Artykuły w czasopismach na temat „2007 i-464”

SCIS & ISIS is a biennial international joint conference in the field of soft computing and intelligent systems, including branches of researches from fuzzy systems, neural networks, evolutionary computation, multi-agent systems, artificial intelligence or robotics. SCIS & ISIS 2006 falls on the 3rd International Conference on Soft Computing and Intelligent Systems (SCIS) and the 7th International Symposium on Advanced Intelligent Systems (ISIS) held at Tokyo Institute of Technology, in Tokyo, Japan, on September 20-24, 2006. In this conference, 464 original papers were accepted for presentation and the number of attendees was 526. After preliminary selection and review made by the session chairs and the International Program Committees of SCIS & ISIS 2006, we have selected more than 50 papers to be published in extended form in the Special Issue of the Journal of Advanced Computational Intelligence and Intelligent Informatics. The accepted papers are published as the special issues in Vol.11, No.6, 7, and 8 in 2007. This current issue presents 23 papers and covers most of the topics of the conference including fuzzy theories, self-organizing maps, and the optimization of neural networks. The learning and search methods in computational intelligence and real-world applications to image processing, robotics and manufacturing systems are highlighted in this current issue. I would like to thank all the authors and reviewers for their contribution to make this special issue possible. I am also grateful to Prof. Toshio Fukuda, Nagoya University and Prof. Kaoru Hirota, Tokyo Institute of Technology, Editors-in-chief, for inviting me to serve as Guest Editor of this Journal.

This third special issue on papers from SCIS&ISIS 2006 draws its contents from a highly successful conference attracting 526 participants from 31 countries and 464 original papers, including 297 in 60 organized sessions. The invaluable contributions by the session organizers made this conference attractive and worthwhile in soft computing and advanced intelligent systems research. Having chaired the conference's organized session committee, I wish to express my gratitude for their assistance. Some 42 selected papers have already been published in Volumes 1 and 2 of this special issue (Vol.11, Nos.6 and 7). The present volume introduces 22 papers from organized sessions in extended form after preliminary selection and review by session organizers, chairs, and international SCIS&ISIS 2006 program committees. These papers cover fields related to intelligent systems, ranging from theoretical to practical issues such as self-organizing maps, neural networks, fuzzy clustering, fuzzy control, intelligent robots, secure smart spaces, data mining, and intelligent communication systems. The guest editors believe that readers will be inspired by these highly interesting papers, which contain clues to exploring new and seminal ideas for that next step in research. I thank all of the authors and reviewers for the time and effort they put into this special issue. I am grateful to Prof. Toshio Fukuda of Nagoya University and to Prof. Kaoru Hirota of the Tokyo Institute of Technology for the opportunity to take part in this work.

As mentioned in the editorial for the special issue on selected papers from SCIS & ISIS 2006 (No.1) by Dr. Naoyuki Kubota, the 3rd International Conference on Soft Computing and Intelligent Systems (SCIS) and the 7th International Symposium on Advanced Intelligent Systems (ISIS) have been highly successful with 464 original papers accepted for presentation and participants numbering 526. We have selected approximately 50 quality papers to be published in extended form in the Special Issue of the Journal of Advanced Computational Intelligence and Intelligent Informatics, following publication of the first volume (Vol.11, No.6) comprising 23 papers. This second volume of the SCIS & ISIS 2006 special issue includes 19 papers covering the cutting edge of computational intelligence, and the guest editors believe that readers will be inspired by the highly interesting contents containing clues to the new frontier of the computational intelligence. linebreak Related areas include image processing, control, sensor fusion, data/context/ network analysis, genetic algorithms, ontology, VHDL, game theory, and robotics among others.smallskip I would like to thank all the authors and reviewers for their valuable contributions in making this volume possible. I am also grateful to Editors-in-Chief Prof. Toshio Fukuda of Nagoya University and Prof. Kaoru Hirota of the Tokyo Institute of Technology, Dr. Toshiaki Murofushi who served as general chair of SICS & ISIS 2006, Dr. Naoyuki Kubota who was the SCIS & ISIS 2006 program chair, and the SCIS & ISIS 2006 conference staff for inviting me to serve as Guest Editor of this Journal. Last, I would like to thank the Fuji Technology Press staff, especially Dr. Kazuki Ohmori.

التراث والمنهج بين أركون والجابري، نايلة أبي نادر، بيروت: الشبكة العربية للأبحاث والنشر، 2008م، 590 صفحة. ما بعد الاستشراق: الغزو الأمريكي للعراق وعودة الكولونياليات البيضاء، فاضل الربيعي، بيروت: مركز دراسات الوحدة العربية، 2007م، 293 صفحة. الإسلام والإصلاح الثقافي، زكي الميلاد، القطيف: دار أطياف للنشر والتوزيع، 2007م، 175 صفحة. تحليل النظريات الاقتصادية، بول كروغمان، ترجمة: رانيا محمد عبد اللطيف، القاهرة: الدار الدولية للاستثمارات الثقافية، 2007م، 270 صفحة. الانتماء الحضاري والهوية الثقافية في ضوء عروبة القرآن - الإسلام العربي .. معالم في طريق الوحدة والتعايش والاعتدال لتدبّر القرآن وفهمه بلسانٍ عربيٍ مبين، علاء الدين المدرس، العراق: دار الرقيم، 2008م، 191 صفحة. الماضوية - الخلل الحضاري في علاقة المسلمين بالإسلام، سامر خير أحمد، عمان: دار البيروني للنشر والتوزيع، 2008م، 166 صفحة. القرآن الكريم في دراسات المستشرقين (دراسة في تاريخ القرآن: نزوله وتدوينه وجمعه)، مشتاق بشير الغزالي، بيروت: دار النفائس، 2008م، 200 صفحة. النظم الإسلامية، عبد العزيز الدوري، بيروت: مركز دراسات الوحدة العربية، سلسلة الأعمال الكاملة للدكتور عبد العزيز الدوري، العدد 6، 2008م، 223 صفحة. تطور الفكر السياسي السُّني: نحو خلافة ديمقراطية، أحمد الكاتب، بيروت: مؤسسة الانتشار العربي، 2008م، 307 صفحة. ما بين دولة الطوائف والدولة الديمقراطية: إشكاليات وتوجهات- تراثنا الفكري: بين الرؤية السّلفية والتّنوير المعرفي، مجموعة مؤلفين، بيروت: دار الفارابي، 2008م، 269 صفحة. الرحمانية ديمقراطية القرآن، محمد سلمان غانم، بيروت: دار الفارابي، 2008م، 245 صفحة. الأصول الاجتماعية للدكتاتورية والديمقراطية: اللورد والفلاح في صنع العالم الحديث، بارينجتون مور، ترجمة أحمد محمود، بيروت: المنظمة العربية للترجمة، 2008م، 639 صفحة. Islam and the Orientalist World-System (Political Econo-my of the World-System Annuals), Khaldoun Samman (Editor), Mazhar Al-Zo'by (Editor), Paradigm Publishers (September 30, 2008), 248 pages. Challenging the New Orientalism: Dissenting Essays on the "War Against Islam", M.Shahid Alam, Islamic Publications In-ternational (January 1, 2007), 272 pages. Defending the West: A Critique of Edward Said's Orien-talism, Ibn Warraq, Prometheus Books (October 23, 2007), 500 pages. Islam in the British Broadsheets: The Impact of Oriental-ism on Representations of Islam in the British Press, Elzain El-gamri, Ithaca Press (15 Sep 2008), 240 pages. American Orientalism: The United States and the Middle East since 1945, Douglas Little, The University of North Carolina Press (March 3, 2008), 464 pages. German Orientalism: The Study of the Middle East and Is-lam from 1800 to 1945 (Culture and Civilization in the Middle East), Ursula Wokoec, Routledge; 1 edition (May 31, 2009), 320pages. Reading Orientalism: Said and the Unsaid, Daniel Martin Varisco, Daniel Martin Varisco, University of Washington Press, November 2007, 501 pages. Muslim American Youth: Understanding Hyphenated Identities through Multiple Methods (Qualitative Studies in Psy-chology), Selcuk Sirin, Michelle Fine, NYU Press (July 12, 2008), 304 pages. Marching Toward Hell: America and Islam After Iraq, Michael Scheuer, Free Press (February 10, 2009), 384 pages. European Perceptions of Islam and America from Saladin to George W. Bush: Europe's Fragile Ego Uncovered, Peter O'Bri-en, Palgrave Macmillan (December 23, 2008), 240 pages. Islam: To Reform or to Subvert?, Mohammed Arkoun, Saqi Books (January 1, 2007), 326 pages. Islam and the Secular State: Negotiating the Future of Shari`a, Abd Allah Naim, Abdullahi Ahmed An-Naim, Triliteral, March 2008, 336 pages. The Fall and Rise of the Islamic State, Noah Feldman, Princeton University Press, March 2008, 189 pages. A Deadly Misunderstanding: A Congressman's Quest to Bridge the Muslim-Christian Divide, Mark D. Siljander, Harper-Collins Publishers, October 2008, 260pp. Islamism in the Shadow of al-Qaeda, François Burgat (Author), Patrick Hutchinson (Translator), University of Texas Press (November 1, 2008), 212 pages. Islam, the People and the State: Political Ideas and Movements in the Middle East, Sami Zubaida, I. B. Tauris; Revised and Updated edition (March 17, 2009), 224 pages. للحصول على كامل المقالة مجانا يرجى النّقر على ملف ال PDF في اعلى يمين الصفحة.

Introduction: advanced age and concomitant procedures could increase the risk of perioperative complications during surgical aortic valve replacement (SAVR). We aimed to evaluate results of elderly patients undergoing SAVR and evaluate the impact of concomitant non-valvular, non-coronary procedures on the outcomes. Methods: A retrospective single-centre study, evaluating 464 elderly patients (mean age = 75.6 ± 4 years) undergoing either isolated-SAVR (I-SAVR = 211) or combined-SAVR (C-SAVR = 253) between 01/2007 and 12/2017. Combined-SAVR involved non-valvular, non-coronary procedures. Study endpoints are postoperative results concerning the VARC-II criteria, valve dysfunction, long-term freedom from redo-AVR and survival. Results: males were 52.8%. Patients had an intermediate risk profile (mean EuroSCORE-II (%) 5.2 ± 5). Postoperative results reported no significant differences in incidence of re-exploration for bleeding (6.6% vs. 6.7%, p = 1.0), stroke (0.9% vs. 0.4%, p = 0.59), dialysis (6.2% vs. 9.5%, p = 0.23) and pacemaker implantation (3.3% vs. 2.8%, p = 0.79) between I-SAVR and C-SAVR groups. Thirty-day (2.4% vs. 7.1% p = 0.03), one-year (5.7% vs. 13.8%, p = 0.003) and overall mortality (24.6% vs. 37.5%, p = 0.002) were lower in the isolated-SAVR group. Re-AVR was indicated in 1.7% of patients due to endocarditis. Conclusions: SAVR in elderly patients offers good outcomes with increased life quality and rare re-operation for structural valvular deterioration. Mortality rates were significantly higher when SAVR was combined with another “non-valvular, non-coronary” procedure.

