Kliknij ten link, aby zobaczyć inne rodzaje publikacji na ten temat: Translocation breakpoint regions.
Artykuły w czasopismach na temat „Translocation breakpoint regions”
Utwórz poprawne odniesienie w stylach APA, MLA, Chicago, Harvard i wielu innych
Sprawdź 50 najlepszych artykułów w czasopismach naukowych na temat „Translocation breakpoint regions”.
Przycisk „Dodaj do bibliografii” jest dostępny obok każdej pracy w bibliografii. Użyj go – a my automatycznie utworzymy odniesienie bibliograficzne do wybranej pracy w stylu cytowania, którego potrzebujesz: APA, MLA, Harvard, Chicago, Vancouver itp.
Możesz również pobrać pełny tekst publikacji naukowej w formacie „.pdf” i przeczytać adnotację do pracy online, jeśli odpowiednie parametry są dostępne w metadanych.
Przeglądaj artykuły w czasopismach z różnych dziedzin i twórz odpowiednie bibliografie.
1
Keats, Jonathan J., Erin Strachan, Andrew R. Belch i Linda M. Pilarski. "The Classical Illegitimate Switch Translocation Model Is Unable To Account for at Least Half of the Translocation Breakpoints from t(4;14)(p16;q32) Multiple Myeloma." Blood 106, nr 11 (16.11.2005): 1556. http://dx.doi.org/10.1182/blood.v106.11.1556.1556.
Pełny tekst źródłaStreszczenie:
Abstract Translocations involving the IgH locus are one of the most common genetic abnormalities observed in multiple myeloma (MM). Unlike several hematological malignancies, MM IgH translocations involve multiple partner chromosomes. Although IgH translocations are not unique to MM, the molecular anatomy of the translocations appears to be different from that observed in most B-cell malignancies. In general, the breakpoints occur within the switch regions of the IgH locus and the translocations appear to result from illegitimate class switch recombination (CSR) events. Previous analysis of the breakpoint junctions from t(4;14) samples suggested that the majority of these translocations result from illegitimate CSR events. These events were characterized by der(4) breakpoints containing Smu-chromosome 4 junctions and der(14) breakpoints with chromosome 4-downstream switch region junctions. However, not all t(4;14) breakpoints fit this “classical” model, as some derivative chromosomes were observed with hybrid switch regions. Unfortunately, the mechanism that generates these hybrid switch regions has been unclear. In general, only a single derivative was cloned from each patient or cell line. In the one case reported elsewhere in which both derivatives were cloned, the mechanism did not appear to be linked to the CSR process and thus represented a “non-classical” translocation. The poor prognostic impact of t(4;14) myeloma has been well established by several groups, including our own. In an attempt to identify recurrent breakpoint sites and to identify the potential mechanism(s) leading to t(4;14) translocations, we cloned the breakpoint junctions of both derivative chromosomes from 4 cell lines and 5 patients with MB4-2 and MB4-3 breakpoints. Furthermore, we cloned der(4) breakpoints from 4 additional patients, three of which are FGFR3 non-expressers for which we could not detect a der(14) breakpoint using our PCR based strategy. We defined the t(4;14) breakpoint region as encompassing 64.5 kb of chromosome 4, flanked by LETM1 exon 3 and MMSET exon 5, based on combining the previously published breakpoints with our newly cloned and sequenced breakpoints. Current dogma suggests that t(4;14) translocation events are randomly distributed throughout the defined breakpoint region, but this idea is not supported by our sequencing data. We identified two hotspots, which contain breakpoints from 9 of the 27 patients or cell lines with at least one cloned derivative. Interestingly, these regions only represent 1 kb of the entire breakpoint region. Therefore 33% of the cloned breakpoints exist within only 1.5% of the total breakpoint region. Moreover, for the 13 MM samples for which both derivatives are cloned, although 6/13 (46%) fit the classical model of CSR mediated switch translocations, surprisingly, 7/13 (54%) appear to be non-classical translocations. The non-classical translocations are defined by little to no loss of sequence from the involved switch region and the presence of a hybrid switch region on one of the two derivative chromosomes. Importantly, the non-classical translocations may not involve B-cell specific mechanisms and could potentially occur before or after a successful CSR event. Therefore, the classical illegitimate CSR event model can explain only half of the t (4; 14) breakpoints cloned to date.
2
Walker, Brian A., Christopher P. Wardell, Dil B. Begum, Nasrin B. Dahir, Fiona M. Ross, Faith E. Davies, David Gonzalez i Gareth J. Morgan. "Base-Pair Resolution Mapping of IGH Translocations in Multiple Myeloma Using Targeted Capture and Massively Parallel Sequencing". Blood 120, nr 21 (16.11.2012): 3490. http://dx.doi.org/10.1182/blood.v120.21.3490.3490.
Pełny tekst źródłaStreszczenie:
Abstract Abstract 3490 IGH loci translocations in multiple myeloma are primary events in the aetiology of the disease. There are 5 main translocation partner chromosomes which result in the over-expression of key oncogenes. These translocations are t(4;14), t(6;14), t(11;14), t(14;16) and t(14;20) and result in the over-expression of MMSET and FGFR3, CCND3, CCND1, MAF and MAFB, respectively. The translocations have a major impact on response and survival with the t(4;14), t(14;16) and t(14;20) resulting in poor prognosis. It is therefore imperative that these chromosomal abnormalities be identified. Translocations have traditionally been identified by fluorescence in situ hybridisation (FISH). Using targeted capture techniques, similar to exome capture technology, followed by massively parallel sequencing it should be possible to identify the translocations and the specific breakpoints. We have developed a targeted capture using the SureSelect (Agilent) system by tiling RNA baits across the IGH locus. Baits covered the V, D and J segments as well as being tiled across the entire constant region, including the switch regions. DNA from samples (n=120) were assayed using 150 ng of DNA and a modified capture protocol. The translocation partner had previously been identified by FISH in 36 samples which comprised 11 t(4;14), 3 t(6;14), 11 t(11;14), 9 t(14;16), 2 t(14;20). The remaining 84 samples were assayed by RQ-PCR for over-expression of the partner oncogenes to determine the translocation. Several identified translocations were verified by PCR. In 90% of samples which had FISH performed the correct IGH translocation was detected using the capture technique. The number of paired reads detecting the translocation varied from 2 to 102. Breakpoints could be determined for all of these samples and were mapped for each translocation group. In the t(4;14) group the breakpoints were clustered around exons 1, 4 and 5, corresponding to the MB4-1, MB4-2 and MB4-3 IgH-MMSET hybrid transcripts. Of the 11 t(4;14) with FISH only 2 did not express FGFR3 and had deletion of der(14). In these samples the breakpoint was located between LETM1 and MMSET, confirming that loss of FGFR3 expression is due to deletion of der(14) and not due to the location of the breakpoint. The sample with the breakpoint furthest from MMSET was located 67 kbp upstream of the start of translation within LETM1, in a position similar to that found in the KMS-11 cell line. In the t(11;14) samples the breakpoints varied dramatically on chromosome 11 but were always centromeric to CCND1. Breakpoints varied from 1.1 kbp centromeric to the start of CCND1 transcription to 1.1 Mbp centromeric, within the PPP6R3 gene. However, most breakpoints (70%) were in the intergenic region between MYEOV and CCND1. The distance from the breakpoint to CCND1 did not inversely correlate with CCND1 expression, in fact the sample with the breakpoint furthest from CCND1, within PPP6R3, had the highest expression of CCND1 as determined by gene expression array. No samples had breakpoints within the mantle cell lymphoma major translocation cluster. However, 2 samples had their breakpoint within 100 bp of one another, indicating a possible common breakpoint. Of the t(6;14) samples 2 had breakpoints in the first intron of CCND3, upstream of the start of translation. The remaining sample had its breakpoint 550 kbp upstream of the transcription start site within UBR2. The t(14;16) samples all had their breakpoints within the last intron of WWOX, 0.48–1.03 Mbp centromeric of MAF and in the location of the common fragile site FRA16D. The breakpoints cluster into 2 groups on either side of the fragile site. The t(14;20) breakpoints were located in the 1.5 Mbp intergenic region centromeric of MAF. The breakpoint furthest from MAF was 1.2 Mbp centromeric of the gene. In conclusion, we have developed and validated a targeted capture and sequencing approach for identifying translocations into the IGH locus in myeloma. This approach is important because of its capacity for high throughput low cost testing strategies that can identify these important prognostic events making a myeloma specific diagnostic platform and personalised medicine a reality for patients with myeloma. Importantly sequence analysis of the peri-breakpoint regions gives insight into molecular mechanisms acting early in the process of myelomagenesis. Disclosures: No relevant conflicts of interest to declare.
3
Cleary, M. L., N. Galili i J. Sklar. "Detection of a second t(14;18) breakpoint cluster region in human follicular lymphomas." Journal of Experimental Medicine 164, nr 1 (1.07.1986): 315–20. http://dx.doi.org/10.1084/jem.164.1.315.
Pełny tekst źródłaStreszczenie:
Our results indicate that there are two major breakpoint cluster regions in chromosome 18 DNA for t(14;18) translocations in follicular lymphomas. The absence of a pFL-1 homologous transcript in a cell line containing a pFL-2-detectable translocation suggests that there may be two different pathogenetic consequences of t(14;18) translocations. One possibility is that, despite the distances between them (greater than 20 kb), breakpoints in the two cluster regions in some way affect transcription of the same gene product, which has not yet been identified. Alternatively, two separate transcriptional units may be involved. The availability of DNA probes for each of the two t(14;18) breakpoint cluster regions will allow further studies regarding the biologic significance of these two genetically distinct classes of t(14;18) translocations.
4
Greisman, Harvey A., Hye Son Yi i Noah G. Hoffman. "transCGH: Rapid Identification and High-Resolution Mapping of Balanced IgH Translocations in Archival DNA Using Custom Oligonucleotide Arrays." Blood 110, nr 11 (16.11.2007): 459. http://dx.doi.org/10.1182/blood.v110.11.459.459.
Pełny tekst źródłaStreszczenie:
Abstract Array based comparative genomic hybridization (CGH) has revolutionized the study of chromosomal imbalances but generally is incapable of detecting balanced genomic rearrangements like reciprocal translocations, which play central roles in the pathogenesis and diagnosis of lymphomas, leukemias and other tumors. The precise identification of immunoglobulin heavy chain (IgH) translocation partners, for example, is essential for the classification of B cell lymphomas and for predicting prognosis in plasma cell neoplasms like multiple myeloma. Using IgH translocations as a model for balanced genomic rearrangements, we have developed a simple modification of array CGH that we call translocation-CGH (transCGH) and that enables the rapid identification of IgH translocation partners and precise mapping of translocation-associated breakpoints to unprecedented resolution. To render IgH translocations detectable on CGH arrays, genomic DNA from test and reference samples is modified prior to array hybridization in an enzymatic linear amplification reaction that employs a single IgH joining (JH) or switch (Sμ/Sα/Sε) region primer, resulting in specific amplification of any fusion partner sequences that may be inserted (via translocation or other rearrangement) downstream of the IgH primer. Using a single tiling-density oligonucleotide array representing such common IgH partner loci as MYC, BCL2 and CCND1 (cyclin D1), transCGH successfully identified and mapped to ∼100bp resolution an assortment of known IgH fusion breakpoints in various cell lines and primary lymphomas, including JH-CCND1 breakpoints in MO2058 and Granta 519 cell lines (mantle cell lymphoma), a cytogenetically cryptic Sα-CCND1 fusion in U266 (myeloma), JH-MYC and Sμ-MYC breakpoints in MC116 and Raji (Burkitt lymphoma), and JH-BCL2 breakpoints in DHL16 (large cell lymphoma; minor cluster region) and in an archival case of follicular lymphoma (major breakpoint region). We then used transCGH to analyze 4 archival cases of mantle cell lymphoma and one t(11;14)-positive case of B cell prolymphocytic leukemia, all of which lacked PCR-detectable translocation breakpoints at the CCND1 major translocation cluster (MTC). Five novel CCND1 translocation breakpoints were identified and mapped to ∼100bp resolution, allowing the rapid design of patient-specific PCR primers for amplification, sequencing, and confirmation of the predicted breakpoints. One breakpoint mapped to within 500bp of the MTC, whereas the other 4 were scattered across a ∼150kb region flanking the MTC. To our knowledge, this represents the largest series of non-MTC mantle cell lymphoma breakpoint sequences reported to date. It also illustrates how transCGH can facilitate the rapid cloning of previously unidentified IgH translocation breakpoints dispersed over very large genomic regions. Because transCGH requires only genomic DNA and can simultaneously detect both balanced IgH translocations and genomic imbalances at ultra-high resolution on the same array, it may become a useful alternative to molecular cytogenetic methods (e.g. FISH) for clinical testing of B cell and plasma cell neoplasms. transCGH also will facilitate the development of highly sensitive breakpoint-specific PCR assays for detecting minimal residual disease. Finally, because the primer used in the linear amplification reaction is fully customizable, transCGH can readily be adapted to identify and map other balanced translocations (or more complex genomic fusions) that involve non-IgH loci, provided that one of the fusion partners is known.
