Gotowa bibliografia na temat „Hf5625.15 .c4 2007”

Abstract. A continuous lacustrine sediment core obtained from the Kathmandu Valley in the Central Himalayas revealed that cyclical changes in C3/C4 vegetation corresponded to global glacial-interglacial cycles from marine isotope stages (MIS) 15 to MIS 4. The C3/C4 vegetation shifts were reconstructed from significant changes in the δ13C values of bulk organic carbon. Glacial ages were characterized by significant 13C enrichment, due to the expansion of C4 plants, attributed to an intensification of aridity. Thus, the southwest (SW) summer monsoon, which brings the majority of rainfall to the Central Himalayan southern slopes, would have been weaker. Marine sediment cores from the Indian Ocean and Arabian Sea have demonstrated a weaker SW monsoon during glacial periods, and our results confirm that arid conditions and a weak SW monsoon prevailed in the continental interior of the Central Himalayas during glacial ages. This study provides the first continuous record for the continental interior of paleoenvironmental changes directly influenced by the Indian monsoon.

Abstract. Life on earth drives a continuous exchange of carbon between soils and the atmosphere. Some forms of soil carbon, or organic matter, are more stable and have a longer residence time in soil than others. Relative differences in stability have often been derived from shifts in δ13C (which is bound to a vegetation change from C3 to C4 type) or through 14C-dating (which is bound to small sample numbers because of high measurement costs). Here, we propose a new concept based on the increase in δ15N and the decrease in C:N ratio with increasing stability. We tested the concept on grasslands at different elevations in the Swiss Alps. Depending on elevation and soil depth, it predicted mineral-associated organic carbon to be 3 to 73 times more stable than particulate organic carbon. Analysis of 14C-ages generally endorsed these predictions.

Abstract. We investigated the fate of root and litter derived carbon into soil organic matter and dissolved organic matter in soil profiles, in order to explain unexpected positive effects of plant diversity on carbon storage. A time series of soil and soil solution samples was investigated at the field site of The Jena Experiment. In addition to the main biodiversity experiment with C3 plants, a C4 species (Amaranthus retroflexus L.) naturally labeled with 13C was grown on an extra plot. Changes in organic carbon concentration in soil and soil solution were combined with stable isotope measurements to follow the fate of plant carbon into the soil and soil solution. A split plot design with plant litter removal versus double litter input simulated differences in biomass input. After 2 years, the no litter and double litter treatment, respectively, showed an increase of 381 g C m−2 and 263 g C m−2 to 20 cm depth, while 71 g C m−2 and 393 g C m−2 were lost between 20 and 30 cm depth. The isotopic label in the top 5 cm indicated that 11 and 15% of soil organic carbon were derived from plant material on the no litter and the double litter treatment, respectively. Without litter, this equals the total amount of carbon newly stored in soil, whereas with double litter this corresponds to twice the amount of stored carbon. Our results indicate that litter input resulted in lower carbon storage and larger carbon losses and consequently accelerated turnover of soil organic carbon. Isotopic evidence showed that inherited soil organic carbon was replaced by fresh plant carbon near the soil surface. Our results suggest that primarily carbon released from soil organic matter, not newly introduced plant organic matter, was transported in the soil solution and contributed to the observed carbon storage in deeper horizons.

The climatic projections for this century indicate the possibility of severe consequences for human beings, especially for agriculture where adverse effects to productivity of crops and to agribusiness as a whole may occur. An agrometeorological model was used to estimate sugarcane yield in tropical southern Brazil, based on future A1B climatic scenarios presented in the fourth Intergovernmental Panel on Climate Change report, in 2007. Sugarcane yield was evaluated for 2020, 2050, and 2080 considering the possible impacts caused by changes in temperature, precipitation, sunshine hours and CO2 concentration in the atmosphere, as well as technological advances. Increasingly higher temperatures will cause an increase of the potential productivity (PP), since this variable positively affects the efficiency of the photosynthetic processes of C4 plants. Changes in solar radiation and rainfall, however, will have less impact. PP will increase by 15% in relation to the present condition in 2020, by 33% in 2050 and by 47% in 2080. Regarding the actual productivities (AP), the increase observed in PP will compensate for the negative effect of the projected increase in water deficit. AP will increase by 12% in relation to the present condition in 2020, by 32% in 2050 and by 47% in 2080. The increase in sugarcane productivity resulting from the projected scenarios will have important impacts on the sugarcane sector.