RESUMEN:En este artículo, procedemos a estudiar el traspaso familiar del oficio manufacturero,concretamente el de la platería, a través de tres generaciones de la familia Gálvez a lo largo de la centuria dieciochesca. Para ello, hemos esbozado la situación actual de la historia de la familia con respecto a su interés sobre los sectores artesanales para posteriormente adentrarnos, tras unos datos concretos del linaje, en los talleres y su evolución de forma conjunta con las trayectorias vitales de los individuos, haciendo hincapié en la importancia de las relaciones entre los consanguíneos para el progreso laboral.PALABRAS CLAVE: Antequera, siglos XVIII, familia, artesanos, platerosABSTRACT:In this paper, I study the family transfer of the manufacturing trade, specifically that of silversmiths, through three generations of the Gálvez family throughout the 18th century. To this end, I have outlined the current situation of the family’s history of the family with respect to their interest in the artisanal sectors to then consider, after some specific data regarding lineage, the workshops and their evolution together with the lives of the individuals concerned, emphasizing the importance of family to professional and economic progress.KEY WORDS: Antequera, 18th century, family, artisans, silversmiths BIBLIOGRAFÍAAlexandre, C. y Ruggiu, F. J., “La circulación de los oficios en Charleville. Familia y trabajo en los siglos XVIII y XIX”, Revista de Historia Moderna, 34 (2016), pp. 239-256.Barroso Vázquez, M. D., “Los plateros portuenses: análisis de su organización corporativa”, Revista de Historia de El Puerto, 4 (1990), pp. 55-66.Benavides Murillo, C., “Reflexiones sobre la formación y función social de los artesanos de Cartago en el siglo XVIII”, Revista Estudios, 18-19 (2004-2005), pp. 15-28.Birriel Salcedo, M., “El cónyuge supérstite en el derecho hispano”, Chronica Nova, 34 (2008), pp. 13-44.Burgos Rincón, J., “Gremio, familia artesana y propiedad. Libreros e impresores en la Barcelona del siglo XVIII”, en Familia, casa y trabajo, Murcia, Universidad, 1997, pp. 423-444.Chacón Jiménez, F. y Ferrer i Alós, L. “Más allá de la familia”, Familia, casa y trabajo, Murcia, Universidad, 1997, pp. 13-16.Chacón Jiménez, F., “Familia, casa y hogar. Una aproximación a la definición y realidad de la organización social española (siglos XVIII-XIX)”, Espacios sociales, universos familiares. La familia en la historiografía española, Murcia, Universidad, 2007, pp. 51-68.Colón de Larraeátegui, J., Tiempos de reforma ilustrada. Informe sobre los gremios de Valladolid, Valladolid, Ayuntamiento, 2008 (ed. L. Amigo Vázquez, M. García Fernández y R. Hernández García).Cruz Valdovinos, J. M. y Nieva Soto, P., “Los Morenos, una familia de plateros madrileña en el Antiguo Régimen”, Anales del Instituto de Estudios Madrileños, 44 (2004), pp. 331-358.Cruz Valdovinos, J. M., Catálogo de platería, Madrid, Ministerio de Cultura, 1982.Cruz Valdovinos, J. M., Los plateros madrileños: estudio histórico-jurídico de su Organización Corporativa, Tomo I, Madrid, Gremio de Joyeros y Plateros de Madrid, 1993.Diego Velasco, T. de, Los gremios granadinos a través de sus ordenanzas, Madrid, Universidad Complutense de Madrid, 1986.Domínguez Ortiz, A., Sociedad y estado en el siglo XVIII español, Barcelona, Ariel, 1976.Fernández Guirao, F. J., “Los Laborda, una familia de plateros entre los siglos XVIII-XIX”, CLAVIS, 9 (2016), pp. 77-102.Fernández Pérez, P. y Sola-Corbacho, J. C., “Familia y comerciantes en la España del Antiguo Régimen”, en Espacios sociales, universos familiares. La familia en la historiografía española, Murcia, Universidad de Murcia, 2007, pp. 177-191.Frey, D. A., “Industrious Households: servival strategies of artisans in a Sothwest German town during the eighteenth an early nineteenth centuries”, International Review of Social History, 45 (2000), pp. 115-135.García Abellán, J., Organización de los gremios en la Murcia del siglo XVIII y recopilación de ordenanzas, Murcia, Academia Alfonso X el Sabio, 1976.García González, F. y Crespo Sánchez, F. J., “Radiografía de un impulso compartido. La historia de la familia en España e Iberoamérica (2000-2015)”, en Familias en el Viejo y el Nuevo Mundo, La Plata, Universidad Nacional de La Plata, 2017, pp. 44-78.García González, F., “Las estructuras familiares y su relación con los recursos humanos y económicos”, en Familias. Historia de la sociedad española (del final de la Edad Media a nuestros días), Madrid, Cátedra, 2011, pp. 159-254.García González, F., “Vejez, viudedad y soledad rural. Viudas, hogares y prácticas familiares en la España centro-meridional del siglo XVIII”, Studia historica. Historia moderna, vol. 38, 2 (2016), pp. 287-324.García González, F., Las estrategias de la diferencia. Familia y reproducción social en la Sierra (Alcaraz, siglo XVIII), Madrid, Ministerio de Agricultura, Pesca y Alimentación, 2000.González Barrero, N., “Los maestros de primeras letras en la provincia de Madrid a través del Catastro de Ensenada”, Historia y Memoria de la Educación, 3 (2016), pp. 197-228.González Enciso, A., “los gremios y el crecimiento económico”, Memoria y Civilización, 1 (1998), pp. 111-137.Guerra Guerra, A., “Profesionales, obreros y artesanos de Badajoz en 1750: sus ganancias y emolumentos según el Catastro de Ensenada”, Revista de estudio extremeños, vol. 27, 3 (1971), pp. 561-582.Gutiérrez Nieto, F. J. y Ybañez Worboys, P., “El llamamiento a la nobleza de las «dos Andalucías» de 1706”, Revista de Historia Moderna, 25 (2007), pp. 53-87.Hernández Benítez, M., A la sombra de la Corona. Poder local y oligarquía urbana (Madrid, 1606-1808), Madrid, Siglo XXI, 1995.Hernández Franco, J. y Molina Puche, S., “La sangre de la familia y su proceso socioinstitucional. Siglos XVI-XVII” en Familias. Historia de la sociedad española (del final de la Edad Media a nuestros días), Madrid, Cátedra, 2011, pp. 113-156.Hernández García, R., “Gremios y corporaciones laborales. Debate historiográficos y estado de la cuestión”, Areas, (34 (2015), pp. 7-18.Hernández López, C., “Trabajo y curso de vida. Los artesanos de Albacete (1636-1792)”, en Escenarios de familia: trayectorias, estrategias y pautas culturales, siglo XVI-XX, Murcia, Universidad, 2017, pp. 257-269.Herraéz Ortega, M. V., “Los Bello, platero de Sahagún, y las cruces procesionales de Vallecillo y Joarilla de las Matas (León)”, en Estudios de Platería: San Eloy, Murcia, Universidad, 2002, pp. 183-194.Irigoyen López, A. “Un obispado para la familia: Francisco Verdín Molina, prelado de Guadalajara y Valladolid en la segunda mitad del siglo XVII”, Historia mexicana, vol. 58, 2 (2008), pp. 557-594.Irigoyen López, A., “Bajo el manto de la Iglesia. Clero y familia en España durante la Edad Moderna”, en Espacios sociales, universos familiares. La familia en la historiografía española, Murcia, Universidad de Murcia, 2007, pp. 245-269.Llordén, A., “Noticas históricas de los maestros plateros antequeranos, siglos XVIII-XIX”, Jábega, (8 (1974), pp. 81-92.Mallo, J., “Emociones, honra y familia. Comerciantes españoles a finales del siglo XVIII”, en Familias en el Viejo y el Nuevo Mundo, La Plata, Universidad Nacional de La Plata, 2017, pp. 367-385.Marchant Rivera, A., “El prohijamiento, la tutela y la carta de aprendiz: instrumentos para una historia de la situación del menor en Málaga durante la primera mitad del siglo XVI”, en Población y grupos sociales en el Antiguo Régimen, vol. 2, Málaga, Área de Historia Moderna de la Universidad de Málaga, 2009, pp. 943-956.Miralles Martínez, P., Seda, trabajo y sociedad en la Murcia del siglo XVII, Murcia, Universidad, 2000.Moral Roncal, A. M. Gremios e Ilustración en Madrid, (1775-1836), Madrid, Actas, 1998.Moral Roncal, A. M., “Honor, vileza y honra de los oficios mecánicos en el siglo XVIII”, Baetica, 18 (1996), pp.Morgado García, A. J., “El ciclo vital de los esclavos en el Cádiz de la modernidad”, Revista de historia moderna: Anales de la Universidad de Alicante, 34 (2016), pp. 297-315.Morgado García, A. J., “La vida familiar de los esclavos en el Cádiz de la modernidad (1600-1750)”, Trocadero: revista de historia moderna y contemporánea, 24 (2012), pp. 67-81.Narotzky, S., “La renta del afecto: ideología y reproducción en el cuidado de los viejos”, en Antropología de los pueblos de España, Madrid, Taurus, 1991, pp. 464-474.Nieto Sánchez, J. A. y Zofío Llorente, J. C., “Los gremios de Madrid durante la Edad Moderna: una revisión”, Áreas, 34 (2015), pp. 47-61.Nieto Sánchez, J. A., Artesanos y mercaderes: una historia social y económica de Madrid, 1450-1850, Madrid, Fundamentos, 2006.Ortega López, M., “Las edades de las mujeres”, en Historia de las mujeres en España y América Latina, vol. 2, Madrid, Cátedra, 2005, pp. 317-350.Pérez Samper, M. A., “Espacios y prácticas de sociabilidad en el siglo XVIII: tertulias, refrescos y cafés de Barcelona”, Cuadernos de Historia Moderna, 26 (2001), pp. 11-55.Sánchez-Lafuente Gémar, R., “El Colegio-Congregación de plateros de Antequera (1782-1833)”, Boletín de Arte, 12 (1991), pp. 317-336.Sánchez-Lafuente Gémar, R., “La platería de Málaga en el siglo XVIII”, en Estudios de Platería: San Eloy, Murcia, Universidad, 2001, pp. 241-256.Sánchez-Lafuente Gémar, R., El Arte de Platería en Málaga, 1550-1800, Málaga, Universidad, 1997.Zofío Llorente, J. C., Gremios y artesanos en Madrid, 1550-1650: la sociedad del trabajo en una ciudad cortesana preindustrial, Madrid, Instituto de Estudio Madrileños, 2005.

The debate about diagnoses and treatment of attention deficit hyperactive disorder (ADHD) in children continue to range on between the developmental and biological perspectives. While there is increasing evidence that support the biological susceptibility of the disorder, a number of researches also emphasized the significant effect of environment on the syndrome. This study used developmental perspectives to evaluate and bring together various bio-psychosocial factors that impact on children diagnosed with ADHD. The study explored and integrated the existing and advancing study on ADHD to a more refined pattern that embraced developmental perspectives. The study also discussed how the linkage in childhood ADHD fits within the developmental psychopathology perspective. The study revealed that ADHD as a developmental disorder is influenced by prenatal, biological and psychosocial environmental risk factors, and suggested that better understanding of genomic susceptibilities, family environment and parental characteristics would transform the pathway for development of ADHD in children. References American Psychiatric Association.(2000). Diagnostic and StatisticalManual of MentalDisorders. 4th ed. Washington, DC: American Psychiatric Association. American Psychiatric Association.(2013). Diagnostic and StatisticalManual of MentalDisorders.5th ed. Washington, DC: American Psychiatric Association. Arnsten, A.F, (2007). Catecholamine and second messenger influenceson prefrontalcortical networks of “representational knowledge”:a rational bridge between genetics andthe symptoms of mental illness. Cerebral Cortex, 17, i6–i15. Arnsten, A.F, & Pliszka, S.R. (2011). Catecholamine influences on prefrontalcorticalfunction: relevance to treatment of attentiondeficit/hyperactivity disorder and relateddisorders. Pharmacology, Biochemistry and Behavior, 99, 211–216. Atladóttir H.O, Parner E.T, & Schendel D. (2007). Variation in incidence ofneurodevelopmental disorders with season of birth. Epidemiology, 18, 240–245. Barkley, R. A. (2006). Attention deficit/hyperactivity disorder: A handbook for diagnosisand treatment (3rd ed.). New York: Guilford Baumeister A.A, Hawkins M.F (2001). Incoherence of neuroimaging studies of attentiondeficit/ hyperactivity disorder. Clinical Neuropharmacology, 24, 2–10. Berger I. (2011). Diagnosis of attention deficit hyperactivity disorder: much ado aboutsomething. Israeli Medical Association Journal, 13, 571–574. Berger, A., Posner, M. I. (2000). Pathologies of brain attentionalnetworks. Neuroscienceand Biobehavioral Reviews, 24, 3–5. Biederman J, Faraone S.V, Keenan K, Knee D, &Tsuang M.T (1990): Familygenetic andpsychosocial risk factors in DSM-III attention deficit disorder. Journal of AmericanAcademy of Child and Adolescent Psychiatry, 29, 526 –533. Biederman J, Faraone SV, Keenan K, Tsuang MT (1991b): Evidence of familialassociationbetween attention deficit disorder and major affective disorders. Archives of GeneralPsychiatry, 48, 633–642. Biederman, J, Faraone, S.V, Keenan K, Benjamin, J, Krifcher, B. &Moore C. et al (1992).Further evidence for family-genetic risk factors in attention deficit hyperactivity disorder.Patterns of comorbidity in probands and relativesin psychiatrically and pediatricallyreferred samples. Archives of General Psychiatry, 49, 728 –738. Biederman, J., Milberger, S., Faraone, S. V., Kiely, K., Guite, J.,Mick, E., Ablon, S., Warburton, R., & Reed, E. (1995). Family environment risk factors for attention deficithyperactivity disorder: A test of Rutter’s indicators of adversity. Archives of GeneralPsychiatry, 52, 464–470. Biederman, J., Faraone, S.V., Mick, E., Spencer,T.,Wilens,T., Kiely,K., Guite, J., Ablon, J.S., Reed, E., & Warburton, R. (1995). High risk for attention deficit hyperactivity disorderamong children of parents with childhood onset of the disorder: A pilot study. Journal ofAmerican Psychiatry, 152, 431–435. Biederman J, Faraone S.V, Monuteaux M, Spencer T, Wilens T, Bober M, et al (2004).Gender effects of attention deficit hyperactivity disorder inadults, revisited. BiologicalPsychiatry, 55, 692–700. Brookes, K.,Mill, J.,&Guindalini,C., et al (2006). Acommon haplotype of the dopaminetransporter geneassociated with attention-deficit/hyperactivity disorderand interactingwithmaternal use of alcohol duringpregnancy. Archives of General Psychiatry, 63, 74–81. Brophy, K., Hawi, Z., Kirley, A., Fitzgerald, M., & Gill, M. (2002). Synaptosomalassociated protein 25 (SNAP-25) and attention deficit hyperactivity disorder (ADHD):Evidence of linkage and association in the Irish population. Molecular Psychiatry, 7 , 913–917 Campbell, S. B. (2000). Attention-Deficit/Hyperactivity Disorder: A developmental view.In: Handbook of Developmental Psychopathology. (pp. 383–401). A. J. Sameroff, M.Lewis, & S. Miller (Eds.). New York: Kluwer Academic/Plenum. Carlson, E. A., Jacobvitz, D., & Sroufe, L. A. (1995). A developmental investigation ofinattentiveness and hyperactivity. Child Development, 66, 37–54. Childress, A.C, Berry, S.A (2012). Pharmacotherapy of attention-deficit hyperactivitydisorder in adolescents. Drugs, 72, 309–325. Cortese, S (2012). The neurobiology and genetics of attention-deficit/hyperactivitydisorder (ADHD): what every clinician shouldknow. European Journal of PaediatricNeurology, 16, 422–433. Dopheide, J.A (2005). ASHP therapeutic position statement on theappropriate use ofmedications in the treatment of attention deficit/hyperactivity disorder in paediatricpatients. American Journal of Health System Pharmacy, 62, 1502– 1509. Coghill, D., Nigg, J., Rothenberger, A., Sonuga-Barke, E., & Tannock, R. (2005). Withercausal models in the neuroscience of ADHD? Developmental Science, 8, 105–114. Cummings, E. M., Davies, P., & Campbell, S. B. (2000). Developmental Psychopathologyand Family Process: Research, Theory, and Clinical Implications. New York: Guilford. Faraone, S. V., Perlis, R. H., Doyle, A. E., Smoller, J. W., Goralnick, J. J., Holmgren, M.A., et al. (2005). Molecular genetics of attention-defi cit/hyperactivity disorder. BiologicalPsychiatry, 57 , 1313–1323. Faraone, S, Biederman, J, Krifcher Lehman, B, Keenan, K, Norman, D, Seidman, L. et al.(1993). Evidence for the independent familial transmission of attentiondeficit hyperactivitydisorder and learning disabilities: Results froma family genetic study. American Journalof Psychiatry, 150, 891– 895. Faraone, S. V, Tsuang, M. T. (1995). Methods in psychiatric genetics. In: Textbook inPsychiatric Epidemiology, Tohen, M, Tsuang, M., Zahner, G. (Eds). (pp. 81–134). NewYork: John Wiley& Sons. Faraone, S. V. & Biederman, J. (1998). Neurobiology of attentiondeficit hyperactivitydisorder. Biological Psychiatry, 44, 951–958. Faraone S.V, Biederman J, &MonuteauxM.C. (2001a). Attention deficit hyperactivitydisorder with bipolar disorder in girls: Further evidence for a familial subtype? Journal ofAffect Disorders, 64, 19 –26. Haraone S.V, Doyle A.E (2001): The nature and heritability of attentiondeficit/hyperactivity disorder. Child and Adolescent Psychiatric Clinics of North America,10, 299 –316, viii–ix. Faraone, S.V., & Biederman, J. (2000). Nature, nuture, and attentiondeficit hyperactivitydisorder. Developmental Review, 20, 568–581. Faraone S.V, Perlis R.H, Doyle A.E, Smoller J.W, Goralnick J, &Holmgren M.A, et al.(2005). Molecular genetics of attention deficit hyperactivity disorder. BiologicalPsychiatry, 57, 1313–1323. Gray, J. A., Feldon, J., Rawlins, J. N. P., Hemsley, D. R., & Smith, A. D. (1991) Theneuropsychology of schizophrenia. Behavioral and Brain Sciences, 14, 1–84. Gray, J. A. (1982). The neumpsychology of anxiety. New York: Oxford University Press. Halperin, J. M., & Healey, D. M. (2011). The infl uences of environmental enrichment,cognitive enhancement,and physical exercise on brain development: Can we alter thedevelopmental trajectory of ADHD? Neuroscience and Biobehavioral Reviews, 35 , 621–634. Hauschild K.M, Mouridsen S.E, & Nielsen S. (2005). Season of birth inDanish childrenwith language disorder born in the 1958–1976 period. Neuropsychobiology; 51, 93–99. Hudziak J.J, Rudiger L.P, Neale M.C, Heath A.C, & Todd R.D (2000). A twin study ofinattentive,aggressive, and anxious/depressed behaviors. Journal of the American Academyof Child and Adolescent Psychiatry, 39, 469 –476. Kahn, R. S., Khoury, J. & Nichols,W.C., et al (2003). Role of dopamine transportergenotype and maternal prenatal smoking in childhood hyperactive-impulsive,inattentive,and oppositional behaviors. Journal of Pediatrics, 143, 104–110. Kesner R.P, & Churchwell J.C (2011). An analysis of rat prefrontal cortexin mediatingexecutive function. Neurobiology of Learning and Memory, 96, 417–431. Kuntsi, J.,& Stevenson, J. (2000). Hyperactivity in children:Afocuson genetic research andpsychological theories. Clinical Child and Family Psychology Review, 3, 1–24. Langley, K., Rice, F., & van den Bree, M. B., et al (2005). Maternal smoking duringpregnancy as an environmental risk factor for attention deficit hyperactivity disorderbehaviour. A Review. Minerva Pediatrica, 57, 359–371. Manshadi M, Lippmann S, O’Daniel R, & Blackman A (1983): Alcohol abuse andattention deficit disorder. Journal of Clinical Psychiatry, 44, 379 –380 Martin N, Scourfield J, McGuffin P (2002).Observer effects and heritability ofchildhoodattention-deficit hyperactivity disorder symptoms. British Journal of Psychiatry, 80, 260 –265. Neale, B. M., Medland, S. E., Ripke, S., Asherson, P., Franke, B., Lesch, K. P., et al.(2010). Meta-analysis of genome-wide association studies of attention-defi cit/hyperactivity disorder. Journal of the American Academy of Child and AdolescentPsychiatry, 49 , 884–897. Nigg J, Nikolas M, & Burt S. A(2010). Measured gene-by-environment interaction inrelation to attention-deficit/hyperactivity disorder. Journal of the American Academy ofChild and Adolescent Psychiatry, 49, 863–73. Oades, R. D., Lasky-Su, J., Christiansen, H., Faraone, S.V., Sonuga-Barke, E. J., Banaschewski, T., et al. (2008). The influence of serotonin- and other genes onimpulsivebehavioral aggression and cognitive impulsivity in children with attentiondeficit/hyperactivity. A Developmental Perspective on ADHD disorder (ADHD): Findingsfrom a family-based association test (FBAT) analysis. Behavioral and Brain Functions, 4,4–48. Pastor P. N & Reuben C.A. (2008). Diagnosed attention deficit hyperactivity disorder andlearning disability: United States, 2004–2006. Vital Health Statistics, 10, 1–14. Quay, H. C. (1988a). Attention deficit disorder and the behavioral inhibitionsystem: Therelvance of the neuropsychological theory of Jeffrey A. Gray. In: Attention deficitdisorder: Criteria, cognition, intervention (pp. 117–126). L. M. Bloomingdale & J.Sergeant (Eds.). NewYork: Pergamon. Quay, H. C. (1988b). The behavioral reward and inhibition systems inchildhood behaviordisorder. In: Attentiondeficit disorder W; New research in treatment, psychopharnmcology,and attention (pp. 176–186). L. M. Bloomingdale (Ed.). NA: Pergamon. Quay, H. C. (1996, January). Gray'sbehavioral inhibition in ADHD:An update. Paperpresented at the annual meeting of the InternationalSociety for Research in Child andAdolescent Psychopathology, Los Angeles, CA. Rader, R, McCauley L,& Callen, E.C. (2009). Current strategies in thediagnosis andtreatment of childhood attention-deficit/hyperactivity disorder. American FamilyPhysician, 79, 657–665. Robbins, T. W. (2003). Dopamine and cognition. Currpin Neurol,16, (2), S1–S2. Rutter, M, Cox, A, Tupling, C, Berger, M, &Yule, W. (1975). Attainment and adjustmentin two geographical areas. 1—The prevalence of psychiatric disorders. British Journal ofPsychiatry, 126, 493–509. Rutter, M., &Sroufe, L. A. (2000). Developmental psychopathology: Concepts andchallenges. Development and Psychopathology, 12, 265–296. Sergeant, J. (2000). The cognitive-energetic model: An empiricalapproach to attentiondeficit hyperactivity disorder. Neuroscienceand Biobehavioral Reviews, 24, 7–12. Sherman D, McGue M, &Iacono W (1997). Twin concordance for attention deficithyperactivity disorder: A comparison of teachers’ and mothers’reports. American Journalof Psychiatry, 154, 532–535. Sonuga-Barke, E. J., Auerbach, J., Campbell, S. B., Daley, D., & Thompson, M. (2005).Preschool varieties of hyperactive and dysregulated behaviour: Multiple pathways betweenrisk and disorder. Developmental Science, 8 , 141–150. Sonuga-Barke, E. J., Bitsakou, P., & Thompson, M. (2010). Beyond the dual pathwaymodel: Evidence for the dissociation of timing, inhibitory, and delayrelated impairments inattention-defi cit/hyperactivity disorder. Journal of the American Academy of Child andAdolescent Psychiatry, 49 , 345–355. Sonuga-Barke, E. J., & Halperin, J. (2010). Developmental phenotypes and causalpathways in attention deficit/hyperactivity disorder: Potential targets for earlyintervention? Journal of Child Psychology and Psychiatry, 51, 368–398. Sprich-Buckminster S, Biederman J, Milberger S, Faraone S, &Krifcher LehmanB (1993):Are perinatal complications relevant to the manifestation ofADD? Issues of comorbidityand familiality. Journal of American Academy of Child and Adolescent Psychiatry,32,1032–1037 Swanson, J. M., Sunohara, G. A., Kennedy, J. L., Regino,R., Fineberg, E.,Wigal, T.,Lerner, M.,Williams, L., LaHoste,G. J.,&Wigal, S. (1998). Association of the dopaminereceptorD4 (DRD4) gene with a refined phenotype of attention deficithyperactivitydisorder (ADHD): A family–based approach.Molecular Psychiatry, 3, 38–41. Taylor, E. (1999). Developmental neuropsychopathology of attentiondeficit and impulsiveness. Development and Psychopathology, 11, 607–628. Thapar, A.,O’Donovan,M., &Owen,M. J. (2005b). The genetics of attention deficithyperactivity disorder. Human Molecular Genetics, 14, 275–282. Thapar, A., Langley, K.,O’Donovan,M. (2006). Refining the attention deficithyperactivity disorderphenotype formolecular genetic studies. Molecular Psychiatry, 11,714–720. Thapar A, Langley K, &Asherson P, (2007). Gene–environment interplay in attentiondeficit hyperactivity disorder and the importance of a developmental perspective. BritishJournal of Psychiatry 190, 1–3. Tochigi M, Okazaki Y, & Kato N, (2004). What causes seasonality of birth inschizophrenia? Neuroscience Res, 48, 1–11 Trent S & Davies W. (2012). The influence of sex-linked genetic mechanisms on attentionand impulsivity. Biological Psychology, 89, 1–13. United States, 2003 and 2007 (2010). Increasing prevalence of parent-reported attentiondeficit/hyperactivity disorder among children, MMWR Morb Mortal Wekly Rep, 59, 1439–43. Yehuda, R. (2000). Biology of posttraumatic stress disorder. Journal of ClinicalPsychiatry, 61, 14–21. Zimmer, L (2009). Positron emission tomography neuroimagingfor a better understandingof the biology of ADHD. Neuropharmacology, 57, 601–607.

