Artykuły w czasopismach: „Thrombin binding aptamer”

1

Ponzo, Irene, Friederike M. Möller, Herwin Daub i Nena Matscheko. "A DNA-Based Biosensor Assay for the Kinetic Characterization of Ion-Dependent Aptamer Folding and Protein Binding". Molecules 24, nr 16 (8.08.2019): 2877. http://dx.doi.org/10.3390/molecules24162877.

Pełny tekst źródła

Streszczenie:

Therapeutic and diagnostic nucleic acid aptamers are designed to bind tightly and specifically to their target. The combination of structural and kinetic analyses of aptamer interactions has gained increasing importance. Here, we present a fluorescence-based switchSENSE aptasensor for the detailed kinetic characterization of aptamer–analyte interaction and aptamer folding, employing the thrombin-binding aptamer (TBA) as a model system. Thrombin-binding aptamer folding into a G-quadruplex and its binding to thrombin strongly depend on the type and concentration of ions present in solution. We observed conformational changes induced by cations in real-time and determined the folding and unfolding kinetics of the aptamer. The aptamer’s affinity for K+ was found to be more than one order of magnitude higher than for other cations (K+ > NH4+ >> Na+ > Li+). The aptamer’s affinity to its protein target thrombin in the presence of different cations followed the same trend but differed by more than three orders of magnitude (KD = 0.15 nM to 250 nM). While the stability (kOFF) of the thrombin–TBA complex was similar in all conditions, the cation type strongly influenced the association rate (kON). These results demonstrated that protein–aptamer binding is intrinsically related to the correct aptamer fold and, hence, to the presence of stabilizing ions. Because fast binding kinetics with on-rates exceeding 108 M−1s−1 can be quantified, and folding-related phenomena can be directly resolved, switchSENSE is a useful analytical tool for in-depth characterization of aptamer–ion and aptamer–protein interactions.

Style APA, Harvard, Vancouver, ISO itp.

2

Kim, Jieun, Dajeong Kim i Jong Bum Lee. "DNA aptamer-based carrier for loading proteins and enhancing the enzymatic activity". RSC Advances 7, nr 3 (2017): 1643–45. http://dx.doi.org/10.1039/c6ra25507h.

Pełny tekst źródła

Streszczenie:

Here, we synthesized DNA microparticles comprised of thrombin binding aptamers via rolling circle amplification (RCA). These DNA aptamer particles could successfully load a number of thrombins and the complexes have shown improved thrombin activity.

Style APA, Harvard, Vancouver, ISO itp.

3

Poturnayová, Alexandra, Maja Šnejdárková i Tibor Hianik. "DNA aptamer configuration affects the sensitivity and binding kinetics of thrombin". Acta Chimica Slovaca 5, nr 1 (1.04.2012): 53–58. http://dx.doi.org/10.2478/v10188-012-0009-z.

Pełny tekst źródła

Streszczenie:

DNA aptamer configuration affects the sensitivity and binding kinetics of thrombinThrombin is serine protease involved in the coagulation cascade, which converts soluble fibrinogen into insoluble strands of fibrin - a matrix of the blood clot formation. Development of the sensitive method of the thrombin detection in nanomolar level is important for clinical practice. In this work we applied acoustic thickness shear mode method (TSM) for study the binding of human thrombin depending on DNA aptamer configuration. We compared sensitivity of detection and binding kinetics of the thrombin to the conventional DNA aptamers and aptamer dimers immobilized at the surface of quartz crystal transducer. We have shown that aptasensors based on aptamer dimers more sensitively detect thrombin. The aptamer-thrombin complexes were also more stable as revealed from equilibrium dissociation constant,KD, that was 4 times lower for aptamer dimers in comparison with conventional aptamers. Determination of motional resistance,Rm, from acoustic impedance analysis allowed us to find important differences in physico-chemical properties of layers formed by conventional aptamers and aptamer dimers.

Style APA, Harvard, Vancouver, ISO itp.

4

Zhdanov, Gleb, Alexander Arutyunyuan, Alexey Kopylov i Elena Zavyalova. "Energy Dissipation Hypothesis Applied to Enhance the Affinity of Thrombin Binding Aptamer". Biophysica 1, nr 2 (14.05.2021): 179–93. http://dx.doi.org/10.3390/biophysica1020014.

Pełny tekst źródła

Streszczenie:

Nucleic acid aptamers are artificial recognizing molecules that are capable of specific binding to a wide variety of targets. Aptamers are commonly selected from a huge library of oligonucleotides and improved by introducing several mutations or modular constructions. Although aptamers hold great promise as therapeutic and diagnostic tools, no simple approach to improve their affinity has been suggested yet. Our recent analysis of aptamer–protein complexes revealed that aptamer affinity correlates with the size of an amino acid sidechain in the protein interface that was explained by efficient dissipation of the energy released during complex formation. G-quadruplex-based thrombin aptamers are not involved in the described dependence. Moreover, aptamers to the same thrombin site have 100-fold differences in affinity. Here we focused on a detailed analysis of the nucleic acid interface of thrombin–aptamer complexes. High affinity of the aptamers was shown to correlate with the solvent accessibility of the apolar part of recognizing loops. To prove the concept experimentally, these loops were modified to enhance contact with the solvent. Dissociation rates of the aptamer–thrombin complexes were drastically slowed due to these modifications. In full correspondence with the energy dissipation hypothesis, the modifications improved both the stability of the G-quadruplexes and affinity to thrombin. The most evident effect was shown for unstable Na+-coordinated G-quadruplexes. These data are of high interest for a directed improvement of aptamers introducing unnatural modifications into the ‘hot spot’ residues.

Style APA, Harvard, Vancouver, ISO itp.

5

Beyer, Stefan, Wendy U. Dittmer, Andreas Reuter i Friedrich C. Simmel. "Controlled Release of Thrombin Using Aptamer-Based Nanodevices". Advances in Science and Technology 53 (październik 2006): 116–21. http://dx.doi.org/10.4028/www.scientific.net/ast.53.116.

Pełny tekst źródła

Streszczenie:

Aptamers are DNA or RNA single strands that have been selected from random pools based on their ability to bind ligands. Like antibodies, aptamers are highly specific to their targets, and thus have many potential uses in biomedicine and biotechnology. We report here on the construction of a protein-binding molecular device based on a DNA aptamer, which can be instructed to hold or release the human blood-clotting factor, α-thrombin, depending on an operator DNA sequence addressing it. In the operation of this DNA nanodevice, the thrombin-binding DNA aptamer is switched between a binding and a non-binding form. This is achieved by sequentially hybridizing and removing a DNA single strand to the protein binding region of the aptamer. This principle of operation is limited as the switching sequence is determined by the protein-binding sequence. To overcome this limitation we introduce a DNA signal translation device that allows the operation of aptamers with arbitrary sequences. The function of the translator is based on branch migration and the action of the endonuclease FokI. The modular design of the translator facilitates the adaptation of the device to various input or output sequences.

Style APA, Harvard, Vancouver, ISO itp.

6

Kolganova, Natalia A., Vladimir B. Tsvetkov, Andrey A. Stomakhin, Sergei A. Surzhikov, Edward N. Timofeev i Irina V. Varizhuk. "Alpha-Deoxyguanosine to Reshape the Alpha-Thrombin Binding Aptamer". International Journal of Molecular Sciences 24, nr 9 (7.05.2023): 8406. http://dx.doi.org/10.3390/ijms24098406.

