Gotowa bibliografia na temat „Urbana High School (Urbana, Ohio)”

The purpose of this study was to examine which Ohio schools offered curricular music courses and the rates at which students participated in those courses. The analysis involved descriptive statistics, analysis of variance, logistic regression, and partially nested multilevel modeling using data from the Ohio Department of Education ( N = 3,222 schools). The investigation revealed that charter schools offered music courses far less often than public schools. However, in charter schools that did offer music, students participated at higher rates than those in public schools. Nearly all public schools featured music classes. The exception was high schools in the highest poverty urban neighborhoods, 31% of which had no curricular music. Students identified as Black, Hispanic, or indigenous were more likely to attend schools without music programs. Elementary students enrolled in an average of 1.00 music classes per year, whereas middle and high school students enrolled in 0.67 and 0.35 music classes per year, respectively. Suburban districts saw the greatest decline in music participation as students progressed to high school. Urban schools with greater percentages of white, non-Hispanic students had higher music enrollment rates.

Due to the recent racially motivated killings in Ferguson, Missouri (2014); Staten Island, New York (2014); Cleveland, Ohio (2014); Charleston, South Carolina (2015); Baton Rouge, Louisiana (2016); and Dallas, Texas (2016), racial and ethnic tensions have heightened across the United States. Whereas schools would seem like optimal spaces for racial inquiry and promoting understanding, most classroom lessons have been standardized to avoid critical race discussions. Thus, the transformative power of education is restricted when conversations about real issues in society are avoided. This qualitative case study examines Fannie Lou Hamer Academy (FLHA)—pseudonym, a high-performing urban school that utilizes critical antiracism education. The findings suggest that multicultural curriculum helps students develop “self-knowledge,” meaning a personal awareness of their race and identity. Participants describe how self-knowledge provides corrective history, a response to negative media portrayals of minorities, and helps students understand current events such as the racial unrest in Ferguson, Missouri. The implications of these findings reveal the central role of the curriculum in shaping positive student identities and helping to mediate social conflicts.

The Young Scholars Program in Ohio is a cooperative effort of nine urban school districts and several major institutions of higher education in Ohio. The program identifies minority youths with college potential who might drop out of school. The students are selected in the sixth grade by a committee of educators from their local school districts. Selection criteria include a written essay, grades, and a standardized test. Students are advised and mentored in various ways during their high school and college years. They must maintain a 3.0 gradepoint average in high school and take collegepreparatory classes to remain eligible for the program. Middle school students take mathematics classes on Saturday mornings, and high school students attend two-hour tutoring sessions twice weekly after school. The program's developers believe that it is very successful. Students who have been through the program can succeed in nearly all the academic disciplines at the college level. A notable exception to this rule is mathematics.

Objective Data-informed decision making is valued among school districts, but challenges remain for local health departments to provide data, especially during a pandemic. We describe the rapid planning and deployment of a school-based COVID-19 surveillance system in a metropolitan US county. Methods In 2020, we used several data sources to construct disease- and school-based indicators for COVID-19 surveillance in Franklin County, an urban county in central Ohio. We collected, processed, analyzed, and visualized data in the COVID-19 Analytics and Targeted Surveillance System for Schools (CATS). CATS included web-based applications (public and secure versions), automated alerts, and weekly reports for the general public and decision makers, including school administrators, school boards, and local health departments. Results We deployed a pilot version of CATS in less than 2 months (August–September 2020) and added 21 school districts in central Ohio (15 in Franklin County and 6 outside the county) into CATS during the subsequent months. Public-facing web-based applications provided parents and students with local information for data-informed decision making. We created an algorithm to enable local health departments to precisely identify school districts and school buildings at high risk of an outbreak and active SARS-CoV-2 transmission in school settings. Practice Implications Piloting a surveillance system with diverse school districts helps scale up to other districts. Leveraging past relationships and identifying emerging partner needs were critical to rapid and sustainable collaboration. Valuing diverse skill sets is key to rapid deployment of proactive and innovative public health practices during a global pandemic.