Abstract Background. Although Hodgkin lymphoma is a highly curable malignancy, about 15% and 30% of patients with respectively localized or disseminated disease do not respond or relapse after initial treatment. Several scoring systems using conventional biological and clinical parameters have been developed for limited and advanced stages in order to adapt the therapeutic strategy. However, the identification of patients with adverse outcome needs to be improved. Cytokines have an important role in the pathogenesis of Hodgkin lymphoma. Several studies have shown that plasma cytokine dosage at diagnosis has prognostic relevance. Various cytokine genes variants are known to influence cytokine productions and have been associated with lymphoma outcomes. We then evaluated the influence of cytokine gene polymorphisms on response to treatment and outcome in patients with Hodgkin lymphoma. Methods. Between 1998 and 2002, we prospectively investigated the prognostic role of plasma cytokines and soluble receptors in Hodgkin lymphoma patients (Casasnovas et al. JCO 2007). A sample was collected at diagnosis specifically to investigate single nucleotide polymorphisms (SNPs) in cytokine genes. Ten SNPs that could be functionally important in seven genes (IL10, TNF-alpha, IL6, IL1B, IL1RN, INF-gamma, CCL17) were studied. DNA was extracted from venous blood samples. All genotyping experiments were performed in duplicate using Taqman technology (ABI Prism 7000, Applied Biosystems): IL10 rs1800890 (−3584>A), 448 pts; IL10 rs1800896 (−1116A>G), 459 pts; IL10 rs1800871 (−853C>T), 446 pts; IL10 rs1800872 (−626C>A), 447 pts; TNFalpha rs1800629 (−487G>A), 464 pts; IL6 rs1800795 (−236G>C), 201 pts; IL1B rs16944 (−1060T>C), 198 pts; ILRNrs419598 (Ex5–35T>C), 199 pts; INF-gamma rs2430561 (+874A>T), 200 pts; CCL17rs223828 (−431T>C), 198 pts. We estimated the prognostic value of each individual SNP and the IL10 haplotype for response to treatment, relapse and overall survival (OS). Results. The median age of the 464 patients studied was 32 years (range, 15–93); 263 (57%) were male. At diagnosis, 335 patients (72%) were in Ann Arbor stage I–II and 206 (44%) presented with B symptoms. Histology was nodular sclerosis in 384 patients (84%). Treatment consisted of 4 to 6 courses of anthracycline-based chemotherapy (CT) followed by involved-field radiotherapy for stages I–II and 8 courses of anthracycline-based CT for stages III–IV. Complete response (CR) and uncertain CR (uCR) were observed in 417 patients (90%), partial response in 15 (3%) and stable and progressive disease in 32 (7%). Relapse occurred in 71 patients (15%) and 35 patients (8%) died, 24 of whom (5%) of Hodgkin lymphoma. After a median follow-up of 3.6 years months, the 4-year progression free survival (PFS) and OS were 83.4% and 93.6%, respectively. Regarding treatment response, only the IL10-1082AA genotype was associated with a better CR + uCR than other IL10 genotypes (95% vs. 88% p=0.02). Neither individual SNPs or IL10 haplotype influenced OS and PFS. Conclusions. In this large series of Hodgkin lymphoma patients with particularly favorable outcome, the IL10-1082AA genotype was associated with better response to initial treatment. These data indicate that some genes associated with non-Hodgkin lymphoma outcome do not predict Hodgkin lymphoma outcome and that other target need to be analyzed to decipher the putative role of host’s immunogenetic background in this disease.

The politics of Italian national identity. Edited by Gino Bedani and Bruce Haddock. Cardiff: University of Wales Press, 2000. Pp. vii+296. ISBN 0-7083-1622-0. £40.00.Fascist modernities: Italy, 1922–1945. By Ruth Ben-Ghiat. Berkeley, University of California Press, 2001. Pp. x+317. ISBN 0-520-22363-2. £28.50.Le spie del regime. By Mauro Canali. Bologna: Il Mulino, 2004. Pp. 863. ISBN 88-15-09801-1. €70.00.I campi del Duce: l'internamento civile nell'Italia fascista (1940–1943). By Carlo Spartaco Capogreco. Turin: Einaudi, 2004. Pp. xi+319. ISBN 88-06-16781-2. €16.00.The American South and the Italian Mezzogiorno: essays in comparative history. Edited by Enrico Dal Lago and Rick Halpern. Houndmills: Palgrave Macmillan, 2002. Pp. 256. ISBN 0-333-73971-X. £28.50.Disastro! Disasters in Italy since 1860: culture, politics, society. Edited by John Dickie, John Foot, and Frank M. Snowden, Houndmills: Palgrave Macmillan, 2002. Pp. ix+342. ISBN 0-312-23960-2. £32.50.Remaking Italy in the twentieth century. By Roy Palmer Domenico. Lanham, MD: Rowman and Littlefield, 2002. Pp. xiv+181. ISBN 0-8476-9637-5. £16.95.Twentieth century Italy: a social history. By Jonathan Dunnage. Harlow: Pearson, 2002. Pp. xi+271. ISBN 0-582-29278-6. £16.99.Milan since the miracle: city, culture and identity. By John Foot. Oxford: Berg, 2001. Pp. xiv+240. ISBN 1-85973-550-9. £14.99.Squadristi: protagonisti e tecniche della violenza fascista, 1919–1922. By Mimmo Franzinelli. Milan: Mondadori, 2003. Pp. 464. ISBN 88-04-51233-4. €19.00.For love and country: the Italian Resistance. By Patrick Gallo. Lanham, MD: University Press of America, 2003. Pp. viii+362. ISBN 0-7618-2496-0. $55.00.The struggle for modernity: nationalism, futurism and Fascism. By Emilio Gentile. Westport, CT: Praeger, 2003. Pp. xix+203. ISBN 0-275-97692-0. $69.95.Italy and its discontents. By Paul Ginsborg. Harmondsworth: Allen Lane, 2001. Pp. xv+521. ISBN 0-713-99537-8. £25.00.Silvio Berlusconi: television, power and patrimony. By Paul Ginsborg. London: Verso, 2004. Pp. xvi+189. ISBN 1-84467-000-7. £16.00.Fascists. By Michael Mann. Cambridge: Cambridge University Press, 2004. Pp. x+429. ISBN 0-521-53855-6. £15.99.Mussolini: the last 600 days of Il Duce. By Ray Moseley. Dallas: Taylor Trade publishing, 2004. Pp. vii+432. ISBN 1-58979-095-2. $34.95.Lo stato fascista e la sua classe politica, 1922–1943. By Didier Musiedlak. Bologna: Il Mulino, 2001. Pp. 585. ISBN 88-15-09381-8. €32.00.Italy's social revolution: charity and welfare from Liberalism to Fascism. By Maria Sophia Quine. Houndmills: Palgrave Macmillan, 2002. Pp. xv+429. ISBN 0-333-63261-3. £55.00.La seduzione totalitaria: guerra, modernità, violenza politica (1914–1918). By Angelo Ventrone. Rome: Donzelli, 2003. Pp. xvi+288. ISBN 88-7989-840-X. €24.00.With its winning of an American Academy Award, the film Life is beautiful (1997), brought its director and leading actor, Roberto Benigni, global fame. Benigni's zaniness and self-mockery seemed to embody everything that has convinced foreigners that Italians are, above all, brava gente (nice people). Sometimes, this conclusion can have a supercilious air – niceness can easily be reduced to levity or fecklessness. In those university courses that seek to comprehend the terrible tragedies of twentieth-century Europe, Italians seldom play a leading role. German, Russian, Polish, Yugoslav, and even British and French history are each riven with death and disaster or, alternatively, with heroism and achievement. In such austere company, brava gente can seem out of place.

The results of evaluation of powdery mildew resistance in winter barley varieties in 285 Czech Official Trials conducted at 20 locations were analysed. Over the period, the number of varieties tested per year increased from four to seven in 1976−1985 to 53−61 in 2002−2005. To assess the resistance of varieties, only trials with sufficient disease severity were used. In 1976−2000, six varieties (1.7% of the varieties tested in the given years) ranked among resistant (average resistance of a variety in a year > 7.5) including NR-468 possessing the gene <i>Mla13</i>, KM-2099 with <i>mlo</i> and Marinka with the genes <i>Mla7</i>, <i>MlaMu2</i>. In 2001−2005, already 33 varieties (16.9%) ranked among resistant, of which Traminer possessing the genes <i>Ml(St)</i> and <i>Ml(IM9 </i> dominated. The proportion of susceptible varieties (average resistance ≤ 5.5) did not change in the two mentioned periods. Two-rowed varieties began to be tested as late as in 1990 (the first variety was Danilo), however, no difference was found in the resistance of two- and six-rowed varieties. Using an example of two pairs of varieties (Dura-Miraj and Marinka-Tiffany) with identical genes for specific resistance but with different resistance in the field, the efficiency of non-specific resistance is discussed. The resistance of domestic and foreign varieties was similar in 1994−2000; however, in 2001−2005 the difference was 0.75 point to disadvantage of domestic ones.

Alan S. Milward, The Rise and Fall of a National Strategy 1945–1963 (The United Kingdom and The European Community, Vol. I) (London and Portland: Frank Cass, 2002), 512 pp., £65.00 (hb), ISBN 0-7146-5111-7.Alex May, ed., Britain, the Commonwealth and Europe: The Commonwealth and Britain's Applications to Join the European Communities (Houndsmill and New York: Palgrave, 2001), 188 pp., £55.00 (hb), ISBN 0-333-80013-3.Oliver J. Daddow, ed., Harold Wilson and European Integration. Britain's Second Application to Join the EEC (London and Portland: Frank Cass, 2003), 298 pp., £45.00 (hb), ISBN 0-7146-5222-9, £17.50 (pb), ISBN 0-7146-8207-1.Sir Con O'Neill, Britain's Entry into the European Community. Report by Sir Con O'Neill on the Negotiations of 1970–1972, ed. and with a foreword by Sir David Hannay (London and Portland: Frank Cass, 2000), 464 pp., £55.00 (hb), ISBN 0-7146-5117-6.