Abstract Background Brentuximab vedotin (BV) was the first antibody-drug conjugate to be approved in multiple cancer types (Gauzy-Lazo 2020). The combination of a CD30-directed monoclonal antibody, a protease-cleavable linker, and the microtubule-disrupting agent monomethyl auristatin E drives the anticancer activity of BV by inducing CD30-targeted cell cycle arrest and apoptosis as well as the bystander effect on adjacent cells (Sutherland 2006, Hansen 2016, Schönberger 2018). In the ECHELON-2 phase 3 clinical trial, BV, cyclophosphamide, doxorubicin, and prednisone (A+CHP) showed efficacy in patients with peripheral T-cell lymphoma (PTCL) across a range of CD30 expression levels, including the lowest eligible level of 10% by immunohistochemistry when compared with patients treated with cyclophosphamide, doxorubicin, vincristine, and prednisone (CHOP) (Advani 2019). It is hypothesized that A+CHP will demonstrate efficacy in PTCL with <10% CD30 expression because i) clinical responses to BV have occurred in patients with PTCL, cutaneous T-cell lymphoma, or B-cell lymphoma with low (<10%) and undetectable CD30 expression (Jagadeesh 2019) and ii) CD30 expression levels were not predictive of A+CHP responses in non-systemic anaplastic large cell lymphoma (sALCL) (Advani 2019). Study Design and Methods SGN35-032 is a dual-cohort, open-label, multicenter, phase 2 clinical trial (NCT04569032) designed to evaluate the efficacy and safety of A+CHP in patients with non-sALCL PTCL and CD30 expression of <10% on tumor cells. Up to approximately 40 patients will be enrolled in each of the CD30-negative (expression <1%) and the CD30-low (expression ≥1% to <10%) cohorts. Patients will be enrolled based on local results but only patients with CD30 expression <10% per central confirmation will be analyzed for the primary and secondary endpoints. Patients will receive 21-day cycles of A+CHP for 6-8 cycles. Key inclusion criteria include adults with newly diagnosed PTCL, excluding sALCL, per the World Health Organization 2016 classification; CD30 expression <10% by local assessment; and fluorodeoxyglucose-avid disease by positron emission tomography (PET) and measurable disease of at least 1.5 cm by computed tomography (CT), as assessed by the site radiologist. Patients with previous exposure to BV or doxorubicin will not be eligible. The primary endpoint of this trial is objective response rate (ORR) per blinded independent central review (BICR) using the Revised Response Criteria for Malignant Lymphoma (Cheson 2007). Secondary endpoints include ORR by BICR using the modified Lugano criteria (Cheson 2014), complete response rate, progression-free survival (PFS), and duration of response per BICR using the Revised Response Criteria for Malignant Lymphoma (Cheson 2007), overall survival, and safety and tolerability. A PET scan is required at baseline, after Cycle 4, and after the completion of study treatment. Follow-up restaging CT scans will be performed over the next 2 years. In both the CD30-negative and the CD30-low cohorts, efficacy and safety endpoints will be summarized using descriptive statistics to describe continuous variables by cohort. Time-to-event endpoints, such as PFS, will be estimated using Kaplan-Meier (KM) methodology and KM plots will be presented. Medians for time-to-event analyses (e.g., median PFS) will be presented and two-sided 95% confidence intervals will be calculated using the log-log transformation method. Enrollment is planned for 15 US sites and 32 sites across the Czech Republic, France, Italy, and the UK. Disclosures Knowles: Seagen Inc.: Current Employment. Horwitz: ADC Therapeutics, Affimed, Aileron, Celgene, Daiichi Sankyo, Forty Seven, Inc., Kyowa Hakko Kirin, Millennium /Takeda, Seattle Genetics, Trillium Therapeutics, and Verastem/SecuraBio.: Consultancy, Research Funding; Affimed: Research Funding; Aileron: Research Funding; Acrotech Biopharma, Affimed, ADC Therapeutics, Astex, Merck, Portola Pharma, C4 Therapeutics, Celgene, Janssen, Kura Oncology, Kyowa Hakko Kirin, Myeloid Therapeutics, ONO Pharmaceuticals, Seattle Genetics, Shoreline Biosciences, Inc, Takeda, Trillium Th: Consultancy; Celgene: Research Funding; C4 Therapeutics: Consultancy; Crispr Therapeutics: Research Funding; Daiichi Sankyo: Research Funding; Forty Seven, Inc.: Research Funding; Kura Oncology: Consultancy; Kyowa Hakko Kirin: Consultancy, Research Funding; Millennium/Takeda: Research Funding; Myeloid Therapeutics: Consultancy; ONO Pharmaceuticals: Consultancy; Seattle Genetics: Consultancy, Research Funding; Secura Bio: Consultancy; Shoreline Biosciences, Inc.: Consultancy; Takeda: Consultancy; Trillium Therapeutics: Consultancy, Research Funding; Tubulis: Consultancy; Verastem/Securabio: Research Funding.