5
Auger, Donald L., i William F. Sheridan. "Negative Crossover Interference in Maize Translocation Heterozygotes". Genetics 159, nr 4 (1.12.2001): 1717–26. http://dx.doi.org/10.1093/genetics/159.4.1717.
Pełny tekst źródłaStreszczenie:
Abstract Negative interference describes a situation where two genetic regions have more double crossovers than would be expected considering the crossover rate of each region. We detected negative crossover interference while attempting to genetically map translocation breakpoints in maize. In an attempt to find precedent examples we determined there was negative interference among previously published translocation breakpoint mapping data in maize. It appears that negative interference was greater when the combined map length of the adjacent regions was smaller. Even positive interference appears to have been reduced when the combined lengths of adjacent regions were below 40 cM. Both phenomena can be explained by a reduction in crossovers near the breakpoints or, more specifically, by a failure of regions near breakpoints to become competent for crossovers. A mathematical explanation is provided.
6
Westbrook, CA, CM Rubin, JJ Carrino, MM Le Beau, A. Bernards i JD Rowley. "Long-range mapping of the Philadelphia chromosome by pulsed-field gel electrophoresis". Blood 71, nr 3 (1.03.1988): 697–702. http://dx.doi.org/10.1182/blood.v71.3.697.697.
Pełny tekst źródłaStreszczenie:
Abstract The Philadelphia chromosome (Ph1) of chronic myelogenous leukemia (CML) contains sequences from chromosome 9, including the ABL protooncogene, that have been translocated to the breakpoint cluster region (bcr) of chromosome 22, giving rise to a bcr-ABL fusion gene, whose product has been implicated in the genesis of CML. Although chromosome 22 translocation breakpoints in CML virtually always occur within the 5.8- kilobase (kb) bcr, chromosome 9 breakpoints have been identified within the known limits of ABL in only a few instances. For a better understanding of the variability of the breakpoints on chromosome 9, we studied the CML cell line BV173. Using pulsed-field gel electrophoresis (PFGE), large-scale maps of the t(9;22) junctions were constructed. The chromosome 9 breakpoint was shown to have occurred within an ABL intron, 160 kb upstream of the v-abl homologous sequences, but still 35 kb downstream of the 5′-most ABL exon. bcr-ABL and ABL-bcr fusion genes were demonstrated on the Ph1 and the 9q+ chromosomes, respectively; both of these genes are expressed. These results suggest that the 9;22 translocation breakpoints in CML consistently occur within the limits of the large ABL gene. RNA splicing, sometimes of very large regions, appears to compensate for the variability in breakpoint location. These studies show that PFGE is a powerful new tool for the analysis of chromosomal translocations in human malignancies.
7
Westbrook, CA, CM Rubin, JJ Carrino, MM Le Beau, A. Bernards i JD Rowley. "Long-range mapping of the Philadelphia chromosome by pulsed-field gel electrophoresis". Blood 71, nr 3 (1.03.1988): 697–702. http://dx.doi.org/10.1182/blood.v71.3.697.bloodjournal713697.
Pełny tekst źródłaStreszczenie:
The Philadelphia chromosome (Ph1) of chronic myelogenous leukemia (CML) contains sequences from chromosome 9, including the ABL protooncogene, that have been translocated to the breakpoint cluster region (bcr) of chromosome 22, giving rise to a bcr-ABL fusion gene, whose product has been implicated in the genesis of CML. Although chromosome 22 translocation breakpoints in CML virtually always occur within the 5.8- kilobase (kb) bcr, chromosome 9 breakpoints have been identified within the known limits of ABL in only a few instances. For a better understanding of the variability of the breakpoints on chromosome 9, we studied the CML cell line BV173. Using pulsed-field gel electrophoresis (PFGE), large-scale maps of the t(9;22) junctions were constructed. The chromosome 9 breakpoint was shown to have occurred within an ABL intron, 160 kb upstream of the v-abl homologous sequences, but still 35 kb downstream of the 5′-most ABL exon. bcr-ABL and ABL-bcr fusion genes were demonstrated on the Ph1 and the 9q+ chromosomes, respectively; both of these genes are expressed. These results suggest that the 9;22 translocation breakpoints in CML consistently occur within the limits of the large ABL gene. RNA splicing, sometimes of very large regions, appears to compensate for the variability in breakpoint location. These studies show that PFGE is a powerful new tool for the analysis of chromosomal translocations in human malignancies.
8
Schüler, Frank, Sandra C. Dölken, Carsten Hirt i Gottfried Dolken. "Multiplex Quantitative Real-Time PCR for the Detection of t(14;18) Translocations with Breakpoints within 5 Different Regions of the BCL-2 Gene: MBR, 3′MBR, mcr, 5′mcr, icr." Blood 106, nr 11 (16.11.2005): 2826. http://dx.doi.org/10.1182/blood.v106.11.2826.2826.
Pełny tekst źródłaStreszczenie:
Abstract Follicular lymphomas (FL) are associated with the chromosomal translocation t(14;18)(q32;q21). Most breakpoints of chromosome 18 (60%) occur in the major breakpoint region (MBR) of the BCL-2 gene. Further breakpoints have been detected in the minor cluster region (mcr), less frequent breakpoints are found in regions called 3′-MBR, 5′-mcr and icr. On chromosome 14 most breakpoints are located within one of the six JH-genes. Therefore, BCL-2 translocations with breakpoints within the MBR and mcr are generally detected by PCR using combinations of different BCL-2 primers with one JH-consensus primer. We have developed a multiplex quantitative real-time PCR strategy that that can be used to detect t(14;18) translocations with breakpoints located within all regions mentioned above. To minimize the costs for expensive probes we used the JH-consensus sequence as a target for one “consensus probe” (fluorescent labelled minor groove binder probe) for all assays in combination with 6 different JH intron primers. To reduce the size of amplified PCR fragments 12 BCL-2 primers were chosen in combination with 6 JH intron primers for the detection of all 5 breakpoint regions. It is very important to choose short DNA target sequences for amplification: (a) to establish a real-time PCR with a high amplification efficacy; (b) to be able to amplify target sequences also from partially degraded DNA isolated from formaldehyde-fixed paraffin-embedded tissue sections; (c) to achieve a high sensitivity to detect 1–3 copies per assay. Peripheral bood mononuclear cells (PBMNC) and formalin fixed, paraffin embedded lymph node tissue obtained from 139 FL patients at the time of diagnosis (LN and PBMNC, n = 54; LN only, n = 3; PBMNC only, n = 82) were tested by multiplex quantitative real-time PCR. 80 breakpoints were identified within the MBR (61%) region. For comparison, 78/80 breakpoints were also detected by our standard real-time PCR assay with one BCL-2-MBR- primer and one JH consensus primer in combination with a fluorescent probe located within the BCL-2 sequence [Doelken et al., BioTechniques, 1998]. Two additional translocations with breakpoints located 5′ of the target sequence of the standard PCR were found by using two additional MBR primers. In addition, five mcr breakpoints (5%), one breakpoint in the 3′MBR region and one breakpoint in the icr region were found. Based on these results the prevalence of breakpoints in various regions of the BCL-2 gene in FL patients is: MBR = 61% (80/139); mcr = 5% (5/139); 3′MBR = 1% (1/139); icr = 1% (1/139); 5′mcr = 0%). Furthermore, based on quantitative PCR results the t(14;18) translocations detected in this study were undoubtedly lymphoma associated and did not belong to t(14;18)-positive non-lymphoma B cell clones found in healthy persons. By applying this multiplex quantitative real-time PCR strategy t(14;18) translocations with breakpoints in five different breakpoint clusters can be detected in about 70% of patients with follicular lymphoma. The assays can be used for a fast and reliable quantitative detection of t(14;18) translocations on DNA isolated from fresh lymph nodes or pathological specimens as well as blood samples at the time of diagnosis. In almost all cases quantitative results will allow a distinction whether the translocation found is lymphoma associated or not, which will in turn allow a quantitative MRD analysis on follow-up samples during and after treatment.
9
Matynia, Anna P., K. David Li, Philippe Szankasi, Jonathan Schumacher, Michael Liew, Mohamed E. Salama i Todd W. Kelley. "Molecular Fingerprinting of Anatomically and Temporally Distinct B-Cell Lymphoma Samples by Next-Generation Sequencing to Establish Clonal Relatedness". Archives of Pathology & Laboratory Medicine 143, nr 1 (6.07.2018): 105–11. http://dx.doi.org/10.5858/arpa.2017-0497-oa.
Pełny tekst źródłaStreszczenie:
Context.— B-cell lymphomas exhibit balanced translocations that involve immunoglobulin loci and result from aberrant V(D)J recombination, class switch recombination, or somatic hypermutation. Although most of the breakpoints in the immunoglobulin loci occur in defined regions, those in the partner genes vary; therefore, it is unlikely that 2 independent clones would share identical breakpoints in both partners. Establishing whether a new lesion in a patient with history of lymphoma represents recurrence or a new process can be relevant. Polymerase chain reaction (PCR)–based clonality assays used in this setting rely only on evaluating the length of a given rearrangement. In contrast, next-generation sequencing (NGS) provides the exact translocation breakpoint at single-base resolution. Objective.— To determine if translocation breakpoint coordinates can serve as a molecular fingerprint unique to a distinct clonal population. Design.— Thirty-eight follicular lymphoma/diffuse large B-cell lymphoma samples collected from different anatomic sites and/or at different time points from 18 patients were analyzed by NGS. For comparison, PCR-based B-cell clonality and fluorescence in situ hybridization studies were performed on a subset of cases. Results.— IGH-BCL2 rearrangements were detected in all samples. The breakpoint coordinates on derivative chromosome(s) were identical in all samples from a given patient, but distinct between samples derived from different patients. Additionally, 5 patients carried a second rearrangement also with conserved breakpoint coordinates in the follow-up sample(s). Conclusions.— Breakpoint coordinates in the immunoglobulin and partner genes can be used to establish clonal relatedness of anatomically/temporally distinct lesions. Additionally, an NGS-based approach has the potential to detect secondary translocations that may have prognostic and therapeutic significance.
10
Ronchetti, Domenica, Palma Finelli, Raffaella Richelda, Luca Baldini, Mariano Rocchi, Luigi Viggiano, Antonio Cuneo i in. "Molecular Analysis of 11q13 Breakpoints in Multiple Myeloma". Blood 93, nr 4 (15.02.1999): 1330–37. http://dx.doi.org/10.1182/blood.v93.4.1330.
Pełny tekst źródłaStreszczenie:
Abstract The t(11;14)(q13;q32) chromosomal translocation, which is the hallmark of mantle cell lymphoma (MCL), is found in approximately 30% of multiple myeloma (MM) tumors with a 14q32 translocation. Although the overexpression of cyclin D1 has been found to be correlated with MM cell lines carrying the t(11;14), rearrangements of theBCL-1/cyclin D1 regions frequently involved in MCL rarely occur in MM cell lines or primary tumors. To test whether specific 11q13 breakpoint clusters may occur in MM, we investigated a representative panel of primary tumors by means of Southern blot analysis using probes derived from MM-associated 11q13 breakpoints. To this end, we first cloned the breakpoints and respective germ-line regions from a primary tumor and the U266 cell line, as well as the germ-line region from the KMS-12 cell line. DNA from 50 primary tumors was tested using a large panel of probes, but a rearrangement was detected in only one case using the KMS-12 breakpoint probe. Our results confirm previous findings that the 11q13 breakpoints in MM are scattered throughout the 11q13 region encompassing the cyclinD1 gene, thus suggesting the absence of 11q13 breakpoint clusters in MM.
11
Ronchetti, Domenica, Palma Finelli, Raffaella Richelda, Luca Baldini, Mariano Rocchi, Luigi Viggiano, Antonio Cuneo i in. "Molecular Analysis of 11q13 Breakpoints in Multiple Myeloma". Blood 93, nr 4 (15.02.1999): 1330–37. http://dx.doi.org/10.1182/blood.v93.4.1330.404k04_1330_1337.
Pełny tekst źródłaStreszczenie:
The t(11;14)(q13;q32) chromosomal translocation, which is the hallmark of mantle cell lymphoma (MCL), is found in approximately 30% of multiple myeloma (MM) tumors with a 14q32 translocation. Although the overexpression of cyclin D1 has been found to be correlated with MM cell lines carrying the t(11;14), rearrangements of theBCL-1/cyclin D1 regions frequently involved in MCL rarely occur in MM cell lines or primary tumors. To test whether specific 11q13 breakpoint clusters may occur in MM, we investigated a representative panel of primary tumors by means of Southern blot analysis using probes derived from MM-associated 11q13 breakpoints. To this end, we first cloned the breakpoints and respective germ-line regions from a primary tumor and the U266 cell line, as well as the germ-line region from the KMS-12 cell line. DNA from 50 primary tumors was tested using a large panel of probes, but a rearrangement was detected in only one case using the KMS-12 breakpoint probe. Our results confirm previous findings that the 11q13 breakpoints in MM are scattered throughout the 11q13 region encompassing the cyclinD1 gene, thus suggesting the absence of 11q13 breakpoint clusters in MM.