Ключові слова: «Варшавська угода», «Союз Пілсудський–Петлюра», УНР, Симон Петлюра,Юзеф Пілсудський, «Київський похід». У статті проаналізовано передумови, процес і результати Варшавської угоди 1920 р. між Польщею іУНР, яка в польській історіографії названа «Союзом Пілсудський–Петлюра». Розкрито також зміствійськової конвенції, була підписана 24 квітня 1920 року і стала додатком до самого договору і являла собоютаємну угоду про надання військової та економічної допомоги УНР у спільній війні з Радянською Росією.Продовженням згаданих угод став фінансовий польсько-український договір від 9 серпня 1920 р. Польськавлада виконувала союзницькі обов’язки перед Україною й на міжнародній арені.Правове, політичне, фінансове і дипломатичне забезпечення Варшавського договору, названого пізніше«Союзом Пілсудський–Петлюра», відбувалося майже одночасно зі спільним антибільшовицьким походом наКиїв, який розпочався 25 квітня 1920 р.Отже, відносини між Польщею і УНР у 20-х роках ХХ ст. еволюціонували від взаємного протистояннядо співпраці. Серед найважливіших актів цього періоду слід назвати Варшавську угоду, військову конвенцію іспільний польсько-український похід на Київ. Так, були закладені традиції польсько-української співпраці, якізнайшли своє продовження в майбутньому. Посилання Vynnychenko, 1990 – Vynnychenko V. Vidrodzhennia natsii [Rebirth of the nation]. (Istoriia ukrainskoi revoliutsii[marets 1917 r. – hruden 1919 r.]). Chastyna III. Repryntne vidtvorennia vydannia 1920 roku. K., 1990. 542 s. [inUkrainian].Hud, 2006 – Hud B. Zahybel Arkadii. Etnosotsialni aspekty ukrainsko-polskykh konfliktiv KhIKh – pershoi polovynyKhKh stolit [The death of Arcadia. Ethno-social aspects of the Ukrainian-Polish conflicts of the 19th and the first halfof the 20th centuries]. Lviv, 2006. 448 s. [in Ukrainian].Hud, Holubko, 1997 – Hud B., Holubko V. Nelehka doroha do porozuminnia. Do pytannia genezy ukrainsko-polskohoviiskovo-politychnoho spivrobitnytstva 1917–1921 rr. [The road to understanding is not easy. On the question of thegenesis of Ukrainian-Polish military-political cooperation in 1917–1921]. Lviv, 1997. 65 s. [in Ukrainian].Dotsenko, 2001 – Dotsenko O. Zymovyi pokhid (6.XII.1919 – 6.V.1920) [Winter campaign (6.XII.1919 – 6.V.1920)].K., 2001. 375 s. [in Ukrainian].Kedryn, 1979 – Kedryn I. Sobornist. Z nahody 60-richchia Aktu 22 sichnia 1919 roku [Congregationalism. On theoccasion of the 60th anniversary of the Act of January 22, 1919] // Almanakh UNS [Ukrainskoho Narodnoho Soiuzu]. Ustorichchia narodzhennia Symona Petliury. Dzherzi Syti-Niu-York, 1979. № 69. S. 43–48. [in Ukrainian].Kolianchuk, 2000 – Kolianchuk O. Ukrainska viiskova emihratsiia u Polshchi (1920–1939) [Ukrainian militaryemigration in Poland (1920–1939)]: Dys... kand. ist. nauk: 20.02.22 / Derzhavnyi un-t «Lvivska politekhnika». Lviv,2000. 204 s. [in Ukrainian].Krasivskyi, 2000 – Krasivskyi O. Ya. Halychyna u pershii chverti KhKh st.: Problemy polsko-ukrainskykh stosunkiv[Galicia in the first quarter of the 20th century: Problems of Polish-Ukrainian relations]. Lviv, 2000. 416 s. [inUkrainian].Krasivskyi, 2008 – Krasivskyi O. Ya. Ukrainsko-polski vzaiemyny v 1917–1923 rr. [Ukrainian-Polish relations in1917–1923]. K., 2008. 544 s. [in Ukrainian].Lytvyn, 2000 – Lytvyn S. Vbyvstvo Petliury i HPU. Do istoriohrafii problemy [The murder of Petliura and the GPU. Tothe historiography of the problem] // Z arkhiviv VUChK–NKVD–KHB. 2000. № 2/4. S. 404–407. [in Ukrainian].Lytvyn, 2001 – Lytvyn S. Sud istorii: Symon Petliura i Petliuriana [Court of history: Simon Petlyura and Petlyuriana].K., 2001. 640 s. [in Ukrainian].Mazepa, 2003 – Mazepa I. Ukraina v ohni i buri revoliutsii 1917–1921 [Ukraine in the fire and storm of the revolution1917–1921]. K., 2003. 608 s. [in Ukrainian].Mandzenko, 1979 – Mandzenko K. Petliura, petliurivtsi, petliurivstvo. Do storichchia vid dnia narodzhennia Holovnohootamana Symona Petliury 1879–1979 [Petlyura, Petlyura people, Petlyuraism. To the centenary of the birth of ChiefAtaman Simon Petliura 1879–1979] // Almanakh UNS. U storichchia narodzhennia Symona Petliury. Dzherzi Syti–NiuYork , 1979. № 69. S. 9–21. [in Ukrainian].Rukkas, 2015 – Rukkas A. O. «Razom z polskym viiskom»: Armiia Ukrainskoi Narodnoi Respubliky 1920 r.(struktura, orhanizatsiia, chyselnist, uniforma) [Together with the «Polish army»: the Army of the Ukrainian People'sRepublic in 1920 (structure, organization, numbers, uniform)]. K., 2015. 480 s. [in Ukrainian].Sekretnoe sohlashenye… – Sekretnoe sohlashenye mezhdu pravytelstvom Polshy y petliurovskoi dyrektoryei ukraynskoi nezavysymoi respublyky o pryznanyy UNR y sotrudnychestve, zakliuchennoe 21.IV.1920 h. (fotokopyy)[Secret agreement... - Secret agreement between the government of Poland and the Petliura directory of the Ukrainianindependent republic on the recognition of the UNR and cooperation, concluded on April 21, 1920 (photocopies)]// Rossyiskyi hosudarstvennыi voennыi arkhyv (RHVA), f. 461/k, op. 2, d. 41. [in Russian].Stakhiv, 1966 – Stakhiv M. Ukraina v dobi Dyrektorii UNR [Ukraine in the era of the UNR Directory]. T. 7. Vykhid izkryzy. Skrenton, 1966. 431 s. [in Ukrainian].Tynchenko, 2007 – Tynchenko Ya. Ofitserskyi korpus Armii Ukrainskoi Narodnoi Respubliky (1917–1921) [OfficerCorps of the Army of the Ukrainian People's Republic (1917–1921)]. K., 2007. 536 s. [in Ukrainian].Shandruk, 2008 – Shandruk P. Syla doblesti [The power of valor]. Ivano-Frankivsk, 2008. 236 s. [in Ukrainian].Shelukhin, 1926 – Shelukhin S. Varshavskyi dohovir mizh poliakamy i S. Petliuroiu 21 kvitnia 1920 roku [The WarsawPact between the Poles and S. Petliura on April 21, 1920]. 2-e vyd. Praha, 1926. 40 s. [in Ukrainian].

Abstract Ungfors, A., McKeown, N. J., Shaw, P. W., and André, C. 2009. Lack of spatial genetic variation in the edible crab (Cancer pagurus) in the Kattegat–Skagerrak area. – ICES Journal of Marine Science, 66: 462–469. The stock structure of the edible crab (Cancer pagurus L.) in the Kattegat and Skagerrak was investigated using eight microsatellite DNA loci. Replicate samples, collected 4–6 years apart, were derived from the Kattegat (Grove Bank, 57°N) and the Skagerrak (Lunneviken, 59°N), plus a geographical outgroup sample from the Norwegian Sea (Midsund, 62°N). Genetic differentiation among samples, estimated as global FST = 0.002, was significant (p = 0.03) when the statistical test was based on allele frequencies, but not when based on genotype frequencies. Moreover, all single- and multilocus pairwise tests between samples were non-significant. An analysis of molecular variance, AMOVA, did not reveal significant differentiation between spatial (Kattegat vs. Skagerrak) or temporal (2001/2002 vs. 2006/2007) groups of samples. Power analysis suggested that the loci and sample sizes employed conferred a power of >90% of detecting even low (true FST = 0.002) levels of population structure. Low spatial and temporal genetic structure might be explained by either or both of (i) high levels of contemporary gene flow in the area attributable to adult migration or larval dispersal or both factors taken together, and (ii) patterns of historical gene flow persisting among recently founded large populations.