Young shoots and leaves of chayote (Sechium edule (Jacq.) Sw.) are commonly consumed as a vegetable in Taiwan. In Hualien County, the major chayote-production area of Taiwan, as much as 15% of chayote plants were not marketable between September and October 2010 because of mosaic symptoms on the leaves. Three symptomatic leaves were collected from each of three fields in Hualien. All nine samples tested positive for a begomovirus by PCR using general primer pair PAL1v1978B/PAR1c715H (3) and negative for Zucchini yellow mosaic virus, Cucumber mosaic virus, Cucumber green mottle mosaic virus, Melon yellow spot virus, Papaya ringspot virus - type W, Watermelon mosaic virus, and Watermelon silver mottle virus by ELISA (2). On the basis of the high nucleotide sequence identity (97.7 to 99.6%) of the 1.5-kb begomoviral DNA-A fragments, all nine samples were considered infected by the same begomovirus species. The 1.5-kb sequences had greatest nucleotide sequence identity (96.6 to 97.8%) with Squash leaf curl Philippines virus (SLCPHV) pumpkin isolate from Taiwan (1) (GenBank Accession No. DQ866135; SLCPHV-TW[TW:Pum:05]). One sample was selected to complete viral genomic DNA analysis. Abutting primer pairs PKA-V/C (PKA-V: 5′-AACGGATCCACTTATGCACGATTTCCCT-3′; PKA-C: 5′-TAAGGATCCCACATGTTGTGGAGCA-3′) and PKB-V/C (PKB-V: 5′-TGTCCATGGATTGATGCGTTATCGGA-3′; PKB-C: 5′-TGACCATGGCATTTCCGAGATCTCCCA-3′') were used to amplify the complete DNA-A and DNA-B, respectively. The sequences of DNA-A (GenBank Accession No. JF146795) and DNA-B (GenBank Accession No. JF146796) contain 2,734 and 2,715 nucleotides, respectively. The geminivirus conserved sequence TAATATTAC was found in both DNA-A and -B. The DNA-A has two open reading frames (ORFs) in the virus sense (V1 and V2) and four in the complementary sense (C1 to C4). The DNA-B also had one ORF each in the virus sense (BV1) and the complementary sense (BC1). When compared by BLASTn in GenBank and analyzed by MEGALIGN software (DNASTAR, Madison, WI), they were found to have greatest nucleotide identity (98.0 to 99.0% of DNA-A and 96.7% of DNA-B) with SLCPHV isolates from Taiwan. In addition, SLCPHV caused similar symptoms on leaves when transmitted to healthy chayote by viruliferous whitefly. In Taiwan, SLCPHV has been detected and sequenced from naturally infected melon (GenBank Accession No. EU479710), pumpkin (GenBank Accession No. DQ866135), and wax gourd (GenBank Accession No. EU310406). To our knowledge, this is the first report of SLCPHV infecting chayote plants in Taiwan. The prevalence of SLCPHV infection on different cucurbit crops should be taken into consideration for managing viral diseases in Taiwan. References: (1) W. S. Tsai et al. Plant Dis. 91:907, 2007. (2) W. S. Tsai et al. Plant Dis. 94:923, 2010. (3) W. S. Tsai et al. Online publication. doi: 10.1111/j.1365-3059.2011.02424.x. Plant Pathol., 2011.

In August 2009, yellowing, upward curling of leaves, and stunted growth were observed on 15 to 40% of dry bean (Phaseolus vulgaris cv. Aluvori) plants in each of several experimental fields in Zacatecas, Mexico. Symptoms and presence of the beet leafhopper (Circulifer tenellus) in affected fields suggested an infection by curtoviruses (Geminiviridae). Total DNA extracts from 18 plant samples exhibiting symptoms were obtained by a modified Dellaporta method (2) and subjected to PCR analysis using two pairs of new, degenerate primers specific for curtoviruses: RepQEW-for (CCRAARTAAGMATCRGCCCAYTCTTG) in combination with CP450-rev (GTCCTCGAGTAGACGGCATAGCCTGACC) and V2Gen910-for (ATGTCGACGAAGCATTTGAAGTTTGATATGGC) with Rep2GQ-rev (GAAGATCTGCWCGMGGAGGYCARCAGACGGCT). This double set of primers was used to amplify two overlapping DNA segments encompassing the complete curtovirus genome. All samples produced amplicons of the expected size (1.75 and 1.8 kb, respectively) that were cloned into pGEM-T Easy Vector (Promega, Madison, WI). Restriction fragment length polymorphism analysis of PCR clones with EcoRI and HinfI endonucleases suggested the presence of a single curtovirus species because only one restriction fragment pattern was observed in all cases. Viral amplicons from three plants were sequenced, and the overlapping DNA fragments were subsequently assembled into a complete genome sequence. Comparison of the virus sequence (Accession No. HQ634913) with sequences of all curtovirus isolates available in GenBank showed that it shared the highest nucleotide identity (98%) with Beet mild curly top virus-Mexico SLP1 from pepper (BMCTV-MX [SLP1]; Accession No. EU586260). Amino acid sequence identity of the seven predicted proteins (Rep, TrAP, REn, C4, V1, V2, and V3) encoded by the virus isolated from bean plants shared 98.0, 97.3, 98.5, 98.8, 100, 99.2, and 97.8% sequence identity, respectively, with the homologous proteins of BMCTV-MX [SLP1]. A BMCTV isolate from pepper collected in Zacatecas in 2007 (Accession No. EU586260) with 96% nucleotide sequence identity to the curtovirus identified in bean induced symptoms in P. vulgaris cv. Topcrop similar to those observed in bean in Zacatecas (1). To determine the presence of curtoviruses in the local populations of insect vectors, beet leafhoppers were collected in one of the sampled dry bean fields and total DNA was isolated from a pool of approximately 20 insects. Amplification of viral DNA with the degenerate primers RepQEW-for and CP450-rev and further sequencing of the PCR products confirmed the presence of a curtovirus DNA sharing almost identical nucleotide identity (99%) with the DNA isolated from bean plants. In 2011, symptoms similar to those observed in bean in 2009 occurred in approximately 30% of dry bean plants, suggesting that BMCTV is endemic in the Zacatecas Region. To our knowledge, this is the first report of BMCTV in legumes in Mexico. References: (1) L. F. Chen et al. Arch. Virol. 156:547, 2011. (2) S. L. Dellaporta et al. Plant Mol. Biol. Rep. 1:19, 1983.