12
Willis, T. G., D. M. Jadayel, L. J. A. Coignet, M. Abdul-Rauf, J. G. Treleaven, D. Catovsky i M. J. S. Dyer. "Rapid Molecular Cloning of Rearrangements of the IGHJ Locus Using Long-Distance Inverse Polymerase Chain Reaction". Blood 90, nr 6 (15.09.1997): 2456–64. http://dx.doi.org/10.1182/blood.v90.6.2456.
Pełny tekst źródłaStreszczenie:
Abstract Clonal rearrangements of the Ig heavy chain (IGH ) locus consisting of either intrachromosomal (VDJ ) rearrangements or interchromosomal translocations are a consistent feature of all B-cell malignancies and may be used both diagnostically and to monitor response to therapy. Many of these rearrangements are targeted to the IGHJ segments, but only some can be amplified with regular polymerase chain reaction (PCR) techniques. To permit PCR amplification of potentially all IGHJ rearrangements, we have devised a method incorporating self-ligation of restriction endonuclease-digested DNA fragments with long-distance PCR (long-distance, inverse PCR [LDI-PCR]). We show here, using only 4 nested oligonucleotide primers, the successful amplification and DNA sequencing of all IGHJ rearrangements up to 5.4 kb in length from a panel of 13 cases and cell lines of various types of B-cell malignancy. In all cases, both VDJ and DJ IGH rearrangements and translocation breakpoints were amplified. Six cases exhibited t(14; 18)(q32; q21). All translocation breakpoints were cloned and sequenced. Three cases exhibited a rearrangement to the BCL2 major breakpoint region (MBR). However, 2 other cases exhibited rearrangements between the MBR and the minor cluster region (mcr). These 2 cases broke within 44 bp of each other, confirming the presence of an additional 3′ BCL2 breakpoint cluster region. The final case fell immediately 3′ of the 3′ UTR of the BCL2 gene adjacent to an Alu repeat. No other BCL2 breakpoints within this region have been reported. Four cases exhibited t(11; 14)(q13; q32). All 3 cases with translocations targeted to the IGHJ segments were successfully amplified and sequenced, including 1 case in which the BCL1 translocation could not be detected by DNA blot using the currently available probes. All three translocation breakpoints fell outside the BCL1 major translocation cluster between 20 and 40 kb telomeric and showed no clustering. Two of the three fell within or adjacent to Alu repeat regions. LDI-PCR is a simple and robust technique that allows PCR amplification of nearly all IGHJ rearrangements.
13
Willis, T. G., D. M. Jadayel, L. J. A. Coignet, M. Abdul-Rauf, J. G. Treleaven, D. Catovsky i M. J. S. Dyer. "Rapid Molecular Cloning of Rearrangements of the IGHJ Locus Using Long-Distance Inverse Polymerase Chain Reaction". Blood 90, nr 6 (15.09.1997): 2456–64. http://dx.doi.org/10.1182/blood.v90.6.2456.2456_2456_2464.
Pełny tekst źródłaStreszczenie:
Clonal rearrangements of the Ig heavy chain (IGH ) locus consisting of either intrachromosomal (VDJ ) rearrangements or interchromosomal translocations are a consistent feature of all B-cell malignancies and may be used both diagnostically and to monitor response to therapy. Many of these rearrangements are targeted to the IGHJ segments, but only some can be amplified with regular polymerase chain reaction (PCR) techniques. To permit PCR amplification of potentially all IGHJ rearrangements, we have devised a method incorporating self-ligation of restriction endonuclease-digested DNA fragments with long-distance PCR (long-distance, inverse PCR [LDI-PCR]). We show here, using only 4 nested oligonucleotide primers, the successful amplification and DNA sequencing of all IGHJ rearrangements up to 5.4 kb in length from a panel of 13 cases and cell lines of various types of B-cell malignancy. In all cases, both VDJ and DJ IGH rearrangements and translocation breakpoints were amplified. Six cases exhibited t(14; 18)(q32; q21). All translocation breakpoints were cloned and sequenced. Three cases exhibited a rearrangement to the BCL2 major breakpoint region (MBR). However, 2 other cases exhibited rearrangements between the MBR and the minor cluster region (mcr). These 2 cases broke within 44 bp of each other, confirming the presence of an additional 3′ BCL2 breakpoint cluster region. The final case fell immediately 3′ of the 3′ UTR of the BCL2 gene adjacent to an Alu repeat. No other BCL2 breakpoints within this region have been reported. Four cases exhibited t(11; 14)(q13; q32). All 3 cases with translocations targeted to the IGHJ segments were successfully amplified and sequenced, including 1 case in which the BCL1 translocation could not be detected by DNA blot using the currently available probes. All three translocation breakpoints fell outside the BCL1 major translocation cluster between 20 and 40 kb telomeric and showed no clustering. Two of the three fell within or adjacent to Alu repeat regions. LDI-PCR is a simple and robust technique that allows PCR amplification of nearly all IGHJ rearrangements.
14
Schnause, Anna Clara, Katalin Komlosi, Barbara Herr, Jürgen Neesen, Paul Dremsek, Thomas Schwarz, Andreas Tzschach i in. "Marfan Syndrome Caused by Disruption of the FBN1 Gene due to A Reciprocal Chromosome Translocation". Genes 12, nr 11 (21.11.2021): 1836. http://dx.doi.org/10.3390/genes12111836.
Pełny tekst źródłaStreszczenie:
Marfan syndrome (MFS) is a hereditary connective tissue disease caused by heterozygous mutations in the fibrillin-1 gene (FBN1) located on chromosome 15q21.1. A complex chromosomal rearrangement leading to MFS has only been reported in one case so far. We report on a mother and daughter with marfanoid habitus and no pathogenic variant in the FBN1 gene after next generation sequencing (NGS) analysis, both showing a cytogenetically reciprocal balanced translocation between chromosomes 2 and 15. By means of fluorescence in situ hybridization of Bacterial artificial chromosome (BAC) clones from the breakpoint area on chromosome 15 the breakpoint was narrowed down to a region of approximately 110 kb in FBN1. With the help of optical genome mapping (OGM), the translocation breakpoints were further refined on chromosomes 2 and 15. Sequencing of the regions affected by the translocation identified the breakpoint of chromosome 2 as well as the breakpoint of chromosome 15 in the FBN1 gene leading to its disruption. To our knowledge, this is the first report of patients with typical clinical features of MFS showing a cytogenetically reciprocal translocation involving the FBN1 gene. Our case highlights the importance of structural genome variants as an underlying cause of monogenic diseases and the useful clinical application of OGM in the elucidation of structural variants.
15
Luo, Wei, Nana Qin, Yang Mu, Huaping Tang, Mei Deng, Yaxi Liu, Guangdeng Chen i in. "Variation and diversity of the breakpoint sequences on 4AL for the 4AL/5AL translocation in Triticum". Genome 61, nr 9 (wrzesień 2018): 635–41. http://dx.doi.org/10.1139/gen-2018-0060.
Pełny tekst źródłaStreszczenie:
The translocation of 4AL/5AL in Triticum, which occurred before the differentiation of T. urartu and einkorn, is an important chromosomal rearrangement. Recently, the first identification of breakpoint sequence on 4AL for this translocation provides the opportunity to analyze the variation and diversity of breakpoints in Triticum. In this study, the breakpoint regions of 52 accessions from 21 species were isolated and further characterized. The sequences were divided into 12 types based on their lengths, which ranged from 2009 to 2552 bp. Cluster analysis showed that they were further divided into three groups. Interesting evolutionary relationships among a few of the species were observed and discussed. Multiple sequence alignment of the 52 sequences made it possible to detect 13 insertion and deletion length polymorphisms (InDels) and 101 single nucleotide polymorphisms (SNPs). Furthermore, several species- or accession-specific SNPs or InDels were also identified. Based on BLAST analysis of the conserved sequences, the breakpoint was narrowed down to a 125 bp fragment. Taken together, the results obtained in this study enrich our understanding of chromosomal breakpoints and will be useful for the identification of other breakpoints in wheat.
16
Künzel, G., K. I. Gecheff i I. Schubert. "Different chromosomal distribution patterns of radiation-induced interchange breakpoints in barley: First post-treatment mitosis versus viable offspring". Genome 44, nr 1 (1.02.2001): 128–32. http://dx.doi.org/10.1139/g00-104.
Pełny tekst źródłaStreszczenie:
Translocation breakpoints (TBs) induced by ionizing radiation are nonrandomly distributed along barley chromosomes. When first post-treatment mitoses were evaluated, centromeres and the heterochromatin-containing proximal segments tended to be more than randomly involved, and terminal segments to be less than randomly involved in translocations. Contrary to this, small chromosomal regions in median and distal arm positions, characterized by high recombination rates and high gene density, were identified as preferred sites for the origination of viable translocations, probably due to deviations in chromatin organization. Apparently, the position of a TB has an influence on the rate of viability versus elimination of the carrier cells. Surprisingly, TBs within centromeres and heterochromatin-containing segments seem to be more harmful for survival than those induced in gene-rich regions.Key words: Hordeum vulgare, radiation-induced chromosome breaks, translocation lines, breakpoint distribution.
17
Ketterling, Rhett P., Ryan A. Knudson i Heather C. Flynn Gilmer. "Discovery of 6 Novel Translocations Involving the Imatinib Responsive Genes PDGFRB and PDGFRB from Screening 29,047 Abnormal Bone Marrow Specimens." Blood 104, nr 11 (16.11.2004): 2902. http://dx.doi.org/10.1182/blood.v104.11.2902.2902.
Pełny tekst źródłaStreszczenie:
Abstract BACKGROUND: DNA rearrangements that result in the inappropriate activation of the PDGFRA gene at 4q12 and the PDGFRB gene at 5q31-q33 occur rarely in patients with chronic myeloproliferative disorders. Approximately 10% of patients with systemic mast cell disease/hypereosinophilic syndrome have a unique mutational mechanism resulting in PDGFRA overexpression due to a novel microdeletion of the CHIC2 region resulting in the juxtaposition of FIP1L1 and PDGFRA. PDGFRB activation has been observed in patients with chronic myelomonocytic leukemia/atypical chronic myeloid leukemia and has been associated with 11 translocation partners. Since patients with demonstrable breakpoints in the PDGFRA and PDGFRB genes often have a dramatic disease response to the tyrosine kinase inhibitor imatinib, we searched the Mayo Clinic Cytogenetic database to identify additional translocation partners involving these regions. METHODS: Homebrew dual-color FISH probes were created which flank the PDGFRA gene at 4q12 and the PDGFRB gene at 5q31-q33. Archived bone marrow karyotypes analyzed in the Mayo Clinic Cytogenetics laboratory from a 15 year period (1989-2004) were reviewed to determine the frequency of specimens with breakpoints at 4q12 and 5q31-33. Of the 29,047 abnormal specimens, 64 possessed a 4q12 breakpoint and 164 possessed a 5q31-q33 breakpoint (excluding simple deletions). Of these 228 patients, residual bone marrow specimens were available from 170 patients for FISH analysis. RESULTS: Eleven of 50 patients with a 4q12 breakpoint yielded a break with the PDGFRA FISH probe. Eight patients had the previously described t(4;12)(q12;p13) which results in a reciprocal exchange between the TEL oncogene and has a break near, but not within, the PDGFRA gene. Three patients had breaks within the PDGFRA gene and had novel translocation partners including 1q44, 3q25 and 17q23. Twelve of 120 patients with a 5q31-q33 anomaly had a break detected with the PDGFRB FISH probe. Nine patients had the classic t(5;12)(q33;p13) involving PDGFRB and TEL. Three patients had novel PDGFRB translocation partners, including 1q21, 14q32 and 16p13.1. CONCLUSIONS: Breakpoints involving the PDGFRA and PDGFRB genes appear to be quite uncommon as only 23 patient samples were abnormal in our series of 29,407 abnormal bone marrow samples. With the description of three new translocations involving PDGFRB, at least 14 unique translocation partners have been identified with this gene. With the exception of the recurrent t(5;12) between PDGFRB and TEL, most translocations involving PDGFRB appear to be unique. The microdeletion of CHIC2 at 4q12 resulting in the juxtaposition of FIP1L1 and PDGFRA has been the sole mechanism thus far described resulting in the activation of this gene. The identification of the three translocations involving the PDGFRA gene represent the first classic cytogenetically visible rearrangements involving this novel gene region. While rare, we propose that all chromosome anomalies identified with breakpoints in the 4q12 and 5q31-q33 regions should receive appropriate FISH testing to determine the potential involvement of the PDGFRA and PDGFRB genes.
