Rozprawy doktorskie na temat „Mud crab”

Commercial farming of mud crab Scylla serrata is a significant industry throughout South East Asia. The limited scientific knowledge of mud crab nutritional requirements and digestive processes, however, is recognised as a major constraint to the future growth of this industry. To better understand the mechanisms of digestion in the mud crab we have analysed the diversity of digestive enzymes from the hepatopancreas. Significant protease, amylase,cellulase and xylanase activities were detected in soluble extracts from this organ. Temperature profiles for all enzymes were basically similar with optimal activities observed at 500C. Examination of pH tolerance revealed optimal activities for protease and amylase at pH 7.0 while optimal activities for cellulase and xylanase were observed at pH 5.5. Under optimum conditions,protease and amylase activities were approximately two orders of magnitude greater than those seen for either cellulase or xylanase. Interestingly, hepatopancreatic extracts were able to liberate glucose from either starch or carboxymethyl (CM)-cellulose suggesting that a range of carbohydrates may be utilised as energy sources. The effects of dietary carbohydrates on feed digestibility, digestive enzyme levels and growth were also studied by inclusion of additional starch or CM-cellulose at the expense of casein in formulated diets. It was shown that amylase, cellulase and xylanase activities in extracts from the hepatopancreas were highest in mud crabs fed diets containing 47% carbohydrate. Based on the findings, we suggest that the ability of the mud crab to modulate digestive enzyme activities may represent a mechanism to maximise access to essential nutrients when the dietary profile changes.

Commercial farming of mud crab Scylla serrata is a significant industry throughout South East Asia. The limited scientific knowledge of mud crab nutritional requirements and digestive processes, however, is recognised as a major constraint to the future growth of this industry. To better understand the mechanisms of digestion in the mud crab we have analysed the diversity of digestive enzymes from the hepatopancreas. Significant protease, amylase,cellulase and xylanase activities were detected in soluble extracts from this organ. Temperature profiles for all enzymes were basically similar with optimal activities observed at 500C. Examination of pH tolerance revealed optimal activities for protease and amylase at pH 7.0 while optimal activities for cellulase and xylanase were observed at pH 5.5. Under optimum conditions,protease and amylase activities were approximately two orders of magnitude greater than those seen for either cellulase or xylanase. Interestingly, hepatopancreatic extracts were able to liberate glucose from either starch or carboxymethyl (CM)-cellulose suggesting that a range of carbohydrates may be utilised as energy sources. The effects of dietary carbohydrates on feed digestibility, digestive enzyme levels and growth were also studied by inclusion of additional starch or CM-cellulose at the expense of casein in formulated diets. It was shown that amylase, cellulase and xylanase activities in extracts from the hepatopancreas were highest in mud crabs fed diets containing 47% carbohydrate. Based on the findings, we suggest that the ability of the mud crab to modulate digestive enzyme activities may represent a mechanism to maximise access to essential nutrients when the dietary profile changes.

Mud crab Scylla serrata is a crustacean that spends most of its life cycle in the mangrove environment throughout its range. Fishery and aquaculture of this crab are significant economic activities in coastal areas in the tropics and sub-tropics because of the meat quality and nutritional value. However there is a significant shortage of information on the ecology, fishery and aquaculture of these crabs in sub-Saharan Africa. This impacts the development of a sustainable aquaculture and fishery for the benefit of coastal communities. The present study analyses various aspects of mud crab ecology, fishery, aquaculture and social economics in East Africa using multidisciplinary approaches. The results are given in seven papers based on field and laboratory studies. The study established for the first time that high intertidal mangrove back-flats constitute a key habitat for the earliest instars of S. serrata (4 -30 mm CW). It also showed that diurnal tidal migration behaviour occurs in small juveniles that migrate to sub-tidal habitats during the day, possibly due to variable predation risks. Monthly sampling of juveniles in Kenya and Tanzania indicated continuous recruitment throughout the year. The large numbers of juvenile crabs along mangrove fringes indicate that these habitats could serve as sites suitable for collection of juvenile crabs for aquaculture. However, these areas must also be managed and protected to support the recruitment to the wild crab populations. An assessment of the crab fishery indicated that artisanal crab fishers possess significant traditional knowledge mainly inherited from their parents that enabled them to exploit the resource. Such knowledge could be useful for the development of the aquaculture and in management of the fishery. Mud crab fishing was found to be a male dominated activity, and fishers on foot practiced fishing in burrows at spring low tides. Interviews indicated that the average size of marketable crabs has declined over the years and a weak management system was observed with most fishers operating without a license. Due to the knowledge required regarding the local conditions, fishers are unable to shift to new areas. Furthermore fishers and could not fish at neap tides. Such limitations provide a “natural closure” of the fishery. Also foot fishers cover fairly limited distances in their daily operations, an aspect that can be utilized to effect site-specific management for the fishery if necessary. Laboratory and field experiments indicated that cannibalistic interactions are heavily influenced both by size differences of crabs and the availability of shelter but no significant effect was found for different stocking densities. Such information is of direct importance for crab farmers in East Africa, where seed from the wild are of multiple sizes and there is a need to grade juvenile crabs and provide shelter at stocking to ensure maximum survival. Experimental studies in earthen pond and mangrove pen cultures indicated high mortality rates. Comparing growth in earthen pond and mangrove pen systems indicated that growth rates were generally high in both systems, but significantly lower in pen systems without shelter, suggesting that shelter may have a stronger effect on growth than has been previously thought. Similar to artisanal mud crab fishery, an assessment of small-scale mud crab farming by organized community groups in Kenya indicated low level of women participation. A good knowledge of the market existed among the mud crab farming groups where hotels and exporters offered the highest prices. However there is a need for national policies to be directed to support small-scale aquaculture development by ensuring training and capacity building for women, operation and management of groups, data management and provision of user rights for communities working in the mangrove environment. Market analyses showed that the common market size of crabs in East Africa ranged between 500-1000 g and are thus larger than in Southeast Asia where the average size is reported at 300 g. Prices for mud crabs were over 50 % lower in Tanzania than in other East African countries and most of the profit was earned by middlemen and exporters. Cost revenue analysis showed that it would be more profitable to farm smaller commercial crabs, and develop a market for 300 g crabs to increase the profitability of crab farming in East Africa. Also, the same analyses found that farming large crabs in individual cages, which is the dominant culture form in East Africa today, had very low profitability due to high labor costs and low growth rates. Using a step-wise function of natural growth it was shown that growth rates of S. serrata cultured in cages was 40 % of the growth rates obtained in experimental pond and pen cultures, which were similar to natural growth. Therefore the good performance of grow-out cultures of juvenile mud crabs in earthen ponds and mangrove pens showed a potential to develop into a profitable and sustainable intervention. However, more work is needed to improve survival in culture systems and address the identified limitations of crab seeds and feed to enable development of sustainable mud crab aquaculture in East Africa.

It is often hypothesised that marine species with mobile planktonic phases are capable of widespread dispersal and may therefore be genetically homogenous throughout their distribution. Studies that have demonstrated positive correlation between duration of plankton phase and levels of gene flow reinforce the prediction that life history characteristics of marine species determine the potential extent of genetic and demographic connectivity throughout their distributions. This prediction has however been challenged by studies that have employed genetic markers highly sensitive to both historical and contemporary demographic changes. Disparities between dispersal potential and measured levels of gene flow have been demonstrated both among historically disconnected ocean basins and within semi-enclosed areas of strong hydraulic connectivity. These studies and others highlight a need for greater focus on factors that may influence population structure and distribution for marine species. In this thesis, I have examined genetic structure within and among populations of an estuarine species of mud crab Scylla serrata (Forskal, 1775) using a number of genetic markers and methods. The species is widely distributed throughout mangrove and estuarine habitats of the Indo - West Pacific (IWP); it is generally assumed that life-history characteristics of S. serrata promote high levels of population admixture and gene flow throughout its distribution. Alternatively, factors that have promoted population genetic structure for a variety of IWP marine species may also have affected S. serrata populations. By investigating genetic structure at several spatial scales of sampling, I was able to address a variety of hypotheses concerning the species distribution, dispersal, and genetic structure. Episodic changes to marine habitat and conditions experienced within the IWP during the Pleistocene may have affected genetic structure for a broad variety of marine taxa. The relative strength of this hypothesis may be assayed by comparative genetic studies of widespread IWP taxa with high dispersal capacity. In order to ascertain levels of historical and contemporary gene flow for S. serrata, I investigated the phylogeographic distribution of mitochondrial DNA haplotypes sampled throughout the species range. Adults were sampled from three west Indian ocean locations (N=21), six west Pacific sites (N=68), and two sites from northern eastern Australia (N=35). Temperature gradient gel electrophoresis and sequencing of 549 base pairs of the mitochondrial cytochrome oxidase I (COI) coding gene identified 18 distinct haplotypes. Apart from that seen in northern Australia, haplotype diversity was low (h < 0.36) at each of the locations. Total nucleotide diversity in the entire sample (excluding northern Australian locations) was also low (p = 0.09). Haplotypes clustered into two clades separated by approximately 2% sequence divergence. One clade was widespread throughout the IWP (clade 1) whereas the other was strictly confined to northern Australia (clade 2). Genealogical assessment of sequenced haplotypes relative to their distributions suggested that a historical radiation of clade 1 S. serrata throughout the IWP occurred rapidly and recently (<1Myr bp) from a west Pacific origin. The evidence of fixed unique haplotypes at the majority of locations suggested that contemporary maternal gene flow between trans-oceanic sites was limited. Contrary to reports for other widespread species of IWP taxa, there was no evidence of lengthy periods of regional separation between Indian from Pacific Ocean populations. However, results may indicate a separation of northern Australian crabs from other locations before and during the IWP radiation. I speculated that this isolation might have resulted in the formation of a new species of Scylla. Additional sampling of mud crabs from the Australian coastline allowed an examination of the diversity and distribution of clade 1 and 2 haplotypes among recently formed shelf-connected coastal locations, and across a historical bio-geographic barrier. Over 300 individuals were sampled from multiple locations within coastal regions (western, northern and eastern) of Australia and analysed for mutational differences at the COI gene. Analysis of molecular variance partitioned by sampling scale (Among regions, within regions, and within all locations) indicated mitochondrial haplotypes were structured regionally (P < 0.001), which contrasted with evidence of genetic panmixia within regions. Regional genetic structure broadly correlated with hydrological circulation, supporting the contention that release and transport of propagules away from the estuary may allow genetic connectivity among widespread shelf-connected S. serrata populations. That similar patterns of maternal gene flow were absent among trans-oceanic populations may indicate that the spatial scale of effective dispersal for this species is generally limited to areas of coastal shelf. The two clades of haplotypes were geographically separated either side of the Torres Strait, a narrow sea channel connecting the northern and eastern regions of coastal Australia. This pattern of historical genetic separation was concordant with a number of other marine species across northern Australia, and might indicate a shared history of vicariance induced by eustasy. Alternatively, differences in diversity and distribution of the clades may be evidence of two independent expansions of clade 1 and 2 crab populations into Australian regions following post-glacial estuary formation. Overall, despite evidence of genetic panmixia within extensive sections of the Australian distribution, there was also evidence of significant barriers to maternal gene flow with both shallow and deep regional phylogeographic assortment of mtDNA haplotypes. The presence of these barriers indicated both historical and contemporary factors have imposed limits to effective dispersal by this species among coastal habitats. A subset of the Australian sample (8 locations, N = 188) was also examined for variation at five microsatellite loci developed specifically here for S. serrata. I examined variation among samples at each of the loci to: a) independently verify regional structure among crab populations previously detected using the mtDNA analysis; b) test for evidence of co-distributed non-interbreeding stocks of S. serrata within Australian waters by examining samples for segregation of alleles within microsatellite loci concordant with the two mtDNA clades. The frequency and distribution of alleles for each of the highly polymorphic microsatellites were homogenous at all levels of sample partitioning and contrasted sharply with the instances of both weak and strong regional phylogeographic assortment of mtDNA haplotypes. These contrasting results between different genomic markers were examined in relation to the species life history, and to differences in mutational rate and inheritance of the genetic markers. Several hypotheses may explain the disparity, however it is most likely that rampant homoplasy and high rates of mutation at the microsatellite in conjunction with large Ne at locations may be concerted to delay equilibrium between genetic drift and migration among populations at these highly polymorphic nuclear markers. There was also no evidence that alleles at microsatellite loci were co-segregated with mtDNA clades and therefore no evidence of segregated breeding between the clades of crabs. Whether or not this result was also driven by homoplasy at the microsatellites remains unknown. Recently established mud crab populations (~ 3-4 years old) observed in a number of southwest Australian estuaries are almost 1000 kilometres south of their previously recorded distribution on the Western Australian coast. Colonisation of the southwest region may have occurred either by a natural range expansion from northwest Australian mud crab populations or by means of translocation from any number of mud crab sources within the Indo - West Pacific. I used mtDNA analysis to verify the species and determine the potential source population(s) of the colonists, by comparing sampled genetic material from the southwest (N = 32) against that previously described for the genus. I also compared levels of diversity at mtDNA and two microsatellite loci between the colonist and suspected source population(s) to qualitatively determine if the southwest populations experienced reductions in genetic diversity as a result of the colonisation process. All colonist samples had S. serrata mtDNA COI sequences identical to one previously described as both prevalent and endemic to northwest Australia. High levels of genetic diversity among source and colonist populations at two microsatellite loci contrasted to the mitochondrial locus which displayed an absence of variation among colonists compared to moderately diverse source populations. I argued that the southwest was recently colonised by large numbers of S. serrata propagules derived from the northwest of Australia, possibly due to an enhanced recruitment event coinciding with the reported strengthening of the Leeuwin Current during 1999. Contrasting levels of diversity among nuclear and mitochondrial loci may be attributed to a difference in response by the two genomes to the colonisation process. I predict that such differences may be generally prevalent among plankton-dispersed species. Finally, I discuss aspects of the species distribution and biogeography obtained as a composite of the various results and ideas expressed in this thesis. I propose that S. serrata populations in the IWP may have experienced several cycles of extinction and population retraction from temperate areas followed by subsequent periods of colonisation and rapid coastal expansion in response to the effects of glacial episodes on coastal habitats in the IWP. I propose that persistence of this species as remnant populations of clade 1 and 2 crabs at equatorial locations during low sea level stands provided source populations for later expansions by the species into a variety of coastal areas throughout the IWP. Further analysis is required to determine if mtDNA clade 1 and 2 crabs are non-interbreeding species of mud crab.