Que reflexões e práticas são possíveis ao professor(a) de Geografia no desenvolvimento da problemática socioambiental urbana em sala de aula? O objetivo deste artigo foi apresentar algumas atividades metodológicas práticas aplicadas a estudantes do Ensino Médio e como elas possibilitaram o ensino de temas relacionados a problemática socioambiental urbana. Constituindo uma temática relevante na ciência geográfica para docentes e estudantes, acredita-se competir aos docentes a reflexão teórica, acompanhada do planejamento e execução de estratégias metodológicas que permitam aos estudantes uma leitura geográfica do mundo vivido. Neste trabalho, são realizados apontamentos sobre as possibilidades teóricas e alçadas alternativas metodológicas para a prática pedagógica, a partir da experiência docente do autor com estudantes de nível médio. Sem a finalidade de esgotar o amplo debate interdisciplinar sobre a questão ambiental urbana e as metodologias existentes, destaca-se a importância de o professor(a) de Geografia, enquanto agente atento às condições da vida no lugar, no bairro ou cidade onde está a escola, refletir a complexa realidade que o urbano abrange. A problemática socioambiental deve ser incluída a partir das categorias e métodos disponíveis na própria Geografia, seja como forma de reafirmar a importância da disciplina nesse debate, bem como construindo com os estudantes um processo de aprendizagens significativas. PALAVRAS-CHAVE Ensino de Geografia, Meio ambiente, Problemática socioambiental urbana. URBAN SOCIO-ENVIRONMENTAL PROBLEM AND POSSIBILITIES OF A CLASSROOM APPROACH ABSTRACT What reflections and practices are possible for the geography teacher in the development of urban socio-environmental problems in the classroom? The purpose of this article was to present some practical methodological activities applied to high school students and how they made it possible to teach themes related to urban socio-environmental issues. Constituting a relevant theme in geographic science for teachers and students, it is believed that the theoretical reflection will be competed by teachers, accompanied by the planning and execution of methodological strategies that allow students to geographically read the lived world. In this work, notes are made on the theoretical possibilities and alternative methodological approaches to pedagogical practice, based on the author's teaching experience with high school students. Without the aim of exhausting the broad interdisciplinary debate on the urban environmental issue and existing methodologies, the importance of the Geography teacher, as an agent attentive to the conditions of life in the place, in the neighborhood or city where the school is located, is highlighted. the complex reality that the urban encompasses. The socio-environmental issue should be included from the categories and methods available in Geography itself, either as a way of reaffirming the importance of the discipline in this debate, as well as building a significant learning process with students. KEYWORDS Geography teaching; Environment, Urban socio-environmental problem.

The aim of this paper was to examine current learning styles and teaching methods in order to suggest a new form of learning environment for young students. Features such as different activity settings and small group activities aimed at enhancing learning resulted from the participation of students, teachers and parents in the design of the Gibsonville Elementary School. Teachers, working in small groups, compared different classroom arrangements along with criteria to compare and evaluate each alternative and unanimously selected an “L” shape classroom, which became the basis for the design of the school. Another critical design feature that emerged from the teacher workshop was direct access from each classroom to the outdoors, allowing teachers to create outdoor classrooms that could enhance student's ecological awareness. The final design featured four academic houses of six L shaped classrooms each around an open courtyard to provide a resource for students, parents, and teachers to collectively explore and maintain outdoor environmental themes. A post occupancy evaluation was conducted several months after completion of construction and revealed a high level of satisfaction; however, the findings pointed to the need for a subsequent workshop to focus on the effective arrangement of furniture in L shaped classrooms. The participatory process was identified by the students and teachers as the key factor contributing to the design, which of one of the first schools of its type in the United States.

Using state-representative teacher surveys in three states—Texas, Ohio, and Kentucky—we examine teachers’ implementation of college- and career-readiness (CCR) standards. What do teachers report about the specificity, authority, consistency, power, and stability of their standards environment? How does their policy environment predict standards-emphasized instruction? Do these relationships differ for those who teach different subjects (math and English Language Arts [ELA]), different grades (elementary or high school), different populations (English Language Learners [ELLs], students with disabilities [SWDs]), and in different areas (rural, urban, or suburban)? We found elementary math teachers taught significantly more standards-emphasized content than elementary ELA teachers, whereas secondary ELA teachers taught significantly more standards-emphasized content than secondary math teachers. Teachers of SWDs and rural teachers taught significantly less of the emphasized content. In all three states, we found greater buy-in (authority) predicted increased emphasized content coverage among ELA teachers but not among math teachers.

The level of oral hygiene in school-aged children in different countries is primarily low. Behavioral factors are the most important contributors to this low level of hygiene. It is also important to note that identifying the specific behaviors that significantly reduce disease burden is critical. The research was provided in Tbilisi, in public schools, to evaluate Oral health indicators (OHI, DMF, def), mean value of intensity of caries in school-aged children (7 to 12 years old), the role of behavioral factors in relation to oral hygiene and carbohydrate nutrition, and the popularity and relevance of preventive measures were determined. A cross-sectional study was conducted, where 149 children aged 7 to 12 were selected by simple random sampling from Tbilisi public schools. Evaluation of DEF, def, and S-OHI indices was carried out. Based on the oral health questionnaire, children’s oral care and carbohydrate nutrition behaviors were assessed, as well as attitudes toward preventive interventions. SPSS version 23 software for statistical data processing was used for statistical analysis. On the example of 149 children in the 7-12-year-old population of Tbilisi, the simplified hygiene index is evaluated by the criterion average (1.56). Urban distribution affects the hygiene index, which is statistically significant (P=0.009). Caries intensity and hygiene index in primary and permanent dentition do not depend on gender - statistical certainty is not fixed. Caries intensity is “medium” for both permanent (3.2) and primary dentition (3.9), and the mean value of caries intensity for the whole population is 6.31, which is rated as “high.” The popularity and relevance of preventive measures are low. Lifestyle behaviors related to both oral hygiene and carbohydrate-rich diets are not consistent with the recommendations provided by the FDI to reduce caries burden.