El objeto de este trabajo es el estudio del simbolismo de las aves en el ámbito tartésico y fenicio-púnico en la península ibérica durante el Bronce Final y el Hierro I. Se han recogido y analizado aquellas piezas con representaciones de aves, así como los restos orgánicos de éstas, si bien esto último no ha dado muchos frutos debido a las dificultades que existen tanto para su conservación como para la posterior identificación de especies. En total se han podido determinar ánades, gallos, palomas, flamencos, cisnes, lechuzas y halcones, todas ellas representadas en el Mediterráneo oriental y cuya iconografía se vincula al mundo funerario, al tránsito al Más Allá y a las divinidades. Gran parte de esa iconografía llegó a la península de mano de los fenicios, si bien su acogida y aceptación entre la población local fue variable. Palabras clave: aves, simbolismo, tartesios, fenicios, púnicosTopónimos: península ibéricaPeriodo: Hierro I. ABSTRACTThe aim of this paper is to study the symbolism of birds in Tartessian and Phoenician-Punic cultures within the Iberian Peninsula during the late Bronze and early Iron Age. To this end, items with any sort of symbolism connected with birds have been analysed. Organic remains have also been examined, although the latter did not make a relevant contribution to the study due to problems of conservation of the organic remains and subsequent identification of species. I have identified ducks, roosters, pigeons, flamingos, swans, owls and hawks, all located around the East Mediterranean basin and related to funerary contexts, the journey to the hereafter and deities. Most of this iconography reached the Iberian Peninsula via Phoenician culture, albeit its acceptance among the local population varied. Keywords: birds, symbolism, Tartesian, Phoenicians, PunicPlace names: Iberian PeninsulaPeriod: Iron Age REFERENCIASAlmagro Gorbea, M. J. (1986), Orfebrería fenicio-púnica, Madrid.Almagro Gorbea, M. (1977), El Bronce Final y el Periodo Orientalizante en Extremadura (Bibliotheca Praehistorica Hispana, 14), Madrid.— (dir.) (2008), La necrópolis de Medellín. II Estudio de los hallazgos, (Bibliotheca Archaeologica Hispana, 26-2), Madrid.Almagro Gorbea, M. y Torres, M. (2006), “Plástica sirio-fenicia en occidente: la sirena de Villaricos y el origen de la plástica ibérica”, Madrider Mitteilungen, 47, pp. 59-82.— (2009), “Los escarabeos fenicios de Portugal. Un estado de la cuestión”, Estudos Arqueológicos de Oeiras, 17, pp. 521-554.Akimova, L. I., Kunze, M. y V. Kästner, V. (1988), Die Welt der Etrusker. Archäeologische Denkmäler aus Museen der sozialististischen Länder, Berlin.Arnold, D. (1995), An Egyptian Bestiary, New York.Arruda, A. M. (2016), “À vol d´oiseau. Pássaros, passarinhos e passarocos na Idade do Ferro do Sul de Portugal”, en Terra e Água. Escolher sementes, invocar a Deusa. Estudos em homenagem a Victor S. Gonçalves, Lisboa, pp. 403-423.Aubet, M. E. (1978), “Los marfiles fenicios del Bajo Guadalquivir. I, Cruz del Negro”, Boletín del seminario de Arte y Arqueología, 44, pp. 15-88.— (1981-82), “Los marfiles fenicios del Bajo Guadalquivir (y III): Bencarrón, Santa Lucía y Setefilla”, Pyrenae, 17-18, pp. 231-287.Blázquez, J. M. (1983), Primitivas religiones ibéricas. Religiones prerromanas, Madrid.Blázquez, J. M. y Jordá, F. (1978), Historia del Arte Hispánico. I: La Antigüedad, Madrid.Blázquez, J. M., Luzón, J. M., Gómez, F. y Clauss, K. (1970), Las cerámicas del Cabezo de San Pedro (Huelva Arqueológica, 1), Madrid.Belén, M. y Escacena, J. L. (2002), “La imagen de la divinidad en el mundo tartésico”, en Ex oriente lux. Las religiones orientales antiguas en la península ibérica (Spal monografías, 21), Sevilla, pp. 159-184.Bendala, M. (1988), Los albores de Grecia. Historias del Viejo Mundo (Historia 16, 9), Madrid.Buero, M. (1984), “Los motivos naturalistas en la cerámica pintada del Bronce Final del suroeste peninsular”, Habis, 15, pp. 345-364.Carriazo, J. de M. (1969), “El cerro del Carambolo”, en Tartessos y sus problemas. V Symposium Internacional de Prehistoria Peninsular. Jerez de la Frontera. Barcelona, pp. 311-340.Celestino, S. y Blanco, J. L. (2006), “Edad del Hierro: Del Periodo Orientalizante al mundo prerromano”, en La joyería en los orígenes de Extremadura: el espejo de los dioses, Mérida, pp. 116-125.Celestino, S. y Salgado, J. A. (2007), “Fenicios e indígenas a través del tesoro de Aliseda”, en Las aguas primigenias. El Próximo Oriente Antiguo como fuente de civilización. Actas del IV Congreso Español de Antiguo Oriente Próximo (Zaragoza, 17 al 21 de octubre de 2006), Zaragoza, pp. 587-601.Celestino, S. y Rodríguez González, E. (2017), “De lo invisible a lo visible. La Transición entre el Bronce Final y la Primera Edad del Hierro en el valle medio del Guadiana”, en Territorios comparados: Los valles del Guadalquivir, el Tajo y el Guadiana en época tartésica (Anejos de AEspA, 80), Mérida, pp. 183-212.Coldstream, J. N. (2003), Geometric Greece, 900-700 BC, London-New York.Corzo, R. (1988), Los fenicios, señores del mar. Historias del Viejo Mundo (Historia 16, 8), Madrid.— (1991): Arte fenicio y púnico. Cuadernos de arte español (Historia 16, 9), Madrid.De Deus, M. y Correira, J. (2005), “Corte Margarida. Mais uma necrópole orientalizante no Baixo Alentejo”, en El Periodo Orientalizante. Actas del III Simposio Internacional de Arqueología de Mérida: Protohistoria del Mediterráneo Occidental, Mérida, pp. 615-618.Díez, F. (2017), “Cuerpos imaginarios: poder y descorporeización en el paso al más allá imaginado en las lécitos áticas de fondo blanco”, Res Publica, 20.3, pp. 493-506.Diogo, C. y Kesser, C. (2018), “The Iconography of Death: continuity and change in the Prothesis ritual through iconographical techniques, motifs, and gestures depicted in Greek pottery”, Classica, 31.1, pp. 61-87.Fantar, M. H. (1970), Eschatologie phénicienne et punique. Tunis.Fernández Flores, A. y Rodríguez Azogue, A. (2007), Tartessos desvelado. La colonización fenicia del suroeste peninsular y el origen y ocaso de Tartessos, Córdoba.Frankfort, H. (2010), Arte y arquitectura del Oriente Antiguo, Madrid.Garrido, J. P. (1970), Excavaciones en la necrópolis de “La Joya”, Huelva (1ª y 2ª campañas) (Excavaciones Arqueológicas en España, 71), Madrid.González Prats, A. (1983), Estudio arqueológico del poblamiento antiguo de la sierra de Crevillente (Alicante) (Anejos de la Revista Lucentum, 1), Alicante.Grosman, L. y Munro, N. D. (2016), “A Natufian ritual event”, Current Anthropology, 57.3, pp. 311-331.Guerrero, V. M. (1986), “El impacto de la colonización púnica en la cultura talayótica de Mallorca”, en Los Fenicios en la peninsula ibérica, Sabadell, pp. 339-375.Hachmann, R. (1983), Frühe Phöniker im Libanon. 20 Jahre deutsche Ausgrabungen in Kāmid el-Lōz. Mainz.Hernández Carrasquilla, F. y Jonsson, L. (1994), “Las aves”, en Castillo de doña Blanca. Archaeo-environmental investigations in the Bay of Cádiz, Spain (750-500 B.C.) (BAR International Series, 593), Oxford, pp. 81-90.Horn, F. (2005), “Les terres cuites d´origine orientale de la peninsule iberique (VIIIᵉ-VIᵉ s. av. J.-C.)”, en El Periodo Orientalizante. Actas del III Simposio Internacional de Arqueología de Mérida: Protohistoria del Mediterráneo Occidental (Anejos de AEspA, 35) vol 2. Mérida, pp. 1405-1415.Ikram, S. (2012), “An eternal aviary: Bird mummies from Ancient Egypt”, en Between heaven and Earth. Birds in Ancient Egypt (Oriental Institute Museum Publications, 35), Chicago, pp. 41-48.Jiménez Ávila, J. (2002), La toréutica orientalizante en la peninsula ibérica (Bibliotheca Archaeologica Hispana, 16), Madrid.Jiménez Guijarro, J., Sánchez Marco, A. y García Díez, M. (2011), “Nuevo examen de los grabados paleolíticos de El Pendo (Cantabria, España). Consideraciones sobre las aves del arte paleolítico de la península ibérica”, Trabajos de Prehistoria, 68.1, pp. 147-158.Karageorghis, V. y Des Gagniers, J. (1974), La Céramique Chypriote de Style Figuré. Âge du Fer (1050-500 AV. J.-C.) (Biblioteca di antichità cipriote, 2.1), Roma.Lacalle, R. (2019), Los símbolos de la Prehistoria. Mitos y creencias del Paleolítico Superior y del Megalitismo europeo, Córdoba.Le Meaux, H. (2010), L´iconographie orientalisante de la Péninsule Ibérique. Questions de styles et d´échanges (VIIIᵉ-VIᵉ siècles av. J.-C.) (Bibliothèque de la Casa de Velázquez, 47), Madrid.Liseau, C., Blasco, C., Ríos, P., Vega, J., Menduiña, R., Francisco, J., Baena, J., Herrera, T., Petri, A. y Gómez, J.L. (2008), “Un espacio compartido por vivos y muertos: el poblado calcolítico de fosos de Camino de las Yeseras (San Fernando de Henares, Madrid)”, Complutum, 19.1, pp. 97-120.López García, P., López Sáez, J. A. y Hernández, A. (2005), “El paleoambiente del suroeste peninsular en la protohistoria”, en El Periodo Orientalizante. Actas del III Simposio Internacional de Arqueología de Mérida: Protohistoria del Mediterráneo Occidental (Anejos de AEspA, 35) vol 1. Mérida, pp. 383-403.López Grande M. J. y Trello, J. (2001-2002), “Pervivencias iconográficas egipcias en las imágenes de damas sagradas del ámbito fenicio-púnico”, en Actas del II Congreso internacional de mundo púnico (Cartagena, 2000). El Mundo púnico: religión, antropología y cultura material, Murcia, pp. 337-352.Maluquer de Motes, J. (1958), Excavaciones Arqueológicas en el Cerro del Berrueco (Salamanca) (Acta Salamanticensia. Filosofía y Letras, XIV.1), Salamanca.— (1981), El santuario protohistórico de Zalamea de La Serena, Badajoz 1978-1981 (Programa de Investigaciones Protohistóricas, IV), Barcelona.— (1983), El santuario protohistórico de Zalamea de La Serena, Badajoz 1981-1982 (Programa de Investigaciones Protohistóricas, V), Barcelona.Marín, M. C. (2013), “La diosa astral ibérica y sus antecedentes orientales”, en Ritual, Religion and Reasons. Studies in the Ancient World in Honour of Paolo Xella, Münster, pp. 561-580.Marín, M. C. y Jiménez, A. M. (2014), Imagen y culto en la Iberia prerromana II. Nuevas lecturas sobre los pebeteros en forma de cabeza femenina (Spal Monografías, 18), SevillaMonge Soares, R., Baptista, L., Pinheiro, R., Rodrigues, L. y Vale, N. (2017), “A necrópole da I Idade do Ferro do Monte do Bolor 1-2 (São Brissos, Beja)”, en Sidereum Ana III. El río Guadiana y Tartessos, Mérida, pp. 263-301.Miguel Azcárraga, B. (2015), “Bronces púnicos en la isla de Ibiza”, en J. Jiménez (ed.), Phoenician Bronzes in Mediterranean (Bibliotheca Archaeologica Hispana, 45). Madrid, pp. 453-478.Miguel Naranjo, P. (2020), Definición y caracterización de las cerámicas a mano con decoración pintada del sur de la península ibérica en época tartésica. Oxford.Molina, F. (1986), “Almuñécar a la luz de los nuevos hallazgos fenicios”, en Los Fenicios en la peninsula ibérica. Sabadell, pp. 193-216.Moscati, S. (ed.) (1988), I Fenici. Milano.Murillo, J. F. (1994), La cultura tartésica en el Guadalquivir Medio (Ariadna, 13-14), Córdoba.Neri, S. (2010), Il tornio e il penello. Ceramica depurata di tradizione geometrica di época orientalizante in Etruria meridionale (Officina etruscologia, 2). Roma.Nauert, J. P. (1965), “The Hagia Triada sarcophagus. An iconographical study”, Antike Kunst, 8.2, pp. 91-98.Nicolás, J. C. (2017), “Gallos, labrys y campanillas, elementos simbólicos de la religión púnico-peninsular”, en El Oriente de Occidente. Fenicios y púnicos en el área ibérica. VIII edición del coloquio internacional del CEFYP en Alicante, Alicante, pp. 433-464.Olmos, R. y Fernández Miranda, M. (1987), “El timiaterio de Albacete”, Archivo Español de Arqueología, 60, pp. 211-219.Padró, J. (1981), “Las divinidades egipcias en la Hispania romana y sus precedentes”, Simposio de la religión romana en Hispania, Madrid, pp. 335-344.Pachón, J. A. y Carrasco, J. (2005), Las cerámicas polícromas orientalizantes y del Bronce Final desde la perspectiva granadina. Granada.Pellicer, M. (2007), La necrópolis Laurita (Almuñécar, Granada) en el contexto de la colonización fenicia (Cuadernos de Arqueología Mediterránea, 15), Barcelona.Perdigones, L., Muñoz, A. y Pisano, G. (1990), La necrópolis fenicio-púnica de Cádiz, (Studia Punica, 7), Roma.Pérez Blasco, M.F. (2012), “El kalathos del gallo: una decoración simbólica singular en un vaso de Lucentum”, MARQ. Arqueología y Museos, 5, pp.133-153.Peyras, J. (1999), Aspects de Hermès-Mercure dans l´Afrique Mineure, en J. Peyras y G. Tirologos (eds.). L´Afrique du Nord Antique. Cultures et paysages, Paris, pp. 127-150.Plaza, L. de la, Martínez, J. M. y Vaquero, J. I. (2019), Guía para identificar los personajes de la mitología clásica, Madrid.Prados, F. (2008), Arquitectura púnica. Los monumentos funerarios (Anejos de Archivo Español de Arqueología, 44), Madrid.Regoli, P. (1991), I brucuaprofumi a testa femminile dal Nuraghe Lugherras (Paulilatino) (Studia Punica, 8), Roma.Rodríguez Díaz, A., Pavón, I. y Duque, D. M. (2015), “El Tesoro de Aliseda: aproximación a su contexto arqueológico y a su tiempo histórico”, en El tiempo del Tesoro de La Aliseda. II. Aproximación a su contexto arqueológico, Cáceres, pp. 205-224.Rodríguez González, E. y Celestino, S. (2019), “Primeras evidencias de un banquete: análisis arquitectónico y material de la estancia S-1 del yacimiento de Casas del Turuñuelo (Guareña, Badajoz)”, Cuadernos de Prehistoria y Arqueología de la Universidad Autónoma de Madrid, 45, pp. 179-202.Ruiz, L. A. (2004), “Appendice. El huevo de avestruz: símbolos, epigrafía y contextos culturales”, en Le uova di struzzo dipinte nella cultura punica (Bibliotheca Archaeologica Hispana, 22 Studia Hispano-Phoenicia, 3), Madrid, pp. 111-118.Russell, N. y McGowan, K. J. (2003), “Dance of the Cranes: Crane symbolism at Çatalhöyük and beyond”, Antiquity, 77.297, pp. 445-455.Salvador, R. M. y Pereira, J. (2017), “A Paisagem funerária a oeste de Beja no período orientalizante. As necrópoles de Carlota (São Brissos) e Cinco Reis 8 (Santiago Maior)”, en Sidereum Ana III. El río Guadiana y Tartessos, Mérida, pp. 333-352.Santos, F., Antunes, S., De Deus, M. y Grillo, C. (2017), “A Necrópole de Palhais (Beringel, Beja)”, en Sidereum Ana III. El río Guadiana y Tartessos, Mérida, pp. 227-261.Schmidt, K. (2010), “Göbekli Tepe- The Stone Age Sanctuaries. New results of ongoing excavations with a special focus on sculptures and high reliefs”, Documenta Praehistorica, 37, pp. 239-256.Schmitz, Ph. (2009), “The owl in Phoenician Mortuary practice”, JANER, 9.1, pp. 51-85.Soave, L. (2017), Simboli nell´arte. Breve guida per scoprire i significati nascoti nelle opere. Modena.Torres, M. (2002), Tartessos (Bibliotheca Archaeologica Hispana, 14), Madrid.— (2017), “El paisaje funerario en las necrópolis tartésicas”, en Arquitecturas funerarias y Memoria: la gestión de las necrópolis en Europa occidental (ss. X-III a. C.), Madrid, pp. 359-398.Townsend, E. (1974), Götterkult (Archaeologia Homerica, 3), Göttingen.Valero, M. A. (2005), “El mosaico del Cerro Gil. Iniesta, Cuenca”, en El Periodo Orientalizante. Actas del III Simposio Internacional de Arqueología de Mérida: Protohistoria del Mediterráneo Occidental (Anejos de AEspA, 35) vol 1. Mérida, pp. 619-634.Vaquero, A. (2012), “Los amuletos de la «Tumba Nº 5» de la necrópolis orientalizante de Les Casetes (Villajoyosa, Alicante)”, Lucentum, 31, pp. 91-114.Vives-Ferrándiz, J. (2007), “La vida social de la vajilla de bronce etrusca en el este de la península ibérica. Notas para un debate”, Revista d´Arqueología de Ponent, 16-17, pp. 318-342.VV.AA. (1979), Mer Égée. Gréce des Îles, Paris.

Работа посвящена обобщению результатов исследования анодирования алюминида титана (γ-TiAl) во фторсодержащих электролитах. Установлены оптимальные условия анодирования, приводящие к формированию самоорганизованных нанопористых анодных оксидных пленок (АОП) на поверхности образцов, сплава Ti-40 wt. % Al. Показано, что при оптимальных условиях образуются рентгеноаморфные оксидные пленки гетерогенного состава (Al2O3:TiO2 @ 1:1) с размерами пор в диапазоне от 40 до 80 nm. Полученные результаты свидетельствуют о перспективности применения анодного наноструктурирования порошков Ti-40 wt. % Al для получения фотокаталитически активных материалов с расширенным до видимого света спектральным диапазоном поглощения. ЛИТЕРАТУРА Wang Y., Ma X., Li H., Yin S., Sato T. Advanced Catalytic materials - Photocatalysis and Other Current Trends, 2016, vol. 12, pp. 337–357. https://doi.org/10.5772/61864 Hashimoto K., Irie H., Fujishima A. Japanese Journal of Applied Physics, 2005, vol. 44, no. 12, pp. 8269–8285. https://doi.org/10.1143/jjap.44.8269 Uddin Md.T., Engg M. Sc. Dr. Rer. Nat. Technical University of Darmstadt, 2014, 222 p. URL: https://d-nb.info/1061050335/04 (accessed 28.11.2018) Batzill M. Energy Environ. Sci., 2011, vol. 4, pp. 3275–3286. https://doi.org/10.1039/c1ee01577j Marschall R. Funct. Mater., 2014. vol. 24. pp. 2421–2440. https://doi.org/10.1002/adfm.201303214 Ghicov A., Schmuki P. Commun., 2009, pp. 2791–2808. https://doi.org/10.1039/b822726h Li F., Zhao Y., Hao Y., Wang X., Liu R., Zhao D., Chen D. Journal of Hazardous Materials, 2012, vol. 239–240. pp. 118–127. https://doi.org/10.1016/j.jhazmat.2012.08.016 Morris S. M., Horton J. A., Jaroniec M. Mesopor. Mater., 2010, vol. 128, pp. 180–186. https://doi.org/10.1016/j.micromeso.2009.08.018 Ahmed M. A., Abdel-Messih M. F. Journal of Alloys and Compounds, 2011, vol. 509, pp. 2154–2159. https://doi.org/10.1016/j.jallcom.2010.10.172 Pakmehr M., Nourmohammadi A., Ghashang M., Saffar-Teluri A. Journal of Particle Science and Technology, 2015, pp. 31–38. https://doi.org/22104/JPST.2015.76 Pei J., Ma W., Li R., Li Y., Du H. Journal of Chemistry, 2015, pp. 1–7. https://doi.org/10.1155/2015/806568 Il'in, A. A., Kolachev, B. A., Pol'kin, I. S. Titanovye splavy. sostav, struktura, svoistva [Titanium alloys. Composition, structure, properties]. Moscow, VILS-MATI Publ., 2009, 520 p. (in Russ.) Tsuchiya, H., Berger, S., Macak, J.M., Ghicov, A., Schmuki, P. Comm., 2007, vol. 9, pp. 2397–2402. https://doi.org/10.1016/j.elecom.2007.07.013 Berger, S., Tsuchiya, H., Schmuki, P. Mater., 2008, vol. 20, pp. 3245–3247. https://doi.org/10.1021/cm8004024 Stepanova K. V., Yakovleva N. M., Kokatev A. N., Pettersson Kh. zap. PetrGU. Seriya Estestvennye i tekhnicheskie nauki, 2015, vol. 147, no. 2, pp. 81–86. (in Russ.) Stepanova К. V., Yakovleva N. M., Kokatev А. N., Pettersson H. Journal of Surface Investigation. X-ray, Synchrotron and Neutron Techniques, 2016, vol. 10, no. 5, pp. 933– https://doi.org/10.1134/S102745101605013X Stepanova K. V. Diss. kand. tekh. nauk. Petrozavodsk, 2016, 162 p. (in Russ.) Yakovleva N. M., Kokatev A. N., Chupakhina E. A., Stepanova K. V., Yakovlev A. N., Vasil'ev S. G., Shul'ga A. M. Condensed Matter and Interphases, 2016, vol. 18, no. 1, pp. 6− URL: http://www.kcmf.vsu.ru/resources/t_18_1_2016_001.pdf (in Russ.) Kokatev A. N. Diss. kand. tekh. nauk. Petrozavodsk, 2013, 170 p. Savchenko O. I., Yakovleva N. M., Yakovlev A. N., Kokatev A. N., Pettersson Kh. Condensed Matter and Interphases, 2012, vol. 14, no. 2, pp. 243–249. URL: http://www.kcmf.vsu.ru/resources/t_14_2_2012_018.pdf (in Russ.) Canulescu S., Rechendorff K., Borca C.N., Jones N.C., Bordo K., Schou J., Pleth Nielsen L., Hoffmann S. V., Ambat R. Applied Physics Letters, 2014, vol. 104, pp. 121910(1–4). https://doi.org/10.1063/1.4866901 Chen C., Liu J., Liu P., Yu B. Advances in Chemical Engineering and Science, 2011, vol. 1, pp. 9– https://doi.org/10.4236/aces.2011.11002 Rashed M. N., El-Amin A. A. International Journal of Physical Sciences, 2007, vol. 2 (3), pp. 073–081. URL: http://www.academicjournals.org/IJPS (accessed 28.11.2018) Ivanov V. M., Tsepkov M. G., Figurovskaya V. N. Vestnik Moskovskogo universiteta. Seriya 2: Khimiya [Moscow University Chemistry Bulletin], 2010, vol. 65, 6, pp. 370-373. https://link.springer.com/article/10.3103%2FS0027131410060076 Scuderi V., Impellizzeri G., Romano L., Scuderi M., Nicotra G., Bergum K., Irrera A., Svensson B.G., Privitera V. Nanoscale Research Letters, 2014, vol. 9, pp. 458–464. https://doi.org/10.1186/1556-276x-9-458 AbdElmoula M. Dr. Philosophy. Boston, 2011, 275 р. Lee K., Mazare A., Schmuki P. Rev., 2014, vol. 114, pp. 9385–9454. https://doi.org/10.1021/cr500061m Leyens C., Peters M. Titanium and Titanium Alloys. Fundamentals and Applications. Weinheim: WILEY-VCH Verlag GmbH & Co. KGaA, 2003, 532 p.

