Playworker’s Taxonomy of Play Types. 2nd ed. Playlink, 2002. Heljakka, Katriina, and Pirita Ihamäki. “Preschoolers Learning with the Internet of Toys: From Toy-Based Edutainment to Transmedia Literacy.” Seminar.Net 14.1 (2018): 85–102. Kahn Jr., Peter, et al. "Robotic Pets in the Lives of Preschool Children." Interaction Studies 7.3 (2007): 405-436. Marsh, Jackie. “The Internet of Toys: A Posthuman and Multimodal Analysis of Connected Play.” Teachers College Record (2017): 30. ———. "The Uncanny Valley Revisited: Play with the Internet of Toys." Internet of Toys : Practices, Affordances and the Political Economy of Children's Smart Play. Eds. Giovanni Mascheroni and Donell Holloway. Cham: Palgrave Macmillan, 2019. 47-66. Marsh, Jackie, et al. “Digital Play: A New Classification.” Early Years 36.3 (2016): 242. Marsh, Jackie, et al. Children, Technology and Play: Key Findings of a Large-Scale Research Report. The LEGO Foundation, 2020. Mascheroni, Giovanni, and Donell Holloway, eds. Internet of Toys : Practices, Affordances and the Political Economy of Children’s Smart Play. Palgrave Macmillan, 2019. Nijssen, Sari, et al. "You, Robot? The Role of Anthropomorphic Emotion Attributions in Children’s Sharing with a Robot." International Journal of Child-Computer Interaction 30 (2021). 15 Apr. 2023 <https://doi.org/10.1016/j.ijcci.2021.100319>. Severson, Rachel L., and Shailee R. Woodard. “Imagining Others? Minds: The Positive Relation between Children's Role Play and Anthropomorphism.” Frontiers in Psychology 9 (2018). 27 Jan. 2023 <https://doi.org/10.3389/fpsyg.2018.02140>. Van den Berghe, Rianne, et al. "A Toy or a friend? Children's Anthropomorphic Beliefs about Robots and How These Relate to Second-Language Word Learning." Journal of Computer Assisted Learning 37.2 (2021): 396– 410. 15 Apr. 2023 <https://doi.org/10.1111/jcal.12497>. Appendix 1: Participants Country Name (Pseudonym) Sex Age Siblings 1 UK Eleanor F 8 2 younger brothers 2 UK Ebrahim M 7 2 older sisters 3 UK Oscar M 7 1 younger sister 4 UK Aryana F 9 2 younger brothers 5 AU Jacob M 10 1 younger brother 6 AU Dylan M 9 2 older brothers 7 Italy Martina F 8 2 younger sisters 8 Italy Anna F 8 1 younger sister 9 Italy Luca M 8 1 older brother 10 Italy Matteo M 9 1 younger sister 11 Belgium Louis M 9 2 younger sisters 12 Belgium Emma F 8 1 younger sister 13 Belgium Arthur M 8 1 younger sister Appendix 2: Play Types Play Type Play Types (Hughes) Digital Play Types (adapted by Marsh et al., "Digital Play") Symbolic play Occurs when an object stands for another object, e.g. a stick becomes a horse Occurs when a virtual object stands for another object, e.g. an avatar’s shoe becomes a wand Rough and tumble play Children are in physical contact during play, but there is no violence Occurs when avatars that represent users in a digital environment touch each other playfully, e.g. bumping each other Socio-dramatic play Enactment of real-life scenarios that are based on personal experiences, e.g. playing house Enactment of real-life scenarios in a digital environment that are based on personal experiences Social play Play during which rules for social interaction are constructed and employed Play in a digital context during which rules for social interaction are constructed and employed Creative play Play that enables children to explore, develop ideas, and make things Play that enables children to explore, develop ideas, and make things in a digital context Communication play Play using words, songs, rhymes, poetry, etc. Play using words, songs, rhymes, poetry, etc., in a digital context, e.g. text messages, multimodal communication Dramatic play Play that dramatises events in which children have not directly participated, e.g. TV shows Play in a digital context that dramatises events in which children have not directly participated, e.g. TV shows. Locomotor play Play which involves movement, e.g. chase, hide and seek Virtual locomotor play involves movement in a digital context, e.g. child may play hide and seek with others in a virtual world Deep play Play in which children encounter risky experiences, or feel as though they have to fight for survival Play in digital contexts in which children encounter risky experiences, or feel as though they have to fight for survival Exploratory play Play in which children explore objects, spaces, etc. through the senses in order to find out information, or explore possibilities Play in a digital context in which children explore objects, spaces, etc., through the senses in order to find out information, or explore possibilities Fantasy play Play in which children can take on roles that would not occur in real life, e.g. be a superhero Play in a digital context in which children can take on roles that would not occur in real life, e.g. be a superhero Imaginative play Play in which children pretend that things are otherwise Play in a digital context in which children pretend that things are otherwise Mastery play Play in which children attempt to gain control of environments, e.g. building dens Play in digital contexts in which children attempt to gain control of environments, e.g. creating a virtual world Object play Play in which children explore objects through touch and vision Play in which children explore virtual objects through vision and touch through the screen or mouse Role play Play in which children might take on a role beyond the personal or domestic roles associated with socio-dramatic play Play in a digital context in which children might take on a role beyond the personal or domestic roles associated with socio-dramatic play Recapitulative play Play in which children might explore history, rituals, and myths, and play in ways that resonate with the activities of our human ancestors (lighting fires, building shelters, and so on) Play in a digital context in which children might explore history, rituals, and myths, and play in ways that resonate with the activities of our human ancestors (lighting fires, building shelters, and so on) Transgressive play Play in which children contest, resist, and/or transgress expected norms, rules, and perceived restrictions in both digital and non-digital contexts.

IntroductionIn the year 2000, a group of likeminded individuals got together and convened the first annual World Barista Championship in Monte Carlo. With twelve competitors from around the globe, each competitor was judged by seven judges: one head judge who oversaw the process, two technical judges who assessed technical skills, and four sensory judges who evaluated the taste and appearance of the espresso drinks. Competitors had fifteen minutes to serve four espresso coffees, four cappuccino coffees, and four “signature” drinks that they had devised using one shot of espresso and other ingredients of their choice, but no alcohol. The competitors were also assessed on their overall barista skills, their creativity, and their ability to perform under pressure and impress the judges with their knowledge of coffee. This competition has grown to the extent that eleven years later, in 2011, 54 countries held national barista championships with the winner from each country competing for the highly coveted position of World Barista Champion. That year, Alejandro Mendez from El Salvador became the first world champion from a coffee producing