Artykuły w czasopismach na temat „Donker F”

Kliknij ten link, aby zobaczyć inne rodzaje publikacji na ten temat: Donker F.

Utwórz poprawne odniesienie w stylach APA, MLA, Chicago, Harvard i wielu innych

Wybierz rodzaj źródła:

Sprawdź 50 najlepszych artykułów w czasopismach naukowych na temat „Donker F”.

Przycisk „Dodaj do bibliografii” jest dostępny obok każdej pracy w bibliografii. Użyj go – a my automatycznie utworzymy odniesienie bibliograficzne do wybranej pracy w stylu cytowania, którego potrzebujesz: APA, MLA, Harvard, Chicago, Vancouver itp.

Możesz również pobrać pełny tekst publikacji naukowej w formacie „.pdf” i przeczytać adnotację do pracy online, jeśli odpowiednie parametry są dostępne w metadanych.

Przeglądaj artykuły w czasopismach z różnych dziedzin i twórz odpowiednie bibliografie.

1

Clini, E. "In memoriam Claudio F. Donner". Pulmonology 27, nr 6 (listopad 2021): 484–85. http://dx.doi.org/10.1016/j.pulmoe.2021.08.006.

Pełny tekst źródła
Style APA, Harvard, Vancouver, ISO itp.
2

Ivanković, Ante, Giovanni Bittante, Gordan Šubara, Edmondo Šuran, Zdenko Ivkić, Mateja Pećina, Miljenko Konjačić, Ivica Kos, Nikolina Kelava Ugarković i Jelena Ramljak. "Genetic and Population Structure of Croatian Local Donkey Breeds". Diversity 14, nr 5 (21.04.2022): 322. http://dx.doi.org/10.3390/d14050322.

Pełny tekst źródła
Streszczenie:
The two native Croatian donkey breeds (Littoral-Dinaric donkey and Istrian donkey) were marginalized in the second half of the 20th century and were on the verge of biological extinction. The aim of this study was to analyze the demographic and genetic status of two donkey breeds, two decades after the start of protection by analyzing their pedigrees and genetic structure. The average generation interval was higher for the Istrian donkey (7.73) than for the Littoral-Dinaric donkey (7.27). The rate of the effective number of founders compared with the effective number of ancestors in the Littoral-Dinaric donkey (1.03; 325/316) and in the Istrian donkey (1.08; 70/65) revealed no evidence of a genetic bottleneck. The inbreeding coefficient (F) and the average relatedness coefficient (AR) was lower in the Littoral-Dinaric donkey population (0.99%; 0.13%) than in the Istrian donkey population (1.77%; 1.10%). Genetic microsatellite analysis showed relatively high genetic diversity in Littoral-Dinaric donkey and Istrian donkey breeds, expressed by mean allele number (5.92; 5.85) and expected heterozygosity (0.650; 0.653). Genetic differentiation between the Littoral-Dinaric donkey and the Istrian donkey has not significantly increased in the last two decades (FST = 0.028). Genetic analysis also showed no evidence of high inbreeding or genetic bottleneck in both breeds. A total of 11 haplotypes including 28 polymorphic sites were found in 30 samples. Analysis of mtDNA has shown that the Littoral-Dinaric donkey and Istrian donkey breeds belong to the Equus asinus africanus group. The study confirms the need to use different analytical approaches to get a regular and complete insight into the situation and trends within and between breeds, so that the existing diversity can be fully preserved.
Style APA, Harvard, Vancouver, ISO itp.
3

Vos, J., J. Lemmers, S. Elmessaoudi, M. Snoeren, A. Van Dijk, T. Duijnhouwer, L. Rodwell i in. "POS1285 PERIPHERAL MICROVASCULAR FUNCTION IS LINKED TO CARDIAC INVOLVEMENT ON CMR IN SYSTEMIC SCLEROSIS-RELATED PULMONARY ARTERIAL HYPERTENSION PATIENTS". Annals of the Rheumatic Diseases 82, Suppl 1 (30.05.2023): 989.2–989. http://dx.doi.org/10.1136/annrheumdis-2023-eular.3748.

Pełny tekst źródła
Streszczenie:
BackgroundSystemic sclerosis (SSc) is characterized by vasculopathy, inflammation and fibrosis, and carries one of the worst prognoses if patients also develop pulmonary arterial hypertension (PAH). Although PAH is a known prognostic factor, SSc-PAH patients demonstrate disproportionately high mortality, presumably due to cardiac involvement [1].ObjectivesTo investigate the relation between cardiac involvement as revealed by Cardiovascular Magnetic Resonance (CMR) and systemic microvascular disease severity as measured with nailfold capillaromicroscopy (NCM) in SSc-PAH patients, compared to idiopathic PAH (IPAH) patients.MethodsSSc-PAH and IPAH patients underwent CMR, transthoracic echocardiography (TTE), and NCM with post-occlusive reactivity hyperemia (PORH) testing on the same day [2-4]. CMR imaging included T2 mapping, native and postcontrast T1 mapping, to assess edema and fibrosis, and adenosine-stress perfusion imaging to measure the relative myocardial upslope (to determine microvascular coronary perfusion). Measures of peripheral microvascular function were related to CMR indices of edema, fibrosis and myocardial perfusion.ResultsSSc-PAH patients (n=20) had higher extracellular volume fraction (ECV) and T2 values than IPAH patients (n=5), and lower nailfold capillary density (NCD) and reduced capillary recruitment after PORH. NCD correlated with native T1, ECV, and T2 values (r=-0.431, -0.443, and -0.464, respectively, p<0.05 for all), and with markers of diastolic dysfunction on echocardiography. Furthermore, PORH-testing, but not NCD, correlated with the relative myocardial upslope by stress CMR (r=0.421, p<0.05) (Table 1).Table 1.Nailfold capillaroscopy with post occlusive hyperemia reactivity testingSSc-PH (n=20)IPAH (n=5)p-valueAverage capillary density (n/mm)4 [3-6]10 [10-11]<0.001Pattern (n)Normal04 (80%)Non-specific01 (20%)Systemic sclerosis: early pattern1 (4%)0Systemic sclerosis: active pattern1 (4%)0Systemic sclerosis: late pattern18 (72%)0Post-occlusive reactivity hyperemia testingRest (n/mm2)55 [39-73]93 [80-97]0.006Average capillaries after PORH (n/mm2)53 [46-77]100 [81-120]0.006Total recruitment of capillaries (n/mm2)1 [-4-5)23 [-3-27)<0.05Average capillaries at venous congestion (n/mm2)55 [50-78]106 [81-126]0.006Total recruitment of capillaries (n/mm2)5 [1-11]11 [-9-30]0.613Values are in medians [interquartile range] or number (%).Abbreviations:NT-proBNP, N-terminal pro-Brain Natriuretic Peptide; POHR, post-occlusive reactivity hyperemia testConclusionSSc-PAH patients showed higher markers of cardiac fibrosis and inflammation, compared to IPAH patients. These markers correlated well with peripheral microvascular dysfunction, suggesting that SSc-driven inflammation and vasculopathy concurrently affect peripheral microcirculation and the heart. This may contribute to the disproportionately high mortality in SSc-PAH patients.References[1]Chung L, Domsic RT, Lingala B, Alkassab F, Bolster M, Csuka ME, et al. Survival and predictors of mortality in systemic sclerosis-associated pulmonary arterial hypertension: outcomes from the pulmonary hypertension assessment and recognition of outcomes in scleroderma registry. Arthritis Care Res (Hoboken). 2014;66(3):489-95.[2]Smith V, Herrick AL, Ingegnoli F, Damjanov N, Angelis, Denton CP, et al. Standardisation of nailfold capillaroscopy for the assessment of patients with Raynaud’s phenomenon and systemic sclerosis. Autoimmun Rev. 2020:102458.[3]Liu A, Wijesurendra RS, Liu JM, Greiser A, Jerosch-Herold M, Forfar JC, et al. Gadolinium-Free Cardiac MR Stress T1-Mapping to Distinguish Epicardial From Microvascular Coronary Disease. J Am Coll Cardiol. 2018;71(9):957-68.[4]Serne EH, Gans RO, ter Maaten JC, Tangelder GJ, Donker AJ, Stehouwer CD. Impaired skin capillary recruitment in essential hypertension is caused by both functional and structural capillary rarefaction. Hypertension. 2001;38(2):238-42.Acknowledgements:NIL.Disclosure of InterestsJaqueline Vos: None declared, Jacqueline Lemmers: None declared, Saloua ElMessaoudi: None declared, Miranda Snoeren: None declared, Arie van Dijk: None declared, Toon Duijnhouwer: None declared, Laura Rodwell: None declared, Sander van Leuven: None declared, Marco Post Speakers bureau: Janssen, Consultant of: Janssen, MSD, Grant/research support from: Janssen, St. Antonius Research fund, ZonMw, Madelon Vonk Speakers bureau: Boehringer Ingelheim, Bristol-Myers Squibb, GSK, Janssen, MSD, Novartis and Roche, Consultant of: Boehringer Ingelheim and Janssen, Grant/research support from: Boehringer Ingelheim, Janssen, Ferrer and Galapagos, Robin Nijveldt Speakers bureau: Sanofi, BMS, Bayer, Boerhinger Ingelheim, Consultant of: Sanofi, BMS, Grant/research support from: Philips Volcano, Biotronik.
Style APA, Harvard, Vancouver, ISO itp.
4

Jessica, P., Rebecca Morris-Miller, Brandy Myette i S. Monty Ghosh. "Recevoir et donner des services virtuels de réduction des méfaits et de pair aidance". Canadian Medical Association Journal 195, nr 37 (24.09.2023): E1279—E1282. http://dx.doi.org/10.1503/cmaj.221188-f.