High Plains disease was first described in wheat (Triticum aestivum) in Nebraska, Idaho, Texas, and other High Plains states in 1993 to 1994 (1). The causal agent is a negative sense RNA virus in the genus Emaravirus with at least three genome segments, which is transmitted by the wheat curl mite (Aceria tosichella Keifer) (2). This virus is variously referred to as High Plains virus (HPV), Maize red stripe virus (MRSV/MRStV), or Wheat mosaic virus (WMoV) in the literature. We adopt the name WMoV based on the latest recommendation (3). The presence of WMoV in Ohio was revealed through a comprehensive survey conducted in early spring 2012. Specifically, wheat plants exhibiting virus-like symptoms including chlorosis, reddening, stunting, spotting, or striping were collected from 27 wheat fields in 14 counties throughout Ohio, between March 20 and April 15, 2012. Total RNA was extracted from individual leaf samples, then pooled prior to ribosomal RNA removal and high throughput RNA-sequencing (RNA-Seq) using the Illumina HiSeq2000 platform (University of Illinois Biotechnology Center, Champaign-Urbana, IL). The resulting sequences were assembled and analyzed using CLC Genomics Workbench 5.5 software (CLC Bio, Cambridge, MA). One 983-nt contig was 99% identical to the nucleocapsid protein (NP)-coding RNA segment of WMoV (GenBank Accession DQ324466). We used reverse transcription (RT)-PCR to determine the distribution of WMoV in individual samples using WMoV-specific primers: WMoV NPf1 (TGCTATGTCATTGTTCAGGTGGTC), and WMoV NPr1 (TTAGGCAGTCCTTGATTGTGCTG). WMoV was identified in one sample each from Miami, Auglaize, and Paulding Counties, which are all in western Ohio. The WMoV-positive plants were chlorotic, with varying degrees of stunting and leaf striping. The presence of WMoV in the three samples was confirmed using protein A sandwich (PAS)-ELISA with WMoV-specific antiserum. Vascular puncture inoculation (VPI) (4) was used to inoculate germinating maize seed (cv. Spirit) with the extracts from the WMoV-positive samples. WMoV was detected in two of 378 surviving inoculated plants by RT-PCR and PAS-ELISA. These two WMoV-positive maize plants developed flecking mosaic symptoms on upper uninoculated leaves, consistent with reported WMoV symptoms. The WMoV-positive sample from Auglaize County also contained Wheat streak mosaic virus (WSMV), and 60 of the 120 surviving plants inoculated with this sample were positive for WSMV. This result suggests that, even with VPI, mechanical transmission of WMoV remains a great challenge. To our knowledge, this is the first report of WMoV in Ohio, and demonstrates that WMoV is more widespread than previously thought, reaching at least the eastern edge of the Midwest wheat production region. The expanding distribution of this emerging virus is significant because of its potential to cause additional yield losses in wheat. References: (1) S. G. Jensen et al. Plant Dis. 80:1387, 1996. (2) N. Mielke-Ehred and H.-P. Muhlbach. Viruses 4:1515, 2012. (3) J. M. Skare et al. Virology 347:343, 2006. (4) R. Louie et al. J. Virol. Methods 135:214, 2006.

This research solicits the opinions of the residents of the Keçiören district of Ankara, Turkey, in order to learn their preferences about their local postmodern environment where the municipality forces all contractors and architects to adhere to strict planning laws requiring Turkish folk and Islamic architectural references. The Municipality of Keçiören, as an agent of civil power, manages the architectural and urban transformation of the area from a district formerly composed of squatter housing to one comprised of, in the words of Robert Venturi, “decorated sheds,” in an effort to create a different looking environment rich in nostalgia and excitement. In this research, a total of 7 different sets of apartment façades were analyzed, with each set comprising three examples each of minimum complexity (representing the former condition of the district), intermediate complexity (representing “high” architecture designed by an architect, which does not exist in the district) and maximum complexity (representing the present postmodern condition of the district). The main hypothesis of the study was that preference rates would be high for intermediately altered “high style” houses by showing the existence of a U-shaped relationship between preference and complexity. That is, façades representing an intermediate level of complexity would be favored over less complex and more complex façades. It was also assumed that there would be a difference in the ratings of different age groups. A questionnaire was carried out with 50 adults (aged 30-45) and 50 high school students (aged 18-20) of Keçiören, who were asked to rate a total of 21 photographs from 7 apartment complexes with the help of a five-point semantic differential scales under three headings: preference, complexity and impressiveness. The results proved the existence of a U-shaped relationship between preference and complexity. On the other hand, younger respondents, compared to older respondents, gave more favorable ratings to the physical qualities of the photographed buildings.