Recenzja publikacji: B. Grochali Od Zielonego Balonika do Ani Mru Mru – kabaretowa tradycja i nowoczesność. Aspekty językowe, [w:] Tradycja a nowoczesność. Materiały z konferencji 14-16 maja 2007 roku, Łódź 2008, s. 469-478

Wyniki pochodzą z dwóch serii badań polowych przeprowadzonych w Rolniczej Stacji Doświadczalnej Zawady należącej do Akademii Podlaskiej w Siedlcach. Doświadczenia założono w układzie split-plot w trzech powtórzeniach. W latach 1999–2001 czynnikami doświadczenia były: I rzędu — sposoby odchwaszczania: 1. obiekt kontrolny — pielęgnacja mechaniczna; 2. pielęgnacja mechaniczna + Sencor 70 WG + Fusilade Super 125 EC; 3. pielęgnacja mechaniczna + Sencor 70 WG + Fusilade Super 125 EC + adiuwant Olbras 88 EC. Czynnik II rzędu — odmiany ziemniaka: Ania, Baszta i Rywal. Natomiast w latach 2002–2004 badanymi czynnikami były: I rzędu — systemy uprawy (uprawa tradycyjna i uprawa uproszczona); II rzędu — sposoby odchwaszczania: 1. obiekt kontrolny — pielęgnacja mechaniczna; 2. pielęgnacja mechaniczna + Barox 460 SL + Fusilade Forte 150 EC; 3. pielęgnacja mechaniczna + Barox 460 SL + Fusilade Forte 150 EC + adiuwant Atpolan 80 EC. Celem badań było określenie wpływu adiuwantów na ograniczenie zachwaszczenia w uprawie ziemniaka. Najbardziej efektywne w ograniczaniu zachwaszczenia zarówno w pierwszej, jak i w drugiej serii badań, okazały się warianty: 2., gdzie zastosowano mieszanki herbicydów: Sencor 70 WG + Fusilade Super 125 EC (seria pierwsza) oraz Barox 460 SL + Fusilade Forte 150 EC (seria druga) i wariant 3., gdzie zastosowano mieszanki herbicydów z dodatkiem adiuwanta: Sencor 70 WG + Fusilade Super 125 EC + Olbras 88 EC (seria pierwsza) oraz Barox 460 SL + Fusilade Forte 150 EC + Atpolan 80EC (seria druga).

Streszczenie W latach 2001-2010 produkcja oraz liczba funkcjonujących kopalń węgla kamiennego w polskim gór­nictwie węgla kamiennego uległa znacznemu zmniejszeniu. Wydobycie węgla ze 102,78 · 106 Mg ograniczono do 76,15 · 106 Mg. Eksploatacja pokładów realizowana w 43 zakładach górniczych w roku 2001, na skutek likwidacji oraz połączenia kopalń, w roku 2010 dotyczyła 29 kopalń. Liczba 30 kopalń metanowych w roku 2001, w których wydobywano węgiel na poziomie 72,37 · 106 Mg, wroku2010 wynosiła21 kopalń, produkujących 52,18 · 106Mg węgla. Pomimo spadku produkcji węgla oraz malejącej liczby kopalń w Polsce wentylacyjna emisja metanu z pro­cesów eksploatacji węgla kopalń metanowych od roku 2001 wzrosła o około 50 m3/Mg. W miarę upływu lat, wysiłki na rzecz odmetanowania niosą jednak pozytywny skutek. Pomimo wzrostu „strat" metanu w procesie odmetanowania, z roku na rok zwiększa się ilość metanu ujętego systemami odmetanowania. Z rozeznania i przeglądu literaturowego dotyczącego zagadnień związanych z emisją metanu w Polsce wynika, że w 2009 roku opublikowano Raport Krajowej Inwentaryzacji Emisji i Pochłaniania gazów ciep­larnianych za rok 2007. Z Raportu Krajowej Inwentaryzacji... wynika, że brak jest danych szczegółowych dotyczących wskaźników emisji metanu z kopalń węgla kamiennego dla polskiego górnictwa. W związku z tym, przygotowano i obliczono szczegółowo emisje metanu z kopalń metanowych w Polsce. Zastosowana metodyka szacowania metanu wykonana została dla dwóch podstawowych źródeł jego emisji. Obliczono emisję metanu w trakcie procesu eksploatacji węgla jako emisję wentylacyjną oraz emisję z układów odgazowania. Takie podejście wynikało z wytycznych IPCC z roku 2006. Aktualizacja proponowanych metod IPCC (2006) szacowania emisji metanu z układów wentylacyjnych i z układów odmetanowania kopalń węgla kamiennego (czynnych i zlikwidowanych) w Polsce polega na za­łożeniu, że wskaźnik emisji metanu (EF) obliczamy, opierając się na wydobyciu z koplań metanowych oraz rzeczywistych wielkościach metanowości bezwzględnej. Rezultat modyfikacji metody szacowania emisji metanu z procesów górniczych dla polskich metanowych koplań węgla kamiennego to równanie wskaźnika emisji metanu. W górnictwie polskim, od roku 2008 średni wskaźnik emisji z systemu węgla kamiennego utrzymuje się na stałym poziomie około 10 m3 C^/Mg. Uzyskane wyniki obliczeń emisji metanu w całym analizowanym okresie lat 2001-2010, mieszczą się w granicach 402-462 Gg (śr. 441,45 Gg).

Achenbach, R 2005. Pentateuch, Hexateuch und Enneateuch. Eine Verhältnisbestimmung, ZAR 11:122–154. Albertz, R 2007. Die kanonische Anpassung des Johuabuches. Ein Neubewertung seiner sog.”Priesterschriftelike Texte”, in Römer and Schmid 2007:199–217. Aurelius, E 2003. Zukunft jenseits des Gerichts: Eine redaktionsgeschichltliche Studie zumEnneateuch. BZAW 319. Berlin: de Gruyter. Barrick, W B & Spencer, J R (eds) 1984. In the shelter of Elyon: essays on ancient Palestinian life in honour of GW Ahlström. JSOTSup 31. Sheffield: JSOT Press. Becker U, 2006. Endredaktionelle Kontextvernetzungen des Josua-Buches, in Witte, Schmid, Prechel and Gertz 2006:139–161. Bieberstein, K 1995. Josua-Jordan-Jericho. Archäologie, Geschichte und Theologie der Landnahmeerzählungen Josua 1–6. OBO. Friborg: Universitätsverlag, Göttingen: Vandenhoeck & Ruprecht. Blum, E 1990. Studien zur Komposition des Pentateuch. BZAW 189. Berlin/New York: de Gruyter. _______ 1997. Die Kompositionelle Knoten am Übergang von Josua zu Richter: Ein Entflechtungsvorschlag, in Lust and Vervenne 1997:181–212. _______ 2006. The literary connection between the books of Genesis and Exodus and the end of the book of Joshua, in Dozeman and Schmid 2006:80–106. _______ 2011. Pentateuch-Hexateuch-Enneateuch, in Dozeman , Römer and Schmid 2011:43–71. Carr, D M 1996. Reading the fractures of Genesis. Historical and literary approaches. Louisville: Westminster John Knox. _______ 2006. What is required to identify pre-Priestly narrative connections between Genesis and Exodus? in Dozeman and Schmid 2006:159–180. _______ 2012. The Moses story: literary and historical reflections, HeBAI 1–2:7–36. Dozeman, T B & Schmid, K (eds) 2006. Farewell to the Yahwist? The composition of the Pentateuch in recent European discussion. SBL Symposium Series 34. Atlanta: SBL. Dozeman, T B, Römer, T C & Schmid, K (eds) 2011. Pentateuch, Hexateuch, or Enneateuch. Identifying literary works in Genesis through Kings. SBL 8. Atlanta: SBL. Du Pury, A, Römer, T C & Macchi, J P (eds) 2000. Israel constructs its history. Deuteronomistic historiography in recent research. Sheffield: Sheffield Academic Press. Edenburg, C & Pakkala, J (eds) 2013. Is Samuel amongst the Deuteronomists? Current views on the place of Samuel in a Deuteronomistic History. Atlanta: SBL. Eisffeldt, O 1964. Einleitung in das Alte Testament. Tübingen: Mohr. Frevel, C 2000. Mit Blick auf das Land die Schöpfung erinnern. Zum Ende der Priestergrundschrift. HBS 23. Freiburg/New York: Herder. _______ 2011. Die Wiederkehr der Hexateuchperspektive. Eine Herausforderung für die These vom Deuteronomistischen Geschictswerk, in Stipp 2011:13–53. Frey, J, Schattner-Rieser, U & Schmid, K (eds) 2012. Die Sameritaner und die Bibel: Historische und literarische Wechselwirkungen zwischen biblischen und Sameritanischen Traditionen. Studia Judaica/Studia Samaritana 7. Berlin/New York. Fritz, V 1994. Das Buch Josua. Hat 1/7. Tübingen: Mohr Siebeck. Garciá-Martinez, F (ed.) 1998. Perspectives in the study of the Old Testament and early Judaism: a symposium in honour of Adam S. van der Woude on the occasion of his 70th Birthday. VTSup 73. Leiden: Brill. Gertz, J C 2000. Tradition und Redaktion in der Exoduserzählung. Untersuchungen zur Endredaktion des Pentateuch. FRLANT 186. Göttingen: Vandenhoeck& Ruprecht. Görg, M 1991. Josua. NEB 26. Würzburg: Echter Verlag. Gunkel, H 1910. Genesis. 3rd ed. GHK 1. Göttingen: Vandenhoeck & Ruprecht. Hjelm, I 2000. The Samaritans and early Judaism: a literary analysis. JSOTSup 303. Sheffield: Sheffield Academic Press. Keel, O 1973. Das Vergaben der “Fremder” Götter in Genesis xxxv 4b, VT 23:305–336. Knauf, E A 2000. Does Deuteronomsitic Historiography (DH) exist? in du Pury , Römer and Macchi 2000:388–398. _______ 2007. Buchschlüsse im Josuabuch, in Römer and Schmid 2007:217–224. _______ 2008. Josua. ZBKAT 6. Zurich: Theologisher Verlag. Knoppers, G N & McConville, J G (eds) 2000. Reconsidering Israel and Judah: recent studies on the Deuteronomistic History. SBTS 8. Winona Lake: Eisenbrauns. Köckert, M 1988. Vätergott und Väterverheisssungen. Eine Auseinandersetzung mit Albrecht Alt und seine Erben. FRLANT 142. Göttingen: Vandenhoeck & Ruprecht. Konkel, M 2008. Sünde und Vergebung:Eine Rekontruktion der Redaktionsgeschichte der hinterein Sinaiperikope (Ex 32–34). Vor dem Hintergrund aktueller Pentateuchmodelle. FAT 88. Tübingen: Mohr. Koopmans, W T 1990. Joshua 24 as poetic narrative. JSOTSup 93. Sheffield: JSOT Press. Kratz, R G 2000. Die Komposition der erzählender Bücher des Alten Testaments: Grundwissen der Bibelkritik. UTB 215.Göttingen: Vandenhoeck & Ruprecht. Levin, C 1993. Der Jahwist. FRLANT 157.Göttingen: Vandenhoeck& Ruprecht. Lipschits, O, Knoppers, G N & Albertz, R (eds) 2007. Judah and the Judeans in the fourth century B.C.E. Winona Lake: Eisenbrauns. Lust, J & Vervenne, M (eds) 1997. Deuteronomy and Deuteronomistic literature. BETL 133. Leuven: Peeters. Mckenzie, S L & Römer, T C (eds) 2000. Rethinking the foundations: historiography in the ancient world and the Bible. Essays in honour of John Van Seters. Berlin/New York: de Gruyter. Nelson, R D 1997. Joshua: a commentary. Louisville: Westminster John Knox. Nentel, J 2000. Trägerschaft und Intentionen des deuteronomistischen Geschichtswerks: Untersuchungen zu Refelexionreden: Jos1; 23; 24; 1 Sam12 und 1 Kön 8. BZAW 297. Berlin: de Gruyter. Nihan, C 2012. The literary relationship between Deuteronomy and Joshua: a reassessment, in Schmid and Person 2012:79–114. _______ 2013. 1 Sam 8 and 12 and the Deuteronomsitic edition of Samuel, in Edenburg and Pakkala 2013: 225–274. Na`man, N 2000. The law of the altar in Deuteronomy and the cultic site near Shechem, in Mckenzie and Römer 2000:141–161. Noll, K L and Schramm, B (eds) 2010. Raising a faithful exegete: essays in honour of Richard Nelson. Winona Lake: Eisenbrauns. Noort, E 1997. The traditions of Ebal and Gerizim: theological positions in the book of Joshua, in Vervenne and Lust 1997:161–180. _______ 1998. Zu Stand und Perspektiven: Der Glaube Israels zwischen Religionsgeschichte und Theologie, der Fall Josua 24, in Garciá-Martinez 1998:82–108. Noth, M 1943. Überlieferungsgeschichtliche Studien. Tübingen: Niemeyer. _______ 1953. Das Buch Josua. 2nd ed. HAT 7. Tübingen: Mohr Siebeck. O’Brien, M A 1989. The Deuteronomistic History hypothesis: a reassessment. OBO 92. Fribourg: Éditions. Universitaires/Göttingen: Vandenhoeck& Ruprecht. Otto, E 1999. Bruckensläge in der Pentateuchsforschung, TRU 64:84–99. _______ 2000. Das Deuteronomium im Pentateuch und Hexateuch. Studien zur Literaturgeschichte von Pentateuch und Hexateuch im Lichte des Deuteronomiumrahmens. FAT 30. Tübingen: Mohr Siebeck. Otto, E & Achenbach, R (eds) 2004. Das Deuteronomium zwischen Pentateuch undDeuteronomistischem Geschictswerk. FRLANT 206. Göttingen: Vandenhoeck & Ruprecht. Perlitt, L 1968. Bundestheologie im Altes Testament. Neukirchen-Vluyn: Neukirchener Verlag. _______ 1994. Priesterschrift in Deuteronomium34? VT 59:475–494. Popovich, M 2009. Conquest of the land, loss of the land. Where does Joshua 24 belong?, in von Ruiten and de Vos 2009:87–98. Rofé, A 2000. Ephraimite versus Deuteronomistic History, in Knoppers & McConville 2000:462–474. Römer, T C 2010. Book-endings in Joshua and the question of the so-called Deuteronomistic History, in Noll and Schramm 2010:85–99. Römer, T C & Brettler, M Z 2000. Deuteronomy 34 and the case for a Persian Hexateuch, JBL 119/3:401–419. Römer, T C and Schmid, K (eds) 2007. Les dernières rédactions du Pentatueque, de l` Hexateuge,et de l` Henneatuege. BETL 203. Leuven: Peeters. Rösel, H N 1980. Die Überleitungen vom Josua-ins Richterbuch, VT 30:342–350. Schmid K, 1999. Erzväter und Exodus: Untersuchungen zur doppelten Begründing der Ursprünge Israels innerhalb der Geschichtsbücher des Alten Testaments. WMANT 81. Neukirchen-Vluyn: Neukirchener Verlag. _______ 2007. The late Persian formation of the Torah: observations on Deuteronomy 34, in Lipschits, Knoppers & Albertz 2007:236–245. _______ 2012. Die Sameritaner und die Judaër. Die biblische Diskussion um ihr Verhältnis in Josua 24, in Frey, Schattner-Rieser & Schmid 2012:21–49. Schmid, K & Person, R (eds) 2012. Deuteronomy in the Pentateuch, Hexateuch, and the Deuteronomistic History. Tübingen: Mohr Siebeck. Schmidt, L 2009. P in Deuteronomium 34, VT 59:475–494. Schmitt, G 1964. Der Landtag von Sichem. Stuttgart: Calwer Verlag. Schmitt, H C 2004. DTN 34 als Verbindingstuck zwischen Tetrateuch und Dtr. Geschictswerk, in Otto and Achenbach 2004:181–192. Smend, R 1970. Das Gesetz un die Völker, in Wolff 1970:494–504. Sperling, S D 1987. Joshua 24 re-examined. HUCA 58:119–136. Steuernage, l C 1923. Das Buch Josua. GHK 1,3 (2). Göttingen: Vandenhoeck & Ruprecht. Stipp, H J (ed.) 2011. Das deuteronomistische Geschichtswerk. ÖBS 39. Frankfurt am Main: Peter Lang. Van Seters, J 1984. Joshua 24 and the problem of tradition in the Old Testament, in Barrick and Spencer 1984:139–158. _______ 2003. Deuteronomy between Pentateuch and Deuteronomistic History, HTS 59/3:947–956. Vervenne, M & Lust, J (eds) 1997. Deuteronomy and Deuteronomistic literature. FS C.H.W Brekelmans. BETL 133. Leuven: Peeters. Von Ruiten, J and de Vos, C (eds) 2009. The land of Israel in Bible, history and theology: studies in honour of Ed Noort. VTSup 124. Leiden: Brill. Weimar, P 2008. Studien zur Priesterschrift. FAT 56. Tübingen: Mohr Siebeck. Westermann, C 1994. Die Geschictsbücher des Alten Testaments: Gab es ein deuteronomsitisches Geschichtswerk? TB Altes Testament 87. Gütersloh: Gütersloher Verlag. Witte, M 1998. Die biblische urgeschichte. Redaktions-und Theologiegeschichtliche Beobachtungen zu Genesis 1,1–11:26. BZAW 265. Berlin: de Gruyter. Witte M, Schmid K, Prechel, D & Gertz, J C (eds) 2006. Die deuteronomistischenGeschichtswerke: Redaktions- und religionsgeschichtliche Perspektiven zur “Deuteronomismus”-Diskussion in Tora und vorderen Propheten. BZAW 365. Berlin: de Gruyter. Wolff, H W (ed.) 1970. Probleme biblischer Theologie: Gerard von Rad zum 70. Geburtstag. Munich: Kaiser Verlag. Würthwein, E 1994a. Erwägungen zum sog. Deuteronomistischen Geschichtswerk: eine Skizze, in Würthwein 1994b:1–11. Würthwein, E 1994b. Studien zum deuteronomistischen Geschichtswerk BZAW227. Berlin: de Gruyter, Zakovitch, Y 1980. The object of the narrative of the burial of the foreign gods at Shechem, BeTM 25:300–337. Zenger, E 2004. Einleitung in das Alte Testament. 5th ed. Stuttgart: Kohlhammer.