Pełny tekst źródła

Streszczenie:

Modification of DNA aptamers is aimed at increasing their thermodynamic stability, and improving affinity and resistance to biodegradation. G-quadruplex DNA aptamers are a family of affinity ligands that form non-canonical DNA assemblies based on a G-tetrads stack. Modification of the quadruplex core is challenging since it can cause complete loss of affinity of the aptamer. On the other hand, increased thermodynamic stability could be a worthy reward. In the current paper, we developed new three- and four-layer modified analogues of the thrombin binding aptamer with high thermal stability, which retain anticoagulant activity against alpha-thrombin. In the modified aptamers, one or two G-tetrads contained non-natural anti-preferred alpha-deoxyguanosines at specific positions. The use of this nucleotide analogue made it possible to control the topology of the modified structures. Due to the presence of non-natural tetrads, we observed some decrease in the anticoagulant activity of the modified aptamers compared to the natural prototype. This negative effect was completely compensated by conjugation of the aptamers with optimized tripeptide sequences.

Style APA, Harvard, Vancouver, ISO itp.

7

Funck, Timon, Tim Liedl i Wooli Bae. "Dual Aptamer-Functionalized 3D Plasmonic Metamolecule for Thrombin Sensing". Applied Sciences 9, nr 15 (26.07.2019): 3006. http://dx.doi.org/10.3390/app9153006.

Pełny tekst źródła

Streszczenie:

DNA nanotechnology offers the possibility to rationally design structures with emergent properties by precisely controlling their geometry and functionality. Here, we demonstrate a DNA-based plasmonic metamolecule that is capable of sensing human thrombin proteins. The chiral reconfigurability of a DNA origami structure carrying two gold nanorods was used to provide optical read-out of thrombin binding through changes in the displayed plasmonic circular dichroism. In our experiments, each arm of the structure was modified with one of two different thrombin-binding aptamers—thrombin-binding aptamer (TBA) and HD22—in such a way that a thrombin molecule could be sandwiched by the aptamers to lock the metamolecule in a state of defined chirality. Our structure exhibited a Kd of 1.4 nM, which was an order of magnitude lower than those of the individual aptamers. The increased sensitivity arose from the avidity gained by the cooperative binding of the two aptamers, which was also reflected by a Hill coefficient of 1.3 ± 0.3. As we further exploited the strong plasmonic circular dichroism (CD) signals of the metamolecule, our method allowed one-step, high sensitivity optical detection of human thrombin proteins in solution.

Style APA, Harvard, Vancouver, ISO itp.

8

Seelam Prabhakar, Preethi, Richard A. Manderville i Stacey D. Wetmore. "Impact of the Position of the Chemically Modified 5-Furyl-2′-Deoxyuridine Nucleoside on the Thrombin DNA Aptamer–Protein Complex: Structural Insights into Aptamer Response from MD Simulations". Molecules 24, nr 16 (10.08.2019): 2908. http://dx.doi.org/10.3390/molecules24162908.

Pełny tekst źródła

Streszczenie:

Aptamers are functional nucleic acids that bind to a range of targets (small molecules, proteins or cells) with a high affinity and specificity. Chemically-modified aptamers are of interest because the incorporation of novel nucleobase components can enhance aptamer binding to target proteins, while fluorescent base analogues permit the design of functional aptasensors that signal target binding. However, since optimally modified nucleoside designs have yet to be identified, information about how to fine tune aptamer stability and target binding affinity is required. The present work uses molecular dynamics (MD) simulations to investigate modifications to the prototypical thrombin-binding aptamer (TBA), which is a 15-mer DNA sequence that folds into a G-quadruplex structure connected by two TT loops and one TGT loop. Specifically, we modeled a previously synthesized thymine (T) analog, namely 5-furyl-2′-deoxyuridine (5FurU), into each of the six aptamer locations occupied by a thymine base in the TT or TGT loops of unbound and thrombin bound TBA. This modification and aptamer combination were chosen as a proof-of-principle because previous experimental studies have shown that TBA displays emissive sensitivity to target binding based on the local environment polarity at different 5FurU modification sites. Our simulations reveal that the chemically-modified base imparts noticeable structural changes to the aptamer without affecting the global conformation. Depending on the modification site, 5FurU performance is altered due to changes in the local environment, including the modification site structural dynamics, degree of solvent exposure, stacking with neighboring bases, and interactions with thrombin. Most importantly, these changes directly correlate with the experimentally-observed differences in the stability, binding affinity and emissive response of the modified aptamers. Therefore, the computational protocols implemented in the present work can be used in subsequent studies in a predictive way to aid the fine tuning of aptamer target recognition for use as biosensors (aptasensors) and/or therapeutics.

Style APA, Harvard, Vancouver, ISO itp.

9

Zeng, Xinling, Qing Zhou, Liyan Wang, Xiaoxian Zhu, Kuiyan Cui, Xinsheng Peng, Terry W. J. Steele, Huizhi Chen, Hui Xu i Yubin Zhou. "A Fluorescence Kinetic-Based Aptasensor Employing Stilbene Isomerization for Detection of Thrombin". Materials 14, nr 22 (16.11.2021): 6927. http://dx.doi.org/10.3390/ma14226927.

Pełny tekst źródła

Streszczenie:

It is important to detect thrombin due to its physiological and pathological roles, where rapid and simple analytical approaches are needed. In this study, an aptasensor based on fluorescence attenuation kinetics for the detection of thrombin is presented, which incorporates the features of stilbene and aptamer. We designed and synthesized an aptasensor by one-step coupling of stilbene compound and aptamer, which employed the adaptive binding of the aptamer with thrombin to cause a change in stilbene fluorescence attenuation kinetics. The sensor realized detection of thrombin by monitoring the variation in apparent fluorescence attenuation rate constant (kapp), which could be further used for probing of enzyme–aptamer binding. In comprehensive studies, the developed aptasensor presented satisfactory performance on repeatability, specificity, and regeneration capacity, which realized rapid sensing (10 s) with a limit of detection (LOD) of 0.205 μM. The strategy was successful across seven variants of thrombin aptasensors, with tunable kapp depending on the SITS (4-Acetamido-4′-isothiocyanato-2,2′-stilbenedisulfonic acid disodium salt hydrate) grafting site. Analyte detection mode was demonstrated in diluted serum, requiring no separation or washing steps. The new sensing mode for thrombin detection paves a way for high-throughput kinetic-based sensors for exploiting aptamers targeted at clinically relevant proteins.

Style APA, Harvard, Vancouver, ISO itp.

10

Russo Krauss, Irene, Andrea Pica, Antonello Merlino, Lelio Mazzarella i Filomena Sica. "Duplex–quadruplex motifs in a peculiar structural organization cooperatively contribute to thrombin binding of a DNA aptamer". Acta Crystallographica Section D Biological Crystallography 69, nr 12 (19.11.2013): 2403–11. http://dx.doi.org/10.1107/s0907444913022269.

Pełny tekst źródła

Streszczenie:

Potent second-generation thrombin aptamers adopt a duplex–quadruplex bimodular folding and recognize thrombin exosite II with very high affinity and specificity. A sound model of these oligonucleotides, either free or in complex with thrombin, is not yet available. Here, a structural study of one of these aptamers, HD22-27mer, is presented. The crystal structure of this aptamer in complex with thrombin displays a novel architecture in which the helical stem is enchained to a pseudo-G-quadruplex. The results also underline the role of the residues that join the duplex and quadruplex motifs and control their recruitment in thrombin binding.

Style APA, Harvard, Vancouver, ISO itp.

11

Smith, Mark H., i Daniel Fologea. "Kinetic Exclusion Assay of Biomolecules by Aptamer Capture". Sensors 20, nr 12 (18.06.2020): 3442. http://dx.doi.org/10.3390/s20123442.