Background: The incorporation of novel agents such as NEL and PEG to frontline therapy has been associated with improved outcomes in pediatric patients (pts) with T-ALL/LBL, but has not been extensively studied in the adult pts. BCL-2 upregulation has been demonstrated in T-lymphoblasts, especially of the early T-cell precursor (ETP) ALL and addition of VEN (BCL-2 inhibitor) may be beneficial. Methods: Pts with previously untreated or minimally pre-treated T-ALL/LBL were eligible if they had an ECOG PS ≤3, creatinine ≤ 2 mg/dL, total bilirubin ≤ 2 mg/dL and ALT/AST ≤ 4 x ULN. Pts received 8 cycles (C) of HCVAD (C 1,3, 5, 7) alternating with high dose Ara-C and methotrexate (MTX) (C 2, 4, 6, 8) at approximately 3-week intervals. Two cycles of NEL (650 mg/m 2 daily x 5) were initially administered after C8 (cohort 1). Later, after a protocol amendment, they were administered after C4 and C5 (cohort 2). Subsequently, the protocol was amended to add PEG (1500 IU/m 2 capped at 3750 IU; for pts age 60 or older, dose was 1000 IU/m 2, capped at 2000 IU) on day 5 of the NEL cycles (cohort 3) and more recently, VEN 400 mg daily was added on the first 7 days of each of 8 cycles of therapy (cohort 4); this was later modified to be given for 7 days during the induction cycle to all pts and reduced to 3 days per post-induction cycle only in pts with ETP-ALL or those with persistent measurable residual disease (MRD) and all other pts did not receive VEN after C1 (cohort 5). Pts with ETP-ALL were referred for allogeneic stem cell transplant (allo-SCT) in first complete remission (CR). After the completion of the intensive phase; pts in all cohorts received 30 cycles of maintenance therapy with monthly POMP (prednisone, vincristine, MTX, prednisone) and early intensification with NEL/PEG on C6 and 7 and late intensification with MTX/PEG in C18 and HCVAD on C19. All pts received 8 intrathecal chemotherapy with MTX alternating with Ara-C and mediastinal radiation was considered in pts with bulky mediastinal disease. Results: Between 7/2007 and 12/2022, 133 pts were enrolled in the 5 study cohorts sequentially (cohort 1= 30, 2= 49, 3=17, 4=16, 5=21) (Table 1). Eighty pts (60%) had T-ALL, 52 T-LBL (39%) and 1 pt had ETP/myeloid bi-phenotypic leukemia. The median age for the entire cohort was 35 years (yrs) (range 18-78), 102 pts were male (77%), 83 pts (62%) were white and 18 pts (14%) had PS ≥2. Overall, 24 pts (18%) had an ETP phenotype and another 19 pts (14%) had a near-ETP phenotype. Six pts (5%) had central nervous system disease at diagnosis, 72 pts (54%) had mediastinal disease, 49 of 80 (61%) T-ALL pts had extramedullary disease and 20 pts (15%) were in complete remission (CR) at trial enrollment after minimal pre-enrollment therapy. Overall response (CR+CRp+CRi+PR) on trial was attained in 109/113 (95%) pts [CR= 101 (89%), CRi/CRp= 3 (3%), PR=5 (4%)]. CR/CRi/CRp was attained in 36/41 (88%) pts with ETP/near-ETP ALL and 60/64 (94%) of confirmed near-ETP ALL pts ( p=0.31). At a median follow-up of 62 months (mos), the median overall survival (OS) was not reached (NR), 3-yr OS was 71% and 5-yr OS was 64% . The 3-yr OS for pts treated with HCVAD+NEL (cohort 1+2), HCVAD+NEL+PEG (Cohort 3) and HCVAD+NEL+PEG+VEN (Cohort 4+5) were 66%, 88% and 76% respectively (Figure 1). Median OS was not reached for both VEN cohorts, while 3-yr OS was 72% in cohort 4 compared to 88% in cohort 5 ( p=0.51), with significantly shorter follow-up for the latter (33 mos vs. 15 mos). Amongst the 124 pts who had CR/CRp/CRi, the median RFS was NR and 5-yr RFS was 68%. 24 (18%) pts underwent SCT in first remission, including 20 (83%) with ETP or near-ETP ALL. The median OS was shorter in the 44 ETP/near-ETP pts compared to the 77 pts with non-ETP phenotype (71 mos vs. NR, p=0.08). 30 and 60-day mortality was 0% and 1%. 10 pts (7.5%) died in remission (3, 5 and 2 pts in cohorts 1, 2 and 4 respectively) including 1 after SCT, 4 after developing therapy-related acute myeloid leukemia and 5 from infectious complications. Conclusion: The ongoing phase 2 trial of NEL, ASP, VEN added to the HCVAD regimen shows promising long-term survival in adult pts with T-ALL/LBL with 3-yr OS of 76%-88% in pts treated with HCVAD+NEL+PEG +/- VEN. Larger prospective trials and longer follow-up are needed to demonstrate further benefit.