18
Shardy, Deborah L., Mohammed F. Azim, Rizwan C. Naeem i Sharon E. Plon. "Identification of the Novel Chromosomal Translocation t(17;19)(q23;q13) in a Pediatric Patient with Acute Myeloid Leukemia." Blood 106, nr 11 (16.11.2005): 4344. http://dx.doi.org/10.1182/blood.v106.11.4344.4344.
Pełny tekst źródłaStreszczenie:
Abstract Chromosomal rearrangements have been associated with many hematologic malignancies. Identification of the genes involved in several of these rearrangements has provided information about the development of malignancy and has led to therapeutic interventions. Historically, a considerable number of pediatric acute myeloid leukemia (AML) cases have been reported as cytogenetically normal. However, with improved cytogenetic techniques and the use of fluorescent in situ hybridization (FISH), new translocations are now being identified. We present the case of a 10-year-old male with AML (FAB subtype M1) and a subtle chromosomal translocation. G-band karyotype analysis revealed a balanced, reciprocal translocation between chromosomes 17 and 19 involving bands 17q23 and 19q13. This translocation was present in 20 out of 20 bone marrow cells examined. Peripheral blood chromosome analysis ruled out a constitutional chromosomal abnormality. Metaphase FISH with telomere-region specific probes for chromosomes 17 and 19 confirmed the reciprocal translocation between 17q and 19q. This patient was treated according to the SJCRH AML 2002 protocol and was randomized to receive high-dose cytarabine. Because he had minimal residual disease following induction therapy, he also received Gemtuzumab Ozogamicin. The patient was in cytogenetic remission for one year after completion of therapy, and then he relapsed with the original leukemic clone and additional cytogenetic abnormalities. The t(17;19)(q23;q13) has not been reported previously in malignancies or other disorders, and therefore identification of the genes at the chromosomal breakpoints may provide new insights into the pathogenesis of AML. As an initial step to map the breakpoint regions, we performed FISH with a commercially available probe encompassing the CRX, GLTSCR2, and GLTSCR1 loci on 19q13 (Vysis, Downers Grove, IL). This revealed that the 19q breakpoint is centromeric to these loci. We are further mapping the translocation breakpoint region on chromosome 19q using FISH-mapped bacterial artificial chromosomes (BACs).
19
Dyer, MJ, VJ Zani, WZ Lu, A. O'Byrne, S. Mould, R. Chapman, JM Heward, H. Kayano, D. Jadayel i E. Matutes. "BCL2 translocations in leukemias of mature B cells". Blood 83, nr 12 (15.06.1994): 3682–88. http://dx.doi.org/10.1182/blood.v83.12.3682.3682.
Pełny tekst źródłaStreszczenie:
Abstract Although translocations of the BCL2 gene are frequent in B-cell non- Hodgkin's lymphomas (B-NHL) the incidence, nature, and prognostic significance of similar translocations in the phenotypically related chronic leukemias of mature B cells are unknown. Therefore, we examined 170 cases of B-cell chronic lymphocytic leukemia (B-CLL), 7 cases of B- cell prolymphocytic leukemia (B-PLL), 25 cases of hairy cell leukemia (HCL) and 22 cases of splenic lymphoma with villous lymphocytes (SLVL) with defined cytogenetic abnormalities by DNA blot using both 5′ and 3′ BCL2 probes to search for rearrangement of the BCL2 locus. Translocation t(14;18) (q32.3;q21.3) was detected cytogenetically in 3 cases of B-CLL. All had breakpoints in the 3′ region of BCL2, mapping between the major breakpoint region (MBR) and the minor cluster region (mcr), the breakpoint clusters commonly detected in B-NHL. In 2 of the 3 cases, the breakpoint within BCL2 was mapped to a 1.0-kb EcoRI- HindIII fragment indicating a clustering of breakpoints. Two cases of B- CLL had cytogenetically detectable t(2;18)(p11;q21.3) or t(18;22)(q21.3;q11). Both had rearranged the 5′ region of the BCL2 gene to the corresponding lg light-chain gene. Molecular cloning of the t(18;22)(q21.3;q11) showed that the translocation disrupted the BCL2 promoter region and the first untranslated BCL2 exon. Nevertheless, high levels of BCL2 protein were seen in this case. Only 2 other cases in whom cytogenetic analysis was not successful showed rearrangement of the 5′ region of BCL2, an overall incidence of 2.3%. No cases of B-PLL, HCL, or SLVL showed either 5′ or 3′ BCL2 rearrangement. These data confirm the cytogenetic observations that translocations involving the BCL2 locus in all forms of leukemia of mature B cells are rare, and limited to a minor subset of B-CLL. BCL2 translocations in B-CLL involve hot spots of recombination of both the 5′ and 3′ regions of the BCL2 gene, which are distinct from those commonly seen in B-NHL, suggesting distinct pathogenic mechanisms.
20
Dyer, MJ, VJ Zani, WZ Lu, A. O'Byrne, S. Mould, R. Chapman, JM Heward, H. Kayano, D. Jadayel i E. Matutes. "BCL2 translocations in leukemias of mature B cells". Blood 83, nr 12 (15.06.1994): 3682–88. http://dx.doi.org/10.1182/blood.v83.12.3682.bloodjournal83123682.
Pełny tekst źródłaStreszczenie:
Although translocations of the BCL2 gene are frequent in B-cell non- Hodgkin's lymphomas (B-NHL) the incidence, nature, and prognostic significance of similar translocations in the phenotypically related chronic leukemias of mature B cells are unknown. Therefore, we examined 170 cases of B-cell chronic lymphocytic leukemia (B-CLL), 7 cases of B- cell prolymphocytic leukemia (B-PLL), 25 cases of hairy cell leukemia (HCL) and 22 cases of splenic lymphoma with villous lymphocytes (SLVL) with defined cytogenetic abnormalities by DNA blot using both 5′ and 3′ BCL2 probes to search for rearrangement of the BCL2 locus. Translocation t(14;18) (q32.3;q21.3) was detected cytogenetically in 3 cases of B-CLL. All had breakpoints in the 3′ region of BCL2, mapping between the major breakpoint region (MBR) and the minor cluster region (mcr), the breakpoint clusters commonly detected in B-NHL. In 2 of the 3 cases, the breakpoint within BCL2 was mapped to a 1.0-kb EcoRI- HindIII fragment indicating a clustering of breakpoints. Two cases of B- CLL had cytogenetically detectable t(2;18)(p11;q21.3) or t(18;22)(q21.3;q11). Both had rearranged the 5′ region of the BCL2 gene to the corresponding lg light-chain gene. Molecular cloning of the t(18;22)(q21.3;q11) showed that the translocation disrupted the BCL2 promoter region and the first untranslated BCL2 exon. Nevertheless, high levels of BCL2 protein were seen in this case. Only 2 other cases in whom cytogenetic analysis was not successful showed rearrangement of the 5′ region of BCL2, an overall incidence of 2.3%. No cases of B-PLL, HCL, or SLVL showed either 5′ or 3′ BCL2 rearrangement. These data confirm the cytogenetic observations that translocations involving the BCL2 locus in all forms of leukemia of mature B cells are rare, and limited to a minor subset of B-CLL. BCL2 translocations in B-CLL involve hot spots of recombination of both the 5′ and 3′ regions of the BCL2 gene, which are distinct from those commonly seen in B-NHL, suggesting distinct pathogenic mechanisms.
21
Dohner, Konstanze, Marianne Habdank, Frank G. Rucker, Simone Miller, Stefan Frohling, Stephen W. Scherer, Lars Bullinger i Hartmut Dohner. "Molecular Characterization of Distinct Hot Spot Regions on Chromosome 7q in Myeloid Leukemias." Blood 108, nr 11 (1.11.2006): 2349. http://dx.doi.org/10.1182/blood.v108.11.2349.2349.
Pełny tekst źródłaStreszczenie:
Abstract In recent years several groups initiated the molecular characterization of deletion and translocation breakpoints affecting the long arm of chromosome 7 (7q−) to identify genes that are involved in the pathogenesis of myeloid leukemias. Based on these studies a commonly deleted segment (CDS) of approximately 2 Mb in size was identified in chromosomal band 7q22 flanked by the microsatellite markers D7S1503 and D7S1841. Recently, the MLL5 gene (mixed lineage leukemia 5) has been cloned and mapped to the CDS as an interesting candidate gene for chromosome 7q associated leukemias. However, the pathogenic role of MLL5 in myeloid leukemias has not been demonstrated yet. In addition, for the less frequent deletion/translocation breakpoints affecting the distal part of chromosome 7q a 4 to 5 Mb sized CDS was defined encompassing chromosomal bands 7q35 to q36. The heterogeneity of deletion/translocation breakpoints on 7q suggests the existence of more than one disease-related gene. We aimed to identify and characterize translocation and deletion breakpoints in a large series of myeloid leukemias with chromosome 7q aberrations using fluorescence in situ hybridisation (FISH) and array-based comparative genomic hybridization (array CGH). Once, novel hot spot regions were identified, transcriptional map(s) were constructed allowing the identification of candidate genes, expressed sequences or miR-sites. FISH with a physical map of well defined YAC/BAC/PAC clones covering the long arm of chromosome 7 was performed on a series of 105 myeloid leukemias [acute myeloid leukaemia, (AML); myelodysplastic syndrome (MDS); myeloproliferative disorders, (MPD)] exhibiting chromosome 7q aberrations on banding analysis. Selected patients were analysed by array CGH and results were confirmed by hybridisation of the corresponding DNA clones. Transcriptional map(s) were constructed using public databases. While most of the deletions were large encompassing the previously published CDS, we identified a distinct 2 Mb sized CDS in the proximal part of 7q22 that was defined by five patients all exhibiting small deletions. This segment contains several candidate genes including the putative tumor-suppressor genes CUTL1, RASA4, EPO and FBXL13. Interestingly, this CDS is located close to multiple miR-sites, which usually indicate common fragile sites in the human genome. In chromosomal bands 7q35–q36 we localized the breakpoint of an unbalanced translocation from a patient with secondary AML between the markers D7S1925 and D7S1395. This region was recently characterized as a common fragile site in the human genome, named FRA7I. Furthermore, the translocation breakpoint t(3;7)(p13;q35) of a second patient with therapy-related AML was cloned into a 100 kb sized genomic segment located centromeric the CNTNAP2-gene close to the proximal border of the CDS. Our data further indicate the remarkable heterogeneity of deletion and translocation breakpoints on 7q supporting the hypothesis of multiple genes involved in 7q-associated myeloid leukemias. Using techniques such as FISH and array CGH known CDS as well as novel hot spot regions were identified. Transcriptional maps from those regions may serve as important starting points for the identification of pathogenetically relevant genes.
22
Jaeger, U., B. Purtscher, GD Karth, S. Knapp, C. Mannhalter i K. Lechner. "Mechanism of the chromosomal translocation t(14;18) in lymphoma: detection of a 45-Kd breakpoint binding protein". Blood 81, nr 7 (1.04.1993): 1833–40. http://dx.doi.org/10.1182/blood.v81.7.1833.1833.
Pełny tekst źródłaStreszczenie:
Abstract The translocation t(14;18) between the BCL-2 oncogene and the Ig heavy chain (IgH) gene provides the molecular basis for the development of follicular lymphomas. The illegitimate recombination occurs in early B cells. While V(D)J-recombinase is most likely involved on the chromosome 14 part, little is known about the mechanism of breakage on chromosome 18. We investigated the BCL-2 breakpoint regions for their structural vulnerability and protein binding capacity. We found that the major breakpoint region (mbr) contains an S1 nuclease-sensitive site and is the target of an endogenous nuclease present in early B cells. A 45 Kd nuclear protein (bp45) from early B cell extracts binds to a homopurine-homopyrimidine stretch (GGGAGGACGGGAGGAAGGCG) in the mbr, which is homologous to a recombinatorial element in Escherichia coli (CHI). The protein also binds to homologous sequences in the minor breakpoint cluster region (mcr) and in the IgH locus. The localization of the binding sites on both chromosomes as well as the tissue distribution of bp45 suggest that this protein-DNA interaction is involved in the translocation t(14;18). The DNA binding motif is also present at other translocation breakpoints indicating a more general role for this mechanism.
23
Jaeger, U., B. Purtscher, GD Karth, S. Knapp, C. Mannhalter i K. Lechner. "Mechanism of the chromosomal translocation t(14;18) in lymphoma: detection of a 45-Kd breakpoint binding protein". Blood 81, nr 7 (1.04.1993): 1833–40. http://dx.doi.org/10.1182/blood.v81.7.1833.bloodjournal8171833.
