Artykuły w czasopismach: „Genetic diversity”

1

Sivanandan, Chithra. "Genetic Diversity of Fungal Endophytes". International Journal of Science and Research (IJSR) 13, nr 4 (5.04.2024): 1639–46. http://dx.doi.org/10.21275/sr24426143007.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

2

McHugh, Drake. "Genetic Diversity". Environmental Conservation 15, nr 1 (1988): 76–77. http://dx.doi.org/10.1017/s0376892900028587.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

3

Sharma, Mamta, i Dr R. S. Meena Dr. R.S. Meena. "Genetic Diversity in Fennel (Foeniculum Vulgare Mill)". International Journal of Scientific Research 2, nr 8 (1.06.2012): 3–4. http://dx.doi.org/10.15373/22778179/aug2013/2.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

4

S, CHITHRA, i RAJALAKSHMI R. "Genetic diversity study of Tagetes Linn. (Asteraceae)". Journal of Medicinal and Aromatic Plant Sciences 36, nr 2 (1.07.2014): 49–58. http://dx.doi.org/10.62029/jmaps.v36i2.s.

Pełny tekst źródła

Streszczenie:

Present study was conducted to access genetic diversity among 10 genotypes of two species of Tagetes i.e., Tagetes erecta (6 cultivars) and Tagetes patula (4 cultivars). Though Tagetes possesses great economical value, little attention has been paid for its genetic improvement. Four polymorphic isozyme systems (AAT, MDH, EST and PRX) were selected for cultivar identification. In isozyme analysis, peroxidase was able to differentiate both the species. Esterase showed large number of alleles and polymorphism to differentiate the two species as well as cultivars of the same species. The data would be important in detailing the level of variation and relationship within and between species to plan future domestication trials in Tageties.

Style APA, Harvard, Vancouver, ISO itp.

5

Vankova, O. E., i N. F. Brusnigina. "Cytomegalovirus genetic diversity". Journal Infectology 9, nr 2 (1.01.2017): 5–12. http://dx.doi.org/10.22625/2072-6732-2017-9-2-5-12.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

6

Schull, W. J. "Genetic Diversity Survey". Science 279, nr 5347 (2.01.1998): 10h—15. http://dx.doi.org/10.1126/science.279.5347.10h.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

7

Sparrow, Robert. "Imposing Genetic Diversity". American Journal of Bioethics 15, nr 6 (czerwiec 2015): 2–10. http://dx.doi.org/10.1080/15265161.2015.1028658.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

8

Williams, Scott. "Genetic diversity matters". New Scientist 241, nr 3223 (marzec 2019): 22–23. http://dx.doi.org/10.1016/s0262-4079(19)30552-4.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

9

Kumar, Anand, i Vivudh Pratap Singh. "Maize Genetic Diversity: Utilization of Molecular Markers in Genetic Diversity". International Journal of Current Microbiology and Applied Sciences 9, nr 2 (10.02.2020): 1948–59. http://dx.doi.org/10.20546/ijcmas.2020.902.222.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

10

Alvarez-Mejia, Cesar, Gustavo Hernandez-Guzman, Varinia Lopez-Ramirez, Jose-Humberto Valenzuela-Soto i Rodolfo Marsch. "Genetic Diversity in Pseudomonas syringae pv. maculicola Strains". Journal of Pure and Applied Microbiology 12, nr 3 (30.09.2018): 1233–38. http://dx.doi.org/10.22207/jpam.12.3.24.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

11

Vellend, Mark, i Monica A. Geber. "Connections between species diversity and genetic diversity". Ecology Letters 8, nr 7 (15.06.2005): 767–81. http://dx.doi.org/10.1111/j.1461-0248.2005.00775.x.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

12

Magurran, Anne E. "Ecology: Linking Species Diversity and Genetic Diversity". Current Biology 15, nr 15 (sierpień 2005): R597—R599. http://dx.doi.org/10.1016/j.cub.2005.07.041.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

13

Exposito-Alonso, Moises, Tom R. Booker, Lucas Czech, Lauren Gillespie, Shannon Hateley, Christopher C. Kyriazis, Patricia L. M. Lang i in. "Genetic diversity loss in the Anthropocene". Science 377, nr 6613 (23.09.2022): 1431–35. http://dx.doi.org/10.1126/science.abn5642.