Pełny tekst źródła

Streszczenie:

DNA aptamers are short nucleotide oligomers selected to bind a target ligand with affinity and specificity rivaling that of antibodies. These remarkable features recommend aptamers as candidates for analytical and therapeutic applications that traditionally use antibodies as biorecognition elements. Numerous traditional and emerging analytical techniques have been proposed and successfully implemented to utilize aptamers for sensing purposes. In this work, we exploited the analytical capabilities offered by the kinetic exclusion assay technology to measure the affinity of fluorescent aptamers for their thrombin target and quantify the concentration of analyte in solution. Standard binding curves constructed by using equilibrated mixtures of aptamers titrated with thrombin were fitted with a 1:1 binding model and provided an effective Kd of the binding in the sub-nanomolar range. However, our experimental results suggest that this simple model does not satisfactorily describe the binding process; therefore, the possibility that the aptamer is composed of a mixture of two or more distinct Kd populations is discussed. The same standard curves, together with a four-parameter logistic equation, were used to determine “unknown” concentrations of thrombin in mock samples. The ability to identify and characterize complex binding stoichiometry, together with the determination of target analyte concentrations in the pM–nM range, supports the adoption of this technology for kinetics, equilibrium, and analytical purposes by employing aptamers as biorecognition elements.

Style APA, Harvard, Vancouver, ISO itp.

12

Mao, Yu, Jimmy Gu, Dingran Chang, Lei Wang, Lili Yao, Qihui Ma, Zhaofeng Luo, Hao Qu, Yingfu Li i Lei Zheng. "Evolution of a highly functional circular DNA aptamer in serum". Nucleic Acids Research 48, nr 19 (6.10.2020): 10680–90. http://dx.doi.org/10.1093/nar/gkaa800.

Pełny tekst źródła

Streszczenie:

Abstract Circular DNA aptamers are powerful candidates for therapeutic applications given their dramatically enhanced biostability. Herein we report the first effort to evolve circular DNA aptamers that bind a human protein directly in serum, a complex biofluid. Targeting human thrombin, this strategy has led to the discovery of a circular aptamer, named CTBA4T-B1, that exhibits very high binding affinity (with a dissociation constant of 19 pM), excellent anticoagulation activity (with the half maximal inhibitory concentration of 90 pM) and high stability (with a half-life of 8 h) in human serum, highlighting the advantage of performing aptamer selection directly in the environment where the application is intended. CTBA4T-B1 is predicted to adopt a unique structural fold with a central two-tiered guanine quadruplex capped by two long stem–loops. This structural arrangement differs from all known thrombin binding linear DNA aptamers, demonstrating the added advantage of evolving aptamers from circular DNA libraries. The method described here permits the derivation of circular DNA aptamers directly in biological fluids and could potentially be adapted to generate other types of aptamers for therapeutic applications.

Style APA, Harvard, Vancouver, ISO itp.

13

Kotkowiak, Weronika, Zofia Jahnz-Wechmann i Anna Pasternak. "A Comprehensive Analysis of the Thrombin Binding Aptamer Containing Functionalized Pyrrolo-2’-deoxycytidines". Pharmaceuticals 14, nr 12 (18.12.2021): 1326. http://dx.doi.org/10.3390/ph14121326.

Pełny tekst źródła

Streszczenie:

Aptamers constitute an answer for the growing need for targeted therapy development. One of the most well-known representatives of this group of compounds is thrombin binding aptamers (TBA) targeted towards thrombin. The TBA inhibitory activity is determined by its spatial arrangement, which consists of two G-tetrads linked by two shorter TT loops and one longer TGT loop and folds into a unimolecular, antiparallel G-quadruplex structure. Interesting properties of the aptamer can be further improved via the introduction of a number of chemical modifications. Herein, a comprehensive analysis of the influence of pyrrolo-2’-deoxycytidine (Py-dC) and its derivatives on TBA physicochemical and biological properties has been presented. The studies have shown that the presence of modified residues at the T7 position of the TGT loop has only minor effects on TBA thermodynamic stability without affecting its folding topology. All analyzed oligomers exhibit anticoagulant properties, but only aptamer modified with a decyl derivative of Py-dC was able to inhibit thrombin activity more efficiently than unmodified, parental compounds. Importantly, the same compound also possessed the potential to effectively restrain HeLa cell line growth.

Style APA, Harvard, Vancouver, ISO itp.

14

Rakhmetova, S. Yu, S. P. Radko, O. V. Gnedenko, N. V. Bodoev, A. S. Ivanov i A. I. Archakov. "Photoaptamer heterodimeric constructs as a new approach to enhance the efficiency of formation of photocrosslinking with a target protein". Biomeditsinskaya Khimiya 56, nr 1 (styczeń 2010): 72–81. http://dx.doi.org/10.18097/pbmc20105601072.

Pełny tekst źródła

Streszczenie:

Using two DNA aptamers selectively recognizing anion-binding exosites 1 and 2 of thrombin as a model, it has been demonstrated that their conjugation by a poly-(dT)-linker (ranging from 5 to 65 nt in length) to produce aptamer heterodimeric constructs results into affinity enhancement. The apparent dissociation constant (Kdapp) measured at the optical biosensor Biacore-3000 for complexes of thrombin with the heterodimeric constructs reached minimum values (Kdapp = 0,2-0,4 nМ) which were approximately 30-fold less than for the complexes with the primary aptamers. A photoaptamer heterodimeric construct was designed connecting photoaptamer and aptamer sequences with the poly-(dT)-linker of 35 nt long. The photoaptamer used could form photo-induced cross-links with the exosite 2 of thrombin and the aptamer used could bind to the exosite 1. The measured value of Kdapp for the photoaptamer construct was approximately 40-fold less than that for the primary photoaptamer (5,3 and 190 nM, respectively). Upon exposure to the UV radiation at 308 nm of the equimolar mixtures of thrombin with the photoaptamer construct, the equal yield of the crosslinked complexes was observed at concentrations which were lower by two orders of magnitude than in the case of the primary photoaptamer. It was found that concurrently with crosslinking to thrombin a photo-induced inactivation of the photoaptamer occurs presumably due to formation of the intermolecular crosslinking.

Style APA, Harvard, Vancouver, ISO itp.

15

Martin, Jennifer A., Peter A. Mirau, Yaroslav Chushak, Jorge L. Chávez, Rajesh R. Naik, Joshua A. Hagen i Nancy Kelley-Loughnane. "Single-Round Patterned DNA Library Microarray Aptamer Lead Identification". Journal of Analytical Methods in Chemistry 2015 (2015): 1–8. http://dx.doi.org/10.1155/2015/137489.

Pełny tekst źródła

Streszczenie:

A method for identifying an aptamer in a single round was developed using custom DNA microarrays containing computationally derived patterned libraries incorporating no information on the sequences of previously reported thrombin binding aptamers. The DNA library was specifically designed to increase the probability of binding by enhancing structural complexity in a sequence-space confined environment, much like generating lead compounds in a combinatorial drug screening library. The sequence demonstrating the highest fluorescence intensity upon target addition was confirmed to bind the target molecule thrombin with specificity by surface plasmon resonance, and a novel imino proton NMR/2D NOESY combination was used to screen the structure for G-quartet formation. We propose that the lack of G-quartet structure in microarray-derived aptamers may highlight differences in binding mechanisms between surface-immobilized and solution based strategies. This proof-of-principle study highlights the use of a computational driven methodology to create a DNA library rather than a SELEX based approach. This work is beneficial to the biosensor field where aptamers selected by solution based evolution have proven challenging to retain binding function when immobilized on a surface.

Style APA, Harvard, Vancouver, ISO itp.

16

Valsangkar, Vibhav, Sweta Vangaveti, Goh Woon Lee, Walid M. Fahssi, Waqas S. Awan, Yicheng Huang, Alan A. Chen i Jia Sheng. "Structural and Binding Effects of Chemical Modifications on Thrombin Binding Aptamer (TBA)". Molecules 26, nr 15 (30.07.2021): 4620. http://dx.doi.org/10.3390/molecules26154620.