Pełny tekst źródła
Style APA, Harvard, Vancouver, ISO itp.
5

Zakharova, Olga. "Donkey Squared, or Who First Called Dostoevsky a Genius". Неизвестный Достоевский 7, nr 3 (wrzesień 2020): 20–30. http://dx.doi.org/10.15393/j10.art.2020.4821.

Pełny tekst źródła
Streszczenie:
The article examines the literary circumstances of F. M. Dostoevsky’s debut. They were reflected in the correspondence and memoirs, and in his contemporaries’ literary polemics. Dostoevsky was one of the few Russian writers who was awarded the title of genius by critics long before the publication of his first novel. Thus, the question of who had called him a genius emerges as relevant? For the first time this word was uttered by V. G. Belinsky, but neither he nor his associates declared Dostoevsky a genius in print. Rumors did it for them more effectively than the printed word. The rumor of “extraordinary talent” and “new genius” provoked the opponents of V. G. Belinsky: F. V. Bulgarin, O. I. Senkovsky, L. V. Brant, S. P. Shevyrev, etc. As they tried to convince readers of the mediocrity of the up-and-coming talent, they unwittingly made Dostoevsky a genius, presented his brilliance as a fact. Two years later, Belinsky abandoned his discovery of the genius of Dostoevsky, and called himself “a donkey squared”, yet the revision of the personal relationship did not affect the writer’s literary fate. The scandal and controversy over the novel The Poor Folk reinforced Dostoevsky’s fame.
Style APA, Harvard, Vancouver, ISO itp.
6

Celik, Figen, Sami Simsek, Harun Kaya Kesik i Seyma Gunyakti Kilinc. "A Comprehensive in silico Analysis of mt-CO1 gene of Fasciola hepatica". Journal of the Hellenic Veterinary Medical Society 73, nr 2 (10.07.2022): 4181–92. http://dx.doi.org/10.12681/jhvms.26881.

Pełny tekst źródła
Streszczenie:
This study was conducted for the aim of comprehensive evaluation of the genetic diversity and phylogenetic relations of F. hepatica among various hosts. In this study, published sequences of mt-CO1 gene fragments belonging to final hosts of F. hepatica were used to create the dataset. First of all, 478 sequences were obtained with PubMed search. Then, some shorter sequences were removed after alignment, and 319 sequences which included cattle (n=242), sheep (n=46), goat (n=5), donkey (n=8), bison (n=7), water buffalo (n=7), human (n=2) and camel (n=2) sequences were analysed in the MEGA X program. The existence of 72 haplotype groups was detected. The most polymorphic sites (n=42) containing 31% (13/42) parsimony informative sites were detected in Iranian isolates. The mt-CO1 network consisted of 35 haplotypes, 80% out of which were geographically unique. However, a main haplotype consisting of 39.2% of the total isolates was formed. The bison isolates of F. hepatica showed the highest haplotype diversity within the final host isolates, followed by the sheep, water buffalo, cattle, goat and donkey isolates. The genetic diversity of F. hepatica in different hosts and countries revealed the possibility of new strains appearing in the future.
Style APA, Harvard, Vancouver, ISO itp.
7

Wagiyo, Karsono, Tirtadanu i Umi Chodriyah. "Biology characteristic, abundance index and fishing aspect of donkey croaker (Pennahia anea Bloch, 1793) in the Tangerang Waters". E3S Web of Conferences 153 (2020): 01011. http://dx.doi.org/10.1051/e3sconf/202015301011.

Pełny tekst źródła
Streszczenie:
Pennahia anea in Tangerang waters have a fork length between 9.4 and 23 cm, with an average of 18.9 cm and modus 18-18.5 cm. Growth type is isometric with correlation R2 = 0.7266 and b = 3.2251. The sex ratio of female: male = 1: 0.9. Level and index maturity of gonad are highest in February and lowest in March.The length first maturity of donkey croaker at 15.8 cmFL. The length of the first capture (Lc) by danish seine net at 16,76 cmFL and by gill net at 17.60 cmFL. Asymptotic length (L∞) at 23.89 cmFL and growth rate (K) = 0.84 per year. Mortality rate; total (Z) = 4.01, natural (M) = 1.73/year and by fishing (F) = 2.28/year. Exploitation rate (E) of donkey croaker fish is 0.57. CPUE the smallest in July was 0.41 kg/trip/day, the largest was in June 9 kg/trip/day, averaging 3.3 kg/trip/day. The fishing season from July to January with its peak in November and the famine season occurs in February-June with a peak in February. The main fishing gear for catching donkey croaker fish in the Tangerang waters is the danish seine net. The highest production of donkey croaker fish in June.
Style APA, Harvard, Vancouver, ISO itp.
8

Gereffi, Gary. "Driving a Bargain: Automobile Industrialization and Japanese Firms in Southeast Asia.Richard F. Doner". American Journal of Sociology 98, nr 2 (wrzesień 1992): 446–48. http://dx.doi.org/10.1086/230044.

Pełny tekst źródła
Style APA, Harvard, Vancouver, ISO itp.
9

Zarakol, Ayse. "The Politics of Uneven Development: Thailand's Economic Growth in Comparative Perspective - By Richard F. Doner". Review of Policy Research 27, nr 6 (20.10.2010): 827–29. http://dx.doi.org/10.1111/j.1541-1338.2010.00473_3.x.

Pełny tekst źródła
Style APA, Harvard, Vancouver, ISO itp.
10

Okabe, Yasunobu. "The Politics of Uneven Development: Thailand's Economic Growth in Comparative Perspective - By Richard F. Doner". Developing Economies 49, nr 3 (24.08.2011): 347–50. http://dx.doi.org/10.1111/j.1746-1049.2011.00138.x.

Pełny tekst źródła
Style APA, Harvard, Vancouver, ISO itp.
11

Lannes, F., i P. O. Fais. "Quelle valeur donner à une fixation prostatique fortuite sur une tomographie par émission de positon au 18 F-fluorodésoxyglucose (TEP 18 F-FDG) ?" Progrès en Urologie 27, nr 13 (listopad 2017): 702–3. http://dx.doi.org/10.1016/j.purol.2017.07.063.

Pełny tekst źródła
Style APA, Harvard, Vancouver, ISO itp.
12

van Schaick, Bert, i Annina H. Persson. "OGH, 6.12.2001 - Wirkliche Übergabe bei Schenkung auch durch Besitzkonstitut?" European Review of Private Law 13, Issue 2 (1.04.2005): 195–207. http://dx.doi.org/10.54648/erpl2005012.

Pełny tekst źródła
Streszczenie:
A plusieurs reprises, pendant une période d?environ vingt ans avant sa mort, Mme F. a exigé du demandeur, chaque fois que celui?ci lui rendait visite, qu?il emporte avec lui un bien mobilier de valeur qu?elle déclarait vouloir lui donner. Mais de son côté le demandeur lui proposait de garder ce bien chez elle aussi longtemps qu?elle vivrait. Dans un premier testament de Mme F., mention fut faite de cette donation. Mais celle?ci n?ayant pas été reprise dans le dernier testament de la défunte, il s?en est suivi un litige sur la réalité de cette donation entre le demandeur et le défendeur. Dans l?arrêt commenté, l?OGH a déclaré que le demandeur était devenu propriétaire et que le défendeur, qui avait vendu le bien dont il n?était pas le possesseur de bonne foi, était tenu de l?indemniser.
Style APA, Harvard, Vancouver, ISO itp.
13

Theunissen, Bert. "Turning refracting into a science: F. C. Donders' ‘scientific reform’ of lens prescription". Studies in History and Philosophy of Science Part C: Studies in History and Philosophy of Biological and Biomedical Sciences 31, nr 4 (grudzień 2000): 557–78. http://dx.doi.org/10.1016/s1369-8486(00)00012-1.