The mud crab (Scylla spp.) aquaculture industry has expanded rapidly in recent years in many countries in the Indo - West Pacific (IWP) region as an alternative to marine shrimp culture because of significant disease outbreaks and associated failures of many shrimp culture industries in the region. Currently, practices used to produce and manage breeding crabs in hatcheries may compromise levels of genetic diversity, ultimately compromising growth rates, disease resistance and stock productivity. Therefore, to avoid “genetic pollution” and its harmful effects and to promote further development of mud crab aquaculture and fisheries in a sustainable way, a greater understanding of the genetic attributes of wild and cultured mud crab stocks is required. Application of these results can provide benefits for managing wild and cultured Asian mud crab populations for multiple purposes including for commercial production, recreation and conservation and to increase profitability and sustainability of newly emerging crab culture industries. Phylogeographic patterns and the genetic structure of Asian mud crab populations across the IWP were assessed to determine if they were concordant with those of other widespread taxa possessing pelagic larvae of relatively long duration. A 597 bp fragment of the mitochondrial DNA COI gene was amplified and screened for variation in a total of 297 individuals of S. paramamosain from six sampling sites across the species’ natural geographical distribution in the IWP and 36 unique haplotypes were identified. Haplotype diversities per site ranged from 0.516 to 0.879. Nucleotide diversity estimates among haplotypes were 0.11% – 0.48%. Maximum divergence observed among S. paramamosain samples was 1.533% and samples formed essentially a single monophyletic group as no obvious clades were related to geographical location of sites. A weak positive relationship was observed however, between genetic distance and geographical distance among sites. Microsatellite markers were then used to assess contemporary gene flow and population structure in Asian mud crab populations sampled across their natural distribution in the IWP. Eight microsatellite loci were screened in sampled S. paramamosain populations and all showed high allelic diversity at all loci in sampled populations. In total, 344 individuals were analysed, and 304 microsatellite alleles were found across the 8 loci. The mean number of alleles per locus at each site ranged from 20.75 to 28.25. Mean allelic richness per site varied from 17.2 to 18.9. All sites showed high levels of heterozygosity as average expected heterozygosities for all loci ranged from 0.917 – 0.953 while mean observed heterozygosity ranged from 0.916 – 0.959. Allele diversities were similar at all sites and across all loci. The results did not show any evidence for major differences in allele frequencies among sites and patterns of allele frequencies were very similar in all populations across all loci. Estimates of population differentiation (FST) were relatively low and most probably largely reflect intra – individual variation for very highly variable loci. Results from nDNA analysis showed evidence for only very limited population genetic structure among sampled S. paramamosain, and a positive and significant association for genetic and geographical distance among sample sites. Microsatellite markers were then employed to determine if adequate levels of genetic diversity has been captured in crab hatcheries for the breeding cycle. The results showed that all microsatellite loci were polymorphic in hatchery samples. Culture populations were in general, highly genetically depauperate, compared with comparable wild populations, with only 3 to 8 alleles recorded for the same loci set per population. In contrast, very high numbers of alleles per locus were found in reference wild S. paramamosain populations, which ranged from 18 to 46 alleles per locus per population. In general, this translates into a 3 to 10 fold decline in mean allelic richness per locus in all culture stocks compared with wild reference counterparts. Furthermore, most loci in all cultured S. paramamosain samples showed departures from HWE equilibrium. Allele frequencies were very different in culture samples from that present in comparable wild reference samples and this in particular, was reflected in a large decline in allele diversity per locus. The pattern observed was best explained by significant impacts of breeding practices employed in hatcheries rather than natural differentiation among wild populations used as the source of brood stock. Recognition of current problems and management strategies for the species both for the medium and long-term development of the new culture industry are discussed. The priority research to be undertaken over the medium term for S. paramamosain should be to close the life cycle fully to allow individuals to be bred on demand and their offspring equalised to control broodstock reproductive contributions. Establishing a broodstock register and pedigree mating system will be required before any selection program is implemented. This will ensure that sufficient genetic variation will be available to allow genetic gains to be sustainably achieved in a future stock improvement program. A fundamental starting point to improve hatchery practices will be to encourage farmers and hatchery managers to spawn more females in their hatcheries as it will increase background genetic diversity in culture stocks. Combining crablet cohorts from multiple hatcheries into a single cohort for supply to farmers or rotation of breeding females regularly in hatcheries will help to address immediate genetic diversity problems in culture stocks. Application of these results can provide benefits for managing wild and cultured Asian mud crab populations more efficiently. Over the long-term, application of data on genetic diversity in wild and cultured stocks of Asian mud crab will contribute to development of sustainable and productive culture industries in Vietnam and other countries in the IWP and can contribute towards conservation of wild genetic resources.

En Nouvelle-Calédonie il y a une forte volonté politique pour diversifier l'aquaculture qui repose encore aujourd'hui sur la crevetticulture. Dans ce contexte le crabe de palétuvier est considéré comme une espèce à fort potentiel. Un des principaux verrous au développement de la carcinoculture en Nouvelle-Calédonie est la disponibilité d'un aliment granulé commercial. Ainsi le principal objectif de cette thèse est d'améliorer notre connaissance des besoins nutritionnels du crabe de palétuvier afin d'être en mesure de formuler un aliment équilibré pour son élevage. Cependant avant d'aborder les études nutritionnelles nous avons vérifié le nombre d'espèces de crabes de palétuvier présentes en Nouvelle-Calédonie.Nos résultats d'études morphologiques et génétiques de 63 individus provenant de 9 sites des côtes Ouest et Nord-Est de la Nouvelle-Calédonie ont confirmé l'existence d'une unique espèce commercialisée: Scylla serrata. C'est donc sur cette espèce que nous avons travaillé en nutrition avec deux séries expérimentales ayant pour objectifs: i) d'évaluer le concentré protéique de soja (CPS) en comparaison avec la farine de poisson comme principale source en protéines et ii) de déterminer le taux optimum d'incorporation du CPS pour la mue et la croissance tissulaire des animaux. Nous avons ainsi observé deux phases de croissance tissulaire au cours d'un cycle de mue (CM): une phase rapide (CTR) qui démarre après la mue et dure jusqu'au début de l'intermue (elle représente 30% du CM) suivi d'une phase de croissance lente (CTL) sur toute la durée de l'intermue et jusqu'à la mue suivante (elle représente 70% du CM). L'accumulation des protéines et des lipides au cours du CM a suivi le même profil de croissance tissulaire contrairement aux cendres qui ont augmenté de façon rapide durant 5 jours suivant l'ecdysis pour atteindre un plateau jusqu'à la prochaine mue. Les deux phases de croissance étaient corrélées avec une prise de l'aliment par les animaux maximale pendant les deux premières semaines suivant la mue. Elle a diminué de moitié sur les 5 semaines suivantes et s'est maintenue ensuite à un niveau de base jusqu'à la prochaine mue. L'énergie ingérée était allouée principalement à la croissance et à l'entretient respectivement durant les périodes CTR et CTL. Durant la phase de croissance lente, 28% de l'énergie ingérée étaient mise en réserve en prévision de la prochaine mue. Le remplacement de la farine de poisson par la CPS n'a pas modifié la croissance tissulaire,l'efficience de l'aliment et le bilan énergétique des animaux quelque soit la phase de croissance considérée. Le taux d'incorporation dans l'aliment de 42% de CPS a permis la meilleure croissance (fréquence de mue et croissance tissulaire, efficience de l'aliment et la rétention de l'énergie des protéines et des lipides. L'hypothèse d'une toxicité de l'ammonium issu de la dégradation des protéines en excès ou des facteurs antinutritionnels du soja est avancée pour expliquer les effets négatifs observés avec les aliments renfermant des taux d'incorporation élevés en CPS. En conclusion, nos travaux apportent des informations originales sur la croissance tissulaire et les dépenses énergétiques durant un cycle de mue et la capacité du crabe juvénile d'utiliser le CPS comme principale source de protéines. Sur ces bases nous somme en mesure de préconiser des contraintes nutritionnelles permettant de formuler un aliment équilibré sans farine de poissons pour l'élevage du crabe de palétuvier S.serrata
In New Caledonia, there is the strong political will to diversify aquaculture which is mainly based on shrimp farming. In this context, mud crabs have been considered as a potential species for aquaculture development. One of the main constraints to develop crab farming is the availability of formulated feed. Thus, the main purpose of this thesis is to get information on the crab nutritional requirements in order to formulate a balanced diet. However, we had to clarify first how many species of mud crab were present in New-Caledonia. The result of our morphological and genetic investigations carried out on 63 specimens from 9 areas of the west and northeast coast of New-Caledonia confirmed that only one species, Scylla serrata, is commercialized in this country. Consequently, S. serrata was used in our nutritional study based on two experiments to: i) evaluate the soy protein concentrate (SPC) compared with the fishmeal as the main protein source and ii) determine the optimum level of SPC in the diet for molting and tissue growth. We observed two tissue growth phases within one molt cycle (MC): a fast tissue growth (FTG) occurred after ecdysis until early intermolt stage (30% of MC) which is followed by a slow tissue growth (STG) period from intermolt to ecdysis (70% of MC). Protein and lipid deposition followed the same trend than tissue growth while ash level increased quickly during five days after molt and then remained stable until the next molt. The two growth phases were correlated with the voluntary feed intakes (VFI) which was maximum during 2 weeks after ecdysis and then decreased by 50% over the five following weeks to reach a baseline until the next molt. Intake energy was allocated mainly for growth during FTG period and for maintenance during STG period. During STG, 28% of the ingested energy was accumulated for the next ecdysis. Replacement of fishmeal by SPC as main protein source did not affect tissue growth, efficiency of feed utilization and energy budget of crabs whatever the tissue growth period considered. The dietary SPC inclusion of 42% in the diet promoted growth (molt frequency and tissue growth), feed efficiency and retention of energy, protein and lipid. Hypothesis related to ammonia toxicity from catabolism of proteins in excess or anti-nutritional factors from soybean could explain the negative effects of higher inclusion of SPC in the diet for juvenile crabs. In conclusion, our work brings novel information on tissue growth, energy budget during a molt cycle and the ability of juvenile crab to use SPC as a main source of protein. On this basis we suggest to formulate nutritionally balanced diet without fishmeal to farm juvenile mud crabs S. serrata

This study investigates how to enhance sustainable livelihood of mud-crab fishers of Bangladesh in the premise of the existing cumbersome and manipulative value chain that threatens fishers’ livelihood. Guided by the social business model, the study proposes a revised cooperative-based crab value chain; and unveils that individual and channel factors influence the benefits and barriers of the proposed cooperative. This eventually influences fishers’ attitude and intention towards cooperative and thus helps achieve their sustainable livelihood.

The study aimed to improve megalopa and crablets production of mud crab, Scylla paramamosain, through dietary supplementation of probiotics and locally available diets under various rearing systems. The results concluded that the probiotic-enriched live food fed until the late zoeal stage in a green water culture system increased the megalopa production. Megalopa fed live Acetes resulted in increased survival. However, the production of crablets and not megalopa, was compromised when green water culture was employed.

Eradication of invasive species is an eminent concept in conservation biology. After prevention is no longer an option, many ecologists argue that eradication is the most effective way to mitigate the risk of impacts from invasive species, given the elevated costs and often prolonged environmental effects of long-term control strategies. In the majority of systems, eradication is most likely to succeed early in the invasion process, when an invader is localized. However, rarely is early eradication considered in practice. This paradox may result from the many uncertainties regarding the future spread and impacts of novel invaders and managers lacking practical guidance to make logical decisions to manage them. In this thesis, I use a case study of an introduced mud crab, Rhithropanopeus harrisii, to propose guidelines for rapidly assessing and communicating the feasibility and the benefits of early eradication. First, I document the recent discovery of an established population of R. harrisii in the Panama Canal, highlighting how maritime traffic in this hub of international shipping may further increase the spread of this invader worldwide. Second, I evaluate the distribution, abundance, and demographics of R. harrisii across the Panama Canal with a standardized quantitative survey; I also assess the crab's potential for spread beyond its distribution in the Canal with two laboratory experiments. Third, I develop an analytical framework for evaluating the feasibility of a rapid response to eradicate R. harrisii and for communicating the potential benefits of this management strategy to decision-makers. My results indicate that R. harrisii currently occupies a limited
L'éradication d'espèces introduites invasives est un concept populaire dans le domaine de la biologie de la conservation. Lorsque la prévention d'une invasion échoue, de nombreux écologistes soutiennent que l'éradication est la méthode la plus efficace afin d'éviter que les espèces introduites ne causent de dommages, considérant les coûts élevés et les effets parfois prolongés du contrôle à long-terme. Notamment, dans la majorité des systèmes, le succès d'un programme d'éradication est supérieur s'il est entrepris tôt lors du processus d'envahissement, lorsqu'une espèce est peu dispersée. Cependant, cette stratégie qui consiste à éradiquer les espèces introduites de façon hâtive est rarement mise en pratique. Ce paradoxe peut résulter d'un haut niveau d'incertitude concernant le potentiel qu'ont les espèces nouvellement introduites à se propager et à causer des impacts, et par le fait que les administrateurs responsables de leur gestion manquent souvent de conseils pratiques afin de réagir promptement suite à leur découverte. Pour remédier à cette lacune, cette thèse se base sur une importante étude de cas et suggère un modèle théorique servant à analyser de façon rapide la possibilité d'implémenter un programme d'éradication hâtif et d'en évaluer les bénéfices. Premièrement, je documente la découverte récente du crabe Rhithropanopeus harrisii dans le Canal de Panama. Le Canal de Panama est une plaque tournante du trafic maritime international et pourrait jouer un rôle important dans l'accroissement de la propagation de R. harrisii au niveau mondial. Deuxièmement, au moyen d'un échantillonnage quantitatif stand