Pełny tekst źródła

Streszczenie:

Anthropogenic habitat loss and climate change are reducing species’ geographic ranges, increasing extinction risk and losses of species’ genetic diversity. Although preserving genetic diversity is key to maintaining species’ adaptability, we lack predictive tools and global estimates of genetic diversity loss across ecosystems. We introduce a mathematical framework that bridges biodiversity theory and population genetics to understand the loss of naturally occurring DNA mutations with decreasing habitat. By analyzing genomic variation of 10,095 georeferenced individuals from 20 plant and animal species, we show that genome-wide diversity follows a mutations-area relationship power law with geographic area, which can predict genetic diversity loss from local population extinctions. We estimate that more than 10% of genetic diversity may already be lost for many threatened and nonthreatened species, surpassing the United Nations’ post-2020 targets for genetic preservation.

Style APA, Harvard, Vancouver, ISO itp.

14

Žáková, M., i M. Benková. "Genetic Diversity of Genetic Resources of Winter Barley Maintained in the Genebank in Slovakia". Czech Journal of Genetics and Plant Breeding 40, No. 4 (23.11.2011): 118–26. http://dx.doi.org/10.17221/3709-cjgpb.

Pełny tekst źródła

Streszczenie:

A set of 140 winter barley genetic resources of foreign and domestic origins was tested on experimental basis of RIPP in 1997–1999 to characterise the variability of the accessions based on agronomic data using multivariate methods. In the set tested, variability was studied of selected traits and characteristics such as: plant height (PH), weight of 1000 grains (W), grain number per a spike (SNG), grain uniformity – ratio of front seeds over 2.5  m sieve (GU), vegetation period – sowing/full maturity (VM) and seed yield (Y). Agronomic characters show great variability between cultivars. The study of matrix interrelationships between different variables showed that the yield is greatly correlated with traits:  vegetation period – sowing/full maturity, grain uniformity and grain number per a spike. High positive correlation was obtained between the grain uniformity and the weight of 1000 grains. Negative correlation was found between the grain number per a spike and weight of 1000 grains in six-row barley. Correlations between agronomic traits differed between two- and six-row barley sets. The study revealed the existence of genetic differences among accessions as well as differences between two- and six-row winter barley and between the genotypes of domestic and foreign country origin, respectively. Results of this study provided information about diversity which should be of particular interest for the further collecting of genetic resources.  

Style APA, Harvard, Vancouver, ISO itp.

15

BERT, T. M., S. SEYOUM, M. D. TRINGALI i A. McMILLEN-JACKSON. "Methodologies for conservation assessments of the genetic biodiversity of aquatic macro-organisms". Brazilian Journal of Biology 62, nr 3 (sierpień 2002): 387–408. http://dx.doi.org/10.1590/s1519-69842002000300002.

Pełny tekst źródła

Streszczenie:

International organizations and biodiversity scientists recognize three levels of biodiversity: genetic, species, and ecosystem. However, most studies with the goal of assessing biodiversity collect data at only a single level -- that of the species. Even when multiple levels of biodiversity are considered, usually only ecosystem diversity is also evaluated. Genetic diversity is virtually never considered. Yet, genetic diversity is essential for the maintenance of populations and species over ecological and evolutionary time periods. Moreover, because components of genetic diversity are independent of either species or ecosystem diversity, genetic diversity can provide a unique measure by which to assess the value of regions for conservation. Regions can be valuable for conservation of their genetic resources regardless of their levels of species or ecosystem uniqueness or diversity. In general, the same methods and statistical programs that are used to answer questions about population genetics and phylogenetics are applicable to conservation genetics. Thus, numerous genetic techniques, laboratory methods, and statistical programs are available for assessing regional levels of genetic diversity for conservation considerations. Here, we provide the rationale, techniques available, field and laboratory protocols, and statistical programs that can be used to estimate the magnitude and type of genetic diversity in regions. We also provide information on how to obtain commonly utilized statistical programs and the type of analyses that they include. The guide that we present here can be used to conduct investigations of the genetic diversity of regions under consideration for conservation of their natural resources.