Pełny tekst źródła

Streszczenie:

The thrombin binding aptamer (TBA) is a promising nucleic acid-based anticoagulant. We studied the effects of chemical modifications, such as dendrimer Trebler and NHS carboxy group, on TBA with respect to its structures and thrombin binding affinity. The two dendrimer modifications were incorporated into the TBA at the 5′ end and the NHS carboxy group was added into the thymine residues in the thrombin binding site of the TBA G-quadruplex (at T4, T13 and both T4/T13) using solid phase oligonucleotide synthesis. Circular dichroism (CD) spectroscopy confirmed that all of these modified TBA variants fold into a stable G-quadruplex. The binding affinity of TBA variants with thrombin was measured by surface plasmon resonance (SPR). The binding patterns and equilibrium dissociation constants (KD) of the modified TBAs are very similar to that of the native TBA. Molecular dynamics simulations studies indicate that the additional interactions or stability enhancement introduced by the modifications are minimized either by the disruption of TBA–thrombin interactions or destabilization elsewhere in the aptamer, providing a rational explanation for our experimental data. Overall, this study identifies potential positions on the TBA that can be modified without adversely affecting its structure and thrombin binding preference, which could be useful in the design and development of more functional TBA analogues.

Style APA, Harvard, Vancouver, ISO itp.

17

Nagata, Madoka, Jinhee Lee, Stephen Henley, Kazunori Ikebukuro i Koji Sode. "An Amine-Reactive Phenazine Ethosulfate (arPES)—A Novel Redox Probe for Electrochemical Aptamer-Based Sensor". Sensors 22, nr 5 (24.02.2022): 1760. http://dx.doi.org/10.3390/s22051760.

Pełny tekst źródła

Streszczenie:

Electrochemical aptamer-based biosensors (E-ABs) are attractive candidates for use in biomarker detection systems due to their sensitivity, rapid response, and design flexibility. There are only several redox probes that were employed previously for this application, and a combination of redox probes affords some advantages in target detection. Thus, it would be advantageous to study new redox probes in an E-AB system. In this study, we report the use of amine-reactive phenazine ethosulfate (arPES) for E-AB through its conjugation to the terminus of thrombin-binding aptamer. The constructed E-AB can detect thrombin by square-wave voltammetry (SWV), showing peak current at −0.15 V vs. Ag/AgCl at pH 7, which differs from redox probes used previously for E-ABs. We also compared the characteristics of PES as a redox probe for E-AB to methylene blue (MB), which is widely used. arPES showed stable signal at physiological pH. Moreover, the pH profile of arPES modified thrombin-binding aptamer revealed the potential application of arPES for a simultaneous multianalyte detection system. This could be achieved using different aptamers with several redox probes in tandem that harbor various electrochemical peak potentials. Our findings present a great opportunity to improve the current standard of biological fluid monitoring using E-AB.

Style APA, Harvard, Vancouver, ISO itp.

18

Hao, Lihua, i Qiang Zhao. "A fluorescein labeled aptamer switch for thrombin with fluorescence decrease response". Analytical Methods 7, nr 9 (2015): 3888–92. http://dx.doi.org/10.1039/c5ay00464k.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

19

Basnar, Bernhard, Roey Elnathan i Itamar Willner. "Following Aptamer−Thrombin Binding by Force Measurements". Analytical Chemistry 78, nr 11 (czerwiec 2006): 3638–42. http://dx.doi.org/10.1021/ac052289e.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

20

Rakhmetova, S. Yu, S. P. Radko, O. V. Gnedenko, N. V. Bodoev, A. S. Ivanov i A. I. Archakov. "Comparative termodynamic analysis of thrombin interaction with anti-thrombin aptamers and their heterodimeric construct". Biomeditsinskaya Khimiya 56, nr 3 (2010): 404–11. http://dx.doi.org/10.18097/pbmc20105603404.

Pełny tekst źródła

Streszczenie:

Aptamers interacting selectively with the anion-binding exosites 1 and 2 of thrombin were merged into dimeric oligonucleotide constructs with use of a poly-(dT)-linker of 35 nucleotides (nt) long. Complexes of thrombin with the aptamers and their hetero- and homodimeric constructs were measured using the optical biosensor Biacore-3000. KD values measured for the hetero- and homodimeric constructs were correspondingly 25-30- and 2-3-fold lower than those for the primary aptamers. Analysis of temperature dependencies of KD values within the temperature interval of 10°C-40°C has shown that the values of enthalpy change ΔH upon formation of complexes of thrombin with the aptamers and the hetrodimeric construct are close. The value of the entropy change ΔS upon complex formation of thrombin with the aptamer heterodimeric construct was 1.5-2-fold higher than ΔS values for the complexes with the aptamers. The complex formation and dissociation rates increased with the elevation of temperature from 10°С to 37°С. However, the dissociation rate for the complex of thrombin with the heterodimeric construct was evidently lower that that for the complexes with the aptamers.

Style APA, Harvard, Vancouver, ISO itp.

21

Wei, Yani, Luhui Wang, Yingying Zhang i Yafei Dong. "An Enzyme- and Label-Free Fluorescence Aptasensor for Detection of Thrombin Based on Graphene Oxide and G-Quadruplex". Sensors 19, nr 20 (12.10.2019): 4424. http://dx.doi.org/10.3390/s19204424.

Pełny tekst źródła

Streszczenie:

An enzyme- and label-free aptamer-based assay is described for the determination of thrombin. A DNA strand (S) consisting of two parts was designed, where the first (Sa) is the thrombin-binding aptamer and the second (Se) is a G-quadruplex. In the absence of thrombin, Sa is readily adsorbed by graphene oxide (GO), which has a preference for ss-DNA rather than for ds-DNA. Upon the addition of the N-methyl-mesoporphyrin IX (NMM), its fluorescence (with excitation/emission at 399/610 nm) is quenched by GO. In contrast, in the presence of thrombin, the aptamer will bind thrombin, and thus, be separated from GO. As a result, fluorescence will be enhanced. The increase is linear in the 0.37 µM to 50 µM thrombin concentration range, and the detection limit is 0.37 nM. The method is highly selective over other proteins, cost-effective, and simple. In our perception, it represents a universal detection scheme that may be applied to other targets according to the proper choice of the aptamer sequence and formation of a suitable aptamer-target pair.

Style APA, Harvard, Vancouver, ISO itp.

22

Fadock, Kaila L., Richard A. Manderville, Purshotam Sharma i Stacey D. Wetmore. "Optimization of fluorescent 8-heteroaryl-guanine probes for monitoring protein-mediated duplex → G-quadruplex exchange". Organic & Biomolecular Chemistry 14, nr 19 (2016): 4409–19. http://dx.doi.org/10.1039/c6ob00474a.

Pełny tekst źródła

Streszczenie:

In this study, we describe the thermal and optical properties of the thrombin binding aptamer (TBA) that has been modified at syn-G-tetrad postions with fluorescent 8-heteroaryl-2′-deoxyguanosine derivatives that light-up upon thrombin binding.

Style APA, Harvard, Vancouver, ISO itp.

23

Nikolaeva, P. A., R. V. Moryachkov, V. N. Raldugina, J. O. Naumova, T. M. Novikova i V. A. Spiridonova. "Structural analysis of thrombin-binding G-aptamers in presence of bivalent ions". Siberian Medical Review, nr 5 (2022): 111–13. http://dx.doi.org/10.20333/25000136-2022-5-111-113.

Pełny tekst źródła

Streszczenie:

The aim of this study was to examine 3D structures of DNA aptamers, thrombin inhibitors. •The main objective was to study 3D structure 15TBA, RE31, NU172 aptamers using the small-angle X-ray scattering method. The size of 15TBA was 4.5 nm, which corresponds to a partially unfolded conformation. The CD spectrum of Nu172 in the presence of 50 mM strontium ions indicates the presence of an antiparallel G-quadruplex, the concentration o f which drops at 50°C. NU172 does not have a rigid structure, apparently due to the presence of a guanine residue in the GT loop. The NU172 aptamer does not form a stable conformation in solution either without ions or with Ba2+ and Sr2+ ions. • It was shown that there is possibility of aptamers transition from one conformation to another dependently on concentration and temperature confirms that the potassium ion is a unique stabilizing ion of natural molecules containing G-quadruplexes

Style APA, Harvard, Vancouver, ISO itp.