The source of a reliable supply of seed is one of the most important factors determining the success of aquaculture. At present mud crab culture is reliant on wild caught juveniles, which limits the expansion of mud crab farming globally. This, coupled with the paucity of knowledge of the spawning and egg characteristics of mud crabs, prompted the investigation into the captive spawning, incubation and egg quality of Scylla serrata in South Africa. A total of 112 mature females were caught from three estuaries in northern KwaZulu Natal and acclimated to captive conditions. Mature females were present in the estuaries throughout the year and ranged from 90 to 200 mm carapace width. Except for 40 crabs all the females spawned in captivity. On average spawning took place 38 ± 23 days after capture but was not dependent on crab size. Fecundity was significantly correlated to crab size (p = 0.026), with larger females producing more eggs. The average fecundity per batch was 5.79 ± 2.07 million eggs. Hatch success rate for all egg batches was high averaging 84 ± 6 %. Egg dropping occurred in all egg batches during incubation. On average 6.5 % of the egg mass was dropped during incubation. At the average temperature of 27⁰C eggs in the incubation system hatched within 292 ± 12 hours after extrusion. In-vitro incubation of eggs proved to be an ineffective means of incubating Scylla serrata eggs with a hatch success rate of only 25 ± 5 %. Egg quality was assessed both directly, using variables such as hatch success rate and hatch synchronicity and retrospectively by using stress tests and comparing survival of larvae from different coloured egg batches. Lipid class composition and fatty acid methyl ester content for 28 batches of eggs and 16 batches of larvae were analyzed. The biochemical composition of the egg was correlated to survival of larvae in the stress tests to ascertain if the lipid content of the eggs determines their quality. Stress tests were used to retrospectively assess egg quality. Four stressors were administered to newly hatched larvae and the LD50 values recorded. An average LD50 of 64 hours was recorded for the starvation tests, 40% for the salinity tests, 37 ppm for the formalin tests and 39.7 mg/l NH3 for the ammonia stress tests was recorded. Egg colour ranged from pale yellow to orange-red. Egg colour was not influenced by female size or the time the females spent in captivity prior to spawning. Egg colour can therefore not be used as an indicator of quality. The lipid profiles of newly extruded eggs had no effect on hatch synchronicity or hatch success rate. However, the stress tests identified female size (p ≤ 0.02), DHA content of the egg (p ≤ 0.02), Σ omega-3 fatty acids of eggs (p ≤ 0.02) and EPA content of eggs (p ≤ 0.007) as possible determinants of egg quality. Larger crabs tended to produce poorer quality eggs. Egg quality also decreased as the amount of DHA, EPA and the Σ omega-3 fatty acids decreased in the eggs. To summarize, the results of this study indicated that the following parameters affect egg quality - crab size, DHA, EPA and Σ omega-3 fatty acid content of eggs.

Mud crabs of the genus Scylla are widely exploited for aquaculture in the Asia- Pacific region. In the current study, a series of in vivo experiments were carried to assess the protein requirement, protein sparing effects of starch and the capacity of Scylla serrata to digest diets that contained different animal and plant-based feed meals and different levels and types of starch. Results from a protein requirement study indicated that juvenile S. serrata fed diets containing 45% or 55% protein demonstrated significantly higher growth responses than those fed the diet containing 25% protein. The subsequent study was carried out to determine if responses to dietary protein could be influenced by using purified wheat, potato, rice or corn starch to manipulate the gross energy level of fishmeal- based diets (18 or 15.5 MJ kg-1), i.e., to see if starch had a protein sparing effect in these animals. Overall, growth responses in this study appeared to be positively correlated with the level of protein in the diet with the highest growth rates achieved using diets containing 45% protein, regardless of the energy level of the diet. In addition, at a dietary protein level of 40% there was no evidence that the source of starch had any significant impact on growth performance or feed utilisation suggesting it had no protein sparing effect. By contrast, it was found that growth of juvenile S. serrata was strongly correlated with the intake of digestible dietary protein. The investigation of the capacity of sub-adult S. serrata to digest different animal and plant- based feed meals showed that apparent dry matter digestibility (ADMD) and apparent gross energy digestibility (AGED) values were not significant different for most selected feed meals (cotton seed, poultry, canola, fishmeal, soybean, and lupin meal). Apparent crude protein digestibility (ACPD) for all test feed meals were relatively high (86-96%). A subsequent study was carried out to determine if purified starch from different sources influenced the digestibility of fishmeal based diets. Overall, most diets containing starch were readily digested by mud crabs. In particular, there were no negative impacts on the digestibility of major nutrients (e.g. protein) observed following the inclusion of wheat, rice or corn starch in formulated feeds. Nevertheless, the apparent starch digestibility (ASD) of wheat starch decreased significantly as the inclusion level was increased from 15% to 60%, although there was no significant effect on ACPD values. At a 30% inclusion level, the ASD of diets containing different starches decreased in the order corn > wheat > potato = rice. Moreover, ACPD values were significantly higher for diets containing corn or rice starch than for those containing wheat or potato starch. The capacity of another species of mud crab commonly exploited for aquaculture in South East Asia, S. paramamosain, to digest the local plant-based ingredients (defatted soybean meal, rice bran, cassava and corn flour) was also conducted in Vietnam. Overall, the findings of this study showed that at a 30% inclusion level diets containing soybean meal or rice bran were well digested by mud crabs. In particular, the ACPD and AGED values for all diets containing soybean meal were not significantly different from the fishmeal based reference diet. Likewise, all digestibility values for the diet containing 30% rice bran were relatively high and not significantly different from the reference diet. By contrast, diets containing cassava flour appeared to be poorly utilised since their digestibility values for all parameters were lower than those from other testingredients. In summary, the apparent digestibility of dry matter, protein and energy was in the following order (from most to least digestible) soybean meal ~ rice bran > corn flour > cassava flour. In the next study the effects of attractants in diets (chicken meal, betaine, tuna oil and bait enhancer), temperature (26.5oC, 28.5oC and 30.5oC), sex (female and male) and size (small, medium and large) on feeding responses of S. serrata were investigated. Significant differences were observed in the behavioral responses of mud crabs to diets containing different attractants. Specifically, consumption of diets with chicken meal or betaine was significantly higher than for other treatments. With the exception of betaine, no significant difference in food consumption was observed when attractant inclusion levels were raised from 2% to 5%. Overall, small crabs consumed significantly more of the ration (as a percentage of body weight) than larger crabs. Temperature showed a significant impact on most behaviour of mud crabs, excepting continuation response and there was some evidence that females were significantly more active than males. Light intensity was considered as a main factor effect to crab response since there were extremely high percentage time of crab spent in half-shaded of the Y –maze which valued at 95.6%, 93.8 and 94.4% (corresponded to small, medium and large size respectively) in comparison to those of crabs spent in the unshaded side. Overall, the findings from these studies demonstrated that mud crabs have a high capacity to digest a range of plant based feed ingredients. In particular, soybean meal appeared to be well digested by both species of mud crabs examined. It was also shown that a range of purified starches were well digested by S. serrata although starch inclusion in diets did not appear to reduce the requirement for protein to promote growth. Subsequent attractant studies demonstrated that chicken meal and betaine produced significantly elevated feeding responses and food consumption when added to diets. Based on these results we propose that these ingredients can be utilised to increase the attractiveness and consumption of artificial mud crab feeds.

Mud crabs of the genus Scylla are widely exploited for aquaculture in the Asia- Pacific region. In the current study, a series of in vivo experiments were carried to assess the protein requirement, protein sparing effects of starch and the capacity of Scylla serrata to digest diets that contained different animal and plant-based feed meals and different levels and types of starch. Results from a protein requirement study indicated that juvenile S. serrata fed diets containing 45% or 55% protein demonstrated significantly higher growth responses than those fed the diet containing 25% protein. The subsequent study was carried out to determine if responses to dietary protein could be influenced by using purified wheat, potato, rice or corn starch to manipulate the gross energy level of fishmeal- based diets (18 or 15.5 MJ kg-1), i.e., to see if starch had a protein sparing effect in these animals. Overall, growth responses in this study appeared to be positively correlated with the level of protein in the diet with the highest growth rates achieved using diets containing 45% protein, regardless of the energy level of the diet. In addition, at a dietary protein level of 40% there was no evidence that the source of starch had any significant impact on growth performance or feed utilisation suggesting it had no protein sparing effect. By contrast, it was found that growth of juvenile S. serrata was strongly correlated with the intake of digestible dietary protein. The investigation of the capacity of sub-adult S. serrata to digest different animal and plant- based feed meals showed that apparent dry matter digestibility (ADMD) and apparent gross energy digestibility (AGED) values were not significant different for most selected feed meals (cotton seed, poultry, canola, fishmeal, soybean, and lupin meal). Apparent crude protein digestibility (ACPD) for all test feed meals were relatively high (86-96%). A subsequent study was carried out to determine if purified starch from different sources influenced the digestibility of fishmeal based diets. Overall, most diets containing starch were readily digested by mud crabs. In particular, there were no negative impacts on the digestibility of major nutrients (e.g. protein) observed following the inclusion of wheat, rice or corn starch in formulated feeds. Nevertheless, the apparent starch digestibility (ASD) of wheat starch decreased significantly as the inclusion level was increased from 15% to 60%, although there was no significant effect on ACPD values. At a 30% inclusion level, the ASD of diets containing different starches decreased in the order corn > wheat > potato = rice. Moreover, ACPD values were significantly higher for diets containing corn or rice starch than for those containing wheat or potato starch. The capacity of another species of mud crab commonly exploited for aquaculture in South East Asia, S. paramamosain, to digest the local plant-based ingredients (defatted soybean meal, rice bran, cassava and corn flour) was also conducted in Vietnam. Overall, the findings of this study showed that at a 30% inclusion level diets containing soybean meal or rice bran were well digested by mud crabs. In particular, the ACPD and AGED values for all diets containing soybean meal were not significantly different from the fishmeal based reference diet. Likewise, all digestibility values for the diet containing 30% rice bran were relatively high and not significantly different from the reference diet. By contrast, diets containing cassava flour appeared to be poorly utilised since their digestibility values for all parameters were lower than those from other testingredients. In summary, the apparent digestibility of dry matter, protein and energy was in the following order (from most to least digestible) soybean meal ~ rice bran > corn flour > cassava flour. In the next study the effects of attractants in diets (chicken meal, betaine, tuna oil and bait enhancer), temperature (26.5oC, 28.5oC and 30.5oC), sex (female and male) and size (small, medium and large) on feeding responses of S. serrata were investigated. Significant differences were observed in the behavioral responses of mud crabs to diets containing different attractants. Specifically, consumption of diets with chicken meal or betaine was significantly higher than for other treatments. With the exception of betaine, no significant difference in food consumption was observed when attractant inclusion levels were raised from 2% to 5%. Overall, small crabs consumed significantly more of the ration (as a percentage of body weight) than larger crabs. Temperature showed a significant impact on most behaviour of mud crabs, excepting continuation response and there was some evidence that females were significantly more active than males. Light intensity was considered as a main factor effect to crab response since there were extremely high percentage time of crab spent in half-shaded of the Y –maze which valued at 95.6%, 93.8 and 94.4% (corresponded to small, medium and large size respectively) in comparison to those of crabs spent in the unshaded side. Overall, the findings from these studies demonstrated that mud crabs have a high capacity to digest a range of plant based feed ingredients. In particular, soybean meal appeared to be well digested by both species of mud crabs examined. It was also shown that a range of purified starches were well digested by S. serrata although starch inclusion in diets did not appear to reduce the requirement for protein to promote growth. Subsequent attractant studies demonstrated that chicken meal and betaine produced significantly elevated feeding responses and food consumption when added to diets. Based on these results we propose that these ingredients can be utilised to increase the attractiveness and consumption of artificial mud crab feeds.

Recent research has focused on the non-lethal effects of predator intimidation and fear, dubbed non-consumptive effects (NCEs), in which prey actively change their behavior and habitat use in response to predator chemical cues. Although NCEs can have large impacts on community structure, many studies have ignored differences in predator population structure and properties of the natural environment that may modify the magnitude and importance of NCEs. Here, I investigated the roles of predator size and density (i.e. biomass), as well as habitat characteristics, on predator risk assessment and the magnitude of consumptive and NCEs using blue crabs, mud crabs, and oyster prey as a model system. Predation experiments between blue crabs and mud crabs demonstrated that blue crabs consume mud crabs; however, the consumptive effects were dependent upon blue crab body size and habitat type. When mud crabs were exposed to chemical cues from differing biomasses of blue crabs in laboratory mesocosms, mud crab activity and predation on oysters was decreased in response to high biomass treatments (i.e. large and multiple small blue crabs), but not to low biomass predators (i.e single small blue crab), suggesting that risk associated with predator size is perceptible via chemical cues and is based on predator biomass. Further experiments showed that the perception of risk and the magnitude of the NCEs were affected by the sensory cues available and the diet of the blue crab predator. The NCE based on blue crab biomass was also demonstrated in the field where water flow can disperse cues necessary for propagating NCEs. Properties of water flow were measured within the experimental design and during the experiment and confirmed cage environments were representative of natural conditions and that patterns in NCEs were not associated with flow characteristics. These results affect species conservation and commercial fisheries management and demonstrate that we cannot successfully predict NCEs without considering predator size structure and the contexts under which we determine predator risk.

The ability of prey to detect and respond appropriately to predator risk is important to overall prey fitness. Many aquatic organisms assess risk through the use of chemical cues that can change with predator diet. Two variable characteristics of diet are: 1. prey type and 2. prey mass. To assess the effect of these two characteristics on the assessment of risk by the mud crab Panopeus herbstii, I exposed mud crabs to the urine of the blue crab Callinectes sapidus fed one of 5 diet treatments: 10g of oyster shell free wet mass, 5g of oyster shell free wet mass, 10g crushed mud crabs, 5g crushed mud crabs, and a mix of 5g of oyster shell free wet mass and 5g crushed mud crab. Effects on P. herbstii foraging were tested in a previously developed bioassay by measuring shrimp consumption over a 4 hour period. I hypothesized that P. herbstii would have a larger magnitude response to urine from C. sapidus fed a diet of crushed mud crabs than to urine from C. sapidus fed a diet of oysters. I further hypothesized that P. herbstii would have a larger magnitude response to urine from C. sapidus fed a high mass diet relative to a lower mass diet. Contrary to expectations there was no observed effect of urine on P. herbstii foraging in any of the treatments. Results suggest that bioassay protocol may be unreliable suggesting further replication to determine the difference between this study and previous results. Future studies examining how P. herbstii varies with urine concentration will aid in understanding the ecological scale of this predator cue system. Determining the role of other potential cue sources will improve the predictive abilities of these studies.