Agriculture production is directly dependent on climate change and weather. Possible changes in temperature, precipitation and CO2 concentration are expected to significantly impact crop growth and ultimately we lose our crop productivity and indirectly affect the sustainable food availability issue. The overall impact of climate change on worldwide food production is considered to be low to moderate with successful adaptation and adequate irrigation. Climate change has a serious impact on the availability of various resources on the earth especially water, which sustains life on this planet. The global food security situation and outlook remains delicately imbalanced amid surplus food production and the prevalence of hunger, due to the complex interplay of social, economic, and ecological factors that mediate food security outcomes at various human and institutional scales. Weather aberration poses complex challenges in terms of increased variability and risk for food producers and the energy and water sectors. Changes in the biosphere, biodiversity and natural resources are adversely affecting human health and quality of life. Throughout the 21st century, India is projected to experience warming above global level. India will also begin to experience more seasonal variation in temperature with more warming in the winters than summers. Longevity of heat waves across India has extended in recent years with warmer night temperatures and hotter days, and this trend is expected to continue. Strategic research priorities are outlined for a range of sectors that underpin global food security, including: agriculture, ecosystem services from agriculture, climate change, international trade, water management solutions, the water-energy-food security nexus, service delivery to smallholders and women farmers, and better governance models and regional priority setting. There is a need to look beyond agriculture and invest in affordable and suitable farm technologies if the problem of food insecurity is to be addressed in a sustainable manner. Introduction Globally, agriculture is one of the most vulnerable sectors to climate change. This vulnerability is relatively higher in India in view of the large population depending on agriculture and poor coping capabilities of small and marginal farmers. Impacts of climate change pose a serious threat to food security. “Food security exists when all people, at all times, have physical and economic access to sufficient, safe and nutritious food that meets their dietary needs and food preferences for an active and healthy life” (World Food Summit, 1996). This definition gives rise to four dimensions of food security: availability of food, accessibility (economically and physically), utilization (the way it is used and assimilated by the human body) and stability of these three dimensions. According to the United Nations, in 2015, there are still 836 million people in the world living in extreme poverty (less than USD1.25/day) (UN, 2015). And according to the International Fund for Agricultural Development (IFAD), at least 70 percent of the very poor live in rural areas, most of them depending partly (or completely) on agriculture for their livelihoods. It is estimated that 500 million smallholder farms in the developing world are supporting almost 2 billion people, and in Asia and sub-Saharan Africa these small farms produce about 80 percent of the food consumed. Climate change threatens to reverse the progress made so far in the fight against hunger and malnutrition. As highlighted by the assessment report of the Intergovernmental Panel on Climate change (IPCC), climate change augments and intensifies risks to food security for the most vulnerable countries and populations. Few of the major risks induced by climate change, as identified by IPCC have direct consequences for food security (IPCC, 2007). These are mainly to loss of rural livelihoods and income, loss of marine and coastal ecosystems, livelihoods loss of terrestrial and inland water ecosystems and food insecurity (breakdown of food systems). Rural farmers, whose livelihood depends on the use of natural resources, are likely to bear the brunt of adverse impacts. Most of the crop simulation model runs and experiments under elevated temperature and carbon dioxide indicate that by 2030, a 3-7% decline in the yield of principal cereal crops like rice and wheat is likely in India by adoption of current production technologies. Global warming impacts growth, reproduction and yields of food and horticulture crops, increases crop water requirement, causes more soil erosion, increases thermal stress on animals leading to decreased milk yields and change the distribution and breeding season of fisheries. Fast changing climatic conditions, shrinking land, water and other natural resources with rapid growing population around the globe has put many challenges before us (Mukherjee, 2014). Food is going to be second most challenging issue for mankind in time to come. India will also begin to experience more seasonal variation in temperature with more warming in the winters than summers (Christensen et al., 2007). Climate change is posing a great threat to agriculture and food security in India and it's subcontinent. Water is the most critical agricultural input in India, as 55% of the total cultivated areas do not have irrigation facilities. Currently we are able to secure food supplies under these varying conditions. Under the threat of climate variability, our food grain production system becomes quite comfortable and easily accessible for local people. India's food grain production is estimated to rise 2 per cent in 2020-21 crop years to an all-time high of 303.34 million tonnes on better output of rice, wheat, pulse and coarse cereals amid good monsoon rains last year. In the 2019-20 crop year, the country's food grain output (comprising wheat, rice, pulses and coarse cereals) stood at a record 297.5 million tonnes (MT). Releasing the second advance estimates for 2020-21 crop year, the agriculture ministry said foodgrain production is projected at a record 303.34 MT. As per the data, rice production is pegged at record 120.32 MT as against 118.87 MT in the previous year. Wheat production is estimated to rise to a record 109.24 MT in 2020-21 from 107.86 MT in the previous year, while output of coarse cereals is likely to increase to 49.36 MT from 47.75 MT. Pulses output is seen at 24.42 MT, up from 23.03 MT in 2019-20 crop year. In the non-foodgrain category, the production of oilseeds is estimated at 37.31 MT in 2020-21 as against 33.22 MT in the previous year. Sugarcane production is pegged at 397.66 MT from 370.50 MT in the previous year, while cotton output is expected to be higher at 36.54 million bales (170 kg each) from 36.07. This production figure seem to be sufficient for current population, but we need to improve more and more with vertical farming and advance agronomic and crop improvement tools for future burgeoning population figure under the milieu of climate change issue. Our rural mass and tribal people have very limited resources and they sometime complete depend on forest microhabitat. To order to ensure food and nutritional security for growing population, a new strategy needs to be initiated for growing of crops in changing