24

Nagatoishi, Satoru, Noburu Isono, Kouhei Tsumoto i Naoki Sugimoto. "Loop residues of thrombin-binding DNA aptamer impact G-quadruplex stability and thrombin binding". Biochimie 93, nr 8 (sierpień 2011): 1231–38. http://dx.doi.org/10.1016/j.biochi.2011.03.013.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

25

Pagano, Bruno, Luigi Martino, Antonio Randazzo i Concetta Giancola. "Stability and Binding Properties of a Modified Thrombin Binding Aptamer". Biophysical Journal 94, nr 2 (styczeń 2008): 562–69. http://dx.doi.org/10.1529/biophysj.107.117382.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

26

Pol, Laura, Laura Karen Acosta, Josep Ferré-Borrull i Lluis F. Marsal. "Aptamer-Based Nanoporous Anodic Alumina Interferometric Biosensor for Real-Time Thrombin Detection". Sensors 19, nr 20 (19.10.2019): 4543. http://dx.doi.org/10.3390/s19204543.

Pełny tekst źródła

Streszczenie:

Aptamer biosensors are one of the most powerful techniques in biosensing. Achieving the best platform to use in aptamer biosensors typically includes crucial chemical modifications that enable aptamer immobilization on the surface in the most efficient manner. These chemical modifications must be well defined. In this work we propose nanoporous anodic alumina (NAA) chemically modified with streptavidin as a platform for aptamer immobilization. The immobilization of biotinylated thrombin binding aptamer (TBA) was monitored in real time by means of reflective interferometric spectroscopy (RIfS). The study has permitted to characterize in real time the path to immobilize TBA on the inner pore walls of NAA. Furthermore, this study provides an accurate label-free method to detect thrombin in real-time with high affinity and specificity.

Style APA, Harvard, Vancouver, ISO itp.

27

Esposito, Veronica, Maria Scuotto, Antonella Capuozzo, Rita Santamaria, Michela Varra, Luciano Mayol, Antonella Virgilio i Aldo Galeone. "A straightforward modification in the thrombin binding aptamer improving the stability, affinity to thrombin and nuclease resistance". Org. Biomol. Chem. 12, nr 44 (2014): 8840–43. http://dx.doi.org/10.1039/c4ob01475h.

Pełny tekst źródła

Streszczenie:

Introduction of inversion of polarity sites at the 5′- and/or 3′-end in the thrombin binding aptamer is a simple modification able to improve, at the same time, thermal stability, affinity to thrombin and nuclease resistance.

Style APA, Harvard, Vancouver, ISO itp.

28

Keijzer, Jordi F., Judith Firet i Bauke Albada. "Site-selective and inducible acylation of thrombin using aptamer-catalyst conjugates". Chemical Communications 57, nr 96 (2021): 12960–63. http://dx.doi.org/10.1039/d1cc05446e.

Pełny tekst źródła

Streszczenie:

Functionalizing a protein-binding aptamer with an acylation catalyst leads to site-selective modification of the target protein in proximity to the aptamer–protein interface. This protein modification can be switched ON or OFF by an external trigger.

Style APA, Harvard, Vancouver, ISO itp.

29

Taira, Kenichi, Koichi Abe, Takayuki Ishibasi, Katsuaki Sato i Kazunori Ikebukuro. "Control of Aptamer Function Using Radiofrequency Magnetic Field". Journal of Nucleic Acids 2011 (2011): 1–6. http://dx.doi.org/10.4061/2011/103872.

Pełny tekst źródła

Streszczenie:

Remote control of aptamer function has allowed us to control protein function in space and time. Here, we propose a novel control system for aptamer function by radiofrequency magnetic field- (RFMF-) induced local heating of a gold nanoparticle conjugated with an aptamer. In this study, we used a 31-mer thrombin-binding aptamer (TBA), which can inhibit thrombin activity, as a model aptamer. We evaluated the RFMF control of the inhibitory activity of a gold nanoparticle-conjugated TBA. To evaluate the effect of RFMF on enzymatic activity, we utilized a complementary DNA strand that maintains the broken structure during the activity assay. We observed a decrease in the inhibitory activity of TBA after RFMF irradiation. It indicates that RFMF is capable of controlling the TBA structure. Because RFMF allows noninvasive control of aptamer function, this strategy is expected to be novel way of controlling aptamer drug activity.

Style APA, Harvard, Vancouver, ISO itp.

30

Porschewski, Peter, Mira A. M. Grättinger, Kerstin Klenzke, Anja Erpenbach, Michael R. Blind i Frank Schäfer. "Using Aptamers as Capture Reagents in Bead-Based Assay Systems for Diagnostics and Hit Identification". Journal of Biomolecular Screening 11, nr 7 (14.09.2006): 773–81. http://dx.doi.org/10.1177/1087057106292138.

Pełny tekst źródła

Streszczenie:

Most applications of xMAP™ (Luminex®) bead-based assay technology in diagnostics and drug discovery use immobilized antigens or antibodies. Here the authors describe the development of novel assay systems in which synthetic oligonucleotides that specifically bind and inhibit other biomolecules—so-called aptamers—are directly immobilized on beads. The robustness, specificity, and sensitivity of aptamer-based assays were demonstrated in a test system that detected human α-thrombin in serum samples. xMAP technology was also adapted to competitive screening formats where an aptamer/protein complex was disrupted by a functionally analogous competitor. The results indicate that such assays are excellently suited for diagnostic applications or drug screening, where aptamers serve as competitive binding probes for the identification of small-molecule hits. These methods should be transferable to a large number of applications because specific aptamers can be rapidly generated for almost any protein target.

Style APA, Harvard, Vancouver, ISO itp.

31

Ptitsyn, K. G., S. E. Novikova, Y. Y. Kiseleva, A. A. Moysa, L. K. Kurbatov, T. E. Farafonova, S. P. Radko, V. G. Zgoda i A. I. Archakov. "Use of DNA-aptamers for enrichment of low abundant proteins in cellular extracts for quntitative detection by selected reaction monitoring". Biomeditsinskaya Khimiya 64, nr 1 (styczeń 2018): 5–9. http://dx.doi.org/10.18097/pbmc20186401005.

Pełny tekst źródła

Streszczenie:

The relationship between the amount of a target protein in a complex biological sample and its amount measured by selected reaction monitoring (SRM) mass spectrometry upon the affinity enrichment of target protein with aptamers immobilized on a solid phase was studied. Human thrombin added in known concentrations to cellular extracts derived from bacterial cells was used as model target protein. It has been demonstrated that the affinity enrichment of thrombin in cellular extracts by means of the thrombin-binding aptamer immobilized on the surface of magnetic microbeads results in an approximately 10-fold increase of the concentration of target protein and a 100-fold decrease of the low limit of a target protein concentration range where its quantitative detection by SRM is possible without an interference from other peptides present in a tryptic digest.

Style APA, Harvard, Vancouver, ISO itp.

32

Kim, Dajeong, Jieun Kim i Jong Bum Lee. "An enzymatically self-assembled DNA patch for enhanced blood coagulation". Chemical Communications 56, nr 44 (2020): 5917–20. http://dx.doi.org/10.1039/d0cc00974a.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

33

Kretz, Colin A., Alan R. Stafford, James C. Fredenburgh i Jeffrey I. Weitz. "Thrombin Aptamer HD1 Inhibits Prothrombin Activation by Binding Proexosite 1 on Prothrombin." Blood 106, nr 11 (16.11.2005): 1950. http://dx.doi.org/10.1182/blood.v106.11.1950.1950.