Pełny tekst źródłaStreszczenie:
The translocation t(14;18) between the BCL-2 oncogene and the Ig heavy chain (IgH) gene provides the molecular basis for the development of follicular lymphomas. The illegitimate recombination occurs in early B cells. While V(D)J-recombinase is most likely involved on the chromosome 14 part, little is known about the mechanism of breakage on chromosome 18. We investigated the BCL-2 breakpoint regions for their structural vulnerability and protein binding capacity. We found that the major breakpoint region (mbr) contains an S1 nuclease-sensitive site and is the target of an endogenous nuclease present in early B cells. A 45 Kd nuclear protein (bp45) from early B cell extracts binds to a homopurine-homopyrimidine stretch (GGGAGGACGGGAGGAAGGCG) in the mbr, which is homologous to a recombinatorial element in Escherichia coli (CHI). The protein also binds to homologous sequences in the minor breakpoint cluster region (mcr) and in the IgH locus. The localization of the binding sites on both chromosomes as well as the tissue distribution of bp45 suggest that this protein-DNA interaction is involved in the translocation t(14;18). The DNA binding motif is also present at other translocation breakpoints indicating a more general role for this mechanism.
24
Coleman, Allen E., Alexander L. Kovalchuk, Siegfried Janz, Alessio Palini i Thomas Ried. "Jumping Translocation Breakpoint Regions Lead to Amplification of Rearranged Myc". Blood 93, nr 12 (15.06.1999): 4442–44. http://dx.doi.org/10.1182/blood.v93.12.4442.
Pełny tekst źródła
25
Levine, EG, DC Arthur, J. Machnicki, G. Frizzera, D. Hurd, B. Peterson, KJ Gajl- Peczalska i CD Bloomfield. "Four new recurring translocations in non-Hodgkin lymphoma". Blood 74, nr 5 (1.10.1989): 1796–800. http://dx.doi.org/10.1182/blood.v74.5.1796.1796.
Pełny tekst źródłaStreszczenie:
Abstract The identification of recurring chromosomal translocations has provided clues to the gene regions important in lymphoma development. Among 157 patients with non-Hodgkin lymphoma studied by cytogenetic analysis, four new recurring translocations have been identified--t(8;9) (q24;p13), t(11;18)(q21;q21), t(14,15)(q32;q15), and an unbalanced translocation giving rise to der(22)t(17;22) (q11;p11). Each translocation appeared twice. The t(11;18) was the only karyotypic abnormality in the two patients with it, and the t(14;15) was the sole karyotypic abnormality in one patient. All translocations were found in B-cell malignancies and were associated with both nodal and extranodal disease. Among the regions affected, only the immunoglobulin heavy- chain gene MYC, and BCL2, have thus far been associated with lymphoma. The breakpoint sites identified by these translocations warrant further investigation at the molecular level.
26
Levine, EG, DC Arthur, J. Machnicki, G. Frizzera, D. Hurd, B. Peterson, KJ Gajl- Peczalska i CD Bloomfield. "Four new recurring translocations in non-Hodgkin lymphoma". Blood 74, nr 5 (1.10.1989): 1796–800. http://dx.doi.org/10.1182/blood.v74.5.1796.bloodjournal7451796.
Pełny tekst źródłaStreszczenie:
The identification of recurring chromosomal translocations has provided clues to the gene regions important in lymphoma development. Among 157 patients with non-Hodgkin lymphoma studied by cytogenetic analysis, four new recurring translocations have been identified--t(8;9) (q24;p13), t(11;18)(q21;q21), t(14,15)(q32;q15), and an unbalanced translocation giving rise to der(22)t(17;22) (q11;p11). Each translocation appeared twice. The t(11;18) was the only karyotypic abnormality in the two patients with it, and the t(14;15) was the sole karyotypic abnormality in one patient. All translocations were found in B-cell malignancies and were associated with both nodal and extranodal disease. Among the regions affected, only the immunoglobulin heavy- chain gene MYC, and BCL2, have thus far been associated with lymphoma. The breakpoint sites identified by these translocations warrant further investigation at the molecular level.
27
Wang, Dandan, Daixi Li, Guangrong Qin, Wen Zhang, Jian Ouyang, Menghuan Zhang i Lu Xie. "The Structural Characterization of Tumor Fusion Genes and Proteins". Computational and Mathematical Methods in Medicine 2015 (2015): 1–9. http://dx.doi.org/10.1155/2015/912742.
Pełny tekst źródłaStreszczenie:
Chromosomal translocation, which generates fusion proteins in blood tumor or solid tumor, is considered as one of the major causes leading to cancer. Recent studies suggested that the disordered fragments in a fusion protein might contribute to its carcinogenicity. Here, we investigated the sequence feature near the breakpoints in the fusion partner genes, the structure features of breakpoints in fusion proteins, and the posttranslational modification preference in the fusion proteins. Results show that the breakpoints in the fusion partner genes have both sequence preference and structural preference. At the sequence level, nucleotide combination AG is preferred before the breakpoint and GG is preferred at the breakpoint. At the structural level, the breakpoints in the fusion proteins prefer to be located in the disordered regions. Further analysis suggests the phosphorylation sites at serine, threonine, and the methylation sites at arginine are enriched in disordered regions of the fusion proteins. Using EML4-ALK as an example, we further explained how the fusion protein leads to the protein disorder and contributes to its carcinogenicity. The sequence and structural features of the fusion proteins may help the scientific community to predict novel breakpoints in fusion genes and better understand the structure and function of fusion proteins.
28
Gutierrez, MI, K. Bhatia, F. Barriga, B. Diez, FS Muriel, ML de Andreas, S. Epelman, C. Risueno i IT Magrath. "Molecular epidemiology of Burkitt's lymphoma from South America: differences in breakpoint location and Epstein-Barr virus association from tumors in other world regions". Blood 79, nr 12 (15.06.1992): 3261–66. http://dx.doi.org/10.1182/blood.v79.12.3261.3261.
Pełny tekst źródłaStreszczenie:
Abstract We have previously shown that the endemic (African) and sporadic (North American) forms of Burkitt's lymphoma (BL) differ at a molecular level. We have now extended our studies to the molecular epidemiology of BL in South America, specifically to two climatic regions: temperate (Argentina and Chile) and tropical (Brazil). We have examined the patterns of chromosomal breakpoint locations in 39 tumors with respect to geography and Epstein-Barr virus (EBV) association. The result of these analyses provide further support for the existence of pathogenetically distinct subtypes of BL in different world regions. The majority of breakpoints on chromosome 8 in South American BL (41%) occurred in the immediate flanking region of c-myc, ie, further 5′ of the “typical” sporadic breakpoints, in the first exon/intron region, and further 3′ of the “typical” endemic breakpoints, which are usually distant from c-myc. However, the distribution of breakpoints on chromosome 14 in tumors from the temperate and tropical regions of South America is similar to that observed in sporadic and endemic tumors. Interestingly, only one tumor with an unrearranged c-myc gene joined to the S mu region of chromosome 14 was observed. This combination was also rarely observed in our earlier series and presumably is either less readily generated by the mechanism that mediates 8;14 translocation or requires other, infrequent genetic changes to provide the necessary selective advantage for lymphomagenesis. The frequency of EBV association in South American BL (51%) is also intermediate with respect to tumors from the United States (30%) and Africa (100%). No correlation with the breakpoint location on chromosome 8 was discernable. Surprisingly, only 54% of tumors with breakpoint outside c-myc were EBV positive. This is in contrast to endemic tumors and suggests that any pathogenetic contribution of EBV is not dependent on breakpoint location, but is more likely to complement additional pathogenetic elements that differ in different world regions.
29
Gutierrez, MI, K. Bhatia, F. Barriga, B. Diez, FS Muriel, ML de Andreas, S. Epelman, C. Risueno i IT Magrath. "Molecular epidemiology of Burkitt's lymphoma from South America: differences in breakpoint location and Epstein-Barr virus association from tumors in other world regions". Blood 79, nr 12 (15.06.1992): 3261–66. http://dx.doi.org/10.1182/blood.v79.12.3261.bloodjournal79123261.
Pełny tekst źródłaStreszczenie:
We have previously shown that the endemic (African) and sporadic (North American) forms of Burkitt's lymphoma (BL) differ at a molecular level. We have now extended our studies to the molecular epidemiology of BL in South America, specifically to two climatic regions: temperate (Argentina and Chile) and tropical (Brazil). We have examined the patterns of chromosomal breakpoint locations in 39 tumors with respect to geography and Epstein-Barr virus (EBV) association. The result of these analyses provide further support for the existence of pathogenetically distinct subtypes of BL in different world regions. The majority of breakpoints on chromosome 8 in South American BL (41%) occurred in the immediate flanking region of c-myc, ie, further 5′ of the “typical” sporadic breakpoints, in the first exon/intron region, and further 3′ of the “typical” endemic breakpoints, which are usually distant from c-myc. However, the distribution of breakpoints on chromosome 14 in tumors from the temperate and tropical regions of South America is similar to that observed in sporadic and endemic tumors. Interestingly, only one tumor with an unrearranged c-myc gene joined to the S mu region of chromosome 14 was observed. This combination was also rarely observed in our earlier series and presumably is either less readily generated by the mechanism that mediates 8;14 translocation or requires other, infrequent genetic changes to provide the necessary selective advantage for lymphomagenesis. The frequency of EBV association in South American BL (51%) is also intermediate with respect to tumors from the United States (30%) and Africa (100%). No correlation with the breakpoint location on chromosome 8 was discernable. Surprisingly, only 54% of tumors with breakpoint outside c-myc were EBV positive. This is in contrast to endemic tumors and suggests that any pathogenetic contribution of EBV is not dependent on breakpoint location, but is more likely to complement additional pathogenetic elements that differ in different world regions.
30
Fung, Jingly, Santiago Munné, Jaqueline Garcia, Ung-Jin Kim i Heinz-Ulli G. Weier. "Molecular cloning of translocation breakpoints in a case of constitutional translocation t(11;22)(q23;q11) and preparation of probes for preimplantation genetic diagnosis". Reproduction, Fertility and Development 11, nr 1 (1999): 17. http://dx.doi.org/10.1071/rd98110.
Pełny tekst źródłaStreszczenie:
In vitro fertilization (IVF) centres with preimplantation genetic diagnosis (PGD) programmes are often confronted with the problem of identifying chromosomal abnormalities in interphase cells biopsied from preimplantation embryos of carriers of a reciprocal translocation. The present authors have developed a DNA testing based approach to analyse embryos from translocation carriers, and this report describes breakpoint-spanning probes to detect abnormalities in cases of the most common human translocation (i.e. the t(11;22)(q23;q11)). Screening a yeast artificial chromosome (YAC) library for probes covering the respective breakpoint regions in the patient lead to probes for the breakpoint on chromosome 11q23. The physically mapped YAC and bacterial artificial chromosome (BAC) clones from chromosome 22 were then integrated with the cytogenetic map, which allowed localization of the breakpoint on chromosome 22q11 to an interval of less than 84 kb between markers D22S184 and KI457 and to prepare probes suitable for interphase cell analysis. In summary, breakpoint localization could be accomplished in about 4 weeks with additional time needed to optimize probes for use in PGD.
31
Fischer, Konstanze, Stefan Fröhling, Stephen W. Scherer, Jill McAllister Brown, Claudia Scholl, Stephan Stilgenbauer, Lap-Chee Tsui, Peter Lichter i Hartmut Döhner. "Molecular Cytogenetic Delineation of Deletions and Translocations Involving Chromosome Band 7q22 in Myeloid Leukemias". Blood 89, nr 6 (15.03.1997): 2036–41. http://dx.doi.org/10.1182/blood.v89.6.2036.
Pełny tekst źródłaStreszczenie:
Abstract Loss of chromosome 7 (−7) or deletion of its long arm (7q−) are recurring chromosome abnormalities in myeloid disorders, especially in therapy-related myelodysplastic syndrome (t-MDS) and acute myeloid leukemia (t-AML). The association of −7/7q− with myeloid leukemia suggests that these regions contain a novel tumor suppressor gene(s) whose loss of function contributes to leukemic transformation or tumor progression. Based on chromosome banding analysis, two critical regions have been identified: one in band 7q22 and a second in bands 7q32-q35. We analyzed bone marrow and blood samples from 21 patients with myeloid leukemia (chronic myeloid leukemia, n = 2; de novo MDS, n = 4; de novo AML, n = 13; t-AML, n = 2) that on chromosome banding analysis exhibited deletions (n = 19) or reciprocal translocations (n = 2) of band 7q22 using fluorescence in situ hybridization. As probes, we used Alu-polymerase chain reaction products from 22 yeast artificial chromosome (YAC) clones that span chromosome bands 7q21.1-q32, including representative clones from a panel of YACs recognizing a contiguous genomic DNA fragment of 5 to 6 Mb in band 7q22. In the 19 cases with deletions, we identified two distinct commonly deleted regions: one region within band 7q22 was defined by the two CML cases; the second region encompassed a distal part of band 7q22 and the entire band 7q31 and was defined by the MDS/AML cases. The breakpoint of one of the reciprocal translocations was mapped to 7q21.3, which is centromeric to both of the commonly deleted regions. The breakpoint of the second translocation, which was present in unstimulated bone marrow and phytohemagglutinin-stimulated blood of an MDS patient, was localized to a 400-kb genomic segment in 7q22 within the deletion cluster of the MDS/AML cases. In conclusion, our data show marked heterogeneity of 7q22 deletion and translocation breakpoints in myeloid leukemias, suggesting the existence of more than one pathogenetically relevant gene.