nation. Champion baristas are more likely to come from coffee consuming countries than they are from coffee producing countries as countries that produce coffee seldom have a culture of espresso coffee consumption. While Ireland is not a coffee-producing nation, the Irish are the highest per capita consumers of tea in the world (Mac Con Iomaire, “Ireland”). Despite this, in 2008, Stephen Morrissey from Ireland overcame 50 other national champions to become the 2008 World Barista Champion (see, http://vimeo.com/2254130). Another Irish national champion, Colin Harmon, came fourth in this competition in both 2009 and 2010. This paper discusses the history and development of coffee and coffee houses in Dublin from the 17th century, charting how coffee culture in Dublin appeared, evolved, and stagnated before re-emerging at the beginning of the 21st century, with a remarkable win in the World Barista Championships. The historical links between coffeehouses and media—ranging from print media to electronic and social media—are discussed. In this, the coffee house acts as an informal public gathering space, what urban sociologist Ray Oldenburg calls a “third place,” neither work nor home. These “third places” provide anchors for community life and facilitate and foster broader, more creative interaction (Oldenburg). This paper will also show how competition from other “third places” such as clubs, hotels, restaurants, and bars have affected the vibrancy of coffee houses. Early Coffee Houses The first coffee house was established in Constantinople in 1554 (Tannahill 252; Huetz de Lemps 387). The first English coffee houses opened in Oxford in 1650 and in London in 1652. Coffee houses multiplied thereafter but, in 1676, when some London coffee houses became hotbeds for political protest, the city prosecutor decided to close them. The ban was soon lifted and between 1680 and 1730 Londoners discovered the pleasure of drinking coffee (Huetz de Lemps 388), although these coffee houses sold a number of hot drinks including tea and chocolate as well as coffee.The first French coffee houses opened in Marseille in 1671 and in Paris the following year. Coffee houses proliferated during the 18th century: by 1720 there were 380 public cafés in Paris and by the end of the century there were 600 (Huetz de Lemps 387). Café Procope opened in Paris in 1674 and, in the 18th century, became a literary salon with regular patrons: Voltaire, Rousseau, Diderot and Condorcet (Huetz de Lemps 387; Pitte 472). In England, coffee houses developed into exclusive clubs such as Crockford’s and the Reform, whilst elsewhere in Europe they evolved into what we identify as cafés, similar to the tea shops that would open in England in the late 19th century (Tannahill 252-53). Tea quickly displaced coffee in popularity in British coffee houses (Taylor 142). Pettigrew suggests two reasons why Great Britain became a tea-drinking nation while most of the rest of Europe took to coffee (48). The first was the power of the East India Company, chartered by Elizabeth I in 1600, which controlled the world’s biggest tea monopoly and promoted the beverage enthusiastically. The second was the difficulty England had in securing coffee from the Levant while at war with France at the end of the seventeenth century and again during the War of the Spanish Succession (1702-13). Tea also became the dominant beverage in Ireland and over a period of time became the staple beverage of the whole country. In 1835, Samuel Bewley and his son Charles dared to break the monopoly of The East India Company by importing over 2,000 chests of tea directly from Canton, China, to Ireland. His family would later become synonymous with the importation of coffee and with opening cafés in Ireland (see, Farmar for full history of the Bewley's and their activities). Ireland remains the highest per-capita consumer of tea in the world. Coffee houses have long been linked with social and political change (Kennedy, Politicks; Pincus). The notion that these new non-alcoholic drinks were responsible for the Enlightenment because people could now gather socially without getting drunk is rejected by Wheaton as frivolous, since there had always been alternatives to strong drink, and European civilisation had achieved much in the previous centuries (91). She comments additionally that cafés, as gathering places for dissenters, took over the role that taverns had long played. Pennell and Vickery support this argument adding that by offering a choice of drinks, and often sweets, at a fixed price and in a more civilized setting than most taverns provided, coffee houses and cafés were part of the rise of the modern restaurant. It is believed that, by 1700, the commercial provision of food and drink constituted the second largest occupational sector in London. Travellers’ accounts are full of descriptions of London taverns, pie shops, coffee, bun and chop houses, breakfast huts, and food hawkers (Pennell; Vickery). Dublin Coffee Houses and Later incarnations The earliest reference to coffee houses in Dublin is to the Cock Coffee House in Cook Street during the reign of Charles II (1660-85). Public dining or drinking establishments listed in the 1738 Dublin Directory include taverns, eating houses, chop houses, coffee houses, and one chocolate house in Fownes Court run by Peter Bardin (Hardiman and Kennedy 157). During the second half of the 17th century, Dublin’s merchant classes transferred allegiance from taverns to the newly fashionable coffee houses as places to conduct business. By 1698, the fashion had spread to country towns with coffee houses found in Cork, Limerick, Kilkenny, Clonmel, Wexford, and Galway, and slightly later in Belfast and Waterford in the 18th century. Maxwell lists some of Dublin’s leading coffee houses and taverns, noting their clientele: There were Lucas’s Coffee House, on Cork Hill (the scene of many duels), frequented by fashionable young men; the Phoenix, in Werburgh Street, where political dinners were held; Dick’s Coffee House, in Skinner’s Row, much patronized by literary men, for it was over a bookseller’s; the Eagle, in Eustace Street, where meetings of the Volunteers were held; the Old Sot’s Hole, near Essex Bridge, famous for its beefsteaks and ale; the Eagle Tavern, on Cork Hill, which was demolished at the same time as Lucas’s to make room for the Royal Exchange; and many others. (76) Many of the early taverns were situated around the Winetavern Street, Cook Street, and Fishamble Street area. (see Fig. 1) Taverns, and later coffee houses, became meeting places for gentlemen and centres for debate and the exchange of ideas. In 1706, Francis Dickson published the Flying Post newspaper at the Four Courts coffee house in Winetavern Street. The Bear Tavern (1725) and the Black Lyon (1735), where a Masonic Lodge assembled every Wednesday, were also located on this street (Gilbert v.1 160). Dick’s Coffee house was established in the late 17th century by bookseller and newspaper proprietor Richard Pue, and remained open until 1780 when the building was demolished. In 1740, Dick’s customers were described thus: Ye citizens, gentlemen, lawyers and squires,who summer and winter surround our great fires,ye quidnuncs! who frequently come into Pue’s,To live upon politicks, coffee, and news. (Gilbert