climatic condition. The country has a large pool of underutilized or underexploited fruit or cereals crops which have enormous potential for contributing to food security, nutrition, health, ecosystem sustainability under the changing climatic conditions, since they require little input, as they have inherent capabilities to withstand biotic and abiotic stress. Apart from the impacts on agronomic conditions of crop productions, climate change also affects the economy, food systems and wellbeing of the consumers (Abbade, 2017). Crop nutritional quality become very challenging, as we noticed that, zinc and iron deficiency is a serious global health problem in humans depending on cereal-diet and is largely prevalent in low-income countries like Sub-Saharan Africa, and South and South-east Asia. We report inefficiency of modern-bred cultivars of rice and wheat to sequester those essential nutrients in grains as the reason for such deficiency and prevalence (Debnath et al., 2021). Keeping in mind the crop yield and nutritional quality become very daunting task to our food security issue and this can overcome with the proper and time bound research in cognizance with the environment. Threat and challenges In recent years, climate change has become a debatable issue worldwide. South Asia will be one of the most adversely affected regions in terms of impacts of climate change on agricultural yield, economic activity and trading policies. Addressing climate change is central for global future food security and poverty alleviation. The approach would need to implement strategies linked with developmental plans to enhance its adaptive capacity in terms of climate resilience and mitigation. Over time, there has been a visible shift in the global climate change initiative towards adaptation. Adaptation can complement mitigation as a cost-effective strategy to reduce climate change risks. The impact of climate change is projected to have different effects across societies and countries. Mitigation and adaptation actions can, if appropriately designed, advance sustainable development and equity both within and across countries and between generations. One approach to balancing the attention on adaptation and mitigation strategies is to compare the costs and benefits of both the strategies. The most imminent change is the increase in the atmospheric temperatures due to increase levels of GHGs (Green House Gases) i.e. carbon dioxide (CO2), methane (CH4), nitrous oxide (N2O) and chlorofluorocarbons (CFCs) etc into the atmosphere. The global mean annual temperatures at the end of the 20th century were almost 0.7 degree centigrade above than those recorded at the end of the 19th century and likely to increase further by 1.8- 6.4ºC by 2100 AD. The quantity of rainfall and its distribution will be affected to a great extent resulting in more flooding. The changes in soil properties such as loss of organic matter, leaching of soil nutrients, salinization and erosion are a likely outcome of climate change in many cases. Water crisis can be a serious problem with the anticipated global warming and climate change. With increasing exploitation of natural resources and environmental pollution, the atmospheric temperature is expected to rise by 3-5 0C in next 75-100 years (www.ipcc.ch/sr15/chapter/chapter-1). If it happens most of the rivers originating from the Himalayas may dry up and cause severe shortage of water for irrigation, suppressing agriculture production by 40-50%. There has been considerable concern in recent years about climatic changes caused by human activities and their effects on agriculture. Surface climate is always changing, but at the beginning of industrial revolution these changes have been more noticeable due to interference of human beings activity. Studies of climate change impacts on agriculture initially focused on increasing temperature. Many researchers, including reported that changes in temperature, radiation and precipitation need to be studied in order to evaluate the impact of climate change. Temperature changes can affect crop productivity. Higher temperatures may increase plant carboxilation and stimulate higher photosynthesis, respiration, and transpiration rates. Meanwhile, flowering may also be partially triggered by higher temperatures, while low temperatures may reduce energy use and increased sugar storage. Changes in temperature can also affect air vapor pressure deficits, thus impacting the water use in agricultural landscapes. This coupling affects transpiration and can cause significant shifts in temperature and water loss (Mukherjee, 2017). In chickpea and other pulse crop this increase in temperature due to climate change affects to a greater extent flower numbers, pod production, pollen viability, and pistilfunction are reduced and flower and pod abortion increased under terminal heat stress which ultimately leads to hamper its productivity on large scale. There is probability of 10-40% loss in crop production in India with the expected temperature increase by 2080-2100. Rice yields in northern India during last three decades are showing a decreasing trend (Aggarwal et al., 2000). Further, the IPCC (2007) report also projected that cereal yields in seasonally dry and tropical regions like India are likely to decrease for even small local temperature increases. wheat production will be reduced by 4-5 million tonnes with the rise of every 10C temperature throughout the growing period that coincides in India with 2020-30. However, grain yield of rice declined by 10% for each 1ºC increase in growing season. A 1ºC increase in temperature may reduce rapeseed mustard yield by 3-7%. Thus a productivity of 2050-2562 kg/ha for rapeseed mustard would have to be achieved by 2030 under the changing scenario of climate, decreasing and degrading land and water resources, costly inputs, government priority of food crops and other policy imperatives from the present level of nearly 1200 kg/ha. Diseases and pest infestation In future, plant protection will assume even more significance given the daunting task before us to feed the growing population under the era of shifting climate pattern, as it directly influence pest life cycle in crop calendar (Mukherjee, 2019). Every year, about USD 8.5 billion worth of crops are lost in India because of disease and insects pests and another 2.5 billion worth of food grains in storages. In the scenario of climate change, experts believe that these losses could rise as high as four folds. Global warming and climate change would lead to emergence of more aggressive pests and diseases which can cause epidemics resulting in heavy losses (Mesterhazy et al., 2020). The range of many insects will change or expand and new combinations of diseases and pests may emerge. The well-known interaction between host × pathogen × environment for plant disease epidemic development and weather based disease management strategies have been routinely exploited by plant pathologists. However, the impact of inter annual climatic variation resulting in the abundance of pathogen populations and realistic assessment of climatic change impacts on host-pathogen interactions are still scarce and there are only handful of studies. Further emerging of new disease with climate alteration in grain crop such as