32
Harada, Shuko, Emily Sizzle, Ming-Tseh Lin i Christopher D. Gocke. "Detection of Chromosomal Translocation in Hematologic Malignancies by a Novel DNA-Based Looped Ligation Assay (LOLA)". Clinical Chemistry 63, nr 7 (1.07.2017): 1278–87. http://dx.doi.org/10.1373/clinchem.2016.270140.
Pełny tekst źródłaStreszczenie:
Abstract BACKGROUND Disease-defining chromosomal translocations are seen in various neoplasms, especially in lymphomas and leukemias. Translocation detection at the DNA level is often complicated by chromosomal breakpoints that are distributed over very large regions. We have developed a ligation-based assay [the looped ligation assay (LOLA)] to detect translocations from diseases with multiple widely spaced breakpoint hot spots. METHODS Oligonucleotide sets that probe breakpoints of IGH-BCL2 (immunoglobulin heavy–apoptosis regulator) in follicular lymphoma (FL), MYC-IGH (MYC proto-oncogene, bHLH transcription factor–immunoglobulin heavy) in Burkitt lymphoma (BL) and BCR-ABL1 (RhoGEF and GTPase activating protein–ABL proto-oncogene 1, non-receptor tyrosine kinase) in chronic myelogenous leukemia (CML) were designed. DNA from cell lines with these translocations was mixed with oligonucleotides in a single-step ligation reaction followed by PCR amplification. Detection was by capillary electrophoresis. We also tested peripheral blood from 16 CML patients and frozen tissue from 17 FL cases, and the results were compared to reverse transcription (RT)-PCR (CML) or fluorescent in situ hybridization (FISH) and δ-PCR (FL). RESULTS LOLA produced signals of the expected sizes for the cell lines. Normal control DNA yielded no signals. A dilution series yielded translocation-specific peaks at dilutions as low as 1%. Signal intensity was log linear to the DNA concentration (R2 = 0.94). Furthermore, we were able to detect a LOLA peak in DNA from 53.3% of FL patients and 87.5% of CML patients. The concordance between LOLA, FISH, and δ-PCR in FL was also excellent. CONCLUSIONS Our results indicate that LOLA is a simple method that is useful for DNA-based detection of translocations in challenging situations, particularly where the breakpoints are not tightly clustered. The assay also has the added benefit of permitting rapid mapping of the breakpoints.
33
Sepsi, A., I. Molnár i M. Molnár-Láng. "Physical mapping of a 7A.7D translocation in the wheat–Thinopyrum ponticum partial amphiploid BE-1 using multicolour genomic in situ hybridization and microsatellite marker analysis". Genome 52, nr 9 (wrzesień 2009): 748–54. http://dx.doi.org/10.1139/g09-047.
Pełny tekst źródłaStreszczenie:
The absence of chromosome 7D in the wheat–Thinopyrum ponticum partial amphiploid BE-1 was detected previously by multicolour genomic in situ hybridization, sequential FISH (fluorescence in situ hybridization) using repetitive DNA probes, and SSR marker analysis. In the present study the previous cytogenetic and SSR marker analyses were expanded to include 25 other SSR markers assigned to wheat chromosomes 7A and 7D to confirm the presence of a 7A.7D translocation and to specify its composition. An almost complete chromosome 7A and a short chromosome segment derived from the terminal region of 7DL were detected, confirming the presence of a terminal translocation involving the distal regions of 7AL and 7DL. In both cases the position of the translocation breakpoint was different from that of known deletion lines. The identification of the 7AL.7DL translocation and its breakpoint position provides a new physical landmark for future physical mapping studies, opening up the possibility of more precise localization of genes or molecular markers within the terminal regions of 7DL and 7AL.
34
Shiramizu, B., i I. Magrath. "Localization of breakpoints by polymerase chain reactions in Burkitt's lymphoma with 8;14 translocations". Blood 75, nr 9 (1.05.1990): 1848–52. http://dx.doi.org/10.1182/blood.v75.9.1848.1848.
Pełny tekst źródłaStreszczenie:
Abstract Translocations involving chromosomes 8 and 14 in Burkitt's lymphoma (BL) often involve the switch mu (Smu) region on chromosome 14, which contains multiple repeats. This has enabled us to use the polymerase chain reaction (PCR) to detect breakpoints that involve this region on chromosome 14 and the c-myc gene on chromosome 8. Using pairs of flanking primers, each pair including one annealing to repeat sequences within the switch region and one of three primers from the c-myc region (first intron, 3′, or 5′ flanking sequence of the first exon of c-myc), we have been able to amplify DNA fragments containing the corresponding breakpoint regions from chromosome 14 in both cell lines and biopsied tumor samples. The definitive demonstration of sequences from both chromosomes in these fragments permitted the confirmation of the presence of a translocation. Because of the sensitivity of PCR, we were able to localize breakpoints in samples containing as few as 1 neoplastic cell in 10(8) cells. PCR provides a valuable tool for the detection of 8;14 chromosomal translocations, which should prove to be of value in diagnosis and molecular epidemiologic studies, as well as providing a means of detecting minimal disease.
35
Shiramizu, B., i I. Magrath. "Localization of breakpoints by polymerase chain reactions in Burkitt's lymphoma with 8;14 translocations". Blood 75, nr 9 (1.05.1990): 1848–52. http://dx.doi.org/10.1182/blood.v75.9.1848.bloodjournal7591848.
Pełny tekst źródłaStreszczenie:
Translocations involving chromosomes 8 and 14 in Burkitt's lymphoma (BL) often involve the switch mu (Smu) region on chromosome 14, which contains multiple repeats. This has enabled us to use the polymerase chain reaction (PCR) to detect breakpoints that involve this region on chromosome 14 and the c-myc gene on chromosome 8. Using pairs of flanking primers, each pair including one annealing to repeat sequences within the switch region and one of three primers from the c-myc region (first intron, 3′, or 5′ flanking sequence of the first exon of c-myc), we have been able to amplify DNA fragments containing the corresponding breakpoint regions from chromosome 14 in both cell lines and biopsied tumor samples. The definitive demonstration of sequences from both chromosomes in these fragments permitted the confirmation of the presence of a translocation. Because of the sensitivity of PCR, we were able to localize breakpoints in samples containing as few as 1 neoplastic cell in 10(8) cells. PCR provides a valuable tool for the detection of 8;14 chromosomal translocations, which should prove to be of value in diagnosis and molecular epidemiologic studies, as well as providing a means of detecting minimal disease.
36
Stong, Nicholas, Maria Ortiz, Fadi Towfic, William Pierceall, Erin Flynt i Anjan Thakurta. "Location of the t(4;14) Translocation Breakpoint Identifies a Subset of Newly-Diagnosed Multiple Myeloma Patients with Poor Prognosis". Blood 138, Supplement 1 (5.11.2021): 2681. http://dx.doi.org/10.1182/blood-2021-151094.
Pełny tekst źródłaStreszczenie:
Abstract Introduction: The recombination of chromosomes 4 and 14 (t(4;14)) is a primary, predominantly clonal event in newly diagnosed multiple myeloma (ndMM) that is present in ~15% of patients. The translocation results in enhancer regions from the immunoglobulin heavy chain locus upregulating the expression of NSD2 and FGFR3 genes implicated in the disease biology of this subset of MM patients (Chesi et al. Blood. 1998, Keats et al, Leuk Lymph. 2006). The presence of t(4;14) translocation is a considered a biomarker of aggressive disease and is part of the Revised International Staging System (R-ISS) for clinical risk stratification. However, historically only ~40% of t(4;14) patients are high-risk based on the GEP70 gene expression signature. (Weinhold et al. Leukemia. 2016) Our previous analysis of a large cohort of ndMM patients described the genomic features of t(4;14) vs ndMM overall population demonstrating that only ~25% of t(4;14) patients died within 24 months of diagnosis and described biomarkers in this high-risk subset. This analysis identified both known and novel aberrations in ndMM, including some that were associated with high-risk t(4;14) (Ortiz et al Blood. 2019; 134 (Suppl_1):366). In this updated analysis, we provide a more robust analysis of the t(4;14) dataset and demonstrate the prognostic value of the NSD2 breakpoint location. Methods: We generated a large genomic dataset from t(4;14) ndMM patients with whole genome sequencing (WGS) and RNA-seq from a TOUL dataset (t(4;14) N=114) patients treated in routine practice), the IFM2009 trial (N=19), and the Myeloma Genome Project (MGP) (N=34) for discovery and validation. Gene expression, copy number aberration, single nucleotide variant and translocations were derived from RNAseq and WGS profiling of biopsies from patients aged less than 75 years who received transplant, and integrated with clinical information (including age, OS). Cytogenetic assessments from WGS were made by MANTA and used to identify translocation DNA breakpoint location. Results: In all datasets, three DNA breakpoint locations were identified, and based on their position with respect to the NSD2 gene named "no-disruption" (upstream of NSD2 gene), "early-disruption" (in the 5' UTR of NSD2 gene) and "late-disruption" (in the coding region of NSD2 gene). Using paired RNA-seq data, we identified IGH-NSD2 RNA fusion transcripts relative to the breakpoints that corresponded with previously described NSD2 isoforms. "No-disruption" and "early-disruption" breakpoints predominantly produced a fusion transcript (MB4-1) that retained the full coding sequence of the gene, while the "late-disruption" produced truncated fusion transcripts (MB4-2/3). We conducted survival analysis in our datasets based on both DNA breakpoint location and RNA fusion transcripts. This analysis demonstrated a significant difference in outcome between the patient samples with "no-disruption" and the "late-disruption" breakpoints that associated with good and poor OS, respectively (OS pval < 3e-4) in the discovery TOUL dataset. Patients with "late-disruption" had a median OS of 28.64 mo vs 59.18 mo for "early disruption" and 82.26 mo for those with "no disruption" (Figure). This association was replicated in an independent dataset (MGP N=33, replication pval<4.3e-5). The mOS difference of patients based on which fusion transcript they express is less than the difference based on breakpoint (mOS MB4-1 = 47.38 mo. vs. MB4-2/3 = 60.89 mo.). These analyses demonstrate that the breakpoint location has a stronger association with outcome than fusion transcript expression. Conclusion: From a large genomic dataset, we were able to discover and validate a clear association between the translocation breakpoints and survival outcome in t(4:14) ndMM patients. While prospective validation is needed before clinical application of our finding, molecular identification of high-risk t(4;14) patients using DNA breakpoint location may enable proper risk classification for this patient group at diagnosis, and would provide improved opportunities for risk-adjusted therapy and identification of a therapeutic target for this high-risk subpopulation. Ongoing work on mutations, copy number, and differential gene expression analyses between translocation breakpoint sub-groups and will be presented. Figure 1 Figure 1. Disclosures Stong: Bristol Myers Squibb: Current Employment, Current equity holder in publicly-traded company. Ortiz: Bristol Myers Squibb: Current Employment. Towfic: Bristol Myers Squibb: Current Employment, Current equity holder in publicly-traded company. Pierceall: Bristol Myers Squibb: Current Employment, Current equity holder in publicly-traded company. Flynt: Bristol Myers Squibb: Current Employment. Thakurta: Bristol Myers Squibb: Current Employment, Current equity holder in publicly-traded company, Patents & Royalties.
37
Tighe, JE, A. Daga i F. Calabi. "Translocation breakpoints are clustered on both chromosome 8 and chromosome 21 in the t(8;21) of acute myeloid leukemia". Blood 81, nr 3 (1.02.1993): 592–96. http://dx.doi.org/10.1182/blood.v81.3.592.592.
Pełny tekst źródłaStreszczenie:
Abstract The t(8;21)(q22;q22) is consistently associated with acute myeloid leukemia (AML) M2. Recent data have suggested that breakpoints on chromosome 21 are clustered within a single intron of a novel gene, AML1, just downstream of a region of homology to the runt gene of D melanogaster. In this report, we confirm rearrangement at the same location in at least 12 of 18 patients with t(8;21). Furthermore, we have isolated recombinant clones spanning the breakpoint regions on both the der(8) and the der(21) from one patient. By using a chromosome 8 probe derived from these clones, we show that t(8;21) breakpoints are also clustered on chromosome 8.
38
Tighe, JE, A. Daga i F. Calabi. "Translocation breakpoints are clustered on both chromosome 8 and chromosome 21 in the t(8;21) of acute myeloid leukemia". Blood 81, nr 3 (1.02.1993): 592–96. http://dx.doi.org/10.1182/blood.v81.3.592.bloodjournal813592.