This study focuses on the students who participate in acts of racism. The study examines the degree to which students who commit acts of racism and engage in cultural clashes are outsiders or nonparticipants in their schools as well as in their communities.

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior
The development of deployed technologies and the advances in the computational area have allowed to establish and to study interfaces related to both the geographic space and the health area. This research is focus on studying the adolescent, considering the adolescence according to the World Health Organization WHO as that period from 10 to 19 years old and that implies physical, psychological and social transformationsseen in different ways and times. Studies on populations that approach underweight in adolescents are still pretty limited in the nutritional education area. The general aim of this work was identifying and mapping the adolescents nutritional statusesthat are registered at the public high school in Santa Maria. In a specific way, it aimed to trace the classificatory system based on the distribution of body mass index; to carry out the anthropometric measurements of triceps and subscapular; to give information about the adolescents nutritional statuses according to demographic, socioeconomic, behavioral and dietary habits, as well as to map the adolescent s nutritional statusesspatializing them into the Santa Maria s neighborhoods with the aim of subsidizing the school lunch menu. It was done through transversal exploratory studies from October to November 2010 and from March to April 2011 with 361 adolescents of both sexes registered in ten public high schools in Santa Maria, RS, and that were spreadon different neighborhoods. The information was collected through a questionnaire and by doing an anthropometric evaluation of the subjects in the research. For the analysis, the program Statistical Analysis System (SAS, Version 9,2) was used. The results were presented through tables, graphics and pictures where they were spatialized geographically from the application ARCgis (version 9,3)and concluded in the program Corel Drow 14. The results showed that the most of the adolescents, from both sexes, are within the normal range in terms of anthropometric evaluation. In terms of feeding, although having the knowledge of what is a healthy feeding, they showed theyare influenced a lot by the family, by other groups (friends/ classmates) and also by the media. Therefore, the presented results allow us to infer that this study gives subsides to implement together with schools new nutritional programs. Healthy children and adolescents represent the improvement in the life quality for this generation in general besides assuringthis quality for the adulthood for the senior periods too.
O desenvolvimento de tecnologias implantadas e de avanços computacionais tem permitido estabelecer e estudar interfaces relacionadas ao espaço geográfico e à área da saúde. A presente pesquisa tem como objeto de estudo o adolescente, cuja fase é definida pela Organização Mundial da Saúde como o período de 10 a 19 anos de idade, a qual envolve transformações físicas, psíquicas e sociais, que se manifestam de forma e períodos diferentes. Estudos populacionais que abordam sobrepeso/obesidade em adolescentes ainda são bastante limitantes na área da educação nutricional. O trabalho teve como objetivo geral identificar e mapear o estado nutricional de adolescentes matriculados nas escolas Estaduais de Ensino Médio de Santa Maria. Especificadamente, buscou-se delinear o sistema de classificação baseado na distribuição do Índice de Massa Corporal; realizar avaliação antropométrica das dobras cutâneas triciptal e subescapular; fornecer informações do estado nutricional dos adolescentes segundo variáveis demográficas, socioeconômicas, comportamentais e hábitos alimentares e realizar o mapeamento do estado nutricional dos adolescentes espacializando-os nos bairros de Santa Maria, buscando subsidiar a preparação do cardápio da merenda escolar. Realizou-se estudo exploratório transversal no período de outubro/novembro de 2010 e março/abril de 2011, com 361 adolescentes, de ambos os sexos, matriculados em dez escolas Estaduais do Município de Santa Maria, RS, situadas em diferentes bairros do município. Os dados foram coletados por meio de um questionário e da avaliação antropométrica dos sujeitos da pesquisa. Para análise, foi utilizado o Programa Statistical Analisys System (SAS, Versão 9.2). Os resultados, que foram espacializados geograficamente a partir do aplicativo ARCgis (versão 9.3) e concluídos no programa Corel Drow 14, foram apresentados em tabelas, gráficos e figuras, Os resultados obtidos indicaram que a maioria dos adolescentes, de ambos os sexos, encontra-se dentro da faixa de normalidade quanto à avaliação antropométrica. No que diz respeito à alimentação dos adolescentes, apesar de terem conhecimento do que é ter uma alimentação saudável, eles demonstraram sentirem-se muito influenciados pela família, grupos de convivência (amigos/colegas) e também pela mídia. Assim, os resultados obtidos permitem inferir que esse estudo fornece subsídios para implantação de novos programas nutricionais com o auxílio das escolas. Crianças e adolescentes saudáveis representam melhoria na qualidade de vida na fase adulta e também na terceira idade.