wheat blast, become challenging for growers and hamper food chain availability (Mukherjee et al., 2019). Temperature increase associated with climatic changes could result in following changes in plant diseases: Extension of geographical range of pathogens Changes in population growth rates of pathogens Changes in relative abundance and effectiveness of bio control agents Changes in pathogen × host × environment interactions Loss of resistance in cultivars containing temperature-sensitive genes Emergence of new diseases/and pathogen forms Increased risk of invasion by migrant diseases Reduced efficacy of integrated disease management practices These changes will have major implications for food and nutritional security, particularly in the developing countries of the dry-tropics, where the need to increase and sustain food production is most urgent. The current knowledge on the main potential effects of climate change on plant patho systems has been recently summarized by Pautasso et al. (2012). Their overview suggests that maintaining plant health across diversified environments is a key requirement for climate change mitigation as well as the conservation of biodiversity and provisions of ecosystem services under global change. Changing in weed flora pattern under different cropping system become very challenging to the food growers, and threat to our food security issue. It has been estimated that the potential losses due to weeds in different field crops would be around 180 million tonnes valued Rs 1,05,000 crores annually. In addition to the direct effect on crop yield, weeds result in considerable reduction in the efficiency of inputs used and food quality. Increasing atmospheric CO2 and temperature have the potential to directly affect weed physiology and crop-weed interactions vis-à-vis their response to weed control methods. Many of the world’s major weeds are C4 plants and major crops are C3 plants (Mandal and Mukherjee, 2018). The differential effects of CO2 on C3 and C4 plants may have implications on crop-weed interactions. Weed species have a greater genetic diversity than most crops and therefore, under the changing scenario of resources (eg., light, moisture, nutrients, CO2), weeds will have the greater capacity for growth and reproductive response than most crops. Differential response to seed emergence with temperature could also influence species establishment and subsequent weed-crop competition. Increasing temperature might allow some sleeper weeds to become invasive (Mukherjeee, 2020; Science Daily, 2009). Studies suggest that proper weed management techniques if adopted can result in an additional production of 103 million tonnes of food grains, 15 million tonnes of pulses,10 million tonnes of oilseeds, and 52 million tonnes of commercial crops per annum, which in few cases are even equivalent to the existing annual production (Rao and Chauhan, 2015). There is tremendous scope to increase agricultural productivity by adopting improved weed management technologies that have been developed in the country. Conclusion The greatest challenge before us is to enhance the production of required amount of food items viz., cereals, pulses, oilseeds, vegetable, underutilized fruit etc to keep pace with population growth through employing suitable crop cultivars, biotechnological approaches, conserving natural resources and protecting crops from weeds, insects pests and diseases eco-friendly with climate change. Research is a continuous process that has to be pursued vigorously and incessantly in the critical areas viz., evolvement of new genotype, land development and reclamation, soil and moisture conservation, soil health care, seeds and planting material, enhancing fertilizer and water use efficiencies, conservation agriculture, eco-friendly plant protection measures etc. Due to complexity of crop environment interaction under different climate situation, a multidisciplinary approach to the problem is required in which plant breeders, agronomists, crop physiologists and agrometeorologists need to interact for finding long term solutions in sustaining crop production. References: Abbade, E. B. 2017. Availability, access and utilization: Identifying the main fragilities for promoting food security in developing countries. World Journal of Science, Technology and Sustainable Development, 14(4): 322–335. doi:10.1108/WJSTSD-05-2016-0033 Aggrawal, P.K., Bandyopadhyay, S. and Pathak, S. 2020. Analysis of yield trends of the Rice-Wheat system in north-western India. Outlook on Agriculture, 29(4):259-268. Christensen, J.H., Hewitson, B., Busuioc, A., Chen, A. and Gao, X, 2007. Regional Climate Projections. In: Climate Change 2007: The Physical Science Basis. Cambridge University Press. Cambridge, United Kingdom. Debnath, S., Mandal, B., Saha, S., Sarkar, D., Batabyal, K., Murmu, S., Patra, B.C., Mukherjee, and Biswas, T. 2021. Are the modern-bred rice and wheat cultivars in India inefficient in zinc and iron sequestration?. Environmental and Experimental Botany,189:1-7. (https://doi.org/10.1016/j.envexpbot.2021.104535) 2007. Climate Change 2007- Impacts, Adaptation and Vulnerability. Contribution of Working Group II to the Fourth Assessment Report of the Intergovernmental Panel on Climate Change, M.L. Parry, O.F. Canziani, J.P. Palutikof, P.J. van der Linden and C.E. Hanson, Eds., Cambridge University Press, Cambridge, UK, 976pp. Mandal, B and Mukherjee, D. 2018. Influenced of different weed management Practices for Higher Productivity of Jute (Corchorus olitorius) in West Bengal. International Journal of Bioresource Science, 5 (1): 21-26. Mesterhazy, A., Olah, J. and Popp, J. 2020. Losses in the grain supply chain: causes and solutions. Sustainability, 12, 2342; doi:10.3390/su12062342. Mukherjee D. 2019. Effect of various crop establishment methods and weed management practices on growth and yield of rice. Journal of Cereal Research, 11(3): 300-303. http://doi.org/10.25174/2249-4065/2019/95811. Mukherjee, D. 2014. Climate change and its impact on Indian agriculture. In : Plant Disease Management and Microbes (eds. Nehra, S.). Aavishkar Publishers, Jaipur, India. Pp 193-206. Mukherjee, D. 2017. Rising weed problems and their effects on production potential of various crops under changing climate situation of hill. Indian Horticulture Journal, 7(1): 85-89. Mukherjee, D., Mahapatra, S., Singh, D.P., Kumar, S., Kashyap , P.L. and Singh, G.P. 2019. Threat assessment of wheat blast like disease in the West Bengal". 4th International Group Meeting on Wheat production enhancement through climate smart practices. at CSK HPKV, Palampur, HP, India, February, 14-16, 2019. Organized by CSK HPKV, Palampur and Society of Advancement of Wheat and Barley Research (SAWBAR). Journal of Cereal Research, 11 (1): 78. Mukherjee, D. 2020. Herbicide combinations effect on weeds and yield of wheat in North-Eastern plain. Indian Journal of Weed Science, 52 (2): 116–122. Pautasso, M. 2012. Observed impacts of climate change on terrestrial birds in Europe: an overview. Italian Journal of Zoology, 38:56-74. .Doi:10.1080/11250003.2011.627381 Rao, A.N. and Chauhan, B.S. 2015. Weeds and weed management in India -A Review. 25 Asian Pacific Weed Science Society Conference, at Hyderabad, India, Volume: 1 (A.N. Rao and N.T. Yaduraju (eds.). pp 87-118.