Статья посвящена анализу малоизученной категории женского погребального инвентаря в могильниках мазунинского типа чегандинской культуры пьяноборской культурно-исторической общности (или мазунинской культуры, по Т.И. Останиной) – предметам кольчужного плетения. Данные изделия являются примером вторичного использования и творческого переосмысления элементов защитной экипировки воинов – кольчужных доспехов lorica hamata. Обнаружены в 97 погребальных комплексах, происходящих из 12 мазунинских могильников. Антропологические данные и сопутствующий погребальный инвентарь свидетельствуют об использовании данной категории вещей исключительно женским полом. В погребениях размещались согласно традициям мазунинского погребального обряда: найдены такие предметы в жертвенных комплексах или в составе костюма. Основное использование кольчужных изделий в женском уборе связано с накосными и нагрудными украшениями. Доступные для изучения фрагменты кольчуг из женских погребений заметно уступают по своим характеристикам целым кольчужным рубашкам мазунинских и азелинских воинов с импортным оружием. Основной массив рассматриваемых находок происходит из закрытых комплексов, которые датируются IV в. н.э. (возможно, 2-й четвертью IV – началом V в.). Близкие аналогии в использовании фрагментов кольчуг прослеживаются в германском мире. Библиографические ссылки Амброз А.К. Фибулы Юга Европейской части СССР. III в. до н. э. – IV в. н. э. / САИ. Вып. Д1-30. М.: Наука, 1966. 142 с. Арматынская О.В. Усть-Сарапульский могильник // Приуралье в древности и средние века / Отв. ред. А.А. Тронин. Устинов: Удмуртский университет, 1986. С. 26–46. Бернц В.А. К вопросу о традиционных элементах погребального обряда финно-угорского населения эпохи великого переселения народов Удмуртского Прикамья (по материалам Заборьинского грунтового могильника) // Взаимодействие народов Евразии в эпоху Великого переселения народов / Отв. ред. Р.Д. Голдина. Ижевск: УдГУ, 2006. С. 351–390. Васюткин С.М. Ангасякский могильник – ранний памятник бахмутинской культуры // Памятники эпохи средневековья в Верхнем Прикамье / Отв. ред. В.Ф. Генинг. Ижевск: УдГУ, 1980. С. 72–91. Васюткин С.М., Останина Т.И. Старо-Кабановский могильник – памятник мазунинской культуры в Северной Башкирии // Вопросы истории и культуры Удмуртии / Сост., науч. ред. Т.И. Останина. Устинов: Удмуртия, 1986. С. 64–125. Водолаго Н.В. Отчет об исследованиях Усть-Сарапульского могильника в Сарапульском районе Удмуртской АССР в 1983 году / Архив ИИКНП. Ф.2. Д. 175. Гей О.А., Бажан И.А. Хронология эпохи «готских походов» (на территории Восточной Европы и Кавказа) / Науч. ред. М.Б. Щукин. М.: Наука, 1997. 144 с. Генинг В.Ф. Азелинская культура III–V вв.: очерки истории Вятского края в эпоху переселения народов / ВАУ. Вып. 5. Ижевск, 1963. 195 с. Генинг В.Ф. Тураевский могильник V в. н.э. (захоронение военоначальников) // Из археологии Волго-Камья / Отв. ред. А.Х. Халиков. Казань: ИЯЛИ КФАН СССР, 1976. С. 67–72. Голдина Е.В., Черных Е.М. Бусы Дубровского могильника IV–V вв. в Среднем Прикамье: классификация и использование // Поволжская археология. 2017. № 1(19). С. 238−256. Голдина Р.Д. Тарасовский могильник I-V вв. на Средней Каме. Т. II / МИКВАЭ. Т. 11. Ижевск: Удмуртия, 2003. 721 с. Голдина Р.Д. Тарасовский могильник I-V вв. на Средней Каме. Т. I / МИКВАЭ. Т. 10. Ижевск: Удмуртия, 2004а. 318 с. Голдина Р.Д. Древняя и средневековая история удмуртского народа. Ижевск: Удмуртский университет, 2004б. 464 с. Голдина Р.Д., Бернц В.А. Тураевский I могильник – уникальный памятник эпохи великого переселения народов в Среднем Прикамье (бескурганная часть) // МИКВАЭ. Т. 17. Ижевск: Изд-во «Удмуртский университет», 2010. 499 с. Голдина Р.Д. Бернц В.А. Хронология женских погребений III–V вв. Тарасовского могильника // Поволжская археология. 2017. № 2(20). С. 42−72. Гопкало О.В., Тылищак В.С. Римские импорты из металла на могильнике Чернелив-Русский // Германия–Сарматия. Выпуск II / Ред. О.А. Щеглова и др. Курск; Калининград: Калининградский областной историко-художественный музей; Курский государственный областной музей археологии, 2010. С. 79–95. Гороховский Е.Л. Хронология черняховских могильников лесостепной Украины // Труды V Международного конгресса археологов-славистов / Глава ред. кол. Б.А. Рыбаков. Киев: Наукова думка, 1988. С. 34–46. Гороховский Е.Л., Кубышев А.И., Терпиловский Р.В. Украшения круга выемчатых эмалей из села Воронькив на Киевщине // Сто лет черняховской культуре / Отв. ред. М.Е. Левада. Киев: ИА НАН Украины, 1999. С. 145–149. Зыков А.П. Защитное вооружение Тарасовского могильника (шлемы и доспехи) // Археологическое наследие Урала: от первых открытий к фундаментальному научному знанию (XX Уральское археологическое совещание): Материалы Всероссийской (с международным участием) научной конференции / Отв. ред. Е.М. Черных. Ижевск: Удмуртский университет, 2016. С. 223–225. Красноперов А.А. Костюм населения чегандинской культуры в Прикамье (II в. до н. э. – V в. н. э.). Дисс… канд. ист. наук. Ижевск, 2006. 269 с. Малашев В.Ю. Периодизация ременных гарнитур позднесарматского времени // Сарматы и их соседи на Дону / Материалы и исследования по археологии Дона. Вып. 1 / Отв. ред. Ю.К. Гугуев. Ростов-на-Дону: Терра, 2000. С. 194−232. Останина Т.И. Нивский могильник // Материалы к ранней истории населения Удмуртии / Отв. ред. М.Г. Иванова. Ижевск: Удмуртия, 1978. С. 92–118. Останина Т.И. Отчет о раскопках Покровского могильника (дер. Сизяшур Мало-Пургинского района УАССР), проведенных летом 1980 года / НA БУК УР «Национальный Музей УР». № 547а. Останина Т.И. Два памятника мазунинской культуры в центральной Удмуртии // Поиски, исследования, открытия / Науч. ред. Т.И. Останина. Ижевск: Удмуртия, 1984. С. 26–92. Останина Т.И. Покровский могильник IV-V вв.. Каталог археологической коллекции. Ижевск: б/и, 1992. 93 с. Останина Т.И. Население Среднего Прикамья в III–V вв. Ижевск: УИИЯЛ УрО РАН, 1997. 327 с. Сабирова Т.М. Фибулы Среднего Прикамья первой половины I тыс. н. э. Ижевск: Шелест, 2019. 238 с. Старостин П.Н. Рождественский V могильник / Археология евразийских степей. Вып. 9. Казань: ИИ АН РТ, 2009. 144 с. Сунгатов Ф.А., Гарустович Г.И., Юсупов Р.М. Приуралье в эпоху великого переселения народов (Старо-Муштинский курганно-грунтовый могильник). Уфа: ГУП «Уфимский полиграфкомбинат», 2004. 172 с. Тагиров Ф.М. Новые исследования Ангасякского могильника // УАВ. 2007. № 6–7. С. 89–110. Черных Е.М., Хайруллина О.Ф. Боярский («Арай») могильник – новый памятник эпохи великого переселения народов в Прикамье // Археология Евразийских степей. 2018. № 1. С. 86−106. Храпунов Н.И. Изделия, сплетенные из железных колец // Боспорские исследования. 2010. № 23. С. 459–462. Шаров О.В. Хронология могильников Ружичанка, Косаново, Данчены и проблема датировки черняховской культуры // Проблемы хронологии эпохи латена и римского времени / Ред. М.Б. Щукин, О.А. Гей. СПб: Ойум, 1992. С. 158–207. Czarnecka K. The reuse of Roman military equipment in barbarian context. A chain-mail souvenir? // Journal of Roman Military Equipment Studies. 1994. Vol. 5. 245–253. James S. The excavations at Dura-Europos conducted by Yale University and the French Academy of Inscriptions and Letters 1928 to 1937. Final Report VII. The Arms and Armour and other Military Equipment. London: The British Museum Press, 2004. 304 p. Kontny B. Przeworsk culture society and its long-distance contacts, AD 1–350 // Past Societies. Vol. 4 / Ed. A. Rzeszotarska-Nowakiewicz. Warszawa: Institute of Archaeology and Ethnology, Polish Academy of Sciences, 2016. P. 164–216. Sim D., Kaminski J. Roman imperial armour: the production of early imperial military armour. Oxford: Oxbow Books, 2012. 201 p. Wijnhoven M.А. Laid out Flat: Mail Making in the Roman Period // Limes XXIII: proceedings of the 23rd International Congress of Roman Frontier Studies Ingolstadt 2015 / Eds. Sommer C. Sebastian, Matešic Suzana. Mainz: Nünnerich-Asmus Verlag, 2018. P. 555−563.