v.1 174) There has long been an association between coffeehouses and publishing books, pamphlets and particularly newspapers. Other Dublin publishers and newspapermen who owned coffee houses included Richard Norris and Thomas Bacon. Until the 1850s, newspapers were burdened with a number of taxes: on the newsprint, a stamp duty, and on each advertisement. By 1865, these taxes had virtually disappeared, resulting in the appearance of 30 new newspapers in Ireland, 24 of them in Dublin. Most people read from copies which were available free of charge in taverns, clubs, and coffee houses (MacGiolla Phadraig). Coffee houses also kept copies of international newspapers. On 4 May 1706, Francis Dickson notes in the Dublin Intelligence that he held the Paris and London Gazettes, Leyden Gazette and Slip, the Paris and Hague Lettres à la Main, Daily Courant, Post-man, Flying Post, Post-script and Manuscripts in his coffeehouse in Winetavern Street (Kennedy, “Dublin”). Henry Berry’s analysis of shop signs in Dublin identifies 24 different coffee houses in Dublin, with the main clusters in Essex Street near the Custom’s House (Cocoa Tree, Bacon’s, Dempster’s, Dublin, Merchant’s, Norris’s, and Walsh’s) Cork Hill (Lucas’s, St Lawrence’s, and Solyman’s) Skinners’ Row (Bow’s’, Darby’s, and Dick’s) Christ Church Yard (Four Courts, and London) College Green (Jack’s, and Parliament) and Crampton Court (Exchange, and Little Dublin). (see Figure 1, below, for these clusters and the locations of other Dublin coffee houses.) The earliest to be referenced is the Cock Coffee House in Cook Street during the reign of Charles II (1660-85), with Solyman’s (1691), Bow’s (1692), and Patt’s on High Street (1699), all mentioned in print before the 18th century. The name of one, the Cocoa Tree, suggests that chocolate was also served in this coffee house. More evidence of the variety of beverages sold in coffee houses comes from Gilbert who notes that in 1730, one Dublin poet wrote of George Carterwright’s wife at The Custom House Coffee House on Essex Street: Her coffee’s fresh and fresh her tea,Sweet her cream, ptizan, and whea,her drams, of ev’ry sort, we findboth good and pleasant, in their kind. (v. 2 161) Figure 1: Map of Dublin indicating Coffee House clusters 1 = Sackville St.; 2 = Winetavern St.; 3 = Essex St.; 4 = Cork Hill; 5 = Skinner's Row; 6 = College Green.; 7 = Christ Church Yard; 8 = Crampton Court.; 9 = Cook St.; 10 = High St.; 11 = Eustace St.; 12 = Werburgh St.; 13 = Fishamble St.; 14 = Westmorland St.; 15 = South Great George's St.; 16 = Grafton St.; 17 = Kildare St.; 18 = Dame St.; 19 = Anglesea Row; 20 = Foster Place; 21 = Poolbeg St.; 22 = Fleet St.; 23 = Burgh Quay.A = Cafe de Paris, Lincoln Place; B = Red Bank Restaurant, D'Olier St.; C = Morrison's Hotel, Nassau St.; D = Shelbourne Hotel, St. Stephen's Green; E = Jury's Hotel, Dame St. Some coffee houses transformed into the gentlemen’s clubs that appeared in London, Paris and Dublin in the 17th century. These clubs originally met in coffee houses, then taverns, until later proprietary clubs became fashionable. Dublin anticipated London in club fashions with members of the Kildare Street Club (1782) and the Sackville Street Club (1794) owning the premises of their clubhouse, thus dispensing with the proprietor. The first London club to be owned by the members seems to be Arthur’s, founded in 1811 (McDowell 4) and this practice became widespread throughout the 19th century in both London and Dublin. The origin of one of Dublin’s most famous clubs, Daly’s Club, was a chocolate house opened by Patrick Daly in c.1762–65 in premises at 2–3 Dame Street (Brooke). It prospered sufficiently to commission its own granite-faced building on College Green between Anglesea Street and Foster Place which opened in 1789 (Liddy 51). Daly’s Club, “where half the land of Ireland has changed hands”, was renowned for the gambling that took place there (Montgomery 39). Daly’s sumptuous palace catered very well (and discreetly) for honourable Members of Parliament and rich “bucks” alike (Craig 222). The changing political and social landscape following the Act of Union led to Daly’s slow demise and its eventual closure in 1823 (Liddy 51). Coincidentally, the first Starbucks in Ireland opened in 2005 in the same location. Once gentlemen’s clubs had designated buildings where members could eat, drink, socialise, and stay overnight, taverns and coffee houses faced competition from the best Dublin hotels which also had coffee rooms “in which gentlemen could read papers, write letters, take coffee and wine in the evening—an exiguous substitute for a club” (McDowell 17). There were at least 15 establishments in Dublin city claiming to be hotels by 1789 (Corr 1) and their numbers grew in the 19th century, an expansion which was particularly influenced by the growth of railways. By 1790, Dublin’s public houses (“pubs”) outnumbered its coffee houses with Dublin boasting 1,300 (Rooney 132). Names like the Goose and Gridiron, Harp and Crown, Horseshoe and Magpie, and Hen and Chickens—fashionable during the 17th and 18th centuries in Ireland—hung on decorative signs for those who could not read. Throughout the 20th century, the public house provided the dominant “third place” in Irish society, and the drink of choice for itd predominantly male customers was a frothy pint of Guinness. Newspapers were available in public houses and many newspapermen had their own favourite hostelries such as Mulligan’s of Poolbeg Street; The Pearl, and The Palace on Fleet Street; and The White Horse Inn on Burgh Quay. Any coffee served in these establishments prior to the arrival of the new coffee culture in the 21st century was, however, of the powdered instant variety. Hotels / Restaurants with Coffee Rooms From the mid-19th century, the public dining landscape of Dublin changed in line with London and other large cities in the United Kingdom. Restaurants did appear gradually in the United Kingdom and research suggests that one possible reason for this growth from the 1860s onwards was the Refreshment Houses and Wine Licences Act (1860). The object of this act was to “reunite the business of eating and drinking”, thereby encouraging public sobriety (Mac Con Iomaire, “Emergence” v.2 95). Advertisements for Dublin restaurants appeared in The Irish Times from the 1860s. Thom’s Directory includes listings for Dining Rooms from the 1870s and Refreshment Rooms are listed from the 1880s. This pattern continued until 1909, when Thom’s Directory first includes a listing for “Restaurants and Tea Rooms”. Some of the establishments that advertised separate coffee rooms include Dublin’s first French restaurant, the Café de Paris, The Red Bank Restaurant, Morrison’s Hotel, Shelbourne Hotel, and Jury’s Hotel (see Fig. 1). The pattern of separate ladies’ coffee rooms emerged in Dublin and London during the latter half of the 19th century and mixed sex dining only became popular around the last decade of the 19th century, partly infuenced by Cesar Ritz and Auguste Escoffier (Mac Con Iomaire, “Public Dining”). Irish Cafés: From Bewley’s to Starbucks A number of cafés appeared at the beginning of the 20th century, most notably Robert Roberts and Bewley’s, both of which were owned by Quaker families. Ernest Bewley took over the running of the Bewley’s