Pełny tekst źródła
Style APA, Harvard, Vancouver, ISO itp.
14

ARRAUT, IVAN. "ABOUT THE PROPAGATION OF THE GRAVITATIONAL WAVES IN AN ASYMPTOTICALLY DE SITTER SPACE: COMPARING TWO POINTS OF VIEW". Modern Physics Letters A 28, nr 09 (21.03.2013): 1350019. http://dx.doi.org/10.1142/s0217732313500193.

Pełny tekst źródła
Streszczenie:
We analyze the propagation of gravitational waves (GWs) in an asymptotically de Sitter space by expanding the perturbation around Minkowski and introducing the effects of the Cosmological Constant (Λ), first as an additional source (de-Donder gauge) and after as a gauge effect (Λ-gauge). In both cases the inclusion of the Cosmological Constant Λ, impedes the detection of a gravitational wave at a distance larger than [Formula: see text], where [Formula: see text] and f and [Formula: see text] are the frequency and strain of the wave, respectively. We demonstrate that L c is just a confirmation of the cosmic no hair conjecture (CNC) already explained in the literature.
Style APA, Harvard, Vancouver, ISO itp.
15

Moret, Sébastien. "Une autre linguistique de 1916: les idées de Ja. Linzbach face à celles de F. de Saussure". Cahiers du Centre de Linguistique et des Sciences du Langage, nr 57 (7.11.2018): 149–63. http://dx.doi.org/10.26034/la.cdclsl.2018.119.

Pełny tekst źródła
Streszczenie:
Si l’histoire de la linguistique a marqué la date de 1916, c’est avant tout et surtoutpour le moment théorique fondateur que représente pour la discipline la publicationdu Cours de linguistique générale de Ferdinand de Saussure. Mais 1916, c’est aussil’année de la parution à Petrograd des Principes d’une langue philosophique del’Estonien Jakob Linzbach. N’y aurait-il eu que cette concordance chronologique, ilest fort probable que ces deux auteurs n’auraient jamais été rapprochés, que ce soitdans cette présente étude ou ailleurs. Indépendamment l’un de l’autre, leurs ouvragesrespectifs vont donner à lire des réflexions sur le signe et sur la linguistiqueen tant que science qui méritent qu’on s’y arrête. Dans le cadre de ces propos, cesont les réflexions et les idées de Linzbach concernant la science linguistique quiseront présentées, analysées et intégrées dans le contexte scientifique et le contenudu Cours saussurien.
Style APA, Harvard, Vancouver, ISO itp.
16

Khogali, Altayeb, Dia-Eldin A. Elnaiem, Ramón Díaz-Regañón, Tayseer Jibreel, Bakri Y. M. Nour, Samira Hamid Abdelrahman, Ricardo Molina i Maribel Jiménez. "Infection of Leishmania donovani in Phlebotomus orientalis Sand Flies at Different Microhabitats of a Kala-Azar Endemic Village in Eastern Sudan". Tropical Medicine and Infectious Disease 9, nr 2 (2.02.2024): 40. http://dx.doi.org/10.3390/tropicalmed9020040.

Pełny tekst źródła
Streszczenie:
A study was carried out to compare the infection rates of Leishmania donovani in Phlebotomus orientalis sandflies at different microhabitats of a VL endemic village in Gedarif state, Sudan. DNA extracts of 1078 P. orientalis sand fly females sampled by CDC light traps from indoor, outdoor, peri-domestic, and sylvatic sites, in three transmission seasons, March–June 2016–18, in Helat-Belo village, were subjected to independent PCR amplifications targeting Leishmania kDNA and the cpb gene followed by ITS1 region sequencing. Leishmania kDNA was detected in 1.4% of the 1078 P. orientalis females captured in the area. Two of these specimens showed a characteristic 741 bp band of L. donovani after cpb gene amplification. The DNA sequence of the ITS1 region of the parasites matched the ITS1 L. donovani genotype F. There were no signficant differences between rates of infection of L. donovani in P. orientalis captured at different sites. Blood meals found in infected flies origninated from human (5 specimens), cattle (4 specimens) and donkey (2 specimens). The finding of fresh cow and donkey blood in the infected flies suggests the possible role of these animals in the zoopotentiation and/or zooprophylaxis against VL. The study provides important information for VL transmission models and control programs in East Africa.
Style APA, Harvard, Vancouver, ISO itp.
17

Dinkelaker, Helmut. ""Videant Consules" - Stellungnahme zu dem Artikel von F. Donner in der AHZ, Band 213/1968, Heft 6, Juni". Allgemeine Homöopathische Zeitung 214, nr 01 (13.04.2007): 24–25. http://dx.doi.org/10.1055/s-2006-935492.

Pełny tekst źródła
Style APA, Harvard, Vancouver, ISO itp.
18

Lepage, Yvan G. "Dans l’atelier de Félix-Antoine Savard". Voix et Images 29, nr 2 (23.09.2004): 53–82. http://dx.doi.org/10.7202/008772ar.

Pełny tekst źródła
Streszczenie:
Résumé De Menaud maître-draveur, roman phare de Félix-Antoine Savard, on possède trois rédactions manuscrites et quatre versions imprimées, s’échelonnant de 1934 à 1967. L’examen des manuscrits permet de suivre la gestation du roman et de saisir sur le vif la méthode de travail de l’écrivain, continuellement tendu vers un idéal de perfection formelle. La première édition (1937) ne donnera pas satisfaction à l’esthète que fut F.-A. Savard. Pendant trois décennies, il reviendra inlassablement sur son oeuvre, ne parvenant à lui donner sa forme définitive, classique, qu’après bien des hésitations et des repentirs. Le célèbre « Songe du Lucon » (fin du chapitre III) est à cet égard tout à fait révélateur.
Style APA, Harvard, Vancouver, ISO itp.
19

Liu, Li-Lin, Xiao-Ling Zhou, Hong-Jian Yang i Rong Chen. "Effect of Dietary Forage/Concentrate Ratio on Nutrient Digestion and Energy and Protein Metabolism in Adult Donkeys". Animals 10, nr 6 (12.06.2020): 1025. http://dx.doi.org/10.3390/ani10061025.

Pełny tekst źródła
Streszczenie:
The domestic donkey is a unique equid species with specific nutritional requirements; however, limited feeding studies have been addressed so far to understand nutrient digestion and metabolism in donkeys. In the present study, six adult female Xinjiang donkeys (180 ± 10 kg live weight) were applied in a 3 × 3 Latin square design to investigate the effect of the forage/concentrate ratio (F/C) in three experimental diets on N and energy balance within 12 weeks. Rice straw and alfalfa hay were chosen as forage ingredients, and the diets included the following: (1) a high-fiber (HF) ration (F/C = 80:20), (2) a medium-fiber (MF) ration (F/C = 55:45), and (3) a low-fiber (LF) ration (35:45). After the fixed amount of diets were daily allowed to the animals, total feces and urine were collected to determine total tract digestibility, N and energy balance. As a result, dry matter intake did not differ among the three diet groups. Decreasing the dietary F/C significantly promoted protein digestibility and decreased fiber digestibility. The N and energy balance analysis showed that increasing the F/C remarkably (p < 0.01) decreased N retention through the increase in N excretion in urine, and the highest N loss relative to N intake was observed in MF. Meanwhile, decreasing the F/C linearly increased the conversion efficiency of digestible energy to metabolizable energy. Taken together, the results obtained in the present study implicated that the dietary forage level should not be less than 55% to maintain greater N and energy utilization in feeding practice, otherwise, a donkey’s N utilization might be highly discounted.
Style APA, Harvard, Vancouver, ISO itp.
20

Nengomasha, E. M., R. A. Pearson i T. Smith. "The donkey as a draught power resource in smallholder farming in semi-arid western Zimbabwe: 2. Performance compared with that of cattle when ploughing on different soil types using two plough types". Animal Science 69, nr 2 (październik 1999): 305–12. http://dx.doi.org/10.1017/s1357729800050876.