The edible mud crab, genus Scylla, is important to fisheries and aquaculture throughout the Indo Pacific region, but its taxonomic status has been confused for decades and a new classification has only recently been proposed. This project was undertaken to investigate the species status of mud crabs in Southeast Asia, with a view to deciding whether two sympatric morphs of Scylla found in Ban Don Bay, Surat Thani Province, Thailand, are two separate species. A further aim was to elucidate any possible pre-zygotic reproductive isolating mechanisms (RIMs) and ecological features that maintain the apparent sympatry between these two morphs. Mud crabs were collected from a primary site (Surat Thani, Thailand) as well as from six other locations in Thailand, Vietnam, Malaysia and Bangladesh. Crab samples from the latter sites were used selectively to provide a comparison to the primary study site. Descriptive taxonomy, multivariate morphometrics and allozyme electrophoresis were used to a) determine the number of species present within the crab samples collected; b) to ascertain which species they represent; c) to discover any geographical variation between locations sampled; d) to produce a possible phylogeny that summaries the relationship between Scylla species; and e) to look for pre-zygotic RIMs to explain the sympatry of the two morphs in Surat Thani. Findings from the present study reinforce the recent revision of the taxonomy of the genus Scylla into four species, S. serrata, S. olivacea, S. tranquebarica and S. paramamosain and provides new information on two of the four species which are dominant within Southeast Asia, including Ban Don Bay, Surat Thani Province, S. paramamosain and S. olivacea. Population studies showed both genetic and morphological differentiation between conspecific populations of S. paramamosain and S. olivacea, indicating stock structure for each species, although there is some disparity between morphological and genetic distances for S. paramamosain. This is discussed in relation to the effects of larval dispersal mechanisms and the subsequent recruitment of juvenile crabs. Phylogenetic interpretation of both genetic and morphological characters revealed that both S. serrata and S. olivacea are the most diverged of the four Scylla species; however, the direction of evolution is open to interpretation and the evidence for either S. olivacea or S. serrata as the more primitive species are discussed. Reproductive studies on the two mud crab species found in Surat Thani revealed no physical barrier to hybridization. Both species have a protracted breeding season which continues throughout the year. However, the size at first sexual maturity was significantly smaller for S. olivacea when compared to S. paramamosain. This and other potential mechanisms that may maintain these two species sympatrically are discussed. The clarification of four Scylla species, and the establishment of diagnostic genetic and morphological characters that can be used to identify them, means that research can now focus on both the ecology and life history of these closely related species. Such information is needed urgently with respect to fisheries management as well as to understanding the environmental requirements of each species in order to develop their potential for aquaculture.

In conjunction with Cambrex, a biomedical company that utilizes horseshoe crabs for the production of Limulus Amoebocyte Lysate (LAL), a study was conducted to investigate movement patterns and population distributions of horseshoe crabs to increase understanding of mid-Atlantic horseshoe crab populations. In addition, areas of the shoreline of Tom's Cove, Assateague Island, Virginia were investigated as possible locations for annual spawning surveys. Twelve thousand five hundred horseshoe crabs were tagged and released in Chincoteague, Virginia and Ocean City, Maryland as part of a movement study; 431 (3.45%) were reported as resights. The mean distance between site of release and site of recapture for all resighted crabs was 68.3 km; maximum distance moved was 493.7 km. During 1999-2004, demographic data were collected from horseshoe crabs harvested in Chincoteague, VA and Ocean City, MD. The proportion of females (p < 0.0001) and juveniles (p < 0.0001) sampled varied from year-to-year, but no trends were observed. This study also showed that a greater proportion of females were observed in the juvenile cohort sampled compared to the adults sampled (p < 0.0001). The spawning survey revealed that spawning activity in Tom's Cove varied between years. On May 30th, 2003, 1,192 horseshoe crabs were observed spawning on the northern shoreline of Tom's Cove. The maximum number of horseshoe crabs observed spawning in the same area in 2004 was 94. This study provides no evidence for isolated subpopulations in Chincoteague, VA or Ocean City, MD. It also shows that horseshoe crab sex and age ratios fluctuate annually, therefore requiring a long time series of data to detect trends.
Master of Science

This study addressed the potential restoration of a population of mud crabs Scylla spp. in the mangroves of Naisud and Bugtong Bato, Ibajay, Aklan, Philippines. Survey of the study site showed that 50 of the 70 ha total mangrove area is still natural mangrove and represents suitable habitat for mud crabs. The dominance of Scylla olivacea in the mud crab catches, through all life stages, suggests fidelity of this species to the area. The absence of berried crabs in the samples may indicate offshore migration for spawning. The high percentage of immature crabs in all months with peaks in March or April may suggest year-round recruitment with peaks in the summer months. The negatively significant correlation of carapace width (CW) and body weight (BW) to time indicates growth overfishing. Results further revealed low yield and catch per unit effort (CPUE). Population estimates ranging from 14 to 34 crabs ha 1 were obtained through a mark-recapture study using coded microwire tag (CWT) and the Jolly-Seber method for open populations. Growth rates were 0.25 mm CW d"' and 1g BW d"1. Results of the stock enhancement trials showed that smallscale release can increase abundance of mud crabs in a partly isolated mangrove habitat. Growth and survival rates of released crabs suggest that S. olivacea is the best suited species for this particular area. The results further revealed that pondconditioned S. olivacea can have higher growth than those released directly from the hatchery and recovery rates equivalent to those of their wild conspecifics. The optimum size-at-release is 65.0-69.9 mm CW regardless of species or source. Both wild and hatchery-reared crabs also exhibited limited post-release movement, supporting the overall conclusion that stock enhancement can be an effective tool in addressing declining fisheries resources.

I den här studien undersöktes fyra elevers kunskapsutveckling och inställning till ämnet matematik under en period av tre veckors intervention. Syftet var att mäta om en enskild intensivundervisning i matematik inom ordinarie undervisningstid kunde vara gynnsam för elever i svårigheter med taluppfattning. Ytterligare syfte var att se på om intensivundervisningen hade någon effekt på elevernas självskattning kring matematik. Studien är en experimentell fallstudie med multipel baslinje singlecase-design. Resultatet visade att interventionen har varit gynnsam för de ingående eleverna både vad gäller kunskapsutvecklingen och deras inställning och självskattning till ämnet.
This study investigates the knowledge progression of four pupils and their attitude to mathematics during a period of three weeks. The aim is to measure whether pupils with number sense problems could benefit from intensive one-to-one teaching of mathematics, within regular teaching hours. The study also aims to find out if intensive teaching affects the pupils´self-assessment regarding mathematics. An experimental case study, with multiple baseline singlecase design, has been used. The results indicate that the intervention has proved beneficial to the pupils in the study, when it comes to their knowledge progression as well as their attitude and self-assessment.

Cette thèse est dédié à l’étude de la problématique des interférences multi utilisateurs dans le système Argos et à la proposition des diverses techniques pour réduire les effets de ces interférences. Le système Argos est un système mondial de localisation et de collecte de données géo positionnées par satellite. Il permet à l’échelle mondiale de collecter et de traiter les données émises par des émetteurs installés sur la surface de terre. Ces émetteurs sont connus sous le nom de balises. Ces balises sont installées sur des voiliers, des stations météo, des bouées, ainsi que sur quelques animaux (phoques, penguins, etc.…). Le système Argos a été créé en 1978 par le Centre National des Études spatiales (CNES), l’agence spatiale américaine (NASA) et l’agence américaine d’étude de l’atmosphère et de l’océan (NOAA). Depuis sa création, le nombre de balises Argos n’a cessé d’augmenter afin de couvrir au mieux la couverture mondiale. Nous sommes orientés ainsi à la saturation de la bande d’émission et à la présence des interférences multi utilisateurs (MUI) provenant de la réception simultanée de plusieurs signaux émis par les balises. Cette MUI limite la capacité du système Argos et dégrade les performances en termes de Taux Erreur Bit (TEB). Actuellement, le système Argos n’est capable de traiter qu’un seul signal reçu à un instant donné. D’où, l’intérêt d’implanter des techniques au niveau du récepteur capable de réduire les effets des interférences et de traiter les signaux émis par toutes les balises. Plusieurs techniques de détection multi utilisateurs (MUD) ont été développées dans le cadre de cette problématique. Ces techniques sont principalement implantées dans les systèmes CDMA où des codes d’étalement sont utilisés afin de différencier entre les différents signaux. Ceci n’est pas le cas du système Argos où les signaux ne présentent pas des séquences d’étalement et que les bandes de fréquences pour ces différents signaux ne sont pas disjointes à cause de l’effet Doppler et donc, un recouvrement spectral au niveau du récepteur est très probable. Dans ce contexte, l’objectif du travail présenté dans cette thèse est d’étudier différentes techniques MUD appliquées au système Argos et d’évaluer ces techniques au niveau des performances en termes de TEB et de complexité d’implantation. Dans ce travail, nous présentons les différentes composantes du système Argos ainsi que son mode de fonctionnement. Ensuite, nous présentons la problématique dans le système Argos ainsi que les différentes solutions proposées. Parmi ces solutions, nous montrons celle basant sur l’implantation des techniques MUD au niveau du récepteur. Ces différentes techniques MUD sont alors présentées ainsi que les avantages et les inconvénients de chacune d’elles. Parmi les techniques possédant un bon compromis entre les performances d’une part et la complexité d’autre part, nous notons la technique d’annulation par série d’interférence (SIC). Dans cette technique, les signaux sont démodulés successivement suivant l’ordre décroissant des puissances. Cette technique nécessite une étape d’estimation des paramètres des signaux à chaque étape. L’impact d’une estimation imparfaite des différents paramètres est aussi étudié. Après l’étude des impacts des erreurs d’estimation, nous proposons des estimateurs adaptables au système Argos. Les performances de ces estimateurs sont obtenues en comparant les variances de leurs erreurs aux bornes de Cramer Rao (CRB). Enfin, nous terminons le travail par une conclusion générale des résultats obtenus et nous envisageons les perspectives des prochains travaux
In our thesis, we investigate the application of multi user detection techniques to a Low Polar Orbit (LPO) satellite used in the Argos system. Argos is a global satellite-based location and data collection system dedicated for studying and protecting the environment. User platforms, each equipped with a Platform Transmitter Terminal (PTT), transmit data messages to a 850 km LPO satellite. An ARGOS satellite receives, decodes, and forwards the signals to ground stations. All PTTs transmit at random times in a 100 kHz bandwidth using different carrier frequencies. The central carrier frequency f0 is 401.65 MHz. Due to the relative motion between the satellite and the platforms, signals transmitted by PTTs are affected by both a different Doppler shift and a different propagation delay. Thus, the Argos satellite receives overlapping signals in both frequency and time domains inducing Multiple Access Interference (MAI). One common approach to mitigate the MAI problem is to implement Multi User Detection (MUD) techniques at the receiver. To tackle this problem, several MUD techniques have been proposed for the reception of synchronous and asynchronous users. In particular, the Successive Interference Cancelation (SIC) detector has been shown to offer a good optimality-complexity trade-off compared to other common approaches such as the Maximum Likelihood (ML) receiver. In an Argos SIC receiver, users are decoded in a successive manner, and the signals of successfully decoded users are subtracted from the waveform before decoding the next user. This procedure involves a parameter estimation step and the impact of erroneous parameter estimates on the performance of Argos SIC receiver has been studied. Argos SIC receiver has been shown to be both robust to imperfect amplitude and phase estimation and sensitive to imperfect time delay estimation. The last part of our work focuses on the implementation of digital estimators for the Argos system. In particular, we propose a time delay estimator, a frequency estimator, a phase estimator and an amplitude estimator. These estimators are derived from the ML principle and they have been already derived for the single user transmission. In our work, we adapt successfully these estimators for the multi user detector case. These estimators use the Non Data Aided (NDA) cases in which no a priori information for the transmitted bits is required. The performance of these different estimators are compared to the Cramer Rao Bound (CRB) values. Finally, we conclude in our work by showing the different results obtained during this dissertation. Also, we give some perspectives for future work on Argos system

Liu Hong.
"September 2004."
Thesis (Ph.D.)--Chinese University of Hong Kong, 2004.
Includes bibliographical references (p. 241-269)
Electronic reproduction. Hong Kong : Chinese University of Hong Kong, [2012] System requirements: Adobe Acrobat Reader. Available via World Wide Web.
Mode of access: World Wide Web.
Abstracts in English and Chinese.

博士
國立中山大學
海洋生物科技暨資源學系研究所
94
Hemocyanin, a copper containing protein, is the respiratory protein of Crustacea. Here, 4 major hemocyanin molecules in the hemolymph of Scylla olivacea were purified and studied. Both two-hexamer (24S) and hexamer (16S) form of hemocyanin are present in all adult’s hemolymph. In vitro, 24S hemocyanin dissociates into two 16S hemocyanin in the absence of calcium under high pH value (> 8.9). Little of 16S hemocyanin assembles spontaneously into 24S hemocyanin after calcium is added. Both 16S and 24S hemocyanins were purified from hemolymph, the 16S hemocyanin differs from the 24S hemocyanin in the presence of intersubunit disulfide bonds, it is inferred that not all native 16S hemocyanin dissociates from 24S hemocyanin. Besides the 24S and 16S hemocyanin, there are two massive proteins in the hemolymph of ovary-maturing female S. olivacea. One is female-specific hemocyanin (FSH), which occurs in the hemolymph of ovary-maturing females, but not in the hemolymph of juveniles of either sex or in adult males. FSH is confirmed as a hemocyanin due to its copper content and oxygen binding ability. FSH is also found in ovary, embryo and early-stage zoea, and is proposed to be an important hemocyanin that supplies enough oxygen for ovary-maturing female crab, egg, embryo and early-stage zoea. Another massive hemolymph protein is a non-respiratory protein (NRP) that is present in hemolymph of adults of both sex, the molecular mass of its subunits is similar to hemocyanin and FSH, and one of subunits can be slightly recognized by anti-FSH antibody. NRP is not a respiratory protein, there is neither copper containing nor absorbance of 340nm. FSH and NRP, especially NRP, contain more carbohydrates than the 16S hemocyanin.