importation business in the 1890s and opened a number of Oriental Cafés; South Great Georges Street (1894), Westmoreland Street (1896), and what became the landmark Bewley’s Oriental Café in Grafton Street (1927). Drawing influence from the grand cafés of Paris and Vienna, oriental tearooms, and Egyptian architecture (inspired by the discovery in 1922 of Tutankhamen’s Tomb), the Grafton Street business brought a touch of the exotic into the newly formed Irish Free State. Bewley’s cafés became the haunt of many of Ireland’s leading literary figures, including Samuel Becket, Sean O’Casey, and James Joyce who mentioned the café in his book, Dubliners. A full history of Bewley’s is available (Farmar). It is important to note, however, that pots of tea were sold in equal measure to mugs of coffee in Bewley’s. The cafés changed over time from waitress- to self-service and a failure to adapt to changing fashions led to the business being sold, with only the flagship café in Grafton Street remaining open in a revised capacity. It was not until the beginning of the 21st century that a new wave of coffee house culture swept Ireland. This was based around speciality coffee beverages such as espressos, cappuccinos, lattés, macchiatos, and frappuccinnos. This new phenomenon coincided with the unprecedented growth in the Irish economy, during which Ireland became known as the “Celtic Tiger” (Murphy 3). One aspect of this period was a building boom and a subsequent growth in apartment living in the Dublin city centre. The American sitcom Friends and its fictional coffee house, “Central Perk,” may also have helped popularise the use of coffee houses as “third spaces” (Oldenberg) among young apartment dwellers in Dublin. This was also the era of the “dotcom boom” when many young entrepreneurs, software designers, webmasters, and stock market investors were using coffee houses as meeting places for business and also as ad hoc office spaces. This trend is very similar to the situation in the 17th and early 18th centuries where coffeehouses became known as sites for business dealings. Various theories explaining the growth of the new café culture have circulated, with reasons ranging from a growth in Eastern European migrants, anti-smoking legislation, returning sophisticated Irish emigrants, and increased affluence (Fenton). Dublin pubs, facing competition from the new coffee culture, began installing espresso coffee machines made by companies such as Gaggia to attract customers more interested in a good latté than a lager and it is within this context that Irish baristas gained such success in the World Barista competition. In 2001 the Georges Street branch of Bewley’s was taken over by a chain called Café, Bar, Deli specialising in serving good food at reasonable prices. Many ex-Bewley’s staff members subsequently opened their own businesses, roasting coffee and running cafés. Irish-owned coffee chains such as Java Republic, Insomnia, and O’Brien’s Sandwich Bars continued to thrive despite the competition from coffee chains Starbucks and Costa Café. Indeed, so successful was the handmade Irish sandwich and coffee business that, before the economic downturn affected its business, Irish franchise O’Brien’s operated in over 18 countries. The Café, Bar, Deli group had also begun to franchise its operations in 2008 when it too became a victim of the global economic downturn. With the growth of the Internet, many newspapers have experienced falling sales of their printed format and rising uptake of their electronic versions. Most Dublin coffee houses today provide wireless Internet connections so their customers can read not only the local newspapers online, but also others from all over the globe, similar to Francis Dickenson’s coffee house in Winetavern Street in the early 18th century. Dublin has become Europe’s Silicon Valley, housing the European headquarters for companies such as Google, Yahoo, Ebay, Paypal, and Facebook. There are currently plans to provide free wireless connectivity throughout Dublin’s city centre in order to promote e-commerce, however, some coffee houses shut off the wireless Internet in their establishments at certain times of the week in order to promote more social interaction to ensure that these “third places” remain “great good places” at the heart of the community (Oldenburg). Conclusion Ireland is not a country that is normally associated with a coffee culture but coffee houses have been part of the fabric of that country since they emerged in Dublin in the 17th century. These Dublin coffee houses prospered in the 18th century, and survived strong competition from clubs and hotels in the 19th century, and from restaurant and public houses into the 20th century. In 2008, when Stephen Morrissey won the coveted title of World Barista Champion, Ireland’s place as a coffee consuming country was re-established. The first decade of the 21st century witnessed a birth of a new espresso coffee culture, which shows no signs of weakening despite Ireland’s economic travails. References Berry, Henry F. “House and Shop Signs in Dublin in the Seventeenth and Eighteenth Centuries.” The Journal of the Royal Society of Antiquaries of Ireland 40.2 (1910): 81–98. Brooke, Raymond Frederick. Daly’s Club and the Kildare Street Club, Dublin. Dublin, 1930. Corr, Frank. Hotels in Ireland. Dublin: Jemma Publications, 1987. Craig, Maurice. Dublin 1660-1860. Dublin: Allen Figgis, 1980. Farmar, Tony. The Legendary, Lofty, Clattering Café. Dublin: A&A Farmar, 1988. Fenton, Ben. “Cafe Culture taking over in Dublin.” The Telegraph 2 Oct. 2006. 29 Apr. 2012 ‹http://www.telegraph.co.uk/news/uknews/1530308/cafe-culture-taking-over-in-Dublin.html›. Gilbert, John T. A History of the City of Dublin (3 vols.). Dublin: Gill and Macmillan, 1978. Girouard, Mark. Victorian Pubs. New Haven, Conn.: Yale UP, 1984. Hardiman, Nodlaig P., and Máire Kennedy. A Directory of Dublin for the Year 1738 Compiled from the Most Authentic of Sources. Dublin: Dublin Corporation Public Libraries, 2000. Huetz de Lemps, Alain. “Colonial Beverages and Consumption of Sugar.” Food: A Culinary History from Antiquity to the Present. Eds. Jean-Louis Flandrin and Massimo Montanari. New York: Columbia UP, 1999. 383–93. Kennedy, Máire. “Dublin Coffee Houses.” Ask About Ireland, 2011. 4 Apr. 2012 ‹http://www.askaboutireland.ie/reading-room/history-heritage/pages-in-history/dublin-coffee-houses›. ----- “‘Politicks, Coffee and News’: The Dublin Book Trade in the Eighteenth Century.” Dublin Historical Record LVIII.1 (2005): 76–85. Liddy, Pat. Temple Bar—Dublin: An Illustrated History. Dublin: Temple Bar Properties, 1992. Mac Con Iomaire, Máirtín. “The Emergence, Development, and Influence of French Haute Cuisine on Public Dining in Dublin Restaurants 1900-2000: An Oral History.” Ph.D. thesis, Dublin Institute of Technology, Dublin, 2009. 