Made available in DSpace on 2014-12-17T15:04:50Z (GMT). No. of bitstreams: 1 JoseFS.pdf: 928824 bytes, checksum: 8f0139c499e8bd9b78ac8ab7d153fc5e (MD5) Previous issue date: 2006-12-15
Coordena??o de Aperfei?oamento de Pessoal de N?vel Superior
Abstract:It boards a study about the methodology applied in the classroom, with emphasis at the Physic teaching, but could be taken to the other matters of high school, mainly to that alumns with school delay and that needs a pedagogics resources to get the aproach of them to the subject showed trying to improve their learnship. The study was developed through the bibliographic research methodology, associated to the induce resource that allows to evaluate the methods of teaching praticed actually at High Schools, as the private as the public, to give to the teachers the resources that should change the dificulties of learning with prejudice the classmates performances. The results reacheds demonstrated that is perfectly possible to augment the physic teaching body, taking in consideration the expansion of the profit at the teaching?learnig procces, besides having allowed to shows that this methodology porpouse could be takes to others subjects of the High School to became this phase of school more suitable to the necessities of society. It concludes that the brazilian Education could receive a lot of augments, from the professional criativity on always that inside the classroom, really close of the problems showed by the classmates about learning collecting
Aborda um estudo sobre a metodologia aplicada em sala de aula, com ?nfase para o ensino da F?sica, mas podendo ser estendida para outras mat?rias do Ensino M?dio, principalmente para aqueles alunos com atraso escolar e que precisam ter argumentos pedag?gicos que permitam a sua proximidade ao assunto tratado para agilizar sua aprendizagem. O estudo foi desenvolvido mediante ado??o da metodologia da pesquisa bibliogr?fica, associada ao recurso indutivo que permitiu avaliar os m?dodos de ensino atualmente praticados nas escolar do Ensino M?dio, tanto no ?mbito privado quando p?blico, a fim de dotar os professores de recursos que podem contornar as dificuldades de aprendizagem que prejudicam o desempenho do alunado. Os resultados alcan?ados demonstram que ? perfeitamente poss?vel incrementar a atua??o do corpo docente da F?sica, levando ? expans?o do rendimento do processo ensino-aprendizagem, al?m de ter permitido demonstrar que essa metodologia proposta pode ser levada para outras mat?rias do Ensino M?dio para tornar essa fase da escolaridade mais adequada ?s necessidades da sociedade. Conclui-se que a educa??o brasileira pode receber muitos incrementos, partindo sempre da criatividade do profissional que est? no interior da sala de aula, bem pr?ximo dos problemas apresentados pelos alunos em captarem os ensinamentos