Pełny tekst źródła
Streszczenie:
AbstractThe work performance of two teams of four donkeys (heavy, 680 kg and light, 460 kg) and one pair of Jersey crossbred oxen (646 kg) was compared when they ploughed 4 hi day on four types of soil (clay, redsoil, sandy soil and sandy clay) using two types of plough, a conventional ox plough (40 kg) and a lighter prototype, the ‘Walco’ plough (32 kg) on an experimental farm. Work parameters were also measured with farmers’ cattle and donkey teams ploughing on f arms in Matobo and Nkayi districts. Working speed, power and effective field capacity (ETC) were higher for the ox-team (1·03 m/s, 920 W and 14·5 h/ha for the conventional plough and 0·99 m/s, 745 W and 13·9 h/hafor the Walco plough) and the heavier donkey team (0·87 m/s, 689 W and 14·2 h/hafor the conventional plough and 0·87 m/s, 787 W and 17·3 h/hafor the Walco plough) than for the lighter donkey team (0·59 m/s, 461 W and 22·1 h/hafor the conventional plough and 0·64 m/s, 445 W and 23·4 h/hafor the Walco plough). Expressed as a proportion of live weight or metabolic live weight there were no significant differences in draught forces exerted between teams but power output per unit live weight was greater in the ox-team than in the light donkey team but similar to that in the heavy donkey team. The Walco plough required a lower force (742 N) to operate than the conventional plough (816 N) but apart from this did not have any marked advantages over the conventional plough. On-farm, team sizes of donkeys varied from three to seven animals (team weight 340 kg to 1007 kg) and cattle team sizes from two to four animals (team weights 558 to 1709 kg). Regardless of team number, the heavier teams tended to out-perform the lighter teams (speed range 0·63 to 1·08 m/s, power 395 to 1136 W, EFC 9·1 to 25 h/ha)) with one exception, a well trained team of two oxen (team weight 879 kg, speed 1·02 m/s, power 775 W, EFC 9·1 h/ha). Donkeys tended to plough at a slower pace than oxen, with a lower power output, although when weight differences between teams were equalized (four heavy donkeys compared with two oxen), then there was little to chose between the species. Results suggested that teams of three or more donkeys can effectively be used for ploughing on the soils tested. The results highlighted the importance that team live weight and training/experience have in determining work performance.
Style APA, Harvard, Vancouver, ISO itp.
21

Cissokho, Sidy. "Comment faire du sur-mesure avec du prêt-à-porter ? Petit exercice pratique de sociologie politique comparée". Critique internationale N° 100, nr 3 (1.09.2023): 121–27. http://dx.doi.org/10.3917/crii.100.0121.

Pełny tekst źródła
Streszczenie:
R&#233;sum&#233; Pour le num&#233;ro 100 de Critique internationale , la r&#233;daction propose un document in&#233;dit&#160;: la transcription du cheminement d'un chercheur alors qu'il &#233;bauche une monographie comparative. Confront&#233; &#224; plusieurs journ&#233;es d'&#233;meutes auxquelles il tente de donner du sens, le chercheur plonge dans sa biblioth&#232;que int&#233;rieure. Il s'interroge sur la fa&#231;on dont on peut se saisir d'une r&#233;f&#233;rence bibliographique portant sur un contexte historique singulier pour construire des hypoth&#232;ses et soulever des interrogations &#224; propos d'un autre contexte tout aussi singulier.
Style APA, Harvard, Vancouver, ISO itp.
22

Healy, D. P. "Radioimmunocytochemical localization of corticotropin-releasing factor and adrenocorticotropin in the hypothalamo-hypophyseal system of the rat: effects of adrenalectomy." Journal of Histochemistry & Cytochemistry 40, nr 7 (lipiec 1992): 969–78. http://dx.doi.org/10.1177/40.7.1318895.

Pełny tekst źródła
Streszczenie:
Various radioimmunocytochemical approaches have been utilized to localize primary antibody-antigen complexes. Here we examined the binding properties of three different radioiodinated compounds for their ability to label the antibody-antigen complex, including: donkey anti-rabbit immunoglobulin, donkey anti-rabbit F(ab')2-IgG, and a biotinylated goat anti-rabbit secondary antibody followed by [125I]-avidin. These probes were used to localize rabbit primary antisera against corticotropin-releasing factor (CRF) and adrenocorticotropin-releasing hormone (ACTH) in the hypothalamo-hypophyseal system of the rat. The pattern of labeling with each radiolabeled probe was consistent with the light microscopic immunocytochemical staining for CRF and ACTH. The utility of the radioimmunocytochemical method for quantitative analyses was further tested by studying the effects of adrenalectomy (ADX) on the levels of immunoreactive CRF and ACTH in the hypothalamo-hypophyseal system. Computer-assisted microdensitometric analysis of immunoreactive CRF levels in the median eminence indicated that there was a 33% decrease 24 h after ADX. Immunoreactive ACTH levels in the anterior pituitary were significantly decreased from 1 day (38%) to 1 week (36%) after ADX and were increased at 2 weeks (89%). The changes in CRF and ACTH levels, as measured radioimmunocytochemically after ADX, were consistent with previous biochemical studies. These results indicate that computer-assisted radioimmunocytochemical analysis can be used quantitatively to measure immunoreactivity in tissue sections. The high resolution and high sensitivity provided by this method should make it widely applicable.
Style APA, Harvard, Vancouver, ISO itp.
23

Hall, V., D. Compton, P. Stojkovic, M. Nesbitt, M. Herbert, A. Murdoch i M. Stojkovic. "36 DEVELOPMENTAL COMPETENCE OF HUMAN AGED OOCYTES AS HOST CELLS FOR NUCLEAR TRANSFER". Reproduction, Fertility and Development 18, nr 2 (2006): 126. http://dx.doi.org/10.1071/rdv18n2ab36.

Pełny tekst źródła
Streszczenie:
The use of aged metaphase II oocytes (cultured in vitro for more than 14 h) for somatic cell nuclear transfer (SCNT) in varying species has resulted in lower developmental outcomes compared with non-aged in vitro- or in vivo-matured oocytes. However, due to limited resources of fresh oocytes for the derivation of nuclear transfer stem cell lines, further investigation in using spare oocytes is required. Aged spare oocytes (48 h post oocyte retrieval) were consigned for research (under HFEA and local ethics approval) by couples undergoing either in vitro fertilization (failed IVF oocytes, f-IVF) or intracytoplasmic sperm injection (failed-ICSI oocytes, f-ICSI) treatments. Aged oocytes were randomly assigned for double-labeling immunocytochemical analysis (f-IVF, n = 10; f-ICSI, n = 7) for the microtubule markers, NuMA and �-tubulin, or parthenogenetic activation. Immunocytochemical analysis was performed as previously described (Chatzimeletiou et al. 2005 Hum. Reprod. 20, 672-682) using primary anti-rabbit NuMA (gift from D. Compton, Dartmouth Medical School, Hanover, NH, USA) and anti-mouse DM1-�. Secondary antibodies were donkey anti-rabbit and anti-mouse immunoglobulins. Oocytes were counterstained with Hoechst 33342. Negative controls were performed as above with blocking solution substituting for primary antibodies. Parthenogenetic activation was performed for 4 h using 10 �M calcium ionophore (5 min) and 2 mM 6-dimethylaminopurine (Ca-I/DMAP) for f-IVF (n = 10) and f-ICSI oocytes (n = 11) or 10 �g/mL puromycin (Ca-I/Pur) for f-IVF (n = 12) and f-ICSI oocytes (n = 10) (4 h). Activated oocytes were cultured in a biphasic system, G1.3" and G2.3" (Vitrolife UK, Ltd., Ediburgh, Lothian, UK) for 5 days at 37 �C in 5% CO2 in humidified air. NuMA was localized to the metaphase spindle in 6/10 (60%) and 7/7 (100%) oocytes for f-IVF and f-ICSI, respectively, and/or in cytoplasmic cytasters. One f-IVF oocyte and four f-ICSI oocytes had visible tetrapolar spindles. Unusual patterns of diffuse NuMA staining containing dense foci within these regions, but not associated with the cytasters or metaphase spindle, were also observed in two f-IVF oocytes. The majority of oocytes displayed ring-like staining of DM1-�, which was aberrant in two f-ICSI oocytes. Parthenogenetic development was poor for both treatments. Cleavage rates were 17% and 20% for f-IVF using Ca-I/PUR and Ca-I/DMAP, respectively, and 40% and 45% for f-ICSI using Ca-I/PUR and Ca-I/DMAP, respectively. Fragmentation rates were high across all treatments. No parthenogenetic embryos developed beyond the 6-cell stage. Thus, the use of aged human oocytes for SCNT may be difficult due to their incapacity to artificially activate using current activation protocols and, in addition, due to the microtubule abnormalities observed in many of these aged oocytes.
Style APA, Harvard, Vancouver, ISO itp.
24

Krijnsen, C. "Herbert Donner, The Mosaic Map of Madaba: An Introductory Guide, Palestina antiqua, 7 (Kampen, Kok Pharos, 1992), 102 pp.,f 47,50." Het Christelijk Oosten 46, nr 3 (29.11.1994): 228. http://dx.doi.org/10.1163/29497663-04603017.

Pełny tekst źródła
Style APA, Harvard, Vancouver, ISO itp.
25

Yean, Tham Siew. "BOOK REVIEW: The Political Economy of Automotive Industrialization in East Asia, by Richard F. Doner, Gregory W. Noble and John Ravenhill". Southeast Asian Economies 39, nr 2 (2022): 222. http://dx.doi.org/10.1355/ae39-2h.