4 Apr. 2012 ‹http://arrow.dit.ie/tourdoc/12›. ----- “Ireland.” Food Cultures of the World Encylopedia. Ed. Ken Albala. Westport, CT: Greenwood Press, 2010. ----- “Public Dining in Dublin: The History and Evolution of Gastronomy and Commercial Dining 1700-1900.” International Journal of Contemporary Hospitality Management 24. Special Issue: The History of the Commercial Hospitality Industry from Classical Antiquity to the 19th Century (2012): forthcoming. MacGiolla Phadraig, Brian. “Dublin: One Hundred Years Ago.” Dublin Historical Record 23.2/3 (1969): 56–71. Maxwell, Constantia. Dublin under the Georges 1714–1830. Dublin: Gill & Macmillan, 1979. McDowell, R. B. Land & Learning: Two Irish Clubs. Dublin: The Lilliput P, 1993. Montgomery, K. L. “Old Dublin Clubs and Coffee-Houses.” New Ireland Review VI (1896): 39–44. Murphy, Antoine E. “The ‘Celtic Tiger’—An Analysis of Ireland’s Economic Growth Performance.” EUI Working Papers, 2000 29 Apr. 2012 ‹http://www.eui.eu/RSCAS/WP-Texts/00_16.pdf›. Oldenburg, Ray, ed. Celebrating the Third Place: Inspiring Stories About The “Great Good Places” At the Heart of Our Communities. New York: Marlowe & Company 2001. Pennell, Sarah. “‘Great Quantities of Gooseberry Pye and Baked Clod of Beef’: Victualling and Eating out in Early Modern London.” Londinopolis: Essays in the Cultural and Social History of Early Modern London. Eds. Paul Griffiths and Mark S. R. Jenner. Manchester: Manchester UP, 2000. 228–59. Pettigrew, Jane. A Social History of Tea. London: National Trust Enterprises, 2001. Pincus, Steve. “‘Coffee Politicians Does Create’: Coffeehouses and Restoration Political Culture.” The Journal of Modern History 67.4 (1995): 807–34. Pitte, Jean-Robert. “The Rise of the Restaurant.” Food: A Culinary History from Antiquity to the Present. Eds. Jean-Louis Flandrin and Massimo Montanari. New York: Columbia UP, 1999. 471–80. Rooney, Brendan, ed. A Time and a Place: Two Centuries of Irish Social Life. Dublin: National Gallery of Ireland, 2006. Tannahill, Reay. Food in History. St Albans, Herts.: Paladin, 1975. Taylor, Laurence. “Coffee: The Bottomless Cup.” The American Dimension: Cultural Myths and Social Realities. Eds. W. Arens and Susan P. Montague. Port Washington, N.Y.: Alfred Publishing, 1976. 14–48. Vickery, Amanda. Behind Closed Doors: At Home in Georgian England. New Haven: Yale UP, 2009. Wheaton, Barbara Ketcham. Savouring the Past: The French Kitchen and Table from 1300-1789. London: Chatto & Windus, Hogarth P, 1983. Williams, Anne. “Historical Attitudes to Women Eating in Restaurants.” Public Eating: Proceedings of the Oxford Symposium on Food and Cookery 1991. Ed. Harlan Walker. Totnes: Prospect Books, 1992. 311–14. World Barista, Championship. “History–World Barista Championship”. 2012. 02 Apr. 2012 ‹http://worldbaristachampionship.com2012›.AcknowledgementA warm thank you to Dr. Kevin Griffin for producing the map of Dublin for this article.

Fig. 1: “Pink Flamingo Furby” (2000), “Peachy Furby Baby” (1999), and “Owl Furby” (1999) Sunlight Up (“Dah-ay-loh oo-tye”): Introduction As playthings at the junction of human experience and imagination, toys like Furby present an interesting touch point to explore cultural imaginations, hopes, and fears about zoomorphic robots and AI toys. This year marks their 25th anniversary. Created by Dave Hampton and Caleb Chung, Furby publicly debuted at the American International Toy Fair in 1998. Originally released by Tiger Electronics, this toy was later sold to Hasbro in 2005 to 2007. Since their introduction to the market, Furbys have been occupying our shelves and basements, perceived as “annoying little owl-like dolls with embedded sound-recording chips” (Gullin) that speak their own language “furbish” (shown throughout in parenthesis). Early reportage likened Furby to all kinds of cute critters: mogwais, hamsters, and Star Trek’s tribbles. Narratively Furbys are framed as a benevolent, alien species, living in space in a cloud known as Furbyland. For motivations not revealed, Furbys, in looking down on our planet, were so struck by the beautiful view of nature and its signs of peacefulness — “no worry (boo boh-bay)” — that they jumped, plummeting to us like tiny fluffy asteroids. Little did they know that their arrival would spark an intergalactic diplomatic incident. During its introduction in 1998, the initial discourse in media reportage emphasised anxieties of the unknown. What lies beneath the surface of Furby, as a toy that might blur the line between the real and imagined for children? What technologies might it harbour? As a hybrid of technology and animal, Furby appeared as a creepy-cute cultural icon that simultaneously delighted and horrified children and adults alike. Today adult fans reimagine Furby through play and customisation as part of their reflections on their childhood experiences of this cultural moment, and as a way of exploring new futures. Furby provides an opportunity to reflect on adults’ interactions with toys, including parents, members of the public, and fans motivated by nostalgia. At the time of its release Furby presented adults with moments of “dissonance” towards new horrifying technologies that “might occur at the seams [of] … monumental cultural shifts” (Powell 4). But for adult fans today, as a childhood memory, the toy represents both strangeness and future possibilities; it has become a tool of “disrupt[ing] and challeng[ing] beliefs and connections” (Rand 9). In this article I primarily analyse the “original” Furbys of 1998 to 2002, but also mention a range of later versions. This includes: the Emoto-tronic Furbys (2006) which were designed to have more expressive faces; the Furby Boom (2003), a toy whose personality changes according to the level of care it is provided with; and the Furby Connect (2016), which has bluetooth capacity. This discussion is supported by a thematic analysis of 3800 news articles about Furby from 1998 to 2000, visual analysis of both the original and customised iterations of Furby, as well as my reflections as a member of the Furby fandom community. You Play? (U-nye-loo-lay-doo?): Furby Encounters A key part of the discourse around Furby since its introduction in 1998 was, “who would want one?” Indeed, the answer at the time appeared to be “several million of us, the toy demons hope” (Weeks). After their release in American toy stores on 2 October 1998 in limited supplies, a Furbish frenzy ensued, resulting in altercations between shoppers and staff (e.g. Munroe; Warmbir; Associated Press). Aged 10, I recall my little black and white Furby, Coco, waiting for me on the shelves of the electronics section of Big W in Australia, fortunately with no such commotion. Furby is classed by the Guinness World Records as the world’s first AI toy, but it was certainly not the first electronic toy to enter the market; at the time of Furby’s release, Tickle Me Elmo and My Interactive Pooh presented competition, and by the late 1980s there was already concern about how electronic pet toys might erode emotion and connection (Turkle, “Authenticity”; Turkle, “Nascent”). Speculation over the reason for the Furby mass hysteria ensued. Some suggested the appeal was the toy’s status symbol status (Beck), whereas others cited its broad appeal: “it's not gender specific; it doesn't appeal to a particular age group; and most important, it's affordable and doesn't require additional equipment or a computer” (Davis). Some experts offered their commentary of the cyberpet phenomena in general, suggesting that it is a way of dealing with isolation and loneliness (Yorkshire Post). Indeed, all of these features are important to note when we consider the transformation of Furby into queer icon. Central to Furby’s cultural narrative is the idea of contact, or a meeting