ST15 Klebsiella pneumoniae (Kpn) is a growing public health concern in China and worldwide, yet its genomic and evolutionary dynamics in this region remain poorly understood. This study comprehensively elucidates the population genomics of ST15 Kpn in China by analyzing 287 publicly available genomes. The proportion of the genomes increased sharply from 2012 to 2021, and 92.3% of them were collected from the Yangtze River Delta (YRD) region of eastern China. Carbapenemase genes, including OXA-232, KPC-2, and NDM, were detected in 91.6% of the studied genomes, and 69.2% of which were multidrug resistant (MDR) and hypervirulent (hv). Phylogenetic analysis revealed four clades, C1 (KL112, 59.2%), C2 (mainly KL19, 30.7%), C3 (KL48, 0.7%) and C4 (KL24, 9.4%). C1 appeared in 2007 and was OXA-232-producing and hv; C2 and C4 appeared between 2005 and 2007, and both were KPC-2-producing but with different levels of virulence. Transmission clustering detected 86.1% (n = 247) of the enrolled strains were grouped into 55 clusters (2–159 strains) and C1 was more transmissible than others. Plasmid profiling revealed 88 plasmid clusters (PCs) that were highly heterogeneous both between and within clades. 60.2% (n = 53) of the PCs carrying AMR genes and 7 of which also harbored VFs. KPC-2, NDM and OXA-232 were distributed across 14, 4 and 1 PCs, respectively. The MDR-hv strains all carried one of two homologous PCs encoding iucABCD and rmpA2 genes. Pangenome analysis revealed two major coinciding accessory components predominantly located on plasmids. One component, associated with KPC-2, encompassed 15 additional AMR genes, while the other, linked to OXA-232, involved seven more AMR genes. This study provides essential insights into the genomic evolution of the high-risk ST15 CP-Kpn strains in China and warrants rigorous monitoring.

This report presents results of upland vegetation and soil monitoring of semi-arid grasslands at three Parks by the Southern Colorado Plateau Inventory and Monitoring Network (SCPN) from 2007?2021. The purpose is to compare and contrast five grassland ecological sites and examine how they have changed during the first 15 years of monitoring. Crews collected data on composition and abundance of vegetation, both at the species level and by lifeform (e.g., perennial grass, shrub, forb) and soil aggregate stability and soil texture at 150 plots within five target grassland/shrubland communities delineated using NRCS ecological site (ecosite) classification (30 plots per ecosite). Soils in plots at Petrified Forest NP and Chaco Culture NHP were deeper than those at Wupatki NM. Undifferentiated soil crust comprised the largest component of the soil surface, except at Wupatki where surface gravel dominated. Cover of biological soil crust (cyanobacteria, lichen, and moss) was low. Soil aggregate stability was moderate. From 2007?2021, SCPN crews identified 283 unique plant species. Overall live foliar cover ranged from 12-24%. Four of five ecological sites were dominated by C4 grass species (>70% of total live foliar cover). Shrubs co-dominated at one site (WUPA L) and forbs were an overall small component of total vegetation cover but contributed most of the diversity in these sites. Less than 4% of species detected were nonnative. Russian thistle (Salsola tragus) was the most frequently sampled nonnative, occurring in > 50% of plots at Wupatki in the volcanic upland ecological site. Cheatgrass (Bromus tectorum) was the second most common invasive species but occurred in < 10% of the plots at all ecological sites. Vegetation cover was modeled using Bayesian hierarchical models and included seasonal climatic water deficits, year effects and topographic variables as covariates. Models revealed significant negative time trends (i.e., changes over time that were not explained by changes in seasonal deficit covariates included) in some modeled responses, particularly in the cover of perennial grass at all five ecological sites. Time trends in shrub and forb responses were mixed. Species richness showed variable effects by ecosite, decreasing at CHCU S, and increasing at PEFO S and WUPA V. Modeled responses were influenced by climate covariates, but direction of these effects varied. The most consistent effects were that greater July water stress and higher accumulated growing degree days (i.e., warmer spring temperatures) increased cover of perennial grasses and shrubs during the same year. However, greater water stress in the spring had a negative effect on many responses as expected. Decreasing cover of perennial grass and increasing cover of shrubs and weedy forbs has been predicted for southwestern grasslands in response to increasing aridification due to anthropogenic climate change. Perennial grass trends reported here correspond with these predictions with mixed results on shrub and forb community trends. Continued drought conditions will likely exacerbate negative changes in these systems.