Pełny tekst źródła
Style APA, Harvard, Vancouver, ISO itp.
26

Metts, Michael B. "Philology and the Last Supper: A Lesson from Qur’an Prehistory for Gospel Prehistory?" Bulletin for Biblical Research 31, nr 3 (październik 2021): 319–55. http://dx.doi.org/10.5325/bullbiblrese.31.3.0319.

Pełny tekst źródła
Streszczenie:
Abstract Qur’an researchers associated with philology and the recent revisionist paradigm (voices such as Alphonse Mingana, Christoph Luxenberg, John Wansbrough, Fred M. Donner, Andrew Rippin, Gabriel Said Reynolds, Emran Iqbal El-Badawi, Robert M. Kerr, and Ibn Warraq) evidence a methodological disparity with NT researchers. While Qur’an historians allow meaningful input from philology by appropriating a sensible linguistic milieu that can accord with the Qur’an’s linguistic phenomena, particularly Aramaic or Syriac influence on the Qur’an’s Arabic, several voices in Last Supper research (including Matthias Klinghardt, Dennis E. Smith, and Paul F. Bradshaw) pursue Greco-Roman symposial and/or pagan influences contrary to philological findings. This article considers philology in Qur’an studies and in NT studies and examines anew the Aramaic influence evident in Mark’s Last Supper. Research by Raymond A. Martin and Joachim Jeremias is especially noted. This article seeks to pose NT researchers with the following question: Is there a lesson to learn from scholars working in Qur’an studies?
Style APA, Harvard, Vancouver, ISO itp.
27

Schwimmer, Eric. "La spirale dédoublée et l'identité nationale. L'art abstrait traditionnel maori a-t-il une signification ?" Anthropologie et Sociétés 16, nr 1 (10.09.2003): 59–72. http://dx.doi.org/10.7202/015199ar.

Pełny tekst źródła
Streszczenie:
Résumé La spirale dédoublée et l'identité nationale L'art abstrait traditionnel maori a-t-il une signification ? La spirale dédoublée est un motif " décoratif ". Du point de vue esthetique, elle relève de l'art abstrait. Cet article s'interroge sur les manières maoris de donner un sens à ces images. Six types de codes font l'objet de l'analyse : a) les codes de classification sociale ; b) les codes des parties du corps tatouées de diverses figures ; c) les codes de proverbes et d'anecdotes historiques qui lient chaque figure à un message verbal particulier ; d) les codes physiologiques, surtout en rapport avec les expressions faciales, de manière à lier la figure à une gamme d'expressions faciales ; e) les codes historiques où le message verbal transmet la succession des cultes millénaristes de la Nouvelle-Zélande contemporaine ; f ) les systèmes de transformation historique de l'image même qui devient plurivoque sur le plan de l'expression, s'insérant à la fois dans un style occidental contemporain et dans un style maori.
Style APA, Harvard, Vancouver, ISO itp.
28

Arbouche, Marc. "Les mutations du sens du management de l’entreprise ordinaire : proposition d’un cadre d’analyse". Management & Sciences Sociales N° 15, nr 2 (1.07.2013): 4–15. http://dx.doi.org/10.3917/mss.015.0004.

Pełny tekst źródła
Streszczenie:
L’objet de cet article est de proposer un cadre d’analyse permettant de mesurer le degré d’institutionnalisation des pratiques de management des ressources humaines (MRH). L’institutionnalisation est un processus s’inscrivant dans le contexte des contraintes et ressources de l’action collective. La problématique posée est traitée à partir du cadre théorique et analytique, ou paradigme conceptuel, que F. Bourricaud (1977) nomme « individualisme institutionnel ». L’apport essentiel de ce paradigme est de donner une vision de l’action, partant de cet agir qu’est le management, dans ses deux dimensions : opératoire et symbolique. Il nous permet de saisir le management à la fois sous sa face gouvernante et d’interaction . Partant de ce cadre conceptuel explicité, on considérera les procès d’institutionnalisation des pratiques de management des ressources humaines. Ces pratiques se conçoivent dans un modèle de l’entreprise économique comme unité active face au marché et au contexte institutionnel dans lequel elle agit. Elles pivotent autour de la relation d’emploi et de la nature spécifique du contrat de travail .
Style APA, Harvard, Vancouver, ISO itp.
29

Patel, Ashim Kumar, Biswajit Mishra, Dewashish Upadhyay i Kamal Lochan Pruseth. "Mineralogical and Geochemical Evidence of Dissolution-Reprecipitation Controlled Hydrothermal Rare Earth Element Mineralization in the Amba Dongar Carbonatite Complex, Gujarat, Western India". Economic Geology 117, nr 3 (1.05.2022): 683–702. http://dx.doi.org/10.5382/econgeo.4890.

Pełny tekst źródła
Streszczenie:
Abstract The Amba Dongar carbonatite complex in western India comprises an inner ring of carbonatite breccia surrounded by a sövite ring dike. The various carbonatite units in the body include calcite carbonatite, alvikite, dolomite carbonatite, and ankerite carbonatite. The carbonate phases (calcite and ankerite) occur as phenocrysts, groundmass phases, fresh primary grains, and partially altered grains and/or pseudomorphs when hydrothermally overprinted. Rare earth element (REE) enrichment in the groundmass/altered calcite grains compared to the magmatic ones is ascribed to the presence of micron-sized REE phases. Fluorapatite and pyrochlore constitute important accessory phases that are altered to variable extents. Higher concentrations of Sr, Si, and REEs in fluorapatite are suggestive of a magmatic origin. Fresh pyrochlore preserves its magmatic composition, characterized by low A-site vacancy and high F in the Y-site, which on alteration becomes poorer in Na, Ca, and F and displays an increase in vacancy. The C-O isotope compositions of the carbonates also corroborate the extensive low-temperature hydrothermal alteration of the carbonatites. The REE mineralization is the result of interaction of the carbonatite with a sulfur-bearing, F-rich hydrothermal fluid that exsolved from late-stage carbonatitic magmas. The hydrothermal fluids caused dissolution of the primary carbonates and simultaneous precipitation of REEs and other high field strength element (HFSE)-bearing minerals. Complex spatial associations of the magmatic minerals with the REE fluorocarbonates, [synchysite-(Ce), parisite-(Ce), bastnäsite-(Ce)] and florencite-(Ce) point to the formation of these REE phases as a consequence of postmagmatic hydrothermal dissolution of the REEs from fluorapatite, pyrochlore, and carbonates. Ubiquitous association of fluorite and barite with REE minerals indicates transport of REEs as sulfate complexes in F-rich fluids. Precipitation of REE fluorocarbonates/florencite resulted from fluid-carbonate interaction, concomitant increase in pH, and decrease in temperature. Additionally, REE precipitation was aided and abetted by the removal of sulfur from the fluid by the precipitation of barite, which destabilized the REE sulfate complexes.
Style APA, Harvard, Vancouver, ISO itp.
30

van der Putten, Frans-Paul. "Small Powers and Imperialism The Netherlands in China, 1886–1905". Itinerario 20, nr 1 (marzec 1996): 115–31. http://dx.doi.org/10.1017/s0165115300021562.

Pełny tekst źródła
Streszczenie:
Ever since its publication in 1966, Tussen Neutraliteit en Imperialisme (‘Between Neutrality and Imperialism’) has been the standard work on Dutch policy towards China between 1863 and 1901. In this study the author, F. van Dongen, stresses the adherence to neutrality towards the strong European neighbour states as the fundamental guideline for Dutch foreign policy, not only within Europe but also in the Far East. This policy stemmed from the fact that the European balance-of-power system had been extended to China in the late nineteenth century, through the participation of most European states in imperialist policies concerning that country. According to Van Dongen this adherence to neutrality slowed down imperialist tendencies, as the Netherlands were anxious to avoid entering in conflicts between the great powers, but at the same time the Dutch were forced to ‘play a modest part in the common Western policy towards China’. Whenever the great powers took a united stand the Netherlands must follow suit. So as a result of its European policy the Netherlands joined the imperialist powers in China, although usually careful not to take the initiative. The Netherlands were, therefore, classified by Van Dongen as a reluctant and generally passive element of imperialism in China: ‘the Dutch were at worst accessories after the fact’. Finally he concluded that whenever Dutch actions concerning China ‘savoured of imperialism, this was not the result of a deliberate policy to exercise control over the empire or to obtain Chinese territory, but an almost accidental by-product of the general aim of promoting the Netherlands’ economic interest'.
Style APA, Harvard, Vancouver, ISO itp.
31

Kuhonta, Erik Martinez. "The Politics of Uneven Development: Thailand's Economic Growth in Comparative Perspective. By Richard F. Doner. Cambridge: Cambridge University Press, 2009. 351p. $24.99." Perspectives on Politics 8, nr 4 (23.11.2010): 1248–50. http://dx.doi.org/10.1017/s1537592710002756.