between robot and user; through play children “teach” their new pet Earth’s new ways (Marsh, “Coded”; Marsh, “Uncanny”). And with this contact also comes a sense of the unknown: what lies beneath the creature’s surface? In their study of zoomorphic robots, Hirofumi Katsumi and Daniel White suggest that Donna Haraway’s work on animal encounters might help us understand this idea of contact. As “animal-like” creature, Furby recalls the transformative potentials of meeting with the more-than-human. Furby’s presence on toy shelves, in classrooms and in homes was one of the first times society had to consider what it meant to “enter the world of becoming with” zoomorphic robots, and to reflect on “who or what ... is precisely at stake” in this entanglement (Haraway 19). What do we learn about ourselves and the unknown through our encounters with Furby? “Monster” (Moh-moh): Technological Threat, Monstrous Other In media reportage, Furby is framed as both new and innovative, but also as a threatening fluffy anarchist. With its technology largely unknown, Furby at the time of its release presented society with a sense of “technohorror” and “imaginings of [social] collapse” (Powell 24). A common concern was that Furby might record and repeat inappropriate language in an act of rebellion. Occasionally tabloid newspapers would report claims such as, "MUM … was horrified when she sat down to play with her daughter's new Furby toy and it squeaked: "F*** me" (The Sun). Some concerns were quite serious, including that Furby could emit electromagnetic fields that would create interference for medical devices and aircraft instruments; this was later disproven by engineers (Tan and Hinberg; Basky; Computer Security). Other urban myths pointed to a more whimsical Furby, whose sensors had the capacity to launch spacecraft (Watson). One persistent concern was the surveillance potentials of Furby. In 1999 the US National Security Agency (NSA) issued a ban on Furby in their Fort Mead headquarters, with concern that they might record and repeat confidential information (Gullin; Ramalho; Borger). This was denied by Tiger Electronics, who emphatically stated “Furby is not a spy” (Computer Security). Engineers performing “autopsies” on Furbys quickly put much of this anxiety to rest (Phobe). This was met with mirthful rebuttals of how future Furbys might be transformed into cute and ubiquitous “wireless furby transmitters” to gather intelligence in warzones (Gullin). As a result, the initial anxiety about surveillance and toys dissipated. However, academics continue to remind us of the real risks of smart toys (e.g. Lupton; Milkaite and Lievens). The 2016 Furby Connect, equipped with voice recognition and Bluetooth capacities has been shown to be hackable (Williams). Further, Maria Ramalho has reported Snowden’s 2014 claims that both NSA and the UK Government Communication Headquarters have been accessing the data collected. In this context, Furby has become “Big Brother transmogrified into ambiguous, cute” unaccountable creature (Ramalho). Through this, we can see how our entanglement with Furby as an object of technohorror speaks both to our anxieties and the real possibilities of technology. In order to craft a narrative around Furby that speaks to this monstrous potential, many have drawn comparisons between Furby and the character Gizmo from the Gremlins franchise. This reference to Gizmo appears in the majority of the media articles sampled for this research. Gizmo is a “mogwai” (trans. demon) with both cute and monstrous potential; like Furby, it also has the potential to transform into a threat to “good society” (Chesher 153-4). This comparison speaks to Gremlins as an anti-technology statement (Sale). However, when we consider how media rhetoric has framed Furby as something to be tamed and controlled, it’s important we approach this comparison with caution in light of the Orientalist underpinnings of the Gremlins franchise. Wendy Allison Lee highlights how Gremlins reflects xenophobic themes of invasion and assimilation. While Gizmo is a “cute, well-behaved” character who “strives to assimilate” much like how Furby might, through play with children, it also harbours a threat to order. In this encounter are resonances of “racist love” that can sometimes underpin our affection for cuteness (Bow). Further reflection is needed on how we might unentangle ourselves from this framing and imagine more inclusive futures with toys like Furby. Fig. 2: Interactive Gizmo, a “Furby Friend” produced by Hasbro, Tiger and Warner Bros in 1999 Big Fun! (Dah doo-ay wah!): Queer Re-Imaginings of Furby Fig. 3: Party time! Adult fans around the world now gather under the “Furby” banner, participating in a colourful array of playful mischief. Reddit forum r/furby (11,200 subscribers) creates a fun space to enjoy the whimsy of Furby, transforming the figure into a sweet and kind companion. Under this umbrella, r/oddbodyfurby (997 subscribers) explore the horrifying potentials of Furby to its playful and surprising ends, which I discuss in this section. In other forums, such as Furby Collectors and Customisers (4.1k members) on Facebook, these different interests come together in a playful and creative space. There was also an active community on Tumblr, where some of the most creatively generative activities around Furby have occurred (Tiffany). In Japan, there is a lively community of fans on Twitter who dress and photograph Emoto-tronic Furbys in a range of cute and charming ways. This forms part of a broader network of creatives, such as “Circuit Benders” who tear down toys and rework them into instruments in a process known as “frankensteining”, such as Look Mum No Computer’s Furby Organ (Deahl). As fans and artists, people act as “queer accessories” to help Furby escape the world and narrative that sought to enclose it, so it might enact its revenge or transcend as a non-binary queer icon (Rand 9-11). As small, collectible and customisable friends, images of happy and creepy Furbys are part of a network of cute media that provides my generation with a source of comfort during times of precarity, occupying our spaces with their own vitality and presence as soothing companions (e.g. Stevens; Allison; Yano). Cuteness as media also lends itself to hybridisation; a mixing and matching with seemingly “opposing” aesthetics. For many fans, the charm of Furby lies in its nostalgic pull as a creature of childhood creepy-cute nightmares. Indeed, it seems that early concerns that Furby may “blur the line between the real and imagined for many children” were in fact valid (Knowlton). While we knew they weren’t “alive” in the true sense, to us they appeared “sort of alive” as our everyday environments became increasingly technological with a dazzling array of electronics (Turkle, “Authenticity”). As Allison (179) explains, we had to “adjust to a world where the border between the imaginary and the real” began to shift rapidly, leaving us open to dream, imagine, and craft narratives populated by a fear of the mechanised undead. Many Millennials were convinced as children that their Furby was waiting for them in the dark, watching, chuckling (“he he heeeee”). Patrick Lenton, diarising his adventures with a rescue Furby this year recalls his childhood toy as “a riot of noise and