Parental Involvement in their children's schooling has long been recognized as a critical component of good education. This study aims to find out the relationship between socioeconomic status, interpersonal communication, and school climate with parental involvement in early childhood education. Using survey and correlational research design, data collection was carried out through accumulation techniques with tests and questionnaires. The data analysis technique used statistical analysis and multiple regressions. The findings in the socio-economic context of parents show that the measure of power is an indicator in the very high category with a total score of 5, while the measures of wealth, honour and knowledge are included in the high category with a total score of 4 in relation to parental involvement. The form of interpersonal communication, the openness of parents in responding happily to information / news received from schools about children is a finding of a significant relationship with parental involvement in early childhood education. The school climate describes the responsibility for their respective duties and roles, work support provided, and interpersonal communication relationships, parents at home and teachers at school. Keywords: Socio-economic Status, Interpersonal Communication, Climate School, Parental Involvement, Early Childhood Education References Amato, P. R. (2005). The Impact of Family Formation Change on the Cognitive, Social, and Emotional Well-Being of the Next Generation. The Future of Children, 15(2), 75–96. https://doi.org/10.1353/foc.2005.0012 Arnold, D. H., Zeljo, A., Doctoroff, G. L., & Ortiz, C. (2008). Parent Involvement in Preschool: Predictors and the Relation of Involvement to Preliteracy Development. School Psychology Review, 37(1), 74–90. https://doi.org/10.1080/02796015.2008.12087910 Barbato, C. A., Graham, E. E., & Perse, E. M. (1997). Interpersonal communication motives and perceptions of humor among elders. Communication Research Reports, 14(1), 48–57. https://doi.org/10.1080/08824099709388644 Barbato, C. A., Graham, E. E., & Perse, E. M. (2003). Communicating in the Family: An Examination of the Relationship of Family Communication Climate and Interpersonal Communication Motives. Journal of Family Communication, 3(3), 123–148. https://doi.org/10.1207/S15327698JFC0303_01 Barnard, W. M. (2004). Parent involvement in elementary school and educational attainment. Children and Youth Services Review, 26(1), 39–62. https://doi.org/10.1016/j.childyouth.2003.11.002 Benner, A. D., Boyle, A. E., & Sadler, S. (2016). Parental Involvement and Adolescents’ Educational Success: The Roles of Prior Achievement and Socioeconomic Status. Journal of Youth and Adolescence, 45(6), 1053–1064. https://doi.org/10.1007/s10964-016-0431-4 Berkowitz, R., Astor, R. A., Pineda, D., DePedro, K. T., Weiss, E. L., & Benbenishty, R. (2021). Parental Involvement and Perceptions of School Climate in California. Urban Education, 56(3), 393–423. https://doi.org/10.1177/0042085916685764 Berkowitz, R., Moore, H., Astor, R. A., & Benbenishty, R. (2017). A Research Synthesis of the Associations Between Socioeconomic Background, Inequality, School Climate, and Academic Achievement. Review of Educational Research, 87(2), 425–469. https://doi.org/10.3102/0034654316669821 Brand, S., Felner, R. D., Seitsinger, A., Burns, A., & Bolton, N. (2008). A large-scale study of the assessment of the social environment of middle and secondary schools: The validity and utility of teachers’ ratings of school climate, cultural pluralism, and safety problems for understanding school effects and school improvement. Journal of School Psychology, 46(5), 507–535. https://doi.org/10.1016/j.jsp.2007.12.001 Brand, S., Felner, R., Shim, M., Seitsinger, A., & Dumas, T. (2003). Middle school improvement and reform: Development and validation of a school-level assessment of climate, cultural pluralism, and school safety. Journal of Educational Psychology, 95(3), 570–588. https://doi.org/10.1037/0022-0663.95.3.570 Culp, A. M., Hubbs-Tait, L., Culp, R. E., & Starost, H.-J. (2000). Maternal Parenting Characteristics and School Involvement: Predictors of Kindergarten Cognitive Competence Among Head Start Children. Journal of Research in Childhood Education, 15(1), 5–17. https://doi.org/10.1080/02568540009594772 Dearing, E., McCartney, K., Weiss, H. B., Kreider, H., & Simpkins, S. (2004). The promotive effects of family educational involvement for low-income children’s literacy. Journal of School Psychology, 42(6), 445–460. https://doi.org/10.1016/j.jsp.2004.07.002 Desforges, C., Abouchaar, A., Great Britain, & Department for Education and Skills. (2003). The impact of parental involvement, parental support and family education on pupil achievements and adjustment: A literature review. DfES. El Nokali, N. E., Bachman, H. J., & Votruba-Drzal, E. (2010). Parent Involvement and Children’s Academic and Social Development in Elementary School: Parent Involvement, Achievement, and Social Development. Child Development, 81(3), 988–1005. https://doi.org/10.1111/j.1467-8624.2010.01447.x Englund, M. M., Luckner, A. E., Whaley, G. J. L., & Egeland, B. (2004). Children’s Achievement in Early Elementary School: Longitudinal Effects of Parental Involvement, Expectations, and Quality of Assistance. Journal of Educational Psychology, 96(4), 723–730. https://doi.org/10.1037/0022-0663.96.4.723 Epstein, J. L. (Ed.). (2002). School, family, and community partnerships: Your handbook for action (2nd ed). Corwin Press. Fan, X. (2001). Parental Involvement and Students’ Academic Achievement: A Growth Modeling Analysis. The Journal of Experimental Education, 70(1), 27–61. https://doi.org/10.1080/00220970109599497 Fan, X., & Chen, M. (2001). Parental Involvement and Students’ Academic Achievement: A Meta-Analysis. Educational Psychology Review, 23. Georgiou, S. N., & Tourva, A. (2007). Parental attributions and parental involvement. 10. Gorski, P. (2008). The Myth of the Culture of Poverty. Educational Leadership, 65(7), 32–36. Hamre, B. K., & Pianta, R. C. (2005). Can Instructional and Emotional Support in the First-Grade Classroom Make a Difference for Children at Risk of School Failure? Child Development, 76(5), 949–967. https://doi.org/10.1111/j.1467-8624.2005.00889.x Hill, N. E., & Taylor, L. C. (2004). Parental School Involvement and Children’s Academic Achievement: Pragmatics and Issues. Current Directions in Psychological Science, 13(4), 161–164. https://doi.org/10.1111/j.0963-7214.2004.00298.x Hong, S., & Ho, H.-Z. (2005). Direct and Indirect Longitudinal Effects of Parental Involvement on Student Achievement: Second-Order Latent Growth Modeling Across Ethnic Groups. 11. Hornby, G., & Lafaele, R. (2011). Barriers to parental involvement in education: An explanatory model. Educational Review, 63(1), 37–52. https://doi.org/10.1080/00131911.2010.488049 Hoy, W. K., Tarter, C. J., & Hoy, A. W. (2006). Academic Optimism of Schools: A Force for Student Achievement. American Educational Research Journal, 43(3), 425–446. https://doi.org/10.3102/00028312043003425 Jeynes, W.H. (2014). Parent involvement for urban youth and student of color. In Handbook of urban education (In H. R. Milner&K. Lomotey (Eds.)). NY: Routledge. Jeynes, William H. (2005). Effects of Parental Involvement and Family Structure on the Academic Achievement of Adolescents. Marriage & Family Review, 37(3), 99–116. https://doi.org/10.1300/J002v37n03_06 Jeynes, William H. (2007). The Relationship Between Parental Involvement and Urban Secondary School Student Academic Achievement: A Meta-Analysis. Urban Education, 42(1), 82–110. https://doi.org/10.1177/0042085906293818 Kaplan, D. S., Liu, X., & Kaplan, H. B. (2010). Influence of Parents’ Self-Feelings and Expectations on Children’s Academic Performance. 12. Kuperminc, G. P., Leadbeater, B. J., & Blatt, S. J. (2001). School Social Climate and Individual Differences in Vulnerability to Psychopathology among Middle School Students. Journal of School Psychology, 39(2), 141–159. https://doi.org/10.1016/S0022-4405(01)00059-0 Kutsyuruba, B., Klinger, D. A., & Hussain, A. (2015). Relationships among school climate, school safety, and student achievement and well-being: A review of the literature. Review of Education, 3(2), 103–135. https://doi.org/10.1002/rev3.3043 Long, H., & Pang, W. (2016). Family socioeconomic status, parental expectations, and adolescents’ academic achievements: A case of China. Educational Research and Evaluation, 22(5–6), 283–304. https://doi.org/10.1080/13803611.2016.1237369 Loukas, A. (2007). High-quality school climate is advantageous for all students and may be particularly beneficial for at-risk students. 3. Mattingly, D. J., Prislin, R., McKenzie, T. L., Rodriguez, J. L., & Kayzar, B. (2002). Evaluating Evaluations: The Case of Parent Involvement Programs. Review of Educational Research, 72(4), 549–576. https://doi.org/10.3102/00346543072004549 McWayne, C., Hampton, V., Fantuzzo, J., Cohen, H. L., & Sekino, Y. (2004). A multivariate examination of parent involvement and the social and academic competencies of urban kindergarten children. Psychology in the Schools, 41(3), 363–377. https://doi.org/10.1002/pits.10163 Miedel, W. T., & Reynolds, A. J. (1999). Parent Involvement in Early Intervention for Disadvantaged Children: Does It Matter? Journal of School Psychology, 24. N.A., A., S.A., H., A.R., A., L.N., C., & N, O. (2017). Parental Involvement in Learning Environment, Social Interaction, Communication, and Support Towards Children Excellence at School. Journal of Sustainable Development Education and Research, 1(1), 77. https://doi.org/10.17509/jsder.v1i1.6247 Poon, K. (2020). The impact of socioeconomic status on parental factors in promoting academic achievement in Chinese children. International Journal of Educational Development, 75, 102175. https://doi.org/10.1016/j.ijedudev.2020.102175 Porumbu, D., & Necşoi, D. V. (2013). Relationship between Parental Involvement/Attitude and Children’s School Achievements. Procedia - Social and Behavioral Sciences, 76, 706–710. https://doi.org/10.1016/j.sbspro.2013.04.191 Potvin, R. D. P., & Leclerc, D. (1999). Family Characteristics as Predictors of School Achievement: Parental Involvement as a Mediator. MCGILLJOURNAL OF EDUCATION, 34(2), 19. Reynolds, A. J. (1991). Early Schooling of Children at Risk. 31. Reynolds, A. J. (1992). Comparing measures of parental involvement and their effects on academic achievement. Early Childhood Research Quarterly, 7(3), 441–462. https://doi.org/10.1016/0885-2006(92)90031-S Reynolds, A. J., Ou, S.-R., & Topitzes, J. W. (2004). Paths of Effects of Early Childhood Intervention on Educational Attainment and Delinquency: A Confirmatory Analysis of the Chicago Child-Parent Centers. Child Development,75(5), 1299–1328. https://doi.org/10.1111/j.1467-8624.2004.00742.x Reynolds, A. J., Temple, J. A., Ou, S.-R., Arteaga, I. A., & White, B. A. B. (2011). School-Based Early Childhood Education and Age-28 Well-Being: Effects by Timing, Dosage, and Subgroups. 333, 6. Shute, V. J., Hansen, E. G., Underwood, J. S., & Razzouk, R. (2011). A Review of the Relationship between Parental Involvement and Secondary School Students’ Academic Achievement. Education Research International, 2011, 1–10. https://doi.org/10.1155/2011/915326 Simons-Morton, B. G., & Crump, A. D. (2003). Association of Parental Involvement and Social Competence with School Adjustment and Engagement Among Sixth Graders. 6. Steinberg, L., Lamborn, S. D., Dornbusch, S. M., & Darling, N. (1992). Impact of Parenting Practices on Adolescent Achievement: Authoritative Parenting, School Involvement, and Encouragement to Succeed. Child Development, 63(5), 1266. https://doi.org/10.2307/1131532 Sun, S., Hullman, G., & Wang, Y. (2011). Communicating in the multichannel age: Interpersonal communication motivation, interaction involvement and channel affinity. 9. Sy, S., & Schulenberg, J. (2005). Parent beliefs and children’s achievement trajectories during the transition to school in Asian American and European American families. International Journal of Behavioral Development, 29(6), 505–515. https://doi.org/10.1080/01650250500147329 Thapa, A., Cohen, J., Guffey, S., & Higgins-D’Alessandro, A. (2013). A Review of School Climate Research. 29. Turney, K., & Kao, G. (2009). Barriers to School Involvement: Are Immigrant Parents Disadvantaged? The Journal of Educational Research, 102(4), 257–271. https://doi.org/10.3200/JOER.102.4.257-271 Wong, S. W., & Hughes, J. N. (2006). Ethnicity and Language Contributions to Dimensions of Parent Involvement. School Psychology Review, 35(4), 645–662. https://doi.org/10.1080/02796015.2006.12087968

Artykuł jest próbą przyjrzenia się Partii Kobiet założonej przez pisarkę i publicystkę, Manuelę Gretkowską w 2007 z perspektywy żenującego kobiecego performansu – wystąpienia jednocześnie emancypacyjnego i budzącego konsternację wśród jego odbiorców. Przedstawiono moment powstania partii i przeanalizowano warunki społeczno-polityczne jej zaistnienia oraz trudności, które od początku napotykały działaczki organizacji. Omówiono też reakcje medialne towarzyszące tworzeniu i działalności Partii Kobiet. Autorka stawia tezę, że porażka wyborcza, jaką ostatecznie poniosła inicjatywa Manueli Gretkowskiej, związana była z dążeniem do wygaszenia żenującego performansu i pójściem na daleko idące kompromisy światopoglądowe. Dowodzi, że w przypadku Partii Kobiet ważniejszy niż program polityczny był imperatyw działania, który miał pchnąć kobiety do upolitycznienia swoich potrzeb.

e13567 Background: Breast cancer in Brazil is the most common cancer among women and is also responsible for the highest number of cancer deaths in this group. For Brazil, 66,280 new cases of breast cancer are estimated for the year 2020. This corresponds to an estimated risk of 61.61 new cases per 100 thousand women. For Espírito Santo, the estimate is 790 new cases.. Affection in women under the age of 40 is still infrequent, but it has been growing in the country with more aggressive and advanced cancer at diagnoses. It happens that in Brazil, with the publication of Ordinance 61/2015 by the Ministry of Health, the procedure became exclusive to women aged 50 to 69 years, contrary to what Federal Law 11.664 / 2008 requires, which determines the right mammography exam for all women over 40 years of age. In other words, asymptomatic women who are under 50 or over 70 years of age cannot take the exam on the public network. Methods: The data presented in this study correspond to patients diagnosed with breast cancer from 2007 to 2017 and were extracted from the database of the Hospital Cancer Registry of the Evangelical Hospital of Cachoeiro de Itapemirim (RHC / HECI) through SisRHC, a tool of management of the computerized database for Hospital Cancer Records. Results: Over the 10 years analyzed, in the south Espírito Santo region, 1,546 women started treatment for breast cancer and of these 528 were aged 49 years or less, stratified by age group: 15-24 years 9 cases (1.71%), 25-34 years 64 cases (12.13%)., 35-39 years 96 cases (18.18%), 40-44 years 156 cases (29.54%), 45-49 years. 203 cases (38.44%). A very important factor when making the diagnosis is the clinical staging (EC) of the disease, a fact that directly influences the type of treatment and the woman's survival. Of the cases analyzed, 464 had complete staging data, of these 27 (5.82%) of the cases were EC 0, EC I were 89 (19.18%), 193 (41.60%) with EC II, 122 ( 26.30%) with EC III and, finally, 33 (7.10%) in EC IV. Conclusions: In Brazil, there is a divergence between the guidance of the INCA (National Cancer Institute), an organ linked to the Ministry of Health, which recommends routine mammography after the age of 50, and the Brazilian Mastology Societies and the Brazilian College of Radiology, which indicate the exam for women over 40 years of age. In this scenario, the reduction in the supply of mammograms puts the country against the recommendations of specialists and medical societies. Mammography is a right for all Brazilian women over 40 years of age. This is the law and we need to enforce it, since the incidence of cancer cases in this age group represented one third of the cases.

1. Alivizatou, M. (2019). Digital intangible heritage: Inventories, virtual learning and participation. Heritage & Society, 12(2–3), 116–135. 2. Billett, S. (2009). Conceptualizing learning experiences: Contributions and mediations of the social, personal, and brute. Mind, Culture, and Activity, 16(1), 32–47. 3. Bonilla, C. M. (2014). Racial Counternarratives and L atina Epistemologies in Relational Organizing. Anthropology & Education Quarterly, 45(4), 391–408. 4. Britain, T. (2007). How We Are: Photographing Britain. 5. Brodie, R. J., Hollebeek, L. D., Jurić, B., & Ilić, A. (2011). Customer Engagement: Conceptual Domain, Fundamental Propositions, and Implications for Research. Journal of Service Research, 14(3), 252–271. https://doi.org/10.1177/1094670511411703 6. Budge, K. (2017). Objects in focus: Museum visitors and Instagram. Curator: The Museum Journal, 60(1), 67–85. 7. Budge, K., & Burness, A. (2018). Museum objects and Instagram: agency and communication in digital engagement. Continuum, 32(2), 137–150. 8. Callanan, M. A., & Oakes, L. M. (1992). Preschoolers’ questions and parents’ explanations: Causal thinking in everyday activity. Cognitive Development, 7(2), 213–233. 9. Callanan, M., Cervantes, C., & Loomis, M. (2011). Informal learning. Wiley Interdisciplinary Reviews: Cognitive Science, 2(6), 646–655. 10. Cameron, F. (2003). Digital Futures I: Museum collections, digital technologies, and the cultural construction of knowledge. Curator: The Museum Journal, 46(3), 325–340. 11. Cokley, J., Gilbert, L., Jovic, L., & Hanrick, P. (2016). Growth of ‘Long Tail’in Australian journalism supports new engaging approach to audiences. Continuum, 30(1), 58–74. 12. Cole, M., & Consortium, D. L. (2006). The fifth dimension: An after-school program built on diversity. Russell Sage Foundation. 13. European Commission. (2015). i-Treasures: intangible cultural heritage of the past available through advanced modern technologies. 14. Fitts, S., & McClure, G. (2015). Building Social Capital in Hightown: The Role of Confianza in L atina Immigrants’ Social Networks in the New South. Anthropology & Education Quarterly, 46(3), 295–311. 15. Francesca, P. (2017). Final Report on User Requirements: Identification and Analysis. 16. Gade, R. (2009). Event Culture - The Museum and Its Staging (Kopenhagen, 6-7 Nov 09). 17. Gibbert, M., Ruigrok, W., & Wicki, B. (2008). What passes as a rigorous case study? Strategic Management Journal, 29(13), 1465–1474. 18. Gillard, P. (2002). Cruising through history wired. Museums and the Web 2002. 19. Goodwin, M. H. (1990). He-said-she-said: Talk as social organization among black children (Vol. 618). Indiana University Press. 20. Hamma, K. (2004). The role of museums in online teaching, learning, and research. First Monday. 21. Henchman, M. (2000). Bringing the object to the viewer: Multimedia techniques for the scientific study of art. 22. Herrgott, C. (2016). Cantu in paghjella: Patrimoine Culturel Immatériel et nouvelles technologies dans le projet I-Treasures. Port Acadie: Revue Interdisciplinaire En Études Acadiennes/Port Acadie: An Interdisciplinary Review in Acadian Studies, 30, 91–113. 23. Howell, R., & Chilcott, M. (2013