This study aimed to develop a suitable formulated diet to replace live food in mud crab, Scylla serrata, larval culture. A microbound diet (MBD) was formulated based on known requirements of other crustaceans and was assessed for ingestion and retention by the various larval stages of S. serrata. Ingestion and retention was determined by labeling the MBD with ¹⁴C, and subsequently measuring ¹⁴C in larvae fed these diets. After it was shown that the larvae readily accepted MBD, different types of binders were tested to determine those best suited for MBD prepared for S. serrata larvae. The diet particle size preference and optimal feeding ration were then determined for the various larval stages. Finally, the diet was tested in combination with different ratios of Artemia as a food source for Megalopa. Fundamental to the success of the study was the development of methods that would ensure routine and reliable production of mud crab larvae. Larval production runs were tried using protocols from various authors and procedures that showed positive results after several trials were adopted. A progressive improvement in survival was achieved towards the end of the study and the rearing protocol that was finally adopted has now formed the basis for hatchery production of S. serrata at James Cook University. A technique for evaluating fish larvae using dietary ¹⁴C was refined and adopted in this study for the measurement of ingestion and retention of the MBD by S. serrata larvae. Several studies were cond ucted to serve as basis to refining this technique. Based on an experiment to determine factors that could affect the measurement of the ¹⁴C content of larvae fed ¹⁴ C labelled MBD, it was found that S. serrata larvae do not absorb the ¹⁴C that leaches from the diet but MBD particles that stick to the larvae were the major source of potential error. As such, it was found necessary to include a control treatment with dead larvae when running an experiment so that the radioactivity reading of the dead larvae can be used to correct the radioactivity readings in the treatments when measuring ingestion. Newly hatched S. serrata zoea readily ingested the MBD and ingestion increases with larval age. Ingestion of MBD did not vary significantly between Zoea I and Zoea II and also between Zoea III and Zoea IV; ingestion by other larval stages were significantly different from each other. Ingestion of MBD by Megalopa was found comparable to previously reported ingestion of live food (8 Artemia larva⁻¹ h⁻¹). Studies were also conducted to determine the duration of diet exposure that resulted in maximal ingestion of the MBD. Results showed that for Zoea I to Zoea III and Megalopa, feeding for 1 h resulted in maximal ingestion as there was no further increase in ingestion with longer diet exposure. For Zoea IV and Zoea V, at least 2 h was required for maximal ingestion as there was no further increase in ingestion after 2 h. The gut residence times (GRT) of MBD for the various larval stages of S. serrata were determined in order to know the required period that should be allowed for the larvae to empty their gut when measuring retention of the MBD. In Zoea I, GRT was found to be 1 h as retention of the MBD significantly decreased after 1 h following removal of available MBD. In Zoea III and Zoea IV, GRT was found to be 2 h; retention of the MBD significantly decreased after 2 h following food removal and there was no further significant decrease in retention after this time. Results did not clearly indicate the GRT of Zoea V and Megalopa, but there were indications suggesting longer GRT of around 4- 5 h for these stages. Studies to test the suitability of different binders (agar, alginate, carrageenan, gelatin and zein) for MBD showed that there were no significant differences in ingestion and retention of MBD resulting from binder type. Further evaluation of these binders, based on leaching of radioactivity from diets, showed that least leaching was found in zeinbound MBD. Since the greater leaching of nutrients from die ts with other types of binders did not make these diets more attractive (i.e. result in significantly greater rates of ingestion), the minimal leaching of nutrients from zein-bound MBD made zein the more desirable binder. Unnecessary leaching wastes important dietary components and can result in deterioration of water quality. The particle size preference and optimal feed ration were determined for the various larval stages of S. serrata based on larval ingestion of ¹⁴C labeled MBD. The results provided important information for feeding management of S. serrata and allowed recommendation of the most suitable MBD particle size range and ration for each of the larval stages of S. serrata (i.e. for Zoea I, <150 μm MBD particles given at 5.4 mg L⁻¹; for Zoae III, 150-250 μm MBD particles fed at 7.1 mg L⁻¹; for Zoea V, 250-400 μm MBD particles fed at 8.2 mg L⁻¹; for Megalopa, 400-600 μm MBD particles given at 2 mg L⁻¹). It was found that the optimal particle size ranges for different larval stages are not completely provided by a rotifer/Artemia diet commonly used in mud crab hatcheries. This highlights the advantage of using MBD since they can be prepared within any desired particle size range and as such offer the potential to provide a more appropriate diet to S. serrata larvae. The results also suggested that MBD, provided at a rate equivalent to 50% of the dry weight of the 'standard' live food diet is the optimal ration for Zoea I to Zoea V larvae and it could be as low as 12.5 % for Megalopa. The potentia l for complete and partial replacement of Artemia with MBD for Megalopa was also tested. Survival of megalopae to crab stage did not vary significantly between the different ratios of MBD and Artemia, but a combination of 25 % MBD and 75% Artemia consistently gave the highest survival. Treatments receiving high proportions of MBD molted earlier compared to those receiving high proportions of Artemia. In another experiment where Megalopa were reared individually, 90 % survival to crab stage was achieved in both treatments fed either MBD or Artemia only. The megalopae fed MBD only also molted one day earlier than those fed Artemia only. These results showed that the MBD was capable of supporting successful molting of megalopae to crab stage and the possibility of complete replacement of Artemia with MBD. It was also shown that while both the MBD and the Artemia were adequate feeds on their own, a combination of the two in an appropriate proportion may give improved results.

碩士
國立海洋大學
食品科學系
90
Abstract The purpose of this study was to investigate the changes of chemical constituents in the abdominal muscle of female mud crab in relation to short-term salinity acclimation and subsequent air-exposured storage at 15℃. The crab specimens were acclimated to 25 ppt of sea water for 24 hours (control) and then transferred to 10 and 40 ppt sea water for a period of 4~48 hours. In comparison with control, moisture in 40 ppt sample decreased, but that in 10 ppt sample increased. On contrary, the glycogen showed a inverse trend. Taurine (Tau), glutamine (Gln), proline (Pro), glycine (Gly), alanine (Ala) and arginine (Arg) were dominant free amino acids (FAA) and they together accounted for about 87﹪of the total FAA. Adenosine triphosphate (ATP) and glycinebetaine (GB) were respectively the major component among the ATP-related compounds (ARC) and quternary ammonium bases (QAB) detected. As a whole, the 40 ppt sample was relatively high in levels of the total FAA, total ARC, GB, and homarine (Hom). In addition, the difference in levels of moisture, glycogen, total FAA, total ARC, GB, and Hom between 10 and 40 ppt samples increased with the elongation of acclimation time. The crab specimens acclimated to 10 ppt, 25 ppt, and 40 ppt sea water and then stored at 15℃ for 12~72 hours. Differences in the moisture and glycogen levels declined after storage. The total FAA in all samples elevated gradually with the storage time and the sample acclimated to higher salinity was more pronounced. The major FAA except for Tau also increased. After storage, the total ARC content was higher in the 40 ppt sample than in other two samples. The ATP decreased with storage time, while its breakdown products accumulated. The GB and Hom contents were higher in the sample acclimated to higher salinity, but their difference between the samples lowered as the storage time increased. Of the samples acclimated to 10、25, and 40 ppt sea water for 48 hours, their hot-water extracts were prepared and compared by sensory test for taste. Taste intensity of the extracts was higher in the 25 and 40 ppt samples than in the 10 ppt sample. The salt, Na+, and total FAA contents in the hot-water extracts followed the order of 40 ppt > 25 ppt > 10 ppt sample. Levels of glycogen, GB, and Hom were higher in the 25 ppt sample than in the 40 ppt and 10 ppt samples. However, there was no significant difference in the total amounts of ARC between them.

碩士
國立成功大學
海洋科技與事務研究所
103
In Taiwanese dietary habit, mud crab dishes are one of the most delicious food in autumn. According to the data from Fisheries Agency in Taiwan, the average import quantum of mud crab is about 4000 tons in the last decade. Living mud crab is the main import item with more than 80% amount other imported crab. High demand for mud crab is catachrestic during the period from September to December, while the harvest of mud crab in Southeast Asia is lower than in summer. Therefore, the demand and supply are usually inconsistent. . Demand of mud carb is also various in short periods that demand in weekend and holiday is rapidly rising than week days. This study thus aims to reach the rapidly raised demand of mud crab by short-term culturing with economic assessment. In this study, mud crabs are cultured for a period of time by a small-scale culturing tank. The survival rate of mud crabs is examined to compare with the result of questionnaires that sent to 20 seafood restaurants. According to the result of questionnaires, the mud crab of cultured by these sea food restaurants has a mortality rate about 15% which is lower that of nonculture restaurants. The result of small-scale culturing experiment in this study shows that the initial mortality rate about 15% in restaurants of owning culture tank could be reduced to 5% by using the culturing system designed in this study. In addition, the benefit assessment of short-term culture of mud carbs in one month revealed that profit of a restaurant would increase about 13% while the mortality rate is lower than 5% and can avoid the magnetic effect from China.

An outbreak of a previously unrecorded shell disease in the Portunid mud crab Scylla serrata from Gladstone Harbour, Port Curtis, Queensland, was investigated. The shell lesions called 'rust spots' appeared as orange coloured areas on the dorsal carapace, which in severe cases would ulcerate to expose underlying soft tissues. Through the examination of over 3000 mud crabs the disease prevalence in Port Curtis compared to a number of other locations in Queensland, was determined. Although the prevalence varied over the three successive sampling periods, the average prevalence (14.3%) in Gladstone Harbour was higher than the normal background prevalence of 5% reported for shell disease in other crustacean populations. The lesion pathology of rust spot lesions was determined to be unique compared to the described pathology of other shell diseases, where there is an external erosion of the shell primarily due to pathogenic organisms. In non-perforated rust spot lesions, however, the external shell layers remain intact, with the lesions being restricted to the endocuticle layer and adjacent muscle attachments. As this layer is fonned in the postmoult period, it is likely the lesions are due to a defect in the manufacturing of this layer rather than one of pathogenic degeneration. The histopathology was supported by observations of diseased mud crabs held over a moulting period, in which lesions were also observed to form in the postmoult phase. Although chitinoclastic bacteria are considered to be the primary causative agents of shell disease in other crustaceans, there was no evidence of an infectious or parasitic agent being associated with the internal organs or carapace lesions of the diseased mud crabs examined. Furthermore, water and inoculation transmission experiments failed to reproduce the disease in juvenile mud crabs, sand crabs (Portunus pelagicus) or prawns (Penaeus japonicus). Although the nature of transmission experiments is that failure to reproduce the disease does not necessarily mean definitively a noninfectious cause, in combination with the pathology results they suggest that the cause of rust spot shell lesions is likely to be non-infectious. Haemolympl1. assays were undertaken in an endeavour to measure the health status of diseased mud crabs. Results indicated elevated biochemical factors (two immune factors; antibacterial and phenoloxidase and one cellular enzyme; glutamate dehydrogenase) in both diseased and non-diseased crabs from Gladstone compared to the crabs from Ayr, a non-impacted site where no shell disease had been recorded. Levels in the diseased group of crabs were, however, depressed in comparison to their non-diseased cohorts from the same location, indicating a possible suppression of immune responses in diseased crabs. As shell disease had been associated with polluted environments, the metal analyses of diseased and non-diseased mud crab tissues from Gladstone were also compared with those from Ayr. Copper and zinc were elevated in mud crab hepatopancreas from Gladstone compared to Ayr in two consecutive years. Mean copper concentrations of Gladstone crabs were two to three times greater than for mud crabs sampled from other locations in Queensland. Total metal burdens were also elevated in the Gladstone mud crabs, with a high variation in the diseased mud crabs suggesting that this group may be unable to regulate metal levels. As copper and other metals have been demonstrated to cause inhibition of calcium uptake in other crustaceans, copper exposure experiments were conducted to test the hypothesis that copper could cause rust spot shell lesions by inhibiting calcium uptake in the developing postmoult cuticle. The experiment confirmed that calcium uptake into the carapace of softshelled juvenile, mud crabs was inhibited by sublethal copper exposure. The copper exposure experiments supported the pathology findings that rust spot shell lesions are likely to be caused by a defect in the manufacturing process of the endocuticle. The source of elevated copper accumulations in mud crabs, whether water or sediment borne or dietary was investigated. Water and sediments collected from mud crab burrows and analysed for metals determined that very low concentrations of metals exist in the burrows. A comparison was made between the diets of Gladstone mud crabs and those from Ayr to determine whether diet could be implicated as a source of elevated copper in the Gladstone mud crabs. Stable isotope analyses (carbon and nitrogen) of mud crab muscle was undertaken as an alternative to gut content analysis to determine the dietary sources of carbon and trophic position of crabs from the two areas. Although Gladstone and Ayr crabs had a similar trophic position the disparate delta carbon results suggests the diets of the crabs are different with a correlation established between delta carbon and copper concentration in the tissues. It is possible that diet may be a source of copper in Gladstone mud crabs through biomagnification along the food chain. Although results are preliminary, research into this poorly defined area of ecosystem health in Port Curtis should be continued.

碩士
國立彰化師範大學
生物學系
98
Sco-CHH and Sco-CHH-L (CHH-like peptide), two structural variants of the crustacean hyperglycemic hormone family identified in the mud crab (Scylla olivacea), are identical up to the 40th residue, but different from each other in the remaining sequence. Analyses of transcript sequences indicated they are encoded by alternatively spliced transcripts of the chh gene. Recombinant protein rSco-CHH were successfully produced using an E. coil expression system, refolded, purified, and confirmed by Western blotting, mass spectrometric analyses, circular dichroism analyses and subsequently used to confer the function of Sco-CHH. To reveal the structural bases of functional divergence, site-directed mutagenesis was used to produced mutated rSco-CHH (mutated sites located at 2, 3, 4, 12, 13, 51, 54, 60, 69, 70, 72 amino acid of the mature Sco-CHH) and tested the biological activity by using the established bioassays. The hyperglycemic activity of I2G (The second amino acid of mature Sco-CHH isoleucine mutated to glycine) decreased by 54.9 ± 50.5 %, F3A (phenylalanine mutated to alanine) decreased by 38.2 ± 57.9 %, Q70A (glutamine mutated to alanine) decreased by 27.1 ± 47.7 %, and V72G (valine mutated to glycine) decreased by 34.1 ± 45.9 %. The substitutions of critical residues at the N-terminus and C-terminus inferred that the N and C-terminal hydrophobic activity of Sco-CHH was important to receptor binding. Furthermore, D12N (aspartic acid mutated to asparagine) lost the hyperglycemic activity. Q51A (glutamine mutated to alanine) and E54Q (glutamic acid mutated to glutamine) not only decreased hyperglycemic activity but also changed the secondary structure of Sco-CHH. The result indicated that these critical residues contributed to the stability of Sco-CHH. The combined results support the notion that Sco-CHH and Sco-CHH-L are functionally divergent, and might reveal the structural bases of functional divergence.