Pełny tekst źródłaStreszczenie:
The t(8;21)(q22;q22) is consistently associated with acute myeloid leukemia (AML) M2. Recent data have suggested that breakpoints on chromosome 21 are clustered within a single intron of a novel gene, AML1, just downstream of a region of homology to the runt gene of D melanogaster. In this report, we confirm rearrangement at the same location in at least 12 of 18 patients with t(8;21). Furthermore, we have isolated recombinant clones spanning the breakpoint regions on both the der(8) and the der(21) from one patient. By using a chromosome 8 probe derived from these clones, we show that t(8;21) breakpoints are also clustered on chromosome 8.
39
Machida, Junichiro, Têmis M. Félix, Jeffrey C. Murray, Koh-ichiro Yoshiura, Mitsuyo Tanemura, Munefumi Kamamoto, Kazuo Shimozato, Shin-ichi Sonta i Takao Ono. "Searching for Genes for Cleft Lip and/or Palate Based on Breakpoint Analysis of a Balanced Translocation t(9;17)(q32;q12)". Cleft Palate-Craniofacial Journal 46, nr 5 (wrzesień 2009): 532–40. http://dx.doi.org/10.1597/08-047.1.
Pełny tekst źródłaStreszczenie:
Objective: Identification of the breakpoints of disease-associated chromosome rearrangements can provide informative clues to a positional cloning approach for genes responsible for inherited diseases. Recently, we found a three-generation Japanese family segregating balanced chromosome translocation t(9;17)(q32;q12). One of the subjects had cleft lip and palate. We examined whether regions near the breakpoint could be associated with cleft lip and/or palate. Methods: We determined the breakpoints involved in the translocation by fluorescence in situ hybridization analysis and subsequent long-range polymerase chain reaction. In order to study the role of these disrupted regions in nonsyndromic cleft lip and/or palate, we performed mutation analysis and a haplotype-based transmission disequilibrium test using tagging single-nucleotide polymorphisms in the flanking regions of the breakpoints in white and Filipino nonsyndromic cleft lip and/or palate populations. Results: Sequence analysis demonstrated that two genes, SLC31A1 (solute carrier family 31 member 1) on chromosome 9 and CCL2 (chemokine ligand 2) on chromosome 17, were rearranged with the breaks occurring within their introns. It is interesting that SLC31A1 lies closed to BSPRY (B-box and SPRY domain), which is a candidate for involvement with cleft lip and/or palate. Some of the variants in BSPRY and CCL2 showed significant p values in the cleft lip and/or palate population compared with the control population. There was also statistically significant evidence of transmission distortion for haplotypes on both chromosomes 9 and 17. Conclusions: The data support previous reports that genes on chromosomal regions of 9q and 17q play an important role in facial development.
40
Zelenetz, AD, G. Chu, N. Galili, CD Bangs, SJ Horning, TA Donlon, ML Cleary i R. Levy. "Enhanced detection of the t(14;18) translocation in malignant lymphoma using pulsed-field gel electrophoresis". Blood 78, nr 6 (15.09.1991): 1552–60. http://dx.doi.org/10.1182/blood.v78.6.1552.1552.
Pełny tekst źródłaStreszczenie:
Abstract The t(14;18) chromosomal translocation that results in the juxtaposition of the bcl-2 proto-oncogene with the heavy chain JH locus is a common cytogenetic abnormality in human lymphoma. In particular, it is seen in about 85% of follicular lymphoma (FL) and up to one-third of diffuse lymphomas (DL). The chromosome 18 breakpoints have been shown to cluster into two regions. The major breakpoint region (mbr) within the 3′ untranslated region of the bcl-2 proto-oncogene accounts for approximately 60% of the cases and the minor cluster region (mcr) 30 kb 3′ of bcl-2 accounts for approximately 25% of the breakpoints. Because of variability in the position of the breakpoint, detection of the t(14;18) by Southern blot analysis provides an important clonal marker for the tumor. However, conventional electrophoresis (CE) fails to detect the translocation in 15% to 25% of cases. We have applied pulsed-field gel electrophoresis (PFGE) to the detection of the t(14;18) in a series of lymphoma prospectively analyzed by CE, polymerase chain reaction (PCR), and cytogenetic analysis. PFGE readily detected t(14;18) rearrangements as indicated by comigration of bands detected with probes for the mbr region (chromosome 18) and the JH locus (chromosome 14). In a series of 40 patients with FL, this method proved to be the most comprehensive for detection of the translocation compared with standard methods; in fact, in one case only PFGE was able to detect the chromosomal rearrangement. Ten percent of the FL cases were negative by all methods tested. In a separate analysis of matched tissue specimens from cases of tumor progression of FL to diffuse lymphoma, PFGE detected a common t(14;18) rearrangement confirming a clonal origin in seven of seven cases, whereas CE detected a rearrangement in only three of seven cases. Overall, PFGE was able to detect a translocation in 8 of 12 cases that were negative by CE and four of eight negative by cytogenetic analysis. In conclusion, PFGE analysis is more comprehensive than CE, PCR, and cytogenetic analysis for the detection of the t(14;18) breakpoint in tissue biopsies of malignant lymphoma.
41
Zelenetz, AD, G. Chu, N. Galili, CD Bangs, SJ Horning, TA Donlon, ML Cleary i R. Levy. "Enhanced detection of the t(14;18) translocation in malignant lymphoma using pulsed-field gel electrophoresis". Blood 78, nr 6 (15.09.1991): 1552–60. http://dx.doi.org/10.1182/blood.v78.6.1552.bloodjournal7861552.
Pełny tekst źródłaStreszczenie:
The t(14;18) chromosomal translocation that results in the juxtaposition of the bcl-2 proto-oncogene with the heavy chain JH locus is a common cytogenetic abnormality in human lymphoma. In particular, it is seen in about 85% of follicular lymphoma (FL) and up to one-third of diffuse lymphomas (DL). The chromosome 18 breakpoints have been shown to cluster into two regions. The major breakpoint region (mbr) within the 3′ untranslated region of the bcl-2 proto-oncogene accounts for approximately 60% of the cases and the minor cluster region (mcr) 30 kb 3′ of bcl-2 accounts for approximately 25% of the breakpoints. Because of variability in the position of the breakpoint, detection of the t(14;18) by Southern blot analysis provides an important clonal marker for the tumor. However, conventional electrophoresis (CE) fails to detect the translocation in 15% to 25% of cases. We have applied pulsed-field gel electrophoresis (PFGE) to the detection of the t(14;18) in a series of lymphoma prospectively analyzed by CE, polymerase chain reaction (PCR), and cytogenetic analysis. PFGE readily detected t(14;18) rearrangements as indicated by comigration of bands detected with probes for the mbr region (chromosome 18) and the JH locus (chromosome 14). In a series of 40 patients with FL, this method proved to be the most comprehensive for detection of the translocation compared with standard methods; in fact, in one case only PFGE was able to detect the chromosomal rearrangement. Ten percent of the FL cases were negative by all methods tested. In a separate analysis of matched tissue specimens from cases of tumor progression of FL to diffuse lymphoma, PFGE detected a common t(14;18) rearrangement confirming a clonal origin in seven of seven cases, whereas CE detected a rearrangement in only three of seven cases. Overall, PFGE was able to detect a translocation in 8 of 12 cases that were negative by CE and four of eight negative by cytogenetic analysis. In conclusion, PFGE analysis is more comprehensive than CE, PCR, and cytogenetic analysis for the detection of the t(14;18) breakpoint in tissue biopsies of malignant lymphoma.
42
Roulston, Diane, Rafael Espinosa, Giuseppina Nucifora, Richard A. Larson, Michelle M. Le Beau i Janet D. Rowley. "CBFA2(AML1) Translocations With Novel Partner Chromosomes in Myeloid Leukemias: Association With Prior Therapy". Blood 92, nr 8 (15.10.1998): 2879–85. http://dx.doi.org/10.1182/blood.v92.8.2879.
Pełny tekst źródłaStreszczenie:
Abstract CBFA2(AML1) has emerged as a gene critical in hematopoiesis; its protein product forms the DNA-binding subunit of the heterodimeric core-binding factor (CBF) that binds to the transcriptional regulatory regions of genes, some of which are active specifically in hematopoiesis. CBFA2 forms a fusion gene with ETO andMDS1/EVI1 in translocations in myeloid leukemia and withETV6(TEL) in the t(12;21) common in childhood pre-B acute lymphoblastic leukemia. We have analyzed samples from 30 leukemia patients who had chromosome rearrangements involving 21q22 by using fluorescence in situ hybridization (FISH). Our analysis showed that 7 of them involved CBFA2 and new translocation partners. Two patients had a t(17;21)(q11.2;q22), whereas the other 5 had translocations involving 1p36, 5q13, 12q24, 14q22, or 15q22. Five of these novel breakpoints in CBFA2 occurred in intron 6; this same intron is involved in the t(3;21). One breakpoint mapped to the t(8;21) breakpoint region in intron 5, and 1 mapped 5′ to that region. All 7 CBFA2 rearrangements resulted from balanced translocations. All 7 patients had myeloid disorders (acute myeloid leukemia or myelodysplastic syndrome); 2 were de novo and 5 had treatment histories that included topoisomerase II targeting agents. The association of therapy-related disorders with translocations involving CBFA2 was significant by Fisher’s exact test (P < .003). These results provide further evidence that this region of CBFA2 is susceptible to breakage in cells exposed to topoisomerase II inhibitors. © 1998 by The American Society of Hematology.
43
Roulston, Diane, Rafael Espinosa, Giuseppina Nucifora, Richard A. Larson, Michelle M. Le Beau i Janet D. Rowley. "CBFA2(AML1) Translocations With Novel Partner Chromosomes in Myeloid Leukemias: Association With Prior Therapy". Blood 92, nr 8 (15.10.1998): 2879–85. http://dx.doi.org/10.1182/blood.v92.8.2879.420k22_2879_2885.
Pełny tekst źródłaStreszczenie:
CBFA2(AML1) has emerged as a gene critical in hematopoiesis; its protein product forms the DNA-binding subunit of the heterodimeric core-binding factor (CBF) that binds to the transcriptional regulatory regions of genes, some of which are active specifically in hematopoiesis. CBFA2 forms a fusion gene with ETO andMDS1/EVI1 in translocations in myeloid leukemia and withETV6(TEL) in the t(12;21) common in childhood pre-B acute lymphoblastic leukemia. We have analyzed samples from 30 leukemia patients who had chromosome rearrangements involving 21q22 by using fluorescence in situ hybridization (FISH). Our analysis showed that 7 of them involved CBFA2 and new translocation partners. Two patients had a t(17;21)(q11.2;q22), whereas the other 5 had translocations involving 1p36, 5q13, 12q24, 14q22, or 15q22. Five of these novel breakpoints in CBFA2 occurred in intron 6; this same intron is involved in the t(3;21). One breakpoint mapped to the t(8;21) breakpoint region in intron 5, and 1 mapped 5′ to that region. All 7 CBFA2 rearrangements resulted from balanced translocations. All 7 patients had myeloid disorders (acute myeloid leukemia or myelodysplastic syndrome); 2 were de novo and 5 had treatment histories that included topoisomerase II targeting agents. The association of therapy-related disorders with translocations involving CBFA2 was significant by Fisher’s exact test (P < .003). These results provide further evidence that this region of CBFA2 is susceptible to breakage in cells exposed to topoisomerase II inhibitors. © 1998 by The American Society of Hematology.
44
Wyatt, R. T., R. A. Rudders, A. Zelenetz, R. A. Delellis i T. G. Krontiris. "BCL2 oncogene translocation is mediated by a chi-like consensus." Journal of Experimental Medicine 175, nr 6 (1.06.1992): 1575–88. http://dx.doi.org/10.1084/jem.175.6.1575.
Pełny tekst źródłaStreszczenie:
Examination of 64 translocations involving the major breakpoint region (mbr) of the BCL2 oncogene and the immunoglobulin heavy chain locus identified three short (14, 16, and 18 bp) segments within the mbr at which translocations occurred with very high frequency. Each of these clusters was associated with a 15-bp region of sequence homology, the principal one containing an octamer related to chi, the procaryotic activator of recombination. The presence of short deletions and N nucleotide additions at the breakpoints, as well as involvement of JH and DH coding regions, suggested that these sequences served as signals capable of interacting with the VDJ recombinase complex, even though no homology with the traditional heptamer/spacer/nonamer (IgRSS) existed. Furthermore, the BCL2 signal sequences were employed in a bidirectional fashion and could mediate recombination of one mbr region with another. Segments homologous to the BCL2 signal sequences flanked individual members of the XP family of diversity gene segments, which were themselves highly overrepresented in the reciprocal products (18q-) of BCL2 translocation. We propose that the chi-like signal sequences of BCL2 represent a distinct class of recognition sites for the recombinase complex, responsible for initiating interactions between regions of DNA separated by great distances, and that BCL2 translocation begins by a recombination event between mbr and DXP chi signals. Since recombinant joints containing chi, not IgRSS, occur in brain cells expressing RAG-1 (Matsuoka, M., F. Nagawa, K. Okazaki, L. Kingsbury, K. Yoshida, U. Muller, D. T. Larue, J. A. Winer, and H. Sakano. 1991. Science [Wash. DC]. 254:81; reference 1), we further suggest that the product of this gene could mediate both BCL2 translocation and the first step of normal DJ assembly through the creation of chi joints, rather than signal or coding joints.