Pełny tekst źródła

Streszczenie:

Abstract Functional maturation of exosites 1 and 2 during prothrombin activation endows thrombin with its physiological activities. Thrombin exosite 1 binds ligands such as fibrinogen, the thrombin receptor, and hirudin, and orients them to the active site. In contrast, thrombin exosite 2 binds ligands such as heparin, platelet glycoprotein Iba, and the chondroitin sulfate moiety of thrombomodulin molecules; ligands that do not directly interact with the active site. Neither exosite is fully functional in prothrombin. Exosite 2 only becomes functional when fragment 2 is released. In contrast, there is evidence for existence of a proexosite 1 in prothrombin which contributes to prothrombin activation by prothrombinase. This domain in prothrombin lacks fibrin-binding capacity, but has been implicated in the interaction with factor Va (fVa), a necessary step for enhanced prothrombin activation by prothrombinase. In the present study, we used fluorescent (F) HD1 and HD22, DNA aptamers that bind to exosites 1 and 2, respectively, to study the exosites in prothrombin, prothrombin intermediates and thrombin. F-HD22 does not bind to prothrombin and only binds prothrombin intermediates lacking fragment 2. In contrast, F-HD1 binds to prothrombin and all of the prothrombin intermediates with Kd values ranging from 80 to 25 nM for prothrombin and thrombin, respectively. These findings are different from what has been reported with the hirudin fragment, Hir54–65, which exhibited a 60-fold lower affinity for prothrombin than for thrombin. To better explore the involvement of proexosite 1 in the activation of prothrombin by prothrombinase, we examined the effect of HD1 on prothrombin activation by intact prothrombinase, or by various components of the prothrombinase complex. HD1 inhibits prothrombin activation by prothrombinase with an IC50 of 140 nM. Omitting fVa from the prothrombinase complex abolishes the inhibitory effect of HD1, supporting the concept that the inhibitory effect of HD1 reflects disruption of the interaction between prothrombin and fVa. In similar experiments, Hir54–65 inhibits prothrombin activation by prothrombinase with an IC50 of 225 nM, in agreement with previous studies. These data show that, like hirugen, HD1 binds to the fVa-binding domain on proexosite 1 of prothrombin. In order to refine the location of HD1 and Hir54–65 binding sites on thrombin and prothrombin, competitive binding experiments were performed. Hir54–65 displaces 80% of F-HD1 from thrombin and 70% from prothrombin. In reverse titrations, HD1 displaces 50% of F-Hir54–65 from thrombin, but does not displace F-Hir54–65 from prothrombin. Taken together, these data suggest that the HD1 binding domain is distinct, at least in part, from the Hir54–65 binding domain on prothrombin, an observation supported by examination of the crystal structures of complexes of HD1 or Hir54–65 with thrombin. In conclusion, our data demonstrate that the prsuggests that the HD1 binding site on prothrombin more closely coincides with the fVa-binding site than does the hirugen-binding site. These findings provide new avenues for investigations into the oexosite 1 domain on prothrombin is fully capacitated for binding HD1. This role of exosite 1, not only in thrombin, but also in prothrombin.

Style APA, Harvard, Vancouver, ISO itp.

34

Zavyalova i Kopylov. "Energy Transfer as A Driving Force in Nucleic Acid–Protein Interactions". Molecules 24, nr 7 (11.04.2019): 1443. http://dx.doi.org/10.3390/molecules24071443.

Pełny tekst źródła

Streszczenie:

Many nucleic acid–protein structures have been resolved, though quantitative structure-activity relationship remains unclear in many cases. Thrombin complexes with G-quadruplex aptamers are striking examples of a lack of any correlation between affinity, interface organization, and other common parameters. Here, we tested the hypothesis that affinity of the aptamer–protein complex is determined with the capacity of the interface to dissipate energy of binding. Description and detailed analysis of 63 nucleic acid–protein structures discriminated peculiarities of high-affinity nucleic acid–protein complexes. The size of the amino acid sidechain in the interface was demonstrated to be the most significant parameter that correlates with affinity of aptamers. This observation could be explained in terms of need of efficient energy transfer from interacting residues. Application of energy dissipation theory provided an illustrative tool for estimation of efficiency of aptamer–protein complexes. These results are of great importance for a design of efficient aptamers.

Style APA, Harvard, Vancouver, ISO itp.

35

Nishimura, Jun-ichi, Angela D. Burnette, Milena Batchvarova, Shahid M. Nimjee, Rahima Zennadi, Bruce A. Sullenger i Marilyn J. Telen. "Blocking Adhesion of Sickle Erythrocytes to Endothelial αVβ3 Using RNA Aptamer." Blood 108, nr 11 (16.11.2006): 688. http://dx.doi.org/10.1182/blood.v108.11.688.688.

Pełny tekst źródła

Streszczenie:

Abstract Vaso-occlusive crises are a major clinical feature of sickle cell disease (SCD), and the adhesion of sickle erythrocytes (SS-RBC) to vascular endothelium is crucial to the generation of vaso-occlusion. The αvβ3 integrin is a major endothelial ligand for SS-RBC. Soluble thrombospondin has been thought to serve as a bridging molecule between erythrocyte CD36 and endothelial αvβ3, and high-molecular-weight multimers of von Willebrand factor also promote SS-RBC adhesion to endothelial αvβ3. Our group recently identified SS-RBC adhesion to endothelium via ICAM-4 (LW, CD242)-αvβ3 interactions (Blood, 104, 3774, 2004), suggesting that αvβ3 is a critical target against which to develop reagents to prevent or treat vaso-occlusive crises in SCD. Aptamers are oligonucleotides that bind to molecular targets in a manner conceptually similar to antibodies and have been identified against a wide range of therapeutic targets. RNA aptamers that bind to human integrin αIIbβ3/αvβ3 and inhibit integrin binding to the ligands vitronectin and fibrinogen have previously been identified (Biochem Biophys Res Commun, 338, 956, 2005). We have now tested one of these high-affinity αvβ3 aptamers (clone 17.16: UUCAACGCUGUGAAGGGCUUAUACGAGCGGAUUACCC) for its ability to prevent adhesion of SS-RBC to endothelial cells. Aptamer clone 17.16 bound αIIbβ3 with a Kd of 7–10nM, and the binding was blocked by both Abciximab, a monoclonal antibody against human integrin αIIbβ3/αvβ3 via a common binding motif RGD (arginine-glycine-aspardic acid), and Eptifibatide, a small molecule that binds to the RGD moiety, suggesting the sharing of the binding site at the RGD moiety. To measure its anti-adhesion activity, an in vitro flow chamber assay was adopted. We first induced enhanced expression of αvβ3 on the immortalized HUVEC cell line EC-RF24, using each of the following: TNF-α (10ng/mL for 18.5 hrs at 37°C), thrombin (1nM for 5 min at 37°C), or histamine (25mM for 12 min at RT), and αvβ3 expression by treated and nontreated cells was measured by flow cytometry. The anti-adhesion activity of aptamer clone 17.16 was then confirmed using HUVECs treated with thrombin (1nM for 5mins at 37°C) using a flow chamber assay. Aptamer clone 17.16 (30nM) had anti-adhesion activity similar to LM609, an inhibitory antibody to αvβ3, whereas human complement 8 aptamer (Blood, 106, 57a, 2005, negative control, 30nM) did not have anti-adhesion activity. The anti-adhesion activity of aptamer clone 17.16 (30nM) was enhanced by a dose escalation to 60nM and 120nM. At 2 dynes/cm2, maximal inhibition of adhesion was 57%. In conclusion, we observed significant anti-adhesion activity of αvβ3 aptamer clone 17.16, and it has currently reached a stage suitable for modification to enhance stability and bioavailability. In addition, in vivo experiments in mice will employ intravital microscopy to measure anti-adhesion activity in vivo. Figure Figure

Style APA, Harvard, Vancouver, ISO itp.