Orientador: Terezinha Machado Maher
Tese (doutorado) - Universidade Estadual de Campinas, Instituto de Estudos da Linguagem
Made available in DSpace on 2018-08-18T05:28:49Z (GMT). No. of bitstreams: 1 Fonseca_AnaSilviaAndreuda_D.pdf: 2170528 bytes, checksum: 2e94ec0cdec9de6fae0381fccc2f9806 (MD5) Previous issue date: 2011
Resumo: Este trabalho procura justificar a didatização e a inserção curricular do rap nacional na grande área de Linguagens, Códigos e suas Tecnologias do Ensino Médio, sobretudo no tocante ao ensino de Língua e Literatura. O rap nacional tem ocupado um lugar de destaque na produção cultural urbana do Brasil: enquanto gênero poético-musical, ele é visto como a ?voz? de uma maioria (jovens das classes C, D e E) que é frequentemente tratada, discursivamente, como ?minoria?; é tema de trabalhos acadêmicos em diversas áreas; é usado em ações educativas de organizações sociais não governamentais; e é tido pelo governo federal como uma manifestação legítima do jovem brasileiro, na consideração de políticas públicas para a juventude. O uso de rap em salas de aula do sistema oficial de educação, porém, tem sido extremamente limitado. Os argumentos correntes para a não inclusão do rap no currículo são que seu discurso incentivaria a violência e sua linguagem seria pobre. Tendo em mente tais argumentos, este trabalho objetiva demonstrar, através do exame de um corpus composto por letras e trechos de letras de rap nacional, que, em primeiro lugar, quando analisadas de uma perspectiva discursiva e multiculturalista, tais letras podem ser extremamente sofisticadas e ricas do ponto de vista poético-linguístico. E, em um segundo momento, que longe de incitar à violência, a análise dessas letras pode contribuir para uma melhor compreensão de suas causas e efeitos, possibilitando que o aluno desenvolva uma leitura crítica desse e de outros problemas do mundo contemporâneo. Nesse percurso, são revisitadas as origens do que se convencionou chamar de black music, com destaque para o hip-hop, movimento do qual o rap é a face poético-musical; as questões relativas aos meios, legais ou ilegais, de sua divulgação; as políticas públicas para a juventude; as reflexões sobre rap e educação, tendo por base sobretudo os Parâmetros Curriculares Nacionais e as teorias do currículo. As bases teóricas do trabalho estão assentadas nos conceitos de identidades e culturas híbridas tais como preconizados prioritariamente pelos Estudos Culturais. Este trabalho também se utiliza de alguns conceitos da Análise do Discurso, da Teoria Literária e da Teoria da Comunicação. O corpus em questão foi analisado de uma perspectiva qualitativa-interpretativista. A expectativa é que idealizadores de currículo, produtores de materiais didáticos, professores e formadores de professores possam, a partir da leitura deste trabalho, convencer-se da contribuição do rap nacional ao currículo de Língua Portuguesa do Ensino Médio, tanto em escolas públicas, quanto em particulares
Abstract: This thesis aims at justifying the pedagogical treatment and the curriculum inclusion of Brazilian rap lyrics in the area of Languages, Codes and their Technology, particularly in what the teaching of Portuguese and Literature is concerned. Brazilian rap has occupied a central position in urban cultural production in the country: this poetic-musical genre is seen as an opportunity to give ?voice? to a youth majority (from middle and working classes) who are, discursively, often treated as ?minorities?; it has been the theme of academic work in different fields; it has been used in educational programs conducted by nongovernmental social organizations; governmental policies for the youth consider it a legitimate manifestation of Brazilian young people. Still, the use of rap lyrics in the classrooms of the official education system has been extremely rare. The arguments presented for the exclusion or rap in the curriculum usually are that its discourse incentives violence and that its lyrics are poor. Bearing in mind such arguments, this thesis tries to demonstrate, through the analysis of some Brazilian contemporary rap lyrics, that, in one hand, such lyrics can be extremely sophisticated and rich in poetical and linguistic terms when examined though a discursive and multicultural perspective. And, secondly, that instead of inciting violence, the analysis of rap lyrics in the classroom such as the ones here included can contribute to a better understanding of its causes and effects, leading students to develop a more critical understanding of this and other problems of contemporary life. In order to be able to achieve such objectives, reviews involving the origins of what is commonly known as black music and the hip-hop movement - which has the rap as its poetic-musical side -, as well as of questions related to legal and illegal means of publicizing raps are presented. Also included are discussions concerning present public policies for Brazilian youth and the place given to cultural products such as raps in curriculum theory and in the Parâmetros Curriculares Nacionais. The theoretical bases of the work include the concepts of hybrid cultures and identities taking the contributions of Cultural Studies as a primary reference. Some concepts from the field of Discourse Analysis, from Literary Theory and Communication Theory, are also used. The data analysis here described is qualitative and interpretative in nature. It is hoped that curriculum policy makers, pedagogical material producers, teachers and teacher educators may, by reading this thesis, be convinced of how valuable can be the inclusion of Brazilian rap lyrics in the curriculum of Língua Portuguesa in both public and private high schools
Doutorado
Multiculturalismo, Plurilinguismo e Educação Bilingue
Doutor em Linguística Aplicada