45
De Melo, Valeria A., Paul Kotzampaltiris, Elisabeth Nacheva, David Marin, Jane F. Apperley i Alistair G. Reid. "Deletions Adjacent to BCR and ABL Breakpoints Occur in a Substantial Minority of Chronic Myeloid Leukaemia Patients with Masked Philadelphia Rearrangements." Blood 110, nr 11 (16.11.2007): 2929. http://dx.doi.org/10.1182/blood.v110.11.2929.2929.
Pełny tekst źródłaStreszczenie:
Abstract Chronic myeloid leukaemia (CML) results from the malignant transformation of haematopoietic stem cells by the BCR-ABL fusion gene, generated by a reciprocal translocation between chromosomes 9 and 22, the Philadelphia (Ph) translocation, or variations thereof. Common permutations of the Ph include translocations involving one or more additional chromosomes to 9 and 22 (“variant” Ph), and rearrangements resulting in cryptic insertion of chromosome 9 into chromosome 22, or vice versa, leaving apparently normal chromosomes 9 and 22 (“masked” Ph). Recently the development of new FISH techniques led to the identification of unexpected deletions at the Ph translocation breakpoints in approximately 15% of CML patients. The deletions, encompassing sequences 3′ of the BCR breakpoint and/or 5′ of the ABL breakpoint, were associated with a shorter duration of chronic phase and shorter survival in patients treated with interferon therapy, although their impact in patients treated with tyrosine kinase inhibitors is currently unclear. Interestingly, the incidence of deletions has been shown to vary for different cytogenetic subgroups of CML, with a significantly higher incidence of deletion in patients with a variant Ph translocation. The frequency of such events in patients with masked Ph rearrangements, however, has not yet been explored because of limitations inherent to the widely adopted dual-colour BCR-ABL FISH approach. We report the evaluation of 14 patients with masked Ph-positive CML for the presence of deletions extending 3′ from BCR and 5′ from ABL using two 3-colour BCR-ABL probes. Deletions were identified in 3 patients in total (21%), encompassing sequences 5′ to ABL in two of these and sequences 3′ to BCR in the remaining patient, thus demonstrating that the phenomenon is a significant feature of the masked Ph CML subgroup. Furthermore, our findings are consistent with the notion that loss of genomic material is a potential side effect of any DNA breakage event at the 9q34.1 and 22q11.2 chromosomal regions, regardless of the subsequent mechanism of chromosomal rearrangement.
46
Uehara, Erika, Atsushi Hattori, Hirohito Shima, Akira Ishiguro, Yu Abe, Tsutomu Ogata, Eishin Ogawa i Maki Fukami. "Unbalanced Y;7 Translocation between Two Low-Similarity Sequences Leading to SRY-Positive 45,X Testicular Disorders of Sex Development". Cytogenetic and Genome Research 158, nr 3 (2019): 115–20. http://dx.doi.org/10.1159/000501378.
Pełny tekst źródłaStreszczenie:
Unbalanced translocations of Y-chromosomal fragments harboring the sex-determining region Y gene (SRY) to the X chromosome or an autosome result in 46,XX and 45,X testicular disorders of sex development (DSD), respectively. Of these, Y;autosome translocation is an extremely rare condition. Here, we identified a 20-year-old man with a 45,X,t(Y;7)(q11.21;q35) karyotype, who exhibited unilateral cryptorchidism, small testis, intellectual disability, and various congenital anomalies. The fusion junction of the translocation was blunt, and the breakpoint-flanking regions shared only 50% similarity. These results indicate that Y;autosome translocations can occur between 2 low-similarity sequences, probably via nonhomologous end joining. Furthermore, translocations of a Ypterq11.21 fragment to 7q35 likely result in normal or only mildly impaired male-type sexual development, along with various clinical features of 7q deletion syndrome, although their effects on adult testicular function remain to be studied.
47
Hohmann, Uwe, Winfried Busch, Katia Badaeva, Bernd Friebe i Bikram S. Gill. "Molecular cytogenetic analysis of Agropyron chromatin specifying resistance to barley yellow dwarf virus in wheat". Genome 39, nr 2 (1.04.1996): 336–47. http://dx.doi.org/10.1139/g96-044.
Pełny tekst źródłaStreszczenie:
Nine families of bread wheat (TC5, TC6, TC7, TC8, TC9, TC10, TC14, 5395-(243AA), and 5395) with resistance to barley yellow dwarf virus and containing putative translocations between wheat and a group 7 chromosome of Agropyron intermedium (L1 disomic addition line, 7Ai#1 chromosome) induced by homoeologous pairing or tissue culture were analyzed. C-banding, genomic in situ hybridization (GISH), and restriction fragment length polymorphism (RFLP) in combination with repetitive Agropyron-specific sequences and deletion mapping in wheat were used to determine the relative locations of the translocation breakpoints and the size of the transferred alien chromatin segments in hexaploid wheat–Agropyron translocation lines. All homoeologous compensating lines had complete 7Ai#1 or translocated 7Ai#1–7D chromosomes that substitute for chromosome 7D. Two complete 7Ai#1 (7D) substitution lines (5395-(243AA) and 5395), one T1BS–7Ai#1S∙7Ai#1L addition line (TC7), and two different translocation types, T7DS–7Ai#1S∙7Ai#1L (TC5, TC6, TC8, TC9, and TC10) and T7DS∙7DL–7Ai#1L (TC14), substituting for chromosome 7D were identified. The substitution line 5395-(243AA) had a reciprocal T1BS∙1BL–4BS/T1BL–4BS∙4BL translocation. TC14 has a 6G (6B) substitution. The RFLP data from deletion mapping studies in wheat using 37 group 7 clones provided 10 molecular tagged chromosome regions for homoeologous and syntenic group 7 wheat or Agropyron chromosomes. Together with GISH we identified three different sizes of the transferred Agropyron chromosome segments with approximate breakpoints at fraction length (FL) 0.33 in the short arm of chromosome T7DS–7Ai#1S∙7Ai#1L (TC5, TC6, TC8, TC9, and TC10) and another at FL 0.37 of the nonhomoeologous translocated chromosome T1BS–7Ai#1S∙7Ai#1L (TC7). One breakpoint was identified in the long arm of chromosome T7DS∙7DL–7Ai#1L (TC14) at FL 0.56. We detected some nonreciprocal translocations for the most proximal region of the chromosome arm of 7DL, which resulted in small duplications. Key words : C-banding, genomic in situ hybridization (GISH), physical mapping, translocation mapping, RFLP analysis.
48
Albinger-Hegyi, Andrea, Bernhard Hochreutener, Marie-Therese Abdou, Ivan Hegyi, María Teresa Dours-Zimmermann, Michael O. Kurrer, Philipp U. Heitz i Dieter R. Zimmermann. "High Frequency of t(14;18)-Translocation Breakpoints Outside of Major Breakpoint and Minor Cluster Regions in Follicular Lymphomas". American Journal of Pathology 160, nr 3 (marzec 2002): 823–32. http://dx.doi.org/10.1016/s0002-9440(10)64905-x.
Pełny tekst źródła
49
Mays, Ashley Nicole, Neil Osheroff, Carolyn Felix, Jo Ann Byl, Kandeepan Saravanamuttu, Andrew Peniket, Robert Corser i in. "Molecular Characterization of the t(15;17)(q22;21) in Epirubicin-Related Acute Promyelocytic Leukaemia". Blood 112, nr 11 (16.11.2008): 791. http://dx.doi.org/10.1182/blood.v112.11.791.791.
Pełny tekst źródłaStreszczenie:
Abstract Chromosomal translocations generating chimaeric oncoproteins play an important role in leukaemogenesis, but mechanisms underlying their formation are largely unclear. Substantial insights can be gained from the analysis of therapy-related acute myeloid leukaemias (t-AMLs), which are becoming an increasing healthcare problem as more patients survive their primary cancers. Exposure to agents targeting topoisomerase II (topoII) predisposes to the development of leukaemias with balanced translocations e.g. t(15;17), fusing PML and RARA genes, in therapy-related acute promyelocytic leukaemia (t-APL) which is particularly associated with prior treatment involving mitoxantrone or epirubicin. Using long-range PCR and sequencing to define genomic junction regions we found that in t-APL cases arising in breast cancer patients exposed to the former agent, chromosome 15 breakpoints clustered tightly in an 8 bp “hotspot” region in PML intron 6, which was shown by functional assay to be a preferred site of mitoxantrone-induced DNA topoII cleavage (Mistry et al, NEJM 2005). Subsequent analysis of an independent cohort of t-APL cases arising after mitoxantrone therapy for multiple sclerosis confirmed chromosome 15 breakpoint clustering in the “hotspot” and identified a recurrent breakpoint within RARA intron 2. This hotspot also was shown to be a preferential site of mitoxantrone-induced cleavage in vitro (Hasan et al, Blood 2008). However, the molecular basis of epirubicin-related APL remains uncertain. Therefore we used long-range PCR and sequence analysis to define translocation breakpoints in 6 patients who developed APL after treatment involving epirubicin-containing regimens for prior breast carcinoma. While mitoxantrone-related APL displayed a bias towards breakpoints occurring within PML intron 6 (bcr1), epirubicin-related breakpoints fell within intron 3 (n=2) or intron 6 (n=4) and were outside the mitoxantrone-related “hotspot” (located at position 1484 according to accession number S57791). Breakpoints within the RARA locus were distinct from those observed in mitoxantrone-related APL. Interestingly, the chromosome 15 or chromosome 17 breakpoints of 4 of the epirubicin-related t-APLs fell in close proximity (within 1–4bp) to one of the other cases. Two shared a breakpoint location in PML intron 6 that occurred at bases 1185 and 1186 (accession number S57791) and two fell within RARA intron 2 at base numbers 16193 and 16197 (accession number AJ297538). Given that PML intron 6 and RARA intron 2 are ~1kb and 17kb in length, respectively, such breakpoint clustering was unlikely to have occurred by chance and consistent with functional sites of topoII cleavage. In addition, in vitro DNA cleavage assays demonstrated that heat stable topoII cleavage complexes are formed at the exact location of the breakpoint identified in one of the other patients, at position 1969 in PML intron 6, which were enhanced by the presence of epirubicin. This study suggests that mitoxantrone and epirubicin exhibit preference differences in sites of DNA damage induced by topoisomerase II, which may underlie the propensity to develop specific molecularly-defined subtypes of t-AML according to the nature of the particular chemotherapeutic agent used.
50
Guikema, Jeroen E. J., Conny de Boer, Jules Gadiot, Ed Schuuring i Philip M. Kluin. "Altered Replication Timing of IGH Alleles in Burkitt’s Lymphoma Depends on IGH Breakpoint Position." Blood 104, nr 11 (16.11.2004): 4276. http://dx.doi.org/10.1182/blood.v104.11.4276.4276.
Pełny tekst źródłaStreszczenie:
Abstract Monoallelic expression of immunoglobulin genes is epigenetically regulated and maintained. Asynchronous replication of the IGH alleles has been implicated in allelic exclusion. Usually, the functional IGH allele replicates early in the S-phase of the cell cycle whereas the non-functional allele replicates late. Previously, the intronic enhancer region (Eμ) and the 3′ Cα enhancer region have been designated as putative replication initiation sites. Activity of these replication origins are likely to be involved in regulation of asynchronous replication. By use of interphase and DNA fiber FISH we have performed a detailed analysis of the configuration of the t(8;14) chromosomal translocation in Burkitt’s lymphoma patients and cell lines and showed that the breakpoints in all studied cases were perfectly reciprocal without loss of IGH genomic material. An important implication is that in patients and cell lines harboring a breakpoint in a downstream switch region (Sγ or Sα) the Eμ and the 3′ Cα enhancer region are physically separated from each other, whereas in patients and cell lines with the IGH breakpoint located in the JH-region both enhancer regions remain on the der(14) chromosome. We therefore studied the IGH replication timing in Burkitt’s lymphoma cell lines harboring different IGH breakpoints by use of BrdU-FISH and interphase FISH on sorted cell cycle fractions. In two cell lines with JH-region breakpoints (Jiyoye and DG-75) the t(8;14) was invariably targeted to the late replicating IGH allele. In contrast, in all three cell lines with switch-region breakpoints (CA-46, Namalwa, BL-65) asynchronous replication of the IGH alleles was lost. As the position of the breakpoint in the MYC locus at 8q24 differed substantially between these cell lines (DG-75 and CA-46: intron 1 of the c-myc gene; Jiyoye, Namalwa, and BL-65: 100 kb to >500 kb centromeric from c-myc) it is unlikely that the position of the 8q24 breakpoint is of crucial influence on IGH replication timing. We speculate that the Eμ and the 3′ Cα enhancer region regulate the IGH replication timing in a cis-acting manner as physical separation of both enhancer regions results in loss of asynchronous replication.