Style APA, Harvard, Vancouver, ISO itp.

16

Teixeira, João C., i Christian D. Huber. "The inflated significance of neutral genetic diversity in conservation genetics". Proceedings of the National Academy of Sciences 118, nr 10 (19.02.2021): e2015096118. http://dx.doi.org/10.1073/pnas.2015096118.

Pełny tekst źródła

Streszczenie:

The current rate of species extinction is rapidly approaching unprecedented highs, and life on Earth presently faces a sixth mass extinction event driven by anthropogenic activity, climate change, and ecological collapse. The field of conservation genetics aims at preserving species by using their levels of genetic diversity, usually measured as neutral genome-wide diversity, as a barometer for evaluating population health and extinction risk. A fundamental assumption is that higher levels of genetic diversity lead to an increase in fitness and long-term survival of a species. Here, we argue against the perceived importance of neutral genetic diversity for the conservation of wild populations and species. We demonstrate that no simple general relationship exists between neutral genetic diversity and the risk of species extinction. Instead, a better understanding of the properties of functional genetic diversity, demographic history, and ecological relationships is necessary for developing and implementing effective conservation genetic strategies.

Style APA, Harvard, Vancouver, ISO itp.

17

Debouck, Daniel G. "Managing Plant Genetic Diversity". Crop Science 43, nr 2 (marzec 2003): 749–50. http://dx.doi.org/10.2135/cropsci2003.749a.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

18

Mengistu, Lemma W., i Calvin G. Messersmith. "Genetic diversity of kochia". Weed Science 50, nr 4 (lipiec 2002): 498–503. http://dx.doi.org/10.1614/0043-1745(2002)050[0498:gdok]2.0.co;2.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

19

LI, Juan, i Ke-Qin ZHANG. "Genetic diversity of microorganisms". Hereditas (Beijing) 34, nr 11 (20.11.2012): 1399–408. http://dx.doi.org/10.3724/sp.j.1005.2012.01399.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

20

Williams, Scott M., Giorgio Sirugo i Sarah A. Tishkoff. "Embracing African Genetic Diversity". Med 2, nr 1 (styczeń 2021): 19–20. http://dx.doi.org/10.1016/j.medj.2020.12.019.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

21

Aradhva, K. M., F. Zee i R. M. Manshardt. "Genetic Diversity in Nephelium". HortScience 30, nr 4 (lipiec 1995): 795F—795. http://dx.doi.org/10.21273/hortsci.30.4.795f.

Pełny tekst źródła

Streszczenie:

Fifty-six accessions involving five taxa of Nephelium (N. Iappaceum varieties lappaceum and pallens, N. hypoleucum, N. ramboutan-ake, and N. cuspidatum) were fingerprinted and evaluated for genetic diversity using isozyme polymorphism. All five taxa were polymorphic for most of the enzymes encoded by 10 putative loci. Number of alleles per locus ranged from three for Pgi-1 to nine for Pgi-2 with a total of 57 alleles. Thirty-eight accessions out of 56 possessed unique isozyme genotypes, indicating a high level of diversity in the collection. On average, 80% of the loci were polymorphic and the expected and observed heterozygosities were 0.374 and 0.373, respectively. The cluster analysis of the isozyme data revealed five distinct clusters representing the five taxa included in the study. Genetic differentiation within N. Iappaceum var. Iappaceum was evident from the cluster analysis. Isozyme data indicated that N. ramboutan-ake is the closest relative of N. Iappaceum var. Iappaceum, followed by N. hypoleucum, N. Iappaceum var. pallens, and N. cuspidatum. Interestingly, the varieties of N. Iappaceum exhibited genetic divergence far beyond that of the congenerics, N. hypoleucum and N. ramboutan-ake and may require a taxonomic revision.