碩士
國立中興大學
獸醫學系暨研究所
95
The aim of this study was to investigate the morphology and haemocytic immune functions of haemocytes in mud crab (Scylla serrata). The effects of immunostimulants on mud crab haemocytes were also studied in vitro. Our results revealed that flow cytometry could successfully classify the crab’s haemocytes into three populations: hyalinocytes, semi-granulocytes and granulocytes. For young female crabs, the percentages of hyalinocytes, semi-granulocytes and granulocytes were 33.70%, 43.47%, and 5.06%, respectively. Because the percoll gradient centrifugation method could not clearly distinguish each subpopulation, we applied flow cytometry to differentiate among the different groups of haemocytes. Our data showed that our technique was capable of separating the haemocytes. The purities of hyalinocytes, semi-granulocytes and granulocytes were 83.1%, 86.8% and 76.9%, respectively. The morphology of the three haemocytes were observed by optical microscopy, fluorescence microscopy, and TEM, respectively. In this study, eight kinds of immunostimulants, including five types of glucan (laminarin, levan, scleroglucan, yeast glucan, and zymosan) and three different sources of lipopolysaccharide (LPS) from Escherichia coli, Pseudomonas aeruginosa and Salmonella enterica were used. Our data suggested that the working dosage of yeast glucan, zymosan, LPS E and LPS P required to induce the crab’s innate immune responses was 20 μg/mL. Interestingly, we found that immunostimulants could change the proportions of the crab’s haemocytic subpopulations, especially for hyalinocytes which increased markedly. The percentages of semi-granulocytes and granulocytes, however, decreased. In order to investigate these changes, a cell proliferation assay was conducted. There were no apparent increases in haemocytic subpopulations when cultured with glucan or LPS. Our data suggested that the cause of changes in haemocytic proportion was subpopulation shift by degranulation, rather than by cell proliferation. Additionally, we confirmed that prophenoloxidase (proPO) was located in haemocytes but not in serum. Moreover, proPO activity could be induced by SDS, trypsin, zymosan, and LPS E. However, it was inhibited by soybean trypsin inhibiter. According to respiratory burst reaction and phagocytosis assay, our results indicated that granulocytes had the strongest phagocytosis and respiratory burst abilities among the three haemocytes. Hyalinocytes had very low phagocytosis and respiratory burst abilities. The abilities of semi-granulocytes were lower than those of granulocytes but higher than those of hyalinocytes. Our results showed that the innate immune response of haemocytes was capable of being enhanced by exposure to high concentrations of bacteria. We found their survival rate as well as respiratory burst and phagocytosis abilities were significantly increased after the cells were treated with immunosimulants (P<0.05).

碩士
國立彰化師範大學
生物學系
101
Crustacean hyperglycemic hormone (CHH) is a polypeptide hormone belonging to the CHH family that includes, in addition to CHH, several other members. CHH is involved in maintaining basal hemolymph glucose levels and mediating stress-induced hyperglycemia. In the present study, an approach of alanine-scanning mutagenesis was employed to determine the residues important for the hyperglycemic activity of CHH. CHH of the mud crab Scylla olivacea (rSco-CHH-Gly) and point-mutated (I2A, F3A, D4A, D12A, R13A, E54A, D60A, I69A, or V72A ) rSco-CHH-Gly were produced as glycine-extended recombinant proteins using an Escherichia coli expression system, refolded, purified, the identities of which were confirmed by mass spectrometric and circular dichroism (CD) analyses. CD spectra of mutant rSco-CHH-Gly indicate they are rich in α-helixes. The different mutated rSco-CHH-Gly was C-terminally amidated (except the V72A rSco-CHH-Gly), and tested for biological activity using an in vivo hyperglycemic assay. Results showed that the hyperglycemic activities of R13A, I69ArSco-CHH and V72ArSco-CHH-Gly completely lost their biological activity. I2A, F3A, D12A, D60ArSco-CHH had hyperglycemic activity but significant different compared to that of the wild type rSco-CHH. Hyperglycemic activity of D4A, E54A rSco-CHH were similar to wild type rSco-CHH. Finally,in co-injection bioassay results suggested that were unable to block R13A, I69A rSco-CHH or V72A rSco-CHH-Gly from CHH induced hyperglycemic. Taken together, the results show tha several amino acids located at the N and C terminal of CHH affect the hyperglycemic activity. In particular, residues located at the C-terminal helix are critical in that mutations at these sites lend to complete loss of biological activity.

Crabs of the genus Scylla, commonly referred to as mud crabs, are commercially important crabs with an Indo-Pacific distribution. Scylla serrata is the most widespread of the four recognized Scylla species, and it has traditionally been an important fishery in coastal communities throughout its range. In recent decades it has also become a targeted species for aquaculture, however, due to a lack of low cost formulated diets, mass production of mud crab seed stock is not reliable, and the majority of mud crab farms rely on juveniles caught in the wild. This has lead to a widespread seeds-stock shortage and over-exploitation of wild populations. Development of more effective hatchery techniques and more reliable production of juveniles are therefore considered critically important for sustainable growth of the mud crab farming industry in this region. Current methods for Scylla hatchery production rely on live foods such as rotifers and Artemia. These prey species are costly to produce, have an inconsistent nutritional profile and lack certain nutritional components essential for normal growth of marine larvae. Development of a nutritionally optimised diet is therefore considered critically important, and recent research at James Cook University has shown that mud crab larvae readily accept microbound diet (MBD) particles. As the contents of such diets easily can be manipulated, MBD shows enormous potential as a tool for further specification of the nutritional requirement of mud crab larvae. Lipids are required in crustacean diets as an important source of energy, essential fatty acids, sterols, phospholipids and fat-soluble vitamins. An appropriate supply of these nutrients is particularly critical during larval development, where a series of important morphological, physiological and biochemical changes take place. On this basis, this thesis was designed to first collect and review all information on the nutritional requirements of S. serrata larvae published to date, and highlight areas where more research is required. Experiments were then conducted to fill gaps in our current knowledge on larval dietary lipid requirements. Some of the most important aspects of lipid metabolism; dietary cholesterol requirements, interaction between cholesterol and phospholipids, the optimum balance of dietary n-3 and n-6 fatty acids, as well as lipid class and fatty acid utilization by developing larvae have been addressed in separate chapters, with the aim to provide information assisting formulation of more appropriate species-specific MBD for S. serrata larval culture. While previous experiments have demonstrated that megalopae of the mud crab can be cultured exclusively on MBD, the potential of MBD as a food source for zoea larvae of the same species has not previously been determined. The first experiment of this thesis was therefore set up to investigate the effect of partial and total replacement of live food with MBD for zoeal larvae, with the aim to determine the best suited larvae stage for further nutritional studies. Zoea III larvae were cultured communally at a density of 25 larvae L-1 and were fed either 100% live Artemia nauplii, 100% MBD or a 50%:50% combination of MBD and Artemia nauplii. Highest survival (66%) and development rate to the zoea IV stage were recorded for larvae fed the 50%:50% combination of MBD and Artemia nauplii. Some successful molts were also found among larvae fed exclusively on MBD, while total mortality was observed in the unfed control. The results indicate that the experimental MBD may contain certain beneficial nutrients lacking in Artemia nauplii, and that co-feeding the MBD with Artemia nauplii enhanced larval survival and development. However, the findings also suggested that total replacement of live food with the experimental MBD will result in poor survival of zoea III larvae, and based on these data, the megalopa stage was chosen as the most appropriate larval stage for further studies. The experimental MBD previously used for rearing S. serrata megalopa contained a high proportion of dried rotifers (38% of total diet dry weight). Although this work demonstrated that mud crab megalopa readily ingest and assimilate formulated diet particles, it did not reduce the reliance on live food cultures. Fundamental to the success of this study was therefore to replace the rotifer components with a commercially available protein source, and four marine animal meals (rotifer meal, Artemia meal, fish meal and squid meal) were evaluated based on larval survival, dry weight and carapace weight of newly molted first stage crabs (C1) and development time from megalopa to C1. Fifteen megalopae were reared individually in 250 mL aquaria, and survival of MBD-fed megalopae to C1 ranged from 46.7% to 60.0% with those fed MBD containing fish meal or squid meal showing higher survival than those fed MBD containing dried Artemia or rotifers. Larvae fed live Artemia nauplii showed the highest overall survival (80%), while none of the unfed megalopae survived to C1. There were no significant differences (P >0.05) in the average time required for megalopae to reach the first crab stage when fed any of the four MBD, however, shortest development time was recorded for larvae fed live Artemia nauplii. The results indicate that squid meal is a suitable protein source for formulation of MBD for S. serrata megalopae, and this meal was used in MBD formulated for subsequent experiments. Cholesterol is an important sterol, serving as a precursor for many physiological compounds such as sex and molting hormones, adrenal corticoids, bile acids and vitamin D. As crustaceans are incapable of de novo production of cholesterol, dietary cholesterol is essential for optimum growth and high survival in crustaceans. Chapter 4 of this thesis reports on an experiment assessing the effects of dietary cholesterol levels on growth, development time and survival of mud crab megalopae. Five semi-purified, iso-nitrogenous and iso-energetic MBD containing cholesterol levels from 0.14% to 1.00% diet dry weight were tested, using fifteen individually reared megalopae for each dietary treatment. The results showed that megalopae from all treatments were able to metamorphose to the first crab stage, suggesting that the endogenous level of cholesterol in the basal diet (0.14%) was sufficient to meet dietary requirements. Highest overall survival (74.3%) was recorded for megalopae fed a diet containing 0.80% cholesterol, while the widest mean carapace width (3.53 ± 0.08 mm) and highest mean dry weight (21.11 ± 2.22 mg) were recorded for juveniles molting from megalopae fed live Artemia. No megalopae in the unfed control treatment metamorphosed into crabs. The average development time from megalopa to the C1 stage varied among the treatments, with megalopae fed live Artemia or MBD containing 0.20%, 0.40% or 0.80% total cholesterol showing relative shorter development time to C1; between 8.0 (± 1.46) days and 9.9 (± 1.37) days, whereas the longest development time was recorded for the megalopae fed diets containing 0.14% or 1.00% total cholesterol; 11 (± 1.45) days and 11 (± 1.24) days, respectively. Based on these findings, 0.80% total dietary cholesterol was suggested as optimum in semi-purified diets for S. serrata megalopa. For some marine crustaceans, an interaction occurs between dietary cholesterol and dietary phospholipid. This has important implications for diet formulation, and to determine if this interaction is present in S. serrata larvae, the experiment reported in Chapter 5 was conducted to evaluate the effects of varying dietary levels of lecithin and cholesterol on growth, development and survival of megalopa. Six semi-purified MBD were formulated to be iso-energetic and iso-nitrogenous and to containing three levels of supplemental lecithin (0.0, 2.0 and 4.0% diet dry weight) and two levels of supplemental cholesterol (0.0 and 0.7% diet dry weight). The experiment was designed in the same manner as in Chapter 4, and the results showed a significant interaction between supplemental dietary lecithin and cholesterol for final mean dry weight of newly settled crabs. Highest survival (60%) was recorded for megalopae fed diets containing the highest levels of dietary lecithin regardless of whether diets were supplemented with cholesterol, and this rate of survival was identical to that of megalopae fed live Artemia nauplii. The experiment indicated that supplemental dietary cholesterol may not be essential for mud crab megalopae when fed a diet containing fish oil and sufficient levels of supplemental dietary phospholipids. Most crustacean diets today are formulated to contain a 2:1 fish oil/corn oil ratio based on known requirements of penaeid prawns. As the results from the previous chapters indicated that the nutritional requirements of S. serrata larvae are different from those of other marine crustaceans, the experiment in Chapter 6 was designed to examine the optimum fish oil/corn oil ratio in semi-purified diets formulated for mud crab megalopae. Six iso-energetic and iso-nitrogenous MBD containing 6% total lipid were formulated to contain fish oil and corn oil either singly or in various ratios (0:1, 1:2, 2:1, 3:1, 1:0, 1:1), and each dietary treatment consisted of 20 individually reared megalopae. Survival, growth, development time to C1 and signs of molting death syndrome (MDS) were recorded daily, and carapace width and dry weight of newly molted crabs were measured immediately after molt. Megalopae from all dietary treatments successfully molted to C1; however, best survival (70%) was achieved by megalopae fed MBD containing a fish oil/corn oil ratio of 1:1. Megalopae fed MBD containing ratios of 3:1and 1:0 showed survival of 65%, while survival of megalopae fed either live Artemia nauplii or MBD containing a fish oil/corn oil ratio of 2:1 was 60%. Lower survival (55% and 35%) was recorded for megalopae fed MBD with ratios of 1:2 and 0:1, respectively. Significantly greater mean carapace width (3.51 ± 0.03 mm) and significantly higher mean dry weight (2.14 ± 0.14 mg) was recorded for crabs molting from megalopae fed live Artemia nauplii compared to those resulting from megalopae fed MBD. Results from this experiment indicate that the optimal fish oil/corn oil ratio is around 1:1 when oil is supplied at a level of 6% of total diet dry weight. The study further showed that complete replacement of fish oil with corn oil in the formulated diet resulted in a high occurrence of MDS-related mortality, indicating an essential dietary requirement for >C18 highly unsaturated fatty acids (HUFA), and a link between n-3 HUFA availability and the occurrence of MDS. In nature the nutritional requirements of crab larvae are satisfied by the diversity and variability of natural prey and their broad nutrient contents. As the study of larvae in the wild is practically impossible, analysis of the biochemical changes occurring in the tissue during larval development in the laboratory has been used as an alternative method for elucidating information on the nutritional requirements of larvae. These principles have been applied successfully to studies of several crustaceans, but a complete record of changes in lipid and fatty acid profile during ontogenetic development of mud crabs was not available. Comprehensive analysis of changes in dry weight, organic content, total lipid, lipid class and fatty acid composition in developing S. serrata larvae reared under standard hatchery conditions is reported in Chapter 7. An increase in mean dry weight (DW) was observed during larval development, from 12.11 ± 0.31 μg for newly hatched zoea I, to 1025.52 ± 87.11 μg for newly molted megalopae. The organic content of larvae ranged between 58.18 ± 2.37% (zoea I) and 70.16 ± 0.68% (zoea III) of sample DW, and statistical analysis indicated significant differences in the percentage organic content between the larval stages. On this basis the results relating to fatty acid composition of larvae were presented on a per unit ash free dry weight (AFDW) basis. The total fatty acid content of larval tissues increased from 22.89 ± 3.72 μg mg-1 AFDW in newly hatched zoea I larvae, peaking at 31.38 ± 18.30 μg mg-1 AFDW at zoea V before dropping down to 24.92 ± 13.56 μg mg-1 AFDW at the megalopa stage. During the first zoea stage, saturated fatty acids (SFA) and highly unsaturated fatty acids (HUFA), dominated the fatty acid profile, while monounsaturated fatty acids (MUFA) were less abundant. As the larval developed the HUFA were depleted, while an increase in MUFA was recorded during the zoea V and megalopa stages, suggesting that HUFA requirements go down during the later part of larval development. The fatty acid composition was relatively stable throughout larval development, dominated by palmitic acid (16:0), stearic acid (18:0), oleic acid (18:1n- 9), arachidonic acid (20:4-n-6, AA), eicosapentaenoic acid (20:5n-3, EPA) and docosahexaenoic acid (22:6n-3, DHA). A substantial increase in linolenic acid (18:3n-3, LNA) levels was recorded in zoea V larvae, a result probably linked to the elevated LNA content in enriched Artemia meta-nauplii used as food for later stage larvae. When subjected to starvation, crustaceans go through distinct phases of biomass degradation. This process is useful for identification of key fatty acids, and Chapter 8 reports on the changes in lipid and fatty acid metabolism observed in zoea V and megalopa subjected to feeding and starvation, respectively. The objective was to gain a better understanding of fatty acid utilization, and to identify possible changes in lipid requirements during the two last larval stages, which again may be linked to the high incidence of MDS during these larvae stages in mud crab hatcheries. Larvae were reared following established hatchery protocols, and newly molted zoea V and megalopae were subject to 4 days of feeding or starvation, and larval tissue was sampled for lipid analysis. An additional 6 day starvation treatment was incorporated for the megalopa stage as a response to the longer duration of this larval stage compared to the zoea stages. The results showed that fatty acids had an important role as an energy store in starved larvae, and the fatty acid content of larval tissue was reduced by 71.93% and 72.96% for zoea V and megalopa, respectively, during the 4 day starvation period. Further depletion of stored fatty acids was not, however, observed when megalopae were starved for another 2 days, indicating that other nutrient sources are utilized for energy when larvae are subject to prolonged starvation. Fatty acids from the polar lipid fraction dominated larval tissue, while fatty acids from the neutral lipid fraction were preferentially metabolized for energy during food deprivation. Depletion of both SFA, MUFA and HUFA was observed among unfed larvae, and in accordance with the findings in the previous chapter, depletion of EPA, DHA and AA indicated a possible decreasing requirement of these fatty acids during later larval development. Fed larvae, on the other hand, maintained more stable fatty acid levels, and they were able to sequester a range of fatty acids from live Artemia. Comparison of the lipid profile of starved and fed larvae highlights an inability for de novo synthesis of both C18 fatty acids such as LNA, and HUFA like DHA, EPA and AA. This project utilised integrated methodology to study lipid requirements of mud crab larvae. Growth trials were the most optimal way of specifying nutritional requirement, while biochemical analysis was used to gain a deeper understanding of the underlying mechanisms behind growth promotion. The findings have significantly enhanced our current understanding of dietary lipid requirements and utilization in mud crab larvae, which will have significant implications for the development of a nutritionally appropriate MBD for S. serrata larval culture in the future.