Pełny tekst źródła
Style APA, Harvard, Vancouver, ISO itp.
32

Nihei, Y. "Book Reviews : Richard F. Doner, Driving a Bargain: Automobile Industrialization and Japanese Firms in Southeast Asia. Berkeley: University of California Press, 1991". International Journal of Comparative Sociology 34, nr 3-4 (1.09.1993): 286–88. http://dx.doi.org/10.1177/002071529303400316.

Pełny tekst źródła
Style APA, Harvard, Vancouver, ISO itp.
33

Viladkar, Shrinivas G., i Natalia V. Sorokhtina. "Evolution of pyrochlore in carbonatites of the Amba Dongar complex, India." Mineralogical Magazine 85, nr 4 (7.06.2021): 554–67. http://dx.doi.org/10.1180/mgm.2021.50.

Pełny tekst źródła
Streszczenie:
AbstractPyrochlore-group minerals are common accessory rare-metal bearing minerals in the calcite and ankerite carbonatites of the Amba Dongar complex (India). Pyrochlore from the Amba Dongar carbonatites differs from that in other Indian complexes in Ta, Zr, Ti, rare earth element (REE) and Pb contents, but is similar with respect to Ca, Ba and Sr abundances. The evolution of pyrochlore composition was studied to understand the alteration processes and the formation of late-stage pyrochlores enriched in REE and Pb. The early magmatic pyrochlore are calcio- and niobium-dominant types and were replaced by secondary cation-deficient varieties as a consequence of the action of hydrothermal fluids and supergene weathering. These processes produce changes mainly at the A site, rarely at the B site, and the original F is replaced by OH– groups. Calcium and Na can be extracted from the structure at the alteration stage and charge balance is achieved by the introduction of REE, Th, U, Ba or Sr. At the latest supergene stages, marginal and fractured zones of pyrochlore grains are altered to Pb-rich, Si-rich and cation-deficient hydrated varieties. The magmatic pyrochlore was crystallised in a highly alkaline environment at a high activity of Ca and at temperatures near 600°C, the alteration of pyrochlore began in a hydrothermal environment at temperatures below 350°C. The major compositional changes that are associated with the alteration are summarised by the following reactions: Ca2+ + Nb5+→ REE3+ + Ti4+; Nb5+ + Fe3+ → Ti4+ + Zr4+; and 2Nb5+ + Ca2+ → Ti4+ + Si4+ + U4+.
Style APA, Harvard, Vancouver, ISO itp.
34

Bahuaud, Marie. "Discontinuité d’existence dans le stress post-traumatique". Perspectives Psy 63, nr 1 (styczeń 2024): 43–50. http://dx.doi.org/10.1051/ppsy/2024631043.

Pełny tekst źródła
Streszczenie:
La définition du traumatisme selon F. Lebigot (2009) souligne l’impact de l’effroi sur la psyché et le corps, en tant que « rencontre avec le réel de la mort ». La phénoménologie nous invite à nous attarder sur cette question de « se voir mourir » et les modifications profondes que cette effraction va provoquer sur l’être-au-monde de la personne qui vient nous consulter. Les manifestations traumatiques et leurs déclinaisons dans la vie quotidienne sont autant de moments de rupture, de discontinuité et d’envahissement des éprouvés. C’est à travers le récit de Djamal et de Léonore que nous aborderons ces différents moments. Ces deux présentations cliniques, contrastées, nous font toucher, de près et de loin, les vécus et leur métamorphose narrative. Que la langue soit « étrangère » ou non, la parole de l’un et de l’autre va tenter de donner forme, à la fois comme retentissement intérieur de la voix, mais également comme réflexivité et saisie d’une altérité. Dans ce face-à-face renouvelé et imprévisible de chaque séance, « quelque chose » va se nouer, se rythmer, résonner, s’éprouver, comme autant de modulations créatives et d’affirmations existentielles.
Style APA, Harvard, Vancouver, ISO itp.
35

Clark, Cal. "Driving a Bargain: Automobile Industrialization and Japanese Firms in Southeast Asia. By Richard F. Doner. Berkeley: University of California Press, 1991. 371p. $39.95." American Political Science Review 86, nr 4 (grudzień 1992): 1080–81. http://dx.doi.org/10.2307/1964398.

Pełny tekst źródła
Style APA, Harvard, Vancouver, ISO itp.
36

MacIntyre, Andrew. "Driving a Bargain: Automobile Industrialization and Japanese Firms in Southeast Asia. By Richard F. Doner. Berkeley: University of California Press, 1991. xv, 371 pp. $39.95." Journal of Asian Studies 51, nr 4 (listopad 1992): 979–81. http://dx.doi.org/10.2307/2059123.

Pełny tekst źródła
Style APA, Harvard, Vancouver, ISO itp.
37

García-Manso, Angélica, i Francisco Javier Tovar-Paz. "Imaginarios teatrales en filmes de ambientación medieval: motivos paganos en El señor de la guerra (The War Lord, 1965), de Franklin J. Schaffner, y Alfredo el Grande (Alfred the Great, 1969), de Clive Donner". eari educación artística revista de investigación, nr 13 (30.12.2022): 77. http://dx.doi.org/10.7203/eari.13.24064.

Pełny tekst źródła
Streszczenie:
En cierta medida, el teatro medieval se percibe como una realidad difusa tanto para la investigación académica como en el marco de su concepción didáctica y en el imaginario popular. Las manifestaciones del teatro medieval, habitualmente ajenas a una plasmación en forma de texto, se desarrollan en un contexto religioso y en festividades rituales, que se encuentra en regresión en lo que se refiere al paganismo y en ascenso en lo relativo al cristianismo –a pesar de que los espectáculos se perciben inicialmente como una celebración fundamentalmente pagana–. En pocas ocasiones el Séptimo Arte ha plasmado el imaginario de los espectáculos paganos, si bien en tales ocasiones contribuye a generar un conocimiento singular del fenómeno. Dos filmes como El señor de la guerra (The War Lord, 1965, de F. J. Schaffner) y Alfredo el Grande (Alfred de Great, 1969, de Clive Donner) muestran cada uno una secuencia en la que se intertextualizan en un espectáculo de carácter teatral las figuras mitológicas de Yggdrasil y Jormungandr procedentes de las sagas nórdicas. La propuesta que se lleva a cabo en este estudio se ofrece como ejemplo de modelo didáctico para el desarrollo de un estudio de investigación transversal (en el marco de un curso de máster universitario).
Style APA, Harvard, Vancouver, ISO itp.
38

Castro, Carolina Mazzaron de. "Debate sobre a noção de planos da linguagem na semiótica discursiva contemporânea". Estudos Linguísticos (São Paulo. 1978) 48, nr 1 (30.04.2019): 58–75. http://dx.doi.org/10.21165/el.v48i1.2190.

Pełny tekst źródła
Streszczenie:
Neste trabalho, pretendemos propor uma discussão teórica sobre a noção de planos da linguagem na semiótica discursiva contemporânea. Utilizaremos como metodologia de análise aspectos teóricos da Historiografia Linguística, empreendida por pesquisadores como E. F. K. Koerner, P. Swiggers e C. Altman, para que haja um cotejo mais preciso do material que pretendemos apresentar. O córpus será composto dos estudos de autores que despontaram análises no âmbito da semiótica visual ou plástica, sendo eles: Lindekens, Floch e Thürlemann. Pressupomos que as análises apresentadas na contemporaneidade por Jacques Fontanille, Maria Giulia Dondero e Everardo Reyes-Garcia arrolam os debates empreendidos por Lindekens, Floch e Thürlemann e articulam os conceitos de substâncias e de formas do conteúdo e da expressão nas discussões contemporâneas, motivando o debate sobre a noção de planos da linguagem, principalmente ao desprender o plano da expressão do modelo teórico-metodológico até então consagrado na teoria.
Style APA, Harvard, Vancouver, ISO itp.
39

Kononova, N. E., E. E. Somov i E. L. Efimova. "To the question of the clinical nature of concomitant strabismus, functional disorders, and it's distribution in the population. Literary review". Russian ophthalmology of children, nr 2 (31.07.2023): 52–60. http://dx.doi.org/10.25276/2307-6658-2023-2-52-60.