Style APA, Harvard, Vancouver, ISO itp.

22

Coutinho, Thamara Carvalho, Telles Timóteo Da Silva i Gustavo Leal Toledo. "Recombination and Genetic Diversity". TEMA (São Carlos) 13, nr 3 (22.12.2012): 265–75. http://dx.doi.org/10.5540/tema.2013.013.03.0265.

Pełny tekst źródła

Streszczenie:

In this paper we present a spatial stochastic model for genetic recombination, that answers if diversity is preserved in an infinite population of recombinating individuals distributed spatially. We show that, for finite times, recombination may maintain all the various potential different types, but when time grows infinitely, the diversity of individuals extinguishes off. So under the model premisses, recombination and spatial localization alone are not enough to explain diversity in a population. Further we discuss an application of the model to a controversy regarding the diversity of "Major Histocompatibility Complex" (MHC).

Style APA, Harvard, Vancouver, ISO itp.

23

Seabrook, Jeremy. "Biotechnology and genetic diversity". Race & Class 34, nr 3 (styczeń 1993): 15–30. http://dx.doi.org/10.1177/030639689303400302.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

24

Howlett, Rory. "Plants lose genetic diversity". Nature Climate Change 2, nr 2 (27.01.2012): 74. http://dx.doi.org/10.1038/nclimate1403.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

25

Bates, D. M. "Managing Plant Genetic Diversity". Heredity 89, nr 3 (wrzesień 2002): 235. http://dx.doi.org/10.1038/sj.hdy.6800105.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

26

Meltzer, Paul S. "Genetic Diversity in Melanoma". New England Journal of Medicine 353, nr 20 (17.11.2005): 2104–7. http://dx.doi.org/10.1056/nejmp058173.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

27

Meade, John C., i Jane M. Carlton. "Genetic diversity inTrichomonas vaginalis". Sexually Transmitted Infections 89, nr 6 (23.05.2013): 444–48. http://dx.doi.org/10.1136/sextrans-2013-051098.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

28

Ellegren, Hans, i Nicolas Galtier. "Determinants of genetic diversity". Nature Reviews Genetics 17, nr 7 (6.06.2016): 422–33. http://dx.doi.org/10.1038/nrg.2016.58.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

29

Burgess, Darren J. "Determinants of genetic diversity". Nature Reviews Genetics 15, nr 10 (9.09.2014): 642. http://dx.doi.org/10.1038/nrg3825.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

30

Lanham, P. G., i R. M. Brennan. "GENETIC DIVERSITY IN RIBES". Acta Horticulturae, nr 546 (luty 2001): 135–37. http://dx.doi.org/10.17660/actahortic.2001.546.11.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

31

Clark, C. Graham, Mehreen Zaki i Ibne Karim Md Ali. "Genetic diversity inEntamoeba histolytica". Journal of Biosciences 27, nr 6 (listopad 2002): 603–7. http://dx.doi.org/10.1007/bf02704854.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

32

Dhar, M. K., A. K. Koul i A. Langer. "Genetic diversity among Plantagos". Theoretical and Applied Genetics 79, nr 2 (luty 1990): 216–18. http://dx.doi.org/10.1007/bf00225954.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

33

Pearce, David. "Economics and genetic diversity". Futures 19, nr 6 (grudzień 1987): 710–12. http://dx.doi.org/10.1016/0016-3287(87)90088-7.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

34

Aradhva, K. M., F. Zee i R. M. Manshardt. "Genetic Diversity in Nephelium". HortScience 30, nr 4 (lipiec 1995): 795F—795. http://dx.doi.org/10.21273/hortsci.30.4.795.