碩士
國立中山大學
海洋生物研究所
86
The hemocyanin during vitellogenesis, embryo and larval development wasstudied in the red-claw mud crab, Scylla olivacea. After purified from ion exchange chromatography, subunit composition was analyzed using SDS-PAGE. Inaddition, rabbit antisera were prepared by injections of the purified hemocyanin. These antisera were used to compare the difference among each type of hemocyanin.Two hemocyanin forms, hexamer and dodecamers were found in native-PAGE of hemolymph samples from males and immature females. An additional female specificprotein (FSP) was found in the hemolymph from mature female. When gel bands were tested for the presence of copper, FSP and other hemocyanins all gave pos-itive reactions. The female specific proteinnot only exited in the hemolymph of mature female, but also in ovary and embryoand first zoeal instar. Morever, FSP was the only hemocyanin type in ovary andembryo tissue. Besides, the FSP contain increased in both hemolymph and oocytes as the ovary maturing but decreasedin embryos as embryo developing. It is suggested, FSP is synthesized in tissuesoutsides the ovary and stored in oocytes through hemolymph by endocytosisduring vitellogesis and then degenerated or changed to other hemocyanin formsduring embryonic development. The composition of three form hemocyanins from mature female was analyzed by SDS-PAGE. The dodecamers showed six distinct subunits and FSP and hexamerswere composed of only five of the six subunits, both luck subunit a. The presence of subunit a in dodecamers is consistent withthe idea that subunita is necessary for the formation of the two-hexamer aggregate.Immunoprecipitationreaction of three hemocyanin types was tested with antiserumagainst female specific protein and hemocyanin. It showes that the FSPand hexamer had thehigher cross reaction thus they may have similar molecularstructure. In addition,the subunit composition of isolated polymeric forms ofhemocyanin was analyzed by crossed immunoelectrophoresis. The dodecamers revealed four precipitation peaks-I, II, III and IV, but FSP and hexamers contained only three precipitation peaks. These results suggest that the subunit IV is required as a joining piece for the assembly of dodecamers.-1 -aChanges in the hemocyanin structure during vitellogensis, embryo and larval development of red-claw mud crab, Scylla olivacea

碩士
國立彰化師範大學
生物學系
93
Crustacean hyperglycemic hormone (CHH) is a neuropeptide original identified from the X-organ (XO)-sinus gland (SG) complex in the crustacean eyestalk. In the present work, three full-length CHH cDNAs were cloned from the mud crab Scylla olivacea eyestalk ganglia (ES), thoracic ganglia (TG), and per- icardial organ (PO) by RT-PCR and rapid amplification of cDNA end (RACE). PO-CHH and TG-CHH have the same deduced amino acid sequence. TG/PO-CHH and sinus gland CHH (SG-CHH) share an identical N-terminal sequence (amino acids 1-40), but the remaining sequences (amino acids 41-73 or 41-75), differ considerably. The sequence evidence suggests that these two isoforms are derived a Chh gene transcribed in an alternative splicing manner. With the use of a two-step HPLC purification procedure and a CHH isoform- specific ELISA, the two CHH isoforms were isolated from sinus gland and pericardial organ, respectively. Mass spectrometric analysis indicates that the molecular masses for the native SG-CHH and TG/PO-CHH are 8379 Da and 8478 Da, respectively, which are consistent with the estimated values based on the deduced sequences. It also suggests that the two CHHs have a blocked N- terminus, and the C-terminus of SG-CHH is amidated, but TG/PO-CHH has a free C-terminus. The partial amino acid sequences of SG-CHH and TG/PO- CHH were determined by MALDI MS/MS analysis of trypsin-digested peptide fragments. The results show that the amino acid sequences of these peptide fragments were identical to the deduced amino acid sequences of the SG-CHH and TG/PO-CHH cDNAs. In addition, SG-CHH (10 pmole) exhibited a hyper- glycemic activity in vivo, whereas the same dosage of TG/PO-CHH did not elicit a hyperglycemic response. The physiological function of TG/PO-CHH remains to be clarified. We speculate that TG/PO-CHH may have regulatory functions differ from those of SG-CHH.

The mud crab, Scylla serrata and the spiny lobster, Panulirus ornatus, are high value crustaceans in the tropics and sub-tropics of the Indo-Pacific region subject to intense fisheries pressure, particularly in Asia where no catch limits are imposed and fishery laws are often not strictly enforced. Because of increasing demand and dwindling fisheries landings, interest in aquaculture of both species has grown strongly over recent years. However, continued dependence on wild seed for stocking has been a major bottleneck for expansion and further development of aquaculture industries for both species. Hatchery techniques for these species have received significant research attention over recent years but considerable development is required to further improve survival and bring commercial viability to hatchery operations. One of the most important yet poorly understood components of hatchery production of crustaceans is larval nutrition, particularly the aspects of larval nutritional requirements and digestive capacity. Larvae of aquatic animals, particularly early larvae, rely primarily on chemical digestion of ingested foods with the aid of enzymes. This study assayed the major digestive enzymes during larval development of both S. serrata and P. ornatus to assess larval capacity to digest major nutrients and to evaluate the relative utilization of these nutrients for energy: (a) during embryonic development and starvation of the newly hatched larvae (Chapter 3); (b) under different conditions of intermittent food availability (Chapter 4); (c) in response to different food quantity and quality (Chapter 5); and (d) at different stages of the moult cycle and larval ontogeny (Chapter 6). Following the general introduction (Chapter 1) and general materials and methods (Chapter 2) sections, changes in activities of the three major digestive enzymes (amylase, protease and esterase) during embryonic development of S. serrata and P. ornatus, as well as in unfed newly hatched larvae, were examined in Chapter 3. For both species, esterase activities started to increase significantly during the early phase of embryonic development while amylase and protease activities remained at about the same levels, suggesting that lipids were the nutrients most heavily utilized during the early embryonic development in both species. However, towards the end of embryonic development, amylase and protease activities increased while esterase activities showed decreasing trends, suggesting that as lipid reserves were depleted and became insufficient to meet the increasing energy demand, protein reserves, and to some extent carbohydrates, were increasingly utilized. It was further shown that proteins continued to be the main energy source of newly hatched larvae during the initial phase of starvation for both S. serrata and P. ornatus as higher levels of protease compared to esterase and amylase were present in starved newly hatched larvae of both species. Chapter 4 was designed to examine changes in the major digestive enzyme activities of first feeding larvae of S. serrata and P. ornatus subject to different food availability conditions: (a) when food was immediately available (fed) vs. when food was not immediately available (starved); (b) when food was initially available (fed) and then withdrawn; and (c) when initial feeding was delayed for different durations. These experiments were intended to obtain insights into how first feeding larvae manipulate their enzyme activities in order to adapt to various conditions of intermittent food availability likely to occur in their natural environment, which should provide useful information for the development of larval formulated diets and hatchery feeding protocols. The enzyme activity responses of first feeding zoeae of S. serrata suggested that protein reserves were the main energy source while no food was available, but where food is available, first feeding zoeae spared proteins and utilized carbohydrates and lipids more extensively. In starved zoeae, protease activity, which was comparably much higher than amylase and esterase activities, remained high throughout the 72 h sampling duration. In contrast, protease activity in fed zoeae initially decreased sharply to very low levels although it eventually increased prior to moulting. Meanwhile, amylase and esterase activities gradually increased, suggesting that fed larvae were possibly building-up protein reserves. The enzyme reponses of first feeding P. ornatus phyllosoma suggest their ability to utilize all three major nutrients, i.e., carbohydrates, proteins and lipids, but also highlight their capacity to prioritise the use of carbohydrates when fed. This was illustrated by the immediate and notable increase in amylase activity in fed phyllosoma, which remained high over following days, however such a phenomenon was not observed in starved larvae. When food was removed after the phyllosoma were fed for 24 h, amylase activity decreased back to low levels, suggesting that the phyllosoma quickly responsed to the withdrawal of food by substantially reducing their utilization of carbohydrates and shifting to greater utilization of proteins and lipids. Newly hatched zoeae of S. serrata and phyllosoma of P. ornatus both showed an ability to compensate for delayed food availability by increasing amylase activity when initial feeding was delayed for varying durations. Both specific and total amylase activities of newly hatched zoeae where feeding was delayed for a period of 12 h to 36 h, were significantly higher than those of larvae fed immediately after hatching for the same 12 h duration. In newly hatched phyllosoma where feeding was delayed for a period of 24 h before being fed for 24 h, both specific and total amylase activities were also significantly higher than those fed immediately after hatching for the same 24 h period. However, such a response was no longer observed when feeding was delayed beyond 24 h, suggesting that the ability of newly hatched phyllosoma to compensate for the delayed food intake diminished as the starvation period extended. In Chapter 5, the digestive enzyme responses of larvae to quantity and quality of foods, particularly in terms of food density and food type were investigated. The results of this chapter clearly showed that both food quantity and quality significantly influenced larval digestive enzyme dynamics. Both S. serrata and P. ornatus larvae showed an ability to maximize the utilization of available food by increasing their digestive enzyme activities in response to increasing prey density. Comparison of enzyme activities of Zoea I S. serrata fed different densities of rotifers showed that the rotifer densities that resulted in maximal digestive enzyme activities fell within the range considered optimal for larval rearing of this species. A similar result was obtained for Stage I phyllosoma of P. ornatus fed different densities of Artemia nauplii. These results together suggest that digestive enzyme activity can be a good indicator of appropriate prey density used in larval rearing. The digestive enzyme responses of Zoea II and megalopae of S. serrata to different types of food helped identify their relative nutritional values to the larvae. The digestive enzyme responses of Zoea II fed rotifers and Artemia, respectively, largely reflected the relative proximate contents of these two most commonly used hatchery prey. Similarly, the enzyme activities of megalopae fed either a microbound diet (MBD) developed in this laboratory or Artemia also indicated differences in digestibility and nutritional quality of Artemia compared to the formulated MBD. Huge differences in amylase activity detected between megalopae fed the MBD and those fed Artemia indicated a possible significant role of dietary carbohydrates in megalopal nutrition and a carbohydrate deficiency in the MBD used. In Chapter 6, changes in digestive enzyme activities during the moult cycle and in the course of larval ontogeny of S. serrata and P. ornatus were examined. The results of activity changes in the major digestive enzymes related to the moult cycle of newly hatched Zoea I and Megalopa as the postlarvae of S. serrata, as well as Stage I and II phyllosoma of P. ornatus, provided insights into the utilization of major nutrients during the recurring episodes of feeding activity changes related to the moult cycle of larvae. During the moult cycle of S. serrata Zoea I, newly hatched zoeae appeared to initially spare proteins and relied more on carbohydrates and lipids for energy, but as the moult cycle progressed, all three major nutrients were utilized when the larvae were actively feeding during the inter-moult stage. On the other hand, newly moulted megalopae seemed to initially utilize carbohydrates and proteins heavily while sparing lipids, however, as the moult cycle advanced, all three major nutrients were utilized and, during the second half of the moult cycle, megalopae relied more on lipids. During the moult cycle of P. ornatus Stage I phyllosoma, newly hatched larvae initially utilized carbohydrates and proteins to a greater extent, however as they developed towards moulting, there was a trend of gradually increasing lipid utilization. During the initial phase of the moult cycle of Stage II phyllosoma, utilization of carbohydrates and lipids was increased while protein utilization was slightly reduced. During the second half of the moult cycle, lipids were increasingly utilized as the phyllosoma approached moulting. Changes in major digestive enzyme activities as larvae developed progressively into subsequent stages revealed ontogenetic improvements in the digestive capacity of both S. serrata and P. ornatus larvae. Comparison of results of specific and total activities showed that total activity appeared to be a better way of expressing changes in enzyme activities during larval ontogeny. In S. serrata larvae, the total activities of the major digestive enzymes clearly increased with larval development but more dramatic improvements occurred at Zoea IV, Zoea V and Megalopal stages. During the development of P. ornatus phyllosoma from Stages I to V, the activities of all three major digestive enzymes also increased from one stage to next stage, but these increases were much more pronounced at Stage IV and V, where protease and esterase activities more than doubled. These results suggest that significant improvements in digestive capacity occur from Zoea IV onward for S. serrata and from Stage IV for P. ornatus, which may imply better chances of success in introducing formulated diets at, or beyond, these larval stages. Chapter 7 summarizes the results of this study and offers general discussion within a broader context. Overall, the results of this research clearly demonstrated that analysis of digestive enzyme activities is a valuable method for the study of larval nutrition. For example, digestive enzyme activities could be used to indicate the relative utilization of various nutrients by the developing embryo and newly hatched larvae, providing useful information that could be used in the formulation of broodstock diets that could improve the quality of the newly hatched larvae. The enzyme responses of larvae to various conditions of food availability, food quality and quantity, as well as during recurring moulting cycles, also provides important information that could be used as the basis for devising appropriate larval feeding regimes and feeding protocols in hatcheries. Furthermore, changes in enzyme activities during larval ontogeny provide information on the digestive capacity of the various larval stages, providing clues regarding the suitable timing for introduction of formulated diets.