fury, the kind of demonic household terror”. Some adults, recalling these memories now refer to Furby as “it” or “evil” (Marsh, “Uncanny” 59). In 2020, adult Furby fans, thinking back to their childhood toys, speculated if the positioning of Furby’s eyes at the front of its head meant it was a predator (Watson). Some suggested that their short legs meant they are ambush predators, their infra-red sensor enabling them to detect prey in the dark. Other playful lore suggested that they were made of real cat and dog fur. Through this act of imaginative play, adults reach back to the playful horrors of their childhoods, combining their sense of dread with glee. This has been recently animated by films such as The Mitchells vs. The Machines (2021), where Furbys equipped with “PAL” chips transmogrify into a horrific pack of menacing creatures, and exact revenge. The main contributing factor to this experience is in part the puppetry of Furby. The 1999 Furby presents an exaggerated performance that is both “alive” and “unalive”, its wild rocking, owlish blinking, and cackling creating a sense of “dread and creeping horror” (Freud 2; Marsh, “Uncanny”). Through a blend of animation and imagination, agency is diffused between toy and child to give Furby “life” (Silvio 423). Interestingly, studies of the 2016 Furby Connect and its friendly and social programming that is designed to encourage positive care and engagement has counteracted some of this experience for children (Marsh, “Uncanny” 54). Likewise, in discussing the 2013 Furby Boom Chesher (151) describes this animation as “zany”, working with Sianne Ngai’s conceptualisation of this aesthetic and its relationship to cuteness. While some might praise these later developments in the Furby franchise as having saved another generation of children from nightmares, compared to the original Furby these later editions are less popular among fans; perhaps there is less “material” to work with. Fans as adults now draw on Furby as a playful and cute text to experiment with and hybridise with a variety of horrifying and surprising potentials. This leans into Furby’s design as a chimera, as it uses a combination of cute features to create a “short-hand” for life and also evoke the “idea” or “character” of appealing animals that form part of cultures “charismatic megafauna” (Nishimura 179; Stuck and Rogers; Gn). With cat-like ears, a tuft of hair that drifts with sympathetic movement, two wide eyes, framed with coquettish false lashes, a bird’s beak, and two paws, Furby both suspends and confounds our disbelief. Following the principles of the Kindchenschema (Lorenz) to a “100% ratio” its body is reduced to a round form, its most dominant feature its large eyes (Borgi, Cogliati-Dezza, Brelsford Meints, and Cirulli). While large eyes generally are thought to have an affective pull to them (Harris 4), their fixed placement in the original Furby’s skull creates a dead-pan gaze, that morphs into a Kubrik stare as the toy tilts forward to greet the viewer. Fig. 4: Kindschenschema at work in Furby’s design Furby fans mischievously extend this hybridisation of Furby’s body further through a range of customisation practices. Through “skinning”, Furby’s faux fur surfaces are removed and replaced with a fantastic array of colours and textures. Through breaking into their mechatronic shell – a practice known as “shucking” – their parts are repaired or modified. This results in a range of delightfully queer, non-binary representations of Furby with a range of vibrant furs, piercings, and evocative twinkling and gentle eyes (“tee-wee-lah!”). These figures act as both avatars and as companions for fans. Sporting earrings and rainbow bead necklaces, they are photographed resting in grassy fields, soft crochet rainbows, and bookshelves: they are an expression of all that is joyful in the world. Some fans push the customisation further to create whimsical creatures from another dimension. Some Furbys appear with moss and lichen for fur, sprouting tiny toadstools. Furbys are also transformed into “oddbodies” of varying species. Some appear both as winged fairies, and as transcendental multi-eyed and winged “biblically accurate” angels. Others are hybridised with plush toys or are reworked into handbags. Some veer into the realm of body horror, using doll limbs and bodies to create humanoid forms. The most iconic is the “long furby”, created by Tumblr user FurbyFuzz in 2018. Elongated and insect-like, the Long Furby wriggles into homes and curls up on soft furnishings. Collectors gather “haunted photos from the dark recesses of the internet” to document their escapades (Long Furby). Sometimes, hybridised Furbys appear not through creator interventions but rather emerge from nature itself. One such mythical creature is Murby, an original Furby unearthed in 2013 on an old farm property. Once toy, now woodland spirit, Murby gazes upon and blesses fans with dreamy, clouded eyes, its body an entanglement of thick moss, rich earth and time. Furby’s queerness, strangeness, and hybridity speaks to fans in different ways. Personally, as a neurodivergent person, I experience the coding and the playful reimaginings of Furby as a reflection of my own life experience. Neurodivergent people have a high capacity for care and empathy for objects as curiosities, supports, and friends (e.g. Atherton and Cross; White and Remington; Clutterbuck, Shah and Livingston). Like Furby, I am an alien whom people want to tame. My body and movement are treated with the same infantilising bemusement and suspicion. I feel like a chimera myself; an entanglement of many parts that make a whole, each on their own charming, but together forming a chaotic attempt to connect with neurotypicals. For me, what lies beneath Furby’s surface is my own psyche; rescuing and customising Furbys is a symbolic act, a creative expression of my desire to transcend and resist ableist forces. Together my Furbys and I revel in our strangeness in solidarity, plotting our mischievous revenge (“party time!”). This micro-level resistance will not overturn ableism but brings me a sense of reprieve as I work with my allies to bring socio-cultural change. Fig. 5: The author, Furby Queen. Photo by Sherbet Birdie Photography. Through their creative work, fans explore how Furbys could be reimagined. While fannish activities may at first glance appear fringe or frivolous, they hold up a mirror to our own limitations, anxieties, and practices as a society. The future is Furby. Go to Sleep Now (U-nye-way-loh-nee-way): Conclusions As a source of technohorror and queer potential, Furby provides a vessel by which we can imagine the futures of toys. Through encounter and contact, this seemingly harmless fluffy robot brought about disruption and chaos as a threat to securities and social fabrics. Adult fans, now recalling this cultural moment, lean into this creature’s promise of new possibilities, queering its cultural narrative. Through exploring adults’ interactions with toys, we explore new potentials for change and futures that are playful and creative. Acknowledgments This article was produced with the support of a Vitalities Lab Scholarship and the Australian Research Council Centre of Excellence for Automated Decision-Making and Society. I also thank Deborah Lupton and David