Acompanha: Ciência e arte na sala de aula e atividades
Este trabalho se propôs a repensar o ensino de alguns tópicos da óptica a partir das relações entre ciência e arte, entendidas como expressões humanas inseparáveis e instrumentos de compreensão do mundo. O referencial teórico possibilitou reflexões sobre o processo ensino-aprendizagem, sobre as relações entre Ciência a Arte como áreas do conhecimento humano construídas sócio historicamente e sobre o papel da criatividade e da imaginação no ensino de ciências. Baseando-se nestas relações, foi desenvolvida uma unidade didática alternativa para transposição de conceitos da óptica geométrica no ensino médio. A intervenção teve como concepção norteadora a pedagogia dialógico-problematizadora de Paulo Freire e se utilizou dos três momentos pedagógicos Estudo da Realidade, Organização do Conhecimento e Aplicação do Conhecimento, que são proposição dos pesquisadores J.A. Angotti e D. Delizoicov. Foi desenvolvida em três etapas e envolveu seis turmas de três colégios estaduais em Curitiba. O tema gerador foi a Arte Urbana (especialmente o grafite), presente no universo dos nossos educandos. A discussão gerada abordou o conceito de Ciência e a problematização foi feita utilizando-se a tela “An Experiment on a Bird in the Air Pump” (1766), de Joseph Wright of Derby. A estratégia de pesquisa foi do tipo observação participante e o tratamento de dados pelo método comparativo constante. Os dados foram obtidos no estilo cooperativo e a categoria geral definida para análise foi a das “Perspectivas tidas pelos sujeitos”, pois esta é consoante com a concepção freiriana de educação centrada nos sujeitos envolvidos e suas vivências. A pesquisa possibilitou concluir que são promissoras as possibilidades de incrementar o ensino de Física numa abordagem que busque reflexão sobre o papel da Ciência na construção coletiva e histórica do conhecimento, enriquecida pelas suas relações com a Arte; tanto na dimensão pedagógica quanto na acadêmica de pesquisa.
A summary of the stages of a qualitative research on Education, developed at UTFPR, Brazil, is presented. The purpose of this work is to rethink Education on some topics of Optics, on the basis of the relationship between Science and Art, which are understood here as inseparable human expressions and representations of the world. Based on this relationship, an alternative didactic unit was developed, aiming the transposition of concepts on Geometrical Optics in high school. The intervention was based on the dialogical and problem-posing approach due to Paulo Freire, and it was applied to six classes at three State high schools in Curitiba. The generative theme was Street Art, ubiquitous in the universe of students. The generated discussion involved the concept of Science and questioning was made using the painting “An Experiment on a Bird in the Air Pump”, by Joseph Wright of Derby (1766). The research strategy was participant observation, and data were processed by constant comparative method. The data were obtained from the cooperative style and the general category set for analysis was that of “Perspectives taken by subject”, since this is consonant with the Freirian conception for education centered on the involved subjects and their experiences. The research made it possible to conclude that the possibilities are promising to increase the teaching of Physics in an approach that aims to reflect on the role of science in building collective and historic knowledge, enriched by their relationships with art; both in pedagogical and academic research.

This publication contains the reflections and proposals made within the framework of the 2018–2019 University of Zaragoza Master of Architecture programme. Continuing on from the work of previous years on other districts of the city of Zaragoza we refer to as ‘inner peripheries’, particularly those com- prising the so-called ‘Orla Este’ (‘eastern fringe’) – the neighbourhoods of San José and Las Fuentes – this time the team of students and teaching staff involved turned their focus to the Torrero-La Paz dis- trict. This area of the city has problems similar to those previously studied, as they are distinguished by depopulation and ageing, in other words, the tendency to lose inhabitants, particularly younger generations. Moreover, its physical structure is characterised by a congested network of streets, high population density, a scarcity of green spaces and facilities, and the poor design of existing public spaces and deficiencies in the standards of construction of many of its buildings. All of this is reflec- ted in the proliferation of urban fabrics in the process of becoming obsolete, which may lead to the appearance of pockets of vulnerability. Nonetheless, the diagnostic exercises undertaken have also allowed the potential of the district to be identified. This publication contains the proposals for urban renewal and building restoration based on the interventions to improve public spaces and dwellings, in addition to facilities, traffic management and public parking spaces. In a nutshell, all those aspects that we can include within the broad concept of urban renewal and with the aim of progressing towards a much-improved neighbourhood. The publication of this book was made possible by the collaboration agreement between Zaragoza City Council, through Zaragoza Vivienda, and the School of Engineering and Architecture of the University of Zaragoza.

This chapter explores the Advanced Placement (AP) program in suburban school districts. Even as urban centers like Fort Worth and New York typify today's livelier venues for AP expansion, the program has deep roots in the prosperous suburbs that abut them. Along with elite private schools, upscale suburban high schools were among the program's earliest adopters, and they remain natural habitats for a nationally benchmarked, high-status venture that gives strong students a head start on the college education that they are almost certainly going to get and perhaps an extra advantage in gaining admission to the universities they aspire to. Yet they are also ripe for attention as they struggle with equity and growth issues of their own. The chapter then reviews two well-known yet very different suburban districts: Dublin City Schools in Ohio and Montgomery County Public Schools in Maryland. Both are celebrated as education successes in their states and both boast long and impressive AP track records. Both, however, face distinctive challenges as they seek to serve today's constituents. Their stories illustrate how AP is functioning in places that know it well yet continue to evolve with it.

Anderson’s parents come from academic families in Indiana. Phil and his sister Grace grew up in Urbana, Illinois because their father was a plant pathologist at the University of Illinois (UI). Mother Elsie demanded academic excellence and respect for others. Father Harry was a model of integrity, a fact displayed during the so-called Krebiozen affair. The Depression affected the family relatively little and Phil acquired his lifelong liberal politics from a UI social group called the Saturday Hikers. At age twelve, he accompanies his family to Europe (a sabbatical for his father) where they observe the rise of Nazism. Phil attends and excels at the University High School where he enjoys math, tennis, and speed skating, but not physics. He wins a National Scholarship to attend Harvard University with a plan to major in mathematics.