Pełny tekst źródła
Streszczenie:
The presented literature review summarizes existent data of domestic and foreign researchers devoted to the clinical nature of strabismus, functional disorders in this pathology and its frequency in the population. The description of the main theories of the occurrence of strabismus was given by: A. Grefe, F. Donders, A. Parino and S. Worth. The spectrum of opinions on the types of inheritance of strabismus is analyzed. Patients with concomitant strabismus have also several functional disorders, such as binocular vision dysfunction and refractive-strabismus amblyopia. The views of leading ophthalmologists E.S. Avetisov, E.E. Somov, S.I. Rychkov, K.J. Ciuffreda and others on amblyopia, the criteria for diagnosis and its various classifications are presented. The considered studies allow us to conclude – treatment of children with concomitant strabismus remains a complex and multidisciplinary problem today. The knowledge of the functional features of various types of concomitant strabismus allows pathogenetically justified treatment of this pathology. Key words: concomitant strabismus, theories of the occurrence of strabismus, amblyopia, genetics of concomitant strabismus
Style APA, Harvard, Vancouver, ISO itp.
40

Nardis, Yioryos. "Explaining Institutional Innovation: Case Studies from Latin America and East Asia. Edited by Richard F. Doner. New York: Social Science Research Council, 2010. 128 pp. $15.00 (paper)." Journal of Asian Studies 71, nr 3 (sierpień 2012): 757–58. http://dx.doi.org/10.1017/s002191181200068x.

Pełny tekst źródła
Style APA, Harvard, Vancouver, ISO itp.
41

Hurst, William. "The Politics of Uneven Development: Thailand's Economic Growth in Comparative Perspective. By Richard F. Doner. New York: Cambridge University Press, 2009. 351 pp. $80.00 (cloth); $24.99 (paper)." Journal of East Asian Studies 10, nr 3 (grudzień 2010): 507–9. http://dx.doi.org/10.1017/s1598240800003714.

Pełny tekst źródła
Style APA, Harvard, Vancouver, ISO itp.
42

Hamilton-Hart, Natasha. "The Politics of Uneven Development: Thailand's Economic Growth in Comparative Perspective. By Richard F. Doner. New York: Cambridge University Press, 2009. xv, 351 pp. $80.00 (cloth); $24.99 (paper)." Journal of Asian Studies 69, nr 4 (listopad 2010): 1298–99. http://dx.doi.org/10.1017/s0021911810002767.

Pełny tekst źródła
Style APA, Harvard, Vancouver, ISO itp.
43

Ageeva, Inna. "La critique de F. de Saussure dans Marxisme et philosophie du langage de V.N. Vološinov et le contexte de la réception des idées saussuriennes dans les années 1920-1930 en Russie". Cahiers du Centre de Linguistique et des Sciences du Langage, nr 26 (10.04.2022): 73–84. http://dx.doi.org/10.26034/la.cdclsl.2009.1353.

Pełny tekst źródła
Streszczenie:
La critique de F. de Saussure occupe une place importante dans Marxisme et philosophie du langage : c’est en réfutant la théorie de Saussure que Vološinov avance les principes de base de sa propre conception. Il critique le linguiste suisse pour l’opposition « langue — parole » comme « social — individuel » et « synchronique — diachronique », et rejette sa notion de langue en tant que système pour son caractère « purement abstrait ». Vološinov propose d’analyser la langue comme phénomène dynamique, historique et social en évolution continue sans pour autant donner une méthode fiable et rigoureuse. Dans Marxisme et philosophie du langage, il formule une théorie de l’énoncé et tente de construire la linguistique de la parole tout en affirmant la primauté de cette dernière sur la langue en tant que système. La critique de Saussure par Vološinov s’inscrit parfaitement dans le contexte des années 1920-1930 en Russie, caractérisé par la recherche de nouveaux principes fondamentaux de la linguistique théorique et « marxiste ». La théorie de Saussure y éveille une grande résonance et provoque de vives discussions. L’interprétation des idées de Saussure par R.O. Šor, M.N. Peterson, L.V. Ščerba, G.O. Vinokur, L.P. Jakubinskij témoigne de l’ambivalence de la réception de Saussure en Russie. D’une part, sa conception est reçue avec enthousiasme, de l’autre part, il est fortement critiqué. Il est à noter que la pensée de Saussure est reçue de façon favorable principalement par les linguistes de Moscou. Quant aux linguistes de Leningrad, ils rejettent la théorie de Saussure, qui propose, selon eux, une approche « abstraite » de la langue.
Style APA, Harvard, Vancouver, ISO itp.
44

Talin, Christian. "Baretti voyageur". Horizons philosophiques 11, nr 1 (29.07.2009): 71–98. http://dx.doi.org/10.7202/802952ar.

Pełny tekst źródła
Streszczenie:
En 1760, Giuseppe Baretti part de Londres, sa ville d’adoption, à destination de Gênes. Plein de curiosité, il consigne en outre ses impressions. L’auteur note, parfois au jour le jour, les caractéristiques et les particularismes des pays, régions, villes visités, jusqu’aux rencontres personnelles — rarement dépourvues d’intérêt. Son avant-propos a l’aspect d’un manifeste méthodologique : un guide de la description objective pour voyageur éclairé. Mais une science des moeurs, par exemple, ne se bâtit que si l’on est capable d’interpréter les données, en les relativisant, en évitant les pièges de l’idéologie, celui du regard subjectif, du choix arbitraire de telle observation ou encore telle interprétation problématique... En raison de la qualité de ses descriptions, ce témoignage constitue un document anthropologique qui contribue à la connaissance de l’Esprit d’un peuple. Toutefois cette relation de voyage demeure préscientifique. Description : substantif féminin (action de décrire quelque chose par le discours). Description. (Abel BOYER, Dictionnaire royal français-anglais et anglais-français, ouvr. cité, vol. I, p. 155.) Description : s. f. latin descriptio, anglais description. Détail des accidents généraux, formes et propriétés d’une chose pour en donner une idée qui la discerne des autres. En géométrie, c’est la construction ou formation d’une figure. C’est aussi un dénombrement rédigé par écrit. (Nouveau Dictionnaire universel des arts et des sciences, français, latin et anglais, à Avignon, chez François Girard, imprimeur-libraire, et [auprès] des collèges pontificaux, MDCCLIII [1753], tome I, p. 335.)
Style APA, Harvard, Vancouver, ISO itp.
45

Teel, P. D., D. E. Bay i P. A. Ajidagba. "Ecology, distribution and host relationships of ticks (Acari: Ixodidae) infesting livestock in Mali". Bulletin of Entomological Research 78, nr 3 (wrzesień 1988): 407–24. http://dx.doi.org/10.1017/s0007485300013183.

Pełny tekst źródła
Streszczenie:
AbstractA survey for ticks on livestock with emphasis on ticks parasitizing cattle was conducted below 16°N lat. in Mali. Seventeen species of ixodid ticks were recovered from cattle, 12 from sheep, five from goat, four from horse, one from donkey and four from camel. Amblyomma variegatum (F.), Boophilus geigyi Aeschlimann & Morel, Hyalomma marginatum rufipes Koch and H. truncatum Koch were widespread, and could each be collected as adults from cattle throughout the year in certain regions. A. variegatum was most numerous from the tropical woodlands to the Sahelo-Sudanian steppe. The prevalence of B. geigyi in Mali confirms an extended distribution of this species in West Africa. B. annulatus (Say) and B. decoloratus (Koch) were prevalent in the inland delta area and in south-western Mali. H. m. rufipes and H. truncatum were most numerous in the Sudanian and Sahelo-Sudanian steppe. H. dromedarii Koch, H. impeltatum Schulze & Schlottke and H. impressum Koch were collected in the steppeland areas. H. nitidum Schulze was collected for the first time in Mali. This comparatively more hydrophilic species was prevalent in the North Guinean forest and Sudano-Guinean vegetation zones. Of eight Rhipicephalus species from livestock, seven were collected from cattle: R. cuspidatus Neumann, R. evertsi evertsi Neumann, R. guilhoni Morel & Vassiliades, R. muhsamae Morel & Vassiliades, R. sanguineus (Latreille), R. senegalensis Koch and R. lunulatus Neumann. R. sulcatus Neumann was obtained only from sheep. The distribution and phytoclimatic associations of these species are discussed.
Style APA, Harvard, Vancouver, ISO itp.
46

Al-Ajeeli, Karim Sadun Ali. "Molecular detection of equine herpes virus-1 in local horses (Equus feruscaballus) and donkeys (Equus asinus)". Iraqi Journal of Veterinary Medicine 42, nr 1 (28.06.2018): 72–78. http://dx.doi.org/10.30539/iraqijvm.v42i1.34.