36

Hall, Scott, Craig Gibbs i Lawrence Leung. "Identification of Critical Residues on Thrombin Mediating Its Interaction with Fibrin". Thrombosis and Haemostasis 86, nr 12 (2001): 1466–74. http://dx.doi.org/10.1055/s-0037-1616750.

Pełny tekst źródła

Streszczenie:

SummaryThrombin binding to fibrin may be important in localizing thrombin to the site of vascular injury. However, fibrin-bound thrombin retains its catalytic activity toward fibrinogen, and may be prothrombotic under certain conditions. A collection of 52 purified thrombin mutants was used to identify those residues mediating the thrombin-fibrin interaction. Comparison of fibrinogen clotting activity with fibrin binding activity identified twenty residues involved in fibrinogen recognition with four of these residues important in fibrin binding (Lys65, His66, Tyr71, Arg73). No mutant was identified with normal clotting activity and deficient fibrin binding, suggesting that these two properties are not readily dissociable. A DNA thrombin aptamer that binds to these residues was able to inhibit the thrombin-fibrin interaction, and displace thrombin that was already bound. Mapping of these fibrin-binding residues on thrombin revealed that they are localized within exosite I, and comprise a subset of the residues important in fibrinogen recognition.

Style APA, Harvard, Vancouver, ISO itp.

37

Ali, Aysha, Gemma A. Bullen, Benjamin Cross, Timothy R. Dafforn, Haydn A. Little, Jack Manchester, Anna F. A. Peacock i James H. R. Tucker. "Light-controlled thrombin catalysis and clot formation using a photoswitchable G-quadruplex DNA aptamer". Chemical Communications 55, nr 39 (2019): 5627–30. http://dx.doi.org/10.1039/c9cc01540j.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

38

Ma, Xiao, Agnivo Gosai, Ganesh Balasubramanian i Pranav Shrotriya. "Aptamer based electrostatic-stimuli responsive surfaces for on-demand binding/unbinding of a specific ligand". Journal of Materials Chemistry B 5, nr 20 (2017): 3675–85. http://dx.doi.org/10.1039/c6tb02386j.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

39

Diculescu, Victor Constantin, Ana-Maria Chiorcea-Paquim, Ramon Eritja i Ana Maria Oliveira-Brett. "Thrombin-Binding Aptamer Quadruplex Formation: AFM and Voltammetric Characterization". Journal of Nucleic Acids 2010 (2010): 1–8. http://dx.doi.org/10.4061/2010/841932.

Pełny tekst źródła

Streszczenie:

The adsorption and the redox behaviour of thrombin-binding aptamer (TBA) and extended TBA (eTBA) were studied using atomic force microscopy and voltammetry at highly oriented pyrolytic graphite and glassy carbon. The different adsorption patterns and degree of surface coverage were correlated with the sequence base composition, presence/absence of K+, and voltammetric behaviour of TBA and eTBA. In the presence of K+, only a few single-stranded sequences present adsorption, while the majority of the molecules forms stable and rigid quadruplexes with no adsorption. Both TBA and eTBA are oxidized and the only anodic peak corresponds to guanine oxidation. Upon addition of K+ions, TBA and eTBA fold into a quadruplex, causing the decrease of guanine oxidation peak and occurrence of a new peak at a higher potential due to the oxidation of G-quartets. The higher oxidation potential of G-quartets is due to the greater difficulty of electron transfer from the inside of the quadruplex to the electrode surface than electron transfer from the more flexible single strands.

Style APA, Harvard, Vancouver, ISO itp.

40

Kim, Hyun Woo, Young Min Rhee i Seung Koo Shin. "Charge–dipole interactions in G-quadruplex thrombin-binding aptamer". Physical Chemistry Chemical Physics 20, nr 32 (2018): 21068–74. http://dx.doi.org/10.1039/c8cp03050b.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

41

Lai, Pei-Xin, Ju-Yi Mao, Binesh Unnikrishnan, Han-Wei Chu, Chien-Wei Wu, Huan-Tsung Chang i Chih-Ching Huang. "Self-assembled, bivalent aptamers on graphene oxide as an efficient anticoagulant". Biomaterials Science 6, nr 7 (2018): 1882–91. http://dx.doi.org/10.1039/c8bm00288f.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

42

Frense, D., S. Kang, K. Schieke, P. Reich, A. Barthel, U. Pliquett, T. Nacke, C. Brian i D. Beckmann. "Label-free impedimetric biosensor for thrombin using the thrombin-binding aptamer as receptor". Journal of Physics: Conference Series 434 (18.04.2013): 012091. http://dx.doi.org/10.1088/1742-6596/434/1/012091.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

43

Zhang, Xiangyuan, Ruoxin Hu i Na Shao. "Label-free sensing of thrombin based on quantum dots and thrombin binding aptamer". Talanta 107 (marzec 2013): 140–45. http://dx.doi.org/10.1016/j.talanta.2013.01.003.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

44

Pérez de Carvasal, Kévan, Claudia Riccardi, Irene Russo Krauss, Domenico Cavasso, Jean-Jacques Vasseur, Michael Smietana, François Morvan i Daniela Montesarchio. "Charge-Transfer Interactions Stabilize G-Quadruplex-Forming Thrombin Binding Aptamers and Can Improve Their Anticoagulant Activity". International Journal of Molecular Sciences 22, nr 17 (2.09.2021): 9510. http://dx.doi.org/10.3390/ijms22179510.

Pełny tekst źródła

Streszczenie:

In the search for optimized thrombin binding aptamers (TBAs), we herein describe the synthesis of a library of TBA analogues obtained by end-functionalization with the electron-rich 1,5-dialkoxy naphthalene (DAN) and the electron-deficient 1,8,4,5-naphthalenetetra-carboxylic diimide (NDI) moieties. Indeed, when these G-rich oligonucleotides were folded into the peculiar TBA G-quadruplex (G4) structure, effective donor–acceptor charge transfer interactions between the DAN and NDI residues attached to the extremities of the sequence were induced, providing pseudo-cyclic structures. Alternatively, insertion of NDI groups at both extremities produced TBA analogues stabilized by π–π stacking interactions. All the doubly-modified TBAs were characterized by different biophysical techniques and compared with the analogues carrying only the DAN or NDI residue and unmodified TBA. These modified TBAs exhibited higher nuclease resistance, and their G4 structures were markedly stabilized, as evidenced by increased Tm values compared to TBA. These favorable properties were also associated with improved anticoagulant activity for one DAN/NDI-modified TBA, and for one NDI/NDI-modified TBA. Our results indicated that TBA pseudo-cyclic structuring by ad hoc designed end-functionalization represents an efficient approach to improve the aptamer features, while pre-organizing and stabilizing the G4 structure but allowing sufficient flexibility to the aptamer folding, which is necessary for optimal thrombin recognition.

Style APA, Harvard, Vancouver, ISO itp.

45

Hagiwara, Kenta, Yuuya Kasahara, Hiroto Fujita i Masayasu Kuwahara. "Non-Equilibrium Capillary Electrophoresis of Equilibrium Mixtures-Based Affinity Separation and Selective Enrichment of a Long-Length DNA Aptamer". Australian Journal of Chemistry 69, nr 10 (2016): 1102. http://dx.doi.org/10.1071/ch16272.

Pełny tekst źródła

Streszczenie:

Non-equilibrium capillary electrophoresis of equilibrium mixtures (NECEEM) is a kinetic capillary electrophoresis method used for the affinity analysis of DNA binding to proteins or ligands as well as a rapid selection of DNA aptamers. However, long DNA strands (100-mer or more) are generally difficult to analyse by this method owing to their poor peak separation. Herein, we report optimized conditions (use of a neutral phosphate buffer with an ionic strength of 0.074 as a binding buffer and use of an 80-cm fused silica capillary with a 75-μm internal diameter) for the peak separation of a 100-mer thrombin-binding DNA aptamer-target complex and its consequent enrichment using the NECEEM-based capillary electrophoresis–systematic evolution of ligands by exponential enrichment (CE-SELEX) method.

Style APA, Harvard, Vancouver, ISO itp.

46

Prommapan, Plengchart, Nermina Brljak, Troy W. Lowry, David Van Winkle i Steven Lenhert. "Aptamer Functionalized Lipid Multilayer Gratings for Label-Free Analyte Detection". Nanomaterials 10, nr 12 (5.12.2020): 2433. http://dx.doi.org/10.3390/nano10122433.

Pełny tekst źródła

Streszczenie:

Lipid multilayer gratings are promising optical biosensor elements that are capable of transducing analyte binding events into changes in an optical signal. Unlike solid state transducers, reagents related to molecular recognition and signal amplification can be incorporated into the lipid grating ink volume prior to fabrication. Here we describe a strategy for functionalizing lipid multilayer gratings with a DNA aptamer for the protein thrombin that allows label-free analyte detection. A double cholesterol-tagged, double-stranded DNA linker was used to attach the aptamer to the lipid gratings. This approach was found to be sufficient for binding fluorescently labeled thrombin to lipid multilayers with micrometer-scale thickness. In order to achieve label-free detection with the sub-100 nm-thick lipid multilayer grating lines, the binding affinity was improved by varying the lipid composition. A colorimetric image analysis of the light diffracted from the gratings using a color camera was then used to identify the grating nanostructures that lead to an optimal signal. Lipid composition and multilayer thickness were found to be critical parameters for the signal transduction from the aptamer functionalized lipid multilayer gratings.

Style APA, Harvard, Vancouver, ISO itp.

47

Nishimura, Jun-ichi, Angela D. Burnette, Sabah Oney, Milena Batchvarova, Martha Delahunty, Rahima Zennadi, Bruce A. Sullenger i Marilyn J. Telen. "Blocking Adhesion of Sickle Erythrocytes to Endothelial P-Selectin Using an RNA Aptamer." Blood 110, nr 11 (16.11.2007): 147. http://dx.doi.org/10.1182/blood.v110.11.147.147.

Pełny tekst źródła

Streszczenie:

Abstract Vaso-occlusive crises are a major clinical feature of sickle cell disease (SCD), and the adhesion of sickle erythrocytes (SS-RBCs) to vascular endothelium is crucial to the generation of vaso-occlusion. SS-RBCs express many adhesion molecules. Adhesive SS-RBCs bind to endothelial cell P-selectin and other adhesion molecules, as well as extracellular matrix proteins. Thrombin causes endothelial retraction with exposure of proadhesive extracellular matrix components as well as upregulation of endothelial expression of P-selectin. Other investigators have shown that SS-RBCs can bind to P-selectin, thus suggesting that P-selectin is a suitable target against which to develop reagents to prevent or treat vaso-occlusive crises in SCD. Aptamers are oligonucleotides that bind to molecular targets in a manner conceptually similar to antibodies and have been identified against a wide range of therapeutic targets. RNA aptamers that bind to human P-selectin, inhibit P-selectin binding to its ligand sialyl Lewis X, and inhibit neutrophil-platelet adhesion have previously been identified (Antisense Nucleic Acid Drug Dev,8:265,1998). We have now tested one of these high-affinity P-selectin aptamers (clone PF377: ACGCUCAACGAGCCAGGAACAUCGACGUCAGCAAACGCGAGCGCAACCAGUAACACC) for its ability to prevent cellular adhesion of SS-RBCs to endothelial cells. Aptamer clone PF377 bound P-selectin with a Kd of 6nM and a Bmax of 87%. To measure its anti-adhesion activity, an in vitro flow chamber assay was adopted. The anti-adhesion activity of aptamer clone PF377 was confirmed using primary human umbilical vein endothelial cells (HUVECs) treated with IL-13 (50ng/mL) for 48hrs, followed by stimulation with histamine (25μM for 12mins at RT) immediately prior to a flow chamber assay. Aptamer clone PF377 at 60nM had anti-adhesion activity similar to heparin (a previously identified inhibitor of SS-RBC adhesion to P-selectin) and 9E1 (an inhibitory antibody to P-selectin), whereas Bi 9.3t (a non-functional aptamer to thrombin, used as a negative control, 60nM) and AC1.2 (a non-inhibitory antibody to P-selectin), did not prevent adhesion (Figure). Normalized % inhibition by aptamer clone (PF377) at 60nM at 1 dynes/cm2 was 99% (Figure). In conclusion, we observed significant anti-adhesion activity of P-selectin aptamer clone PF377, and this aptamer is now suitable for modification to enhance stability and bioavailability. Since we previously reported strong anti-adhesion activity of integrin αvβ3 aptamer clone 17.16 (Blood,108:206a,2006), in vivo experiments in mice are currently employing intravital microscopy to measure anti-adhesion activity of aptamer clone 17.16, PF377, and both in combination. The development of combinatorial blocking aptamers against various adhesion molecules, including αvβ3 and P-selectin, represents a novel potential therapeutic option for patients with SCD. Figure Figure

Style APA, Harvard, Vancouver, ISO itp.

48

Avino, Anna, Carme Fabrega, Maria Tintore i Ramon Eritja. "Thrombin Binding Aptamer, More than a Simple Aptamer: Chemically Modified Derivatives and Biomedical Applications". Current Pharmaceutical Design 18, nr 14 (1.03.2012): 2036–47. http://dx.doi.org/10.2174/138161212799958387.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

49

Pica, Andrea, Irene Russo Krauss, Antonello Merlino, Satoru Nagatoishi, Naoki Sugimoto i Filomena Sica. "Dissecting the contribution of thrombin exosite I in the recognition of thrombin binding aptamer". FEBS Journal 280, nr 24 (1.11.2013): 6581–88. http://dx.doi.org/10.1111/febs.12561.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

50

Kovačič, Matic, Peter Podbevšek, Hisae Tateishi-Karimata, Shuntaro Takahashi, Naoki Sugimoto i Janez Plavec. "Thrombin binding aptamer G-quadruplex stabilized by pyrene-modified nucleotides". Nucleic Acids Research 48, nr 7 (25.02.2020): 3975–86. http://dx.doi.org/10.1093/nar/gkaa118.

Pełny tekst źródła

Streszczenie:

Abstract Guanine-rich regions of the human genome can adopt non-canonical secondary structures. Their role in regulating gene expression has turned them into promising targets for therapeutic intervention. Ligands based on polyaromatic moieties are especially suitable for targeting G-quadruplexes utilizing their size complementarity to interact with the large exposed surface area of four guanine bases. A predictable way of (de)stabilizing specific G-quadruplex structures through efficient base stacking of polyaromatic functional groups could become a valuable tool in our therapeutic arsenal. We have investigated the effect of pyrene-modified uridine nucleotides incorporated at several positions of the thrombin binding aptamer (TBA) as a model system. Characterization using spectroscopic and biophysical methods provided important insights into modes of interaction between pyrene groups and the G-quadruplex core as well as (de)stabilization by enthalpic and entropic contributions. NMR data demonstrated that incorporation of pyrene group into G-rich oligonucleotide such as TBA may result in significant changes in 3D structure such as formation of novel dimeric topology. Site specific structural changes induced by stacking of the pyrene moiety on nearby nucleobases corelate with distinct thrombin binding affinities and increased resistance against nuclease degradation.

Style APA, Harvard, Vancouver, ISO itp.

Artykuły w czasopismach na temat „Thrombin binding aptamer”

Utwórz poprawne odniesienie w stylach APA, MLA, Chicago, Harvard i wielu innych