El treball proposat per a aquest Taller Vertical Social planteja el reconeixement d'un territori en expansió, que en la majoria dels casos creix sense la planificació adequada, en condicions d'autogestió que a poc a poc consoliden fragments de la ciutat que se sumen a la dinàmica econòmica , cultural i social. Alhora que els entorns d'aquestes zones frontera del que és urbà es consoliden en colònies de la taca urbana, sovint no tenen les dotacions apropiades de serveis i equipaments, connectivitat urbana, mobilitat, cohesió social, seguretat pública i ocupació. El canvi d'ús del sòl rural a urbà és un fenomen habitual en aquestesàrees perifèriques de la ciutat, generalment com a resultat de la migració de persones tant d'altres localitats com de la mateixa. Els assentaments humans fixen com a primera necessitat l'habitatge i els serveis que requereixen, inicien així un procés de transformació permanent on les persones es van adaptant a les condicions que a poc a poc succeeixen, moltes vegades d'una manera espontània, poc reflexiva cap a la meta d'habitabilitat requerida per a un desenvolupament sa. Recentment s'ha treballat des d'instàncies governamentals la idea de recerca de benestar per a les famílies menys afavorides, entenent que el concepte implica treballar en diverses dimensions, com allò social, cultural, econòmic, ambiental i humà. Implicant això darrer un procés participatiu de gestió on les persones que requereixen una millora substancial de vida siguin els agents més importants d'aquesta causa. Puerto Benestar és per això el concepte que dóna forma a aquest exercici acadèmic, on es planteja a partir d'una lectura del lloc, de la interacció amb habitants del lloc i la valoració tecniconormativa, realitzar propostes d'intervenció de l'espai públic que enforteixin i qualifiquin les condicions de les persones que hi habiten. De la mateixa manera cal destacar que la nostra Facultat proposa en el seu nou pla d'estudis, enfortir diferents habilitats i capacitats dels seus estudiants, entre les quals hi ha el comprendre les diferents problemàtiques de la societat, vincular el seu treball per a la seva atenció amb ple compromís de responsabilitat social, des d'una plataforma d'anàlisi crítica, capacitat creativa, treball en equip, autogestió del coneixement i destreses que avui dia demanen la professió de l'arquitecte. L'exercici planteja desenvolupar habilitats en quatre aspectes del procés: Anàlisi, Disseny, Comunicació, Enfocament Transversal. Alhora els objectius principals del taller van ser: Mostrar l'elaboració d'estudis socials i multidisciplinaris sobre el context i l'espai construït aplicables al procés de disseny. Demostrar habilitat i destresa en la comunicació escrita utilitzant la terminologia idònia en funció de l'objecte arquitectònic dissenyat o construït, inclusivament […], del context en diferents etapes de la història de l'arquitectura i de l'entorn cultural i urbà on està immers. Demostrar coneixements sobre responsabilitat social i principis ètics de la professió.L'exercici va tenir dues etapes de realització, la primera de caràcter teòric, amb anàlisi de barri, i mapeigs d'interaccions socioespacials. La segona realitzant una micro intervenció al lloc d'una manera molt senzilla, molt conceptual, molt a nivell de construcció de comunitatFinalment, de la valoració de 185 treballs que van ser pujats a la plataforma d'avaluació es poden identificar certs patrons que evidencien com els estudiants observen el territori de la vida pública, així com les interaccions entre les persones. The Vertical Social Workshop proposes the recognition of an expanding territory, which in most cases grows without adequate planning, in conditions of self-management that gradually consolidate fragments of the city that are added to the economic, cultural and social dynamics of the same. In the instrumental pedagogical part, the exercise is located within the academic programming of the 2022-22 school year of the undergraduate programme of the UMNSH Faculty of Architecture, with the objective of carrying out a short workshop in which all the students of the institution participated, organised in teams, carrying out an intervention project in the public space in areas of the city characterised by high marginalisation and which were considered within the support programme of the Ministry of Territorial Development (SEDATU). The academic results were very positive and in their materialisation they continued with the consolidation of neighbourhood improvement. El Taller Vertical Social plantea el reconocimiento de un territorio en expansión, que en la mayoría de los casos crece sin la planeación adecuada, en condiciones de autogestión que poco a poco consolidan fragmentos de la ciudad que se suman a la dinámica económica, cultural y social de la misma. En la parte instrumental pedagógica el ejercicio se ubica dentro de la programación académica del ciclo escolar 2022-22 del programa de licenciatura de la Facultad de Arquitectura UMNSH, teniendo como objetivo realizar un taller de corta duración donde participaran todos los estudiantes de la institución organizados en equipos realizando un proyecto de intervención en el espacio público en polígonos de la ciudad caracterizados por una alta marginación y que estuvieran considerados dentro del programa de apoyos de la Secretaria de Desarrollo Territorial (SEDATU). Los resultados académicos fueron muy positivos y en su materialización continuaron con la consolidad del mejoramiento barrial.