Pełny tekst źródła
Streszczenie:
Equine herpsvirus type1 was classified as a member of the subfamily Alphaherpesvirinae. It was reported to cause respiratory, reproductive and neurologic infection in horses. The reproductive form of the disease induces abortion in pregnant mare, while the neurologic form is associated with paralysis of infected horses. This study was designed for molecular detection of Equine herpsvirus type1 by polymerase chain reaction. Blood buffy coat samples were collected from 25 horses (Equus feruscaballus) and 25 donkeys (Equus asinus) admitted to local private veterinary clinics around Baghdad and Baaquba cities. DNA was extracted from such samples by the use of DNA extraction kit of COLLECTAGENET .The samples were subjected to conventional PCR test using specific primers for gB gene of equine herepesvirus-1. Forward primer (F) (5’ TAACTGAGATCT AACCGAC 3’) and reverse primer (R) (CATATATAGCTATCACGTCC 3’). One buffy coat sample from aborted mare and one buffy coat sample from a donkey suffering from acute respiratory clinical signs were inoculated in mice to follow the fate of equine herepesvirus-1in nasal turbinates, cervical lymph nodes and lungs of these mice. The results showed that only 4 samples from horses and 2 samples from donkeys were positive to polymerase chain reaction. Experimentally infected mice did not show any clinical signs but they were positive to polymerase chain reaction, and the virus easily terminated, probably due to low dose of the virus and host specificity. It can be concluded that local horses and donkeys, somewhere have had infected with equine herepesvirus-1, and became latent carriers for the virus. Furthermore, microbiological and epidemiological studies on local Equine herpsvirus type1 and Equine herpsvirus type 4 are recommended.
Style APA, Harvard, Vancouver, ISO itp.
47

Nurhayati, Eria, Isda Pramuniati i Rabiah Adawi. "ANALYSE DU VERBE IMPÉRATIF DANS LE TEXTE INJONCTIF DANS LA RECETTE DE CUISINE". HEXAGONE Jurnal Pendidikan, Linguistik, Budaya dan Sastra Perancis 5, nr 1 (28.06.2016): 45. http://dx.doi.org/10.24114/hxg.v5i1.3897.

Pełny tekst źródła
Streszczenie:
RÉSUMÉ Eria Nurhayati, 2113131015. Analyse du Verbe Impératif Dans le Texte Injonctif Dans la Recette de Cuisine. Section Française, Département des Langues Étrangères, Faculté de Lettres et d’Arts, Université de Medan. 2016. Cette recherche a pour de savoir la forme du verbe impératif, de savoir l’analyse des valeurs du verbe impératif : l’ordre, la défense et le conseil dans le texte injonctif dans la recette de cuisine et de savoir la fonction du texte injonctif qui se trouve dans la recette de cuisine. Cette recherche s’est déroulée à la Bibliothèque de la Faculté de Lettres et d’Arts de l’UNIMED. L’échantillon est 5 recettes de cuisine sur les desserts dans le magazine “Elle à Table” édition novembre-décembre en 2013. Cette recherche utilise la méthode descriptive qualitative. Pour compter la valeur fréquemment dans la recette de cuisine utilisée la formule de Widodo suivant: N = F/K X 100% Par rapport au résultat et l’analyse de la recherche, le résultat de la recherche montre que la forme du verbe impératif qui utilisée est l’impératif présent. Ensuite, la valeur de l’ordre du verbe impératif est 126 fois ou 96 %, il est suivi parla valeur du conseil apparait 5 fois ou 4 %. Cependent la valeur de la défense ne se trouve pas dans cette recette de cuisine ou 0 %. Tous les verbes impératifs qui utilisés dans la recette de cuisine ont la fonction de donner les instructions pour faire quelques choses qui a pour but d’obtenir quelques choses comme prévu par l’auteur après faire les instructions qui se trouvent dans la recette de cuisine, c’est pourquoi la fonction du texte injonctif qui se trouve dans la recette de cuisine est dire comment faire. Mots clés : Verbe Impératif, Texte Injonctif, Recette de Cuisine
Style APA, Harvard, Vancouver, ISO itp.
48

Ben Abdallah, Ferjani, Nada Elloumi, Imed Mezghani, Makki Boukhris i Jean Pierre Garrec. "Réponses d’une vigne locale à une pollution fluorée". Canadian Journal of Botany 84, nr 3 (marzec 2006): 393–99. http://dx.doi.org/10.1139/b06-010.

Pełny tekst źródła
Streszczenie:
Les effets d’une pollution atmosphérique par des composés fluorés ont été étudiés sur des cultivars d’une vigne locale, Vitis vinifera L. ‘Asli’, cultivée aux environs d'une usine de production d'engrais phosphatés. L’étude a pour objectif de déterminer les mécanismes permettant à ces vignes autochtones de survivre dans la zone polluée. Elle a consisté à suivre le comportement de ces cultivars dans deux parcelles : l’une soumise aux fumées d’une usine polluante et l’autre au loin de toute pollution. Les paramètres mesurés sont la conductance stomatique, la teneur des feuilles en F– et en Ca2+ et l’activité photosynthétique des zones foliaires saines. Nos résultats suggèrent que la survie de la vigne est liée à une compartimentation du fluor dans les bordures et les extrémités des feuilles, avec une tendance de la plante à contourner les nouveaux tissus nécrosés par un liseré de transition conduisant au développement d’auréoles concentriques de zones nécrosées donnant au limbe un aspect de mosaïque. Ce dernier peut donner des informations intéressantes sur la qualité de l’air et l’état des plantes. Ce comportement est concomitant à une aptitude des zones foliaires saines à conserver la capacité photosynthétique de la plante, tant que les nécroses ne dépassent pas 10 % à 20 % de la surface foliaire. Outre le piégeage du fluor dans des régions foliaires particulières, la fermeture temporaire des stomates semble également contribuer à la restriction de l’accumulation de ce polluant. Par ailleurs, le parallélisme entre l’accumulation du fluor et celle du calcium suggère que ce cation est impliqué dans le piégeage et la détoxication du fluor en le séquestrant sous forme de CaF2. Enfin, nos résultats ne plaident pas en faveur d’une remobilisation foliaire du fluor qui demeure séquestré dans les feuilles les plus âgées. D’ailleurs, la contamination des baies semble se faire directement par les fumées de l'usine, et non par apports endogènes.
Style APA, Harvard, Vancouver, ISO itp.
49

Francq, B. "La prévention comme dispositif politique". International Review of Community Development, nr 10 (19.01.2016): 133–48. http://dx.doi.org/10.7202/1034663ar.

Pełny tekst źródła
Streszczenie:
L’auteur aborde ici un thème central du débat actuel sur les politiques et leur redéfinition dans le contexte de crise de l’État-providence, la prévention. Après avoir souligné la polysémie du concept, il en délimite la pertinence à partir d’un examen de sa résurgence dans l’imaginaire professionnel des travailleurs du social. L’auteur aborde ici un thème central du débat actuel sur les politiques et leur redéfinition dans le contexte de crise de l’État-providence, la prévention. Après avoir souligné la polysémie du concept, il en délimite la pertinence à partir d’un examen de sa résurgence dans l’imaginaire professionnel des travailleurs du social. Cet examen s’effectue à partir d’une mise en perspective de deux paradigmes centraux qui entrent en conflit. Le premier paradigme, la prévention comme programmation offensive, part de l’hypothèse d’une alliance entre professionnels et administratifs alors que le second, qui mise davantage sur une reconquête de la société civile, considère plutôt que ce sont les rapports entre usagers et professionnels qui seraient au centre du dispositif préventif. En conclusion, l’auteur ouvre le débat sur le sens et la portée du dispositif préventif à la lueur de sa problématique centrée sur la crise de l’État et des enjeux politiques qui la traversent. Deux auteurs questionnent ensuite la problématique de B. Francq. F. Smet (Bruxelles), « Les intellectuels et la prévention », s’interroge sur le rôle des intellectuels dans la construction du discours sur la prévention. G. Renaud (Montréal), « À propos de la prévention comme programmation offensive », se demande dans le même sens si la sociologie, même critique, n’exerce pas une fonction de rationalisation constante de la construction de l’État. En positionnant la prévention comme programmation offensive, ne contribue-t-on pas précisément à créer cette programmation, à donner une cohérence théorique à des éléments qui ne sont pas a priori cohérents ?
Style APA, Harvard, Vancouver, ISO itp.
50

Hugonnier, Claire. "Benjamin F erron , Émilie N ée et Claire O ger (dir.), Donner la parole aux « sans-voix » ? Construction sociale et mise en discours d’un problème social. Rennes, Presses universitaires de Rennes, 2022, 334 p." Langage et société N° 181, nr 1 (18.03.2024): 165–68. http://dx.doi.org/10.3917/ls.181.0165.

Pełny tekst źródła
Style APA, Harvard, Vancouver, ISO itp.
Oferujemy zniżki na wszystkie plany premium dla autorów, których prace zostały uwzględnione w tematycznych zestawieniach literatury. Skontaktuj się z nami, aby uzyskać unikalny kod promocyjny!

Do bibliografii