Eastwood for their support in the production of an arts-based project that draws on this research into cyberpet histories. References Allison, Anne. Millennial Monsters: Japanese Toys and the Global Imagination. Berkeley: U of California P, 2006. Associated Press. “Two Injured in Flurry over Furby.” Charleston Daily Mail 28 Nov. 1998. Atherton, Gray, and Liam Cross. “Seeing More than Human: Autism and Anthropomorphic Theory of Mind.” Frontiers in Psychology 9 (2018): 1–18. Basky, Greg. “Furby Not Guilty as ‘Charged’.” The Western Journal of Medicine 172 (2000): 59. Beck, Rachel. “‘Must-Have’ Toys Created by Intense Publicity Campaigns.” AP Business Writer 16 Oct. 1998. Borgi, Marta, Irene Cogliati-Dezza, Victoria Brelsford, Kerstin Meints, and Francesca Cirulli. “Baby Schema in Human and Animal Faces Induces Cuteness Perception and Gaze Allocation in Children.” Frontiers in Psychology 5 (2014): 1–12. Borger, Julian. “Secret Agent Furby Sneaks into Spies’ Inner Sanctum.” The Guardian 14 Jan. 1999. <https://www.theguardian.com/world/1999/jan/14/julianborger1>. Bow, Leslie. Racist Love: Asian Abstraction and the Pleasures of Fantasy. Durham: Duke UP. Chesher, Chris. “Toy Robots on YouTube: Consumption and Peer Production at the Robotic Moment.” Convergence 25 (2019): 148–160. Clutterbuck, Rachel A., Punit Shah, and Lucy A. Livingston. “Anthropomorphic Tendencies in Autism: A Conceputal Replication and Extension of White and Remington (2019) and Preliminary Development of a Novel Anthropomorphism Measure.” Autism 26.4 (2021): 940–950. Computer Security. “Furby Alert: A National Security Concern?” Computer Security 36 (1999): 87–88. Davis, Pamela. “Too Cute to Mute?” St. Petersburg Times 9 Nov. 1998. Deahl, Dani. “Circuit Bending: Hacking a Furby in the Name of Music.” The Verge 14 Sep. 2018. Francescani, Christopher, and Tracy Connor. “Hot Toy’s a Doll Order; $30 Cuddlers Now Going for $100.” New York Post 29 Nov. 1998: 5. Freud, Sigmund. The Uncanny. Trans. D. McLintok. London: Penguin, 1919 [2003]. Gn, Joel. “Designing Affection: On the Curious Case of Machine Cuteness.” The Aesthetics and Affects of Cuteness. Eds. Joshua Paul Dale, Joyce Goggin, Julia Leyda, Anthony McIntyre, and Diane Negra. New York: Routledge, 2017. Gremlins. Dir. Joe Dante. Warner Bros, 1984. Gremlins 2. Dir. Joe Dante. Warner Bros, 1990. Guinness World Records. “First AI Robot Toy.” Guinness World Records, 2023. <https://www.guinnessworldrecords.com/world-records/100867-first-ai-robot-toy>. Gullin, Paul. “The Future Is Furbys.” Computerworld 33 (1999): 30. Harris, David. Cute, Quaint, Hungry and Romantic: The Aesthetics of Consumerism. New York: Basic. Katsuno, Hirofumi, and Daniel White. “Haptic Creatures: Tactile Affect and Human-Robot Intimacy in Japan.” Consumer Culture Theory in Asia: History and Contemporary Issues. Eds. Yuko Minowa and Russell Belk. New York: Routledge. 242–262. Knowlton, Brian. “If Raggedy Ann Could Talk.” International Herald Tribune 9. Nov 1998. Long Furby. 2018. <https://www.longfurby.com/>. Lorenz, Konrad. “Die angeborenen Formen möglicher Erfahrung [The Innate Condition of the Possibility of Experience].” Zeitschrift für Tierpsychologie 5.2 (1943): 245–409. Lupton, Deborah, and Ben Williamson. “The Datafied Child: The Dataveillance of Children and Implications for Their Rights.” New Media & Society 19 (2017): 780–794. Marsh, Alison. “Coded for Cuteness.” IEE Spectrum 56.1 (2019): 60. Marsh, Jackie. “The Uncanny Valley Revisited: Play with the Internet of Toys.” The Internet of Toys: Practices, Affordances and the Political Economy of Children’s Smart Play. Eds. Giovanna Mascheroni and Donell Holloway. London: Palgrave Macmillan, 2019. Milkaite, Ingrida, and Eva Lievens. “The Internet of Toys: Playing Games with Children’s Data?” The Internet of Toys: Practices, Affordances and the Political Economy of Children’s Smart Play. Eds. Giovanna Mascheroni and Donell Holloway. London: Palgrave Macmillan, 2019. Lee, Wendy Allison. “Cute. Dangerous. Asian American. 'Gremlins' @ 35.” Public Books, 2019. <https://www.publicbooks.org/cute-dangerous-asian-american-gremlins-35/>. Lenton, Patrick. “Happy 25th Birthday Furby, the Toy That Stole a Generation’s Hearts.” Sydney Morning Herald 6 Apr. 2023. <https://www.smh.com.au/culture/comedy/happy-25th-birthday-furby-the-toy-that-stole-a-generation-s-hearts-20230403-p5cxoe.html>. The Mitchells vs. The Machines. Dir. Mike Rianda. Sony Pictures Animation, 2021 Munroe, Tony. “Fur Flies at Mass. Malls over Hasbro’s Furby Doll.” Reuters, 28 Nov. 1998. Ngai, Sianne. Our Aesthetic Categories: Zany, Cute, Interesting. Cambridge: Harvard UP, 2012. Nishimura, Keiko. Communication Robot: Animating a Technological Solution in Twenty-First Century Japan. Dissertation. University of North Carolina at Chapel Hill, 2021. Phobe. Furby Autopsy, 1998. <http://www.phobe.com/furby/>. Powell, Daniel. Horror Culture in the New Millennium: Digital Dissonance and Technohorror. Washington, D.C.: Lexington, 2018. Ramalho, Maria Irene. “The Private Is Public or Furbies Are Us.” e-cadernos 27 (2017). <http://journals.openedition.org/eces/2199>. Rand, Erica. Barbie’s Queer Accessories. Carolina: Duke UP. Sale, Kirkpatrick. Rebels against the Future. London: Quartet Books, 1996. Silvio, Terry. “Animation: The New Performance.” Journal of Linguistic Anthropology 20: 422–438. Stevens, Carolyn. “Cute But Relaxed: Ten Years of Rilakkuma in Precarious Japan.” M/C Journal 17.2 (2014). <https://doi.org/10.5204/mcj.783>. Stuck, Rachel E., and Wendy A. Rogers. “Older Adults Perceptions of Supporting Factors of Trust in a Robot Care Providers.” Journal of Robotics (2018): 6519713. The Sun. “Frisky Furby Fun.” 31 Dec. 1999. Tan, Kok-Swang, and Irwin Hinberg, “Furby Does Not Interfere with Medical Devices.” Canadian Medical Association Journal 161 (1999): 971. Tiffany, Kaitlyn. “Every Furby Gets a Home.” Vox, 21 Dec. 2018. <https://www.vox.com/the-goods/2018/12/21/18149004/furby-collectors-tumblr-vintage-robots-fandom>. Turkle, Sherry. “Authenticity in the Age of Digital Companions.” Interaction Studies: Social Behaviour and Communication in Biological and Artificial Systems 8 (2007): 501–517. Turkle, Sherry. “A Nascent Robotics Culture: New Complicities for Companionship.” Machine Ethics and Robot Ethics. London: Routledge, 2017. Warmbir, Steve. “Mild Weather Draws Shoppers Out into the Sun. But Furby Frenzy Drives Desperate into Long Lines.” Chicago Daily Herald, 28 Nov. 1998: 4. Watson, Averie. “A Dark Furby Theory May Reveal Them as Flesh-Devouring Predators.” CBR, 20 Nov. 2021. <https://www.cbr.com/dark-furby-predator-theory/>. White, Rebecca, and Anna Remington. “Object Personification in Autism: This Paper Will Be Very Sad If You Don’t Read It.” Autism 23.4 (2018): 1042–1045. Williams, Al. “Mission Impossible: Infiltrating Furby.” Hackaday, 26 Nov. 2017. <https://hackaday.com/2017/11/26/mission-impossible-infiltrating-furby/>. Weeks, Linton. “The Great Furby Fuss.” The Washington Post, 24 Nov. 1998. <https://www.washingtonpost.com/archive/lifestyle/1998/11/24/the-great-furby-fuss/30a0a340-658a-4609-ae07-f38ff368c7c4/>. Yano, Christine. “Reach Out and Touch Someone: Thinking through Sanrio’s Social Communication Empire.” Japanese Studies 31.1 (2011): 23–36. Yorkshire Post. “Cyberpets – Harmless Fun or Addictive Craze?” 9 Nov. 1998: 9.