碩士
國立彰化師範大學
生物學系
96
Sco-CHH and Sco-CHH-L (CHH-like peptide), two structural variants of the crustacean hyperglycemic hormone family identified in the mud crab (Scylla olivacea), are identical up to the 40th residue, but different from each other in the remaining sequence. In this study, recombinant proteins (rSco-CHH and rSco-CHH-L) were produced by an E. coil expression system, refolded, purified, and confirmed by Western blotting and mass spectrometric analyses. Purified rSco-CHH was C-terminally amidated (rSco-CHHamide) in accordance with its native counterpart. Circular dichromatic spectra of rSco-CHHamide and rSco-CHH-L indicate they are rich in -helixes (47 % and 46 %, respectively); mass spectrometric analyses of peptide fragments of rSco-CHH and rSco-CHH-L reveal a common disulfide bond pattern typical of CHH family peptides. Functionally, rSco-CHHamide at 10 or 100 pmoles/animal elicited significant hyperglycemic responses, whereas rSco-CHH-L had no effect at the same dosage. On the other hand, rSco-CHH-L, but not rSco-CHHamide, dose-dependently (0-400 nM) increased the gill Na+/K+-ATPase activity. Finally, gene expression assays showed that the levels of Sco-CHH-L, but not Sco-CHH, were significantly increased in acclimated animals 12 h after exposing to an osmotic stress. In summary, recombinant Sco-CHH and Sco-CHH-L were successfully produced and characterized. Studies using the recombinant proteins provide evidence revealing that the 2 CHH structural variants diverge functionally.

碩士
國立海洋大學
水產養殖學系
84
This study was conducted to investigate the effects of diets with different sources of lipid and different quantity of polyunsaturated fatty acids (PUFA) or highly unsaturated fatty acids (HUFA) on the growth and survival of juvenile crabs. In Experiment 1, juvenile crabs were fed with diets supplemented with 4 % cod liver oil, corn oil, olive oil, soybean oil and sesame oil for 10 weeks. The results showed that juvenile crabs fed with 4 % cod liver oil had the best growth. Juvenile crabs fed with diets containing corn oil, olive oil, soybean oil and sesame oil showed no significant differences. Juvenile crabs fed diets containing cod liver oil had high level of EPA and DHA of body tissue of juvenile crabs. These results showed that the fatty acid composition of tissue of crabs was obviously reflected from fatty acid composition of diet. Weight gain and survival responses and analyses of fatty acid composition of tissue were used to investigate the nutritional value of C18 polyunsaturated fatty acids (PUFA) provided to juvenile crabs in a purified diet. There were seven isonitrogenous and isoenergetic diets containing pure triglycerides of 0.2, 0.4 and 0.6﹪18:3n-3 (trilinolenin) and 18:2n-6 (trilinolein) and 0.2 ﹪22:6n-3 (tridocosahexaenoin) as control diet for experiment 2 . All diets were formulated to contain a total of 4﹪lipid and were fed to juvenile crabs for 12 weeks. The results showed that juvenile crabs fed diets containing 0.2﹪tridocosahexaenoin showed better growth than those fed diets containing trilinolenin and trilinolein. Diets containing high proportion of trilinolein or trilinolenin could not improve the growth of juvenile crabs. The high level of 18:2n-6 and 18:3n-3 in the polar and neutral lipids of tissue of juvenile crabs was found that crabs were fed diets containing trilinolein or trilinolenin. Crab fed diet containing 0.2 % tridocosahexaenoin had high level of EPA and DHA in the polar lipid of crab tissue. Weight gain and survival responses and analyses of fatty acid composition of tissue were used to investigate the nutritional value of C≧20 highly unsaturated fatty acids (HUFA) provided to juvenile crabs in a purified diet. There were isonitrogenous and isoenergetic diets containing pure triglycerides of 0.2, 0.4 and 0.6﹪20:4n-6 (triarachidonin) and 22:6n-3 (tridocosahexaenoin). Reference diet was included cod liver oil as the lipid source. All diets were formulated to contain a total of 4﹪lipid. A diets containing only saturated (14:0, 16:0, and 18:0) and monounsaturated (16:1n-7 and 18:1n-9) fatty acids as lipid sources, in proportions similar to that found in a 2:1 cod liver oil/corn oil mixture, served as a conditioning and control diets for experiment {= 3 \* ROMAN|III}. At the termination of the feeding trials, that juvenile crabs fed diets containing 0.4 % tridocosahexaenoin and 4 % cod liver oil had the best growth. The control group (diet included without PUFA and HUFA) had the lowest growth and survival. Crab fed diets containing 0.6 % triarachidonin and control group had high mortality. Crab fed diets containing triarachidonin (20:4n-6) and tridocosahexaenoin (22:6n-3) had high level of 20:4n-6 and 22:6n-3 in the tissue. However, crab fed diets containing tridocosahexaenoin (22:6n-3) had high level of EPA and DHA in the polar lipid of crab tissue.

Pathogens and disease throughout the larval stage of the mud crab Scylla serrata are said to be responsible for preventing the establishment of a viable mud crab aquaculture industry within Australia. Vibriosis has been demonstrated as the underlying cause for inconsistent survival of larvae of the mud crab S. serrata (Mann et al. 1998). Initial investigations of this study were directed at gaining an understanding of virulence factors of vibrios, namely siderophores, haemolysin, chitinases and bacteriophages. Haemolysin, chitinase and siderophore activity were assessed through observation on specifically prepared agars. Detection of a bacteriophage was conducted by mitomycin C induced growth curves. It was visibly evident that the LLD1 strain of V. harveyi had the greatest haemolysin production compared to the other strains. The V. harveyi strain 12 produced the least haemolytic activity. Colony and halo diameter of the strains were as a group, significantly different (F=70.78,df=4, 100, P<0.0001) and (F=148.31,df=4, 100, P<0.0001) respectively. When examining chitinase activity, strains 12 and LLB2 were the only isolates that did not produce an evident zone of clearance. Colony and halo diameter of chitinases of the above strains were as a group, significantly different (F=41.46,df=5, 60, P<0.0001) and (F=118.03,df=5, 60, P<0.0001) respectively. It was visibly evident that the selected probiotic isolate V. harveyi LLB1 had the greatest siderophore production compared to the other strains. Colony and halo diameter of siderophores of the strains were as a group significantly different (F=22.79,df=4, 50, P<0.0001) and (F=172.97,df=4, 50, P<0.0001) respectively. From the four isolates that were concentrated through ultracentrifugation and analysed by TEM, V. harveyi 642 was the only isolate to possess a bacteriophage. The effectiveness of an environmental probiotic, referred to as the V. alginolyticus LLB2, was assessed on the survival of larvae of S. serrata when challenged with a virulent V. harveyi strain. The factors of the experimental trial, the bacterial isolate and concentration of bacteria, were significantly different as a group (P<0.0001) indicating that survival of zoea were affected by these factors. It was evident that there was a definite trend between increase in concentrations of bacteria and an increase in mortalities. It was also evident that treatments with V. alginolyticus LLB2 led to the highest survival, which also happened to be at a concentration of 105 CFU ml-1. Treatment consisting of V. harveyi LLD1 obtained the lowest survival at a concentration of 105 CFU ml-1. Treatments that were inoculated at a cell density of 105 CFU ml-1 with the virulent Vibrio harveyi strains LLD1 and 642 and supplemented with the probiotic V. alginolyticus LLB2 had significantly higher survival rate (P>0.05) than the treatment inoculated with V.harveyi LLD1 and 642 alone. These results suggest that the probiotic V. alginolyticus LLB2 demonstrated a protective effect towards the larvae of S. serrata when challenged with a virulent V. harveyi isolate. A histological investigation was carried out on the possible diseases associated with the larvae of S. serrata, and adult mud crabs. Cells within the hepatopancreas in both the larvae and adults showed nuclear pathology. Amorphous basophilic intranuclear inclusions, which were markedly hypertrophied were observed. These observations were similar to the initial surveys of the intranuclear bacilliform virus Scylla baculovirus virus (SBV) in adult S. serrata (Anderson and Prior 1992). From 15 batches of larvae that were surveyed only two batches of individuals were found to carry SBV. The prevalences of infected larvae were 32.26% and 52.17 %, respectively, where as 8% of 25 adult crabs from the Townsville region were infected. Following the detection of an intranuclear bacilliform virus within the larvae of S. serrata, presumably SBV, an attempt was made to amplify the nucleotide sequence of this virus. Novel primer sets were designed from the protein-binding gene from WSSV which is said to be homologous to that of the insect baculovirus. Only the primer set BP2, BP2 5’ – AAAAATGGTTGCCCGAAGCTC and BP2 5’ – TGAGGAACGGCGACGGACAG-3’ were successful in producing amplicons. When the relatedness of the amplicon sequences were compared to available databases using Basic Local Alignment Search Tool (BLAST), there were no significant phylogenetic matches. This has been the first time the intranuclear bacilliform virus SBV has been identified in larvae of S. serrata, as well as the first partial sequence from SBV. The investigation of virulence mechanisms possessed by Vibrio sp. as well as the use of environmental probiotics in attempt to control vibriosis, will provide a sound basis for future studies in diseases in the mud crab S. serrata.

碩士
東海大學
生命科學系
104
The biodiversity of estuarine wetlands was affected by natural process and human disturbance, such as seawall construction, pollution, and tidal effect. Many kinds of data were used to be indicators for quantifying the quality of wetland, including water quality, the biodiversity or composition of birds, fishes, invertebrates, or condition of coastline. Among the biodiversity indices, Abundance Biomass Comparison Method (ABC method) is used to detect the effect of environmental stress on marine macro benthic communities and was widely used on fish or benthic community in recent years. ABC method was applied to one of the previous study in our lab in 2003 and, in that study, the crab communities in Da’an, Gaomei, and Dadu wetlands were all under moderately stressed. But the environmental factors were not included in the discussion of that study. Therefore, the first part of this study was to exam the association between environmental factors and crab community. The second part of this study is to assess the environmental stress on the three wetlands in ten years through analyzing the difference of crab community in different year. Biotope Area Factor (BAF) was widely used in landscape ecology. In BAF, it is hypothesized that different land uses were weighed by the permeability and vegetation cover ratio. When the surface has a higher permeability or more vegetation covered, a higher ecologically-effective weighting will be given. Therefore, BAF may be applied to assess the level of human development near wetlands. But there were no ecological data available for supporting the ecologically-effective part and the linkage between BAF and biodiversity was not known. The third part of this study was to test whether the BAF value correlated with species diversity of wetlands. I used ABC method to study crab composition of the four wetlands in central Taiwan and collected soil samples to analyze soil content. The adjacent land use in four wetlands was included to obtain BAF value and crab community was to obtain Shannon-Wiener index and Simpson indices. Results indicated that crab community was affected by soil organic content, soil water content, soil particle size, soil pH, and habitat types. From my study in 2013, the crab community in Gaomei wetland was under higher environmental stress than that in 2003, and the composition of crab communities in 2003 and 2013 were different. It could result from the human disturbance on Gaomei wetland. There was no correlation between BAF and biodiversity indices (Shannon-Wiener and Simpson indices), but crab community was significantly different in different types of adjacent land use. The environment of wetland may be affected by adjacent land use and crab community may be indirectly affected by adjacent land use.