Pełny tekst źródła

Streszczenie:

Fifty-six accessions involving five taxa of Nephelium (N. Iappaceum varieties lappaceum and pallens, N. hypoleucum, N. ramboutan-ake, and N. cuspidatum) were fingerprinted and evaluated for genetic diversity using isozyme polymorphism. All five taxa were polymorphic for most of the enzymes encoded by 10 putative loci. Number of alleles per locus ranged from three for Pgi-1 to nine for Pgi-2 with a total of 57 alleles. Thirty-eight accessions out of 56 possessed unique isozyme genotypes, indicating a high level of diversity in the collection. On average, 80% of the loci were polymorphic and the expected and observed heterozygosities were 0.374 and 0.373, respectively. The cluster analysis of the isozyme data revealed five distinct clusters representing the five taxa included in the study. Genetic differentiation within N. Iappaceum var. Iappaceum was evident from the cluster analysis. Isozyme data indicated that N. ramboutan-ake is the closest relative of N. Iappaceum var. Iappaceum, followed by N. hypoleucum, N. Iappaceum var. pallens, and N. cuspidatum. Interestingly, the varieties of N. Iappaceum exhibited genetic divergence far beyond that of the congenerics, N. hypoleucum and N. ramboutan-ake and may require a taxonomic revision.

Style APA, Harvard, Vancouver, ISO itp.

35

Elfituri Muftah Eltariki, Fuzia, Kartikeya Tiwari, Indang Ariati Ariffin i Mohammed Abdelfatah Alhoot. "Genetic Diversity of Fungi Producing Mycotoxins in Stored Crops". Journal of Pure and Applied Microbiology 12, nr 4 (30.12.2018): 1815–23. http://dx.doi.org/10.22207/jpam.12.4.15.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

36

Komatsudaa, T., Y. Manoa, Y. Turuspekovb, I. Hondab, N. Kawadab i Y. Watanabe. "Inheritance and genetic diversity of flowering types in barley". Czech Journal of Genetics and Plant Breeding 41, Special Issue (31.07.2012): 194. http://dx.doi.org/10.17221/6167-cjgpb.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

37

Blackburn, HD. "Genetic Selection and Conservation of Genetic Diversity*". Reproduction in Domestic Animals 47 (25.07.2012): 249–54. http://dx.doi.org/10.1111/j.1439-0531.2012.02083.x.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

38

Harpending, Henry, i Gregory Cochran. "Genetic diversity and genetic burden in humans". Infection, Genetics and Evolution 6, nr 2 (marzec 2006): 154–62. http://dx.doi.org/10.1016/j.meegid.2005.04.002.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

39

Neelima, S., K. Ashok Kumar, K. Venkataramanamma i Y. Padmalatha. "Genetic variability and genetic diversity in sunflower". Electronic Journal of Plant Breeding 7, nr 3 (2016): 703. http://dx.doi.org/10.5958/0975-928x.2016.00090.9.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

40

Vajda, I., i J. Zvárová. "On Genetic Information, Diversity and Distance". Methods of Information in Medicine 45, nr 02 (2006): 173–79. http://dx.doi.org/10.1055/s-0038-1634063.

Pełny tekst źródła

Streszczenie:

Summary Objectives: General information-theoretic concepts such as f-divergence, f-information and f-entropy are applied to the genetic models where genes are characterized by randomly distributed alleles. The paper thus presents an information-theoretic background for measuring genetic distances between populations, genetic information in various observations on individuals about their alleles and, finally, genetic diversities in various populations. Methods: Genetic distances were derived as divergences between frequencies of alleles representing a gene in two different populations. Genetic information was derived as a measure of statistical association between the observations taken on individuals and the alleles of these individuals. Genetic diversities were derived from divergences and information. Results: The concept of genetic f-information introduced in the paper seems to be new. We show that the measures of genetic distance and diversity used in the previous literature are special cases of the genetic f-divergence and f-diversity introduced in the paper and illustrated by examples. We also display intimate connections between the genetic f-information and the genetic f-divergence on one side and genetic f-diversity on the other side. The examples at the same time also illustrate practical computations and applications of the important concepts of quantitative genetics introduced in the paper. Conclusions: We discussed a general class of f-divergence measures that are suitable measures of genetic distance between populations characterized by concrete frequencies of alleles. We have shown that a wide class of genetic information, called f-information, can be obtained from f-divergences and that a wide class of measures of genetic diversity, called f-diversities, can be obtained from the f-divergences and f-information.

Style APA, Harvard, Vancouver, ISO itp.

41

Pfeiffer, Vera Wilder, Brett Michael Ford, Johann Housset, Audrey McCombs, José Luis Blanco‐Pastor, Nicolas Gouin, Stéphanie Manel i Angéline Bertin. "Partitioning genetic and species diversity refines our understanding of species–genetic diversity relationships". Ecology and Evolution 8, nr 24 (grudzień 2018): 12351–64. http://dx.doi.org/10.1002/ece3.4530.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

42

Bonneuil, Noël, i Raouf Boucekkine. "Genetic diversity and its value: conservation genetics meets economics". Conservation Genetics Resources 12, nr 1 (25.10.2019): 141–51. http://dx.doi.org/10.1007/s12686-019-01113-y.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

43

Watanabe, K. N., i J. A. Watanabe. "Genetic Diversity and Molecular Genetics of Ornamental Plant Species". Biotechnology & Biotechnological Equipment 14, nr 2 (styczeń 2000): 19–21. http://dx.doi.org/10.1080/13102818.2000.10819081.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

44

Holderegger, Rolf, Urs Kamm i Felix Gugerli. "Adaptive vs. neutral genetic diversity: implications for landscape genetics". Landscape Ecology 21, nr 6 (sierpień 2006): 797–807. http://dx.doi.org/10.1007/s10980-005-5245-9.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

45

Peter, Benjamin M., Desislava Petkova i John Novembre. "Genetic Landscapes Reveal How Human Genetic Diversity Aligns with Geography". Molecular Biology and Evolution 37, nr 4 (28.11.2019): 943–51. http://dx.doi.org/10.1093/molbev/msz280.

Pełny tekst źródła

Streszczenie:

Abstract Geographic patterns in human genetic diversity carry footprints of population history and provide insights for genetic medicine and its application across human populations. Summarizing and visually representing these patterns of diversity has been a persistent goal for human geneticists, and has revealed that genetic differentiation is frequently correlated with geographic distance. However, most analytical methods to represent population structure do not incorporate geography directly, and it must be considered post hoc alongside a visual summary of the genetic structure. Here, we estimate “effective migration” surfaces to visualize how human genetic diversity is geographically structured. The results reveal local patterns of differentiation in detail and emphasize that while genetic similarity generally decays with geographic distance, the relationship is often subtly distorted. Overall, the visualizations provide a new perspective on genetics and geography in humans and insight to the geographic distribution of human genetic variation.

Style APA, Harvard, Vancouver, ISO itp.

46

TASMA, I. MADE, i SEKAR ARUMSARI. "ANALISIS DIVERSITAS GENETIK AKSESI KELAPA SAWIT KAMERUN BERDASARKAN MARKA SSR". Jurnal Penelitian Tanaman Industri 19, nr 4 (19.06.2020): 194. http://dx.doi.org/10.21082/jlittri.v19n4.2013.194-202.

Pełny tekst źródła

Streszczenie:

ABSTRAK Diversitas genetik aksesi kelapa sawit Indonesia saat ini sangat rendah. Dalam usaha meningkatkan keragaman genetik telah dilakukan eksplorasi plasma nutfah di pusat keragaman genetik kelapa sawit di Kamerun. Tujuan dari penelitian ini untuk mengetahui diversitas genetik dan tingkat polimorfisme berdasarkan marka SSR aksesi-aksesi kelapa sawit Kamerun. Bahan tanaman yang digunakan 49 aksesi kelapa sawit Kamerun, Afrika yang ditanam di Kebun Sumber Daya Genetik (SDG) Sawit Sijunjung, Sumatera Barat. DNA genomik diisolasi dari tiap individu aksesi menggunakan protokol isolasi DNA untuk tanaman bergetah. DNA dianalisis menggunakan 20 marka SSR. Dendrogram kekerabatan dikonstruksi menggunakan metode Unweighted Pair Group Method Arithmetic (UPGMA) melalui software NTSYS-pc (Numerical Taxonomy and Multivariate Analysis System) versi 2.1-pc. Hasil penelitian menunjukkan nilai polimorfisme information content (PIC) marka SSR tinggi sebesar 0,80 (berkisar 0,63-0,91). Jumlah alel yang terdeteksi per marka SSR berkisar antara 4-15 alel per lokus SSR (rata-rata 8,75). Analisis filogenetik 49 aksesi menghasilkan diversitas genetik 12,5- 54,72% (kemiripan genetik 55,28-87,50%). Pada diversitas genetik 54,72%, aksesi Kamerun terbagi menjadi tujuh kelompok masing-masing terdiri dari 9, 28, 4, 2, 1, 2, dan 3 aksesi. Aksesi dengan diversitas genetik tinggi dan berada pada klaster berbeda, potensial digunakan sebagai calon tetua dalam program pemuliaan kelapa sawit. Kata kunci: Elaeis guineensis Jacq., diversitas genetik, plasma nutfah, marka SSRABSTRACT Genetic diversity of the Indonesian oil palm collection is very low. To improve their genetic variability, exploration from the oil palm center of origins has been done in Kamerun. The objectives of this study were to determine genetic and polymorphism level of the SSR markers Cameroon- originated oil palm accessions. Genetic materials used were 49 Cameroon- originated oil palm accessions collected at Sijunjung Oil Palm Germplam Collection Station, West Sumatera. Genomic DNA was isolated using a protocol for isolating DNA from leaves rich with latex. DNA was analyzed using 20 SSR markers. A dendogram was constructed using the Unweighted Pair Group Method Arithmetic (UPGMA) method through the Numerical Taxonomy and Multivariate Analysis System software (NTSYS-pc) version 2.1-pc. Results showed that the polimorfisme information content (PIC) values of the SSR markers used was high, 0.80 (range from 0.63-0.91). The average number of the SSR alleles detected was also high, 8.75 alleles (range from 4-15 alleles per SSR locus). Phylogenetic analysis of the 49 oil palm accessions resulted genetic diversity of 12.5-54.72% (genetic similarity of 55.28-87.50%). At genetic diversity 54.72%, the 49 accessions were divided into seven clusters, each consisted of 9, 28, 4, 2, 1, 2, and 3 accesions, respectively. Accessions with high genetic diversity and located at different clusters may be useful as parent candidates in the future oil palm breeding programs. Key words: Elaeis guineensis Jacq., genetic diversity, germplasm, SSR markers

Style APA, Harvard, Vancouver, ISO itp.

47

Xuan, Zhou, Zheng Hong Li, Cheng Zhang, Hong Dao Zhang, Ji Lin Li i Yan Ming Zhang. "An Application of Molecular Tools in Plant Genetic Diversity Conservation". Advanced Materials Research 955-959 (czerwiec 2014): 830–33. http://dx.doi.org/10.4028/www.scientific.net/amr.955-959.830.

Pełny tekst źródła

Streszczenie:

The conservation and use of plant genetic diversity are essential to the continued maintenance and improvement of agricultural and forestry production and thus, to sustainable development and poverty alleviation. The dramatic advances in molecular genetics over the last decade years have provided workers involved in the conservation of plant genetic diversity with a range of new techniques. Molecular tools, such as molecular markers and other genomic applications, have been highly successful in characterizing existing genetic variation within species, which generates new genetic diversity that often extends beyond species boundaries. The objectives of this article are to review the molecular basis on plant genetic diversity conservation and summarize the continuously rising and application of molecular tool. Then, we look forward and consider the significant of application of molecular tools in plant genetic diversity conservation.

Style APA, Harvard, Vancouver, ISO itp.

48

CROW, J. F. "Human Genetic Diversity: Genetic Variation and Its Maintenance." Science 236, nr 4807 (12.06.1987): 1475–76. http://dx.doi.org/10.1126/science.236.4807.1475-a.

Pełny tekst źródła

Style APA, Harvard, Vancouver, ISO itp.

49

Neri, Jordana, Tânia Wendt i Clarisse Palma-Silva. "Comparative phylogeography of bromeliad species: effects of historical processes and mating system on genetic diversity and structure". Botanical Journal of the Linnean Society 197, nr 2 (27.03.2021): 263–76. http://dx.doi.org/10.1093/botlinnean/boab019.

Pełny tekst źródła

Streszczenie:

Abstract A fundamental challenge in population genetics is to understand the role of ecological and historical processes in shaping genetic diversity patterns within and among species. Based on a set of nuclear microsatellite loci, we conducted a comparative study of the genetic diversity and structure of two epiphytic plant species: Vriesea simplex and V. scalaris (Bromeliaceae), endemic to the Brazilian Atlantic Rainforest. The results showed contrasting genetic diversity and structure patterns according to variation in reproductive systems of these species. High genetic diversity, high effective population sizes and low genetic differentiation were observed in the mainly outcrossing V. simplex populations. In contrast, low genetic diversity, low effective population sizes and high genetic differentiation were detected in the mainly selfing V. scalaris populations. Accordingly, the isolation-by-distance indicated stronger population structures in V. scalaris than in V. simplex. Both species showed a similar phylogeographic north-south split across the Atlantic Rainforest, suggesting possible multiple refugia in this biome. Historical climatic changes during the Pleistocene were possible determinants of the genetic diversity and structure of these species in the Atlantic Rainforest. Divergent mating systems (selfing vs. outcrossing), genetic drift and colonization history influenced the genetic diversity and structure of these Neotropical plant species.

Style APA, Harvard, Vancouver, ISO itp.

50

Nooratiny, I i Kumara Thevan Krishnan. "A preliminary investigation of genetic diversity amongst Rusa timorensis in Tanjung Malim, Perak and Bilut Agro Farm, Pahang, Malaysia". Journal of Tropical Resources and Sustainable Science (JTRSS) 10, nr 1 (30.06.2022): 39–42. http://dx.doi.org/10.47253/jtrss.v10i1.897.

Pełny tekst źródła

Streszczenie:

A study on genetic diversity analysis was conducted on Rusa timorensis obtained from state of Perak and state of Pahang to investigate the level of genetic diversity occur and to compare the diversity amongst two R. timorensis breeders in Malaysia. A total of six (n=6) individual samples of R. timorensis were extracted from Tanjung Malim, Perak and Bilut Agro Farm, Pahang and amplified using mitochondria deoxyribonucleic acid (mtDNA) primers gene as a target molecular marker. The mtDNA region was amplified using a set of cytochrome b gene primers (5”AAACCAGAAAAGGAGAGCAAC3”;5”TCATCTAGGCATTTTCAGTGCC3”) and nucleotide sequence of the mtDNA cyt b was aligned by using MEGA Ver 7.0. The result indicated that the R. timorensis from Pahang has a low degree of variation (0.252) of genetic distance compared to, R. timorensis from Perak (0.696). The phylogenetic three analysis, indicated, R. timorensis from Pahang resulted the highest intra-specific relationship at 100% compared to , R. timorensis from Perak at 63% of intra-specific relationship. The results showed that the genetic diversity of, R. timorensis in Perak and Pahang is likely to decrease in the future. Therefore, future breeding program plan needs to be implemented to diversify the genetics of genus Rusa in Malaysia.

Style APA, Harvard, Vancouver, ISO itp.

Artykuły w czasopismach na temat „Genetic diversity”

Utwórz poprawne odniesienie w stylach APA, MLA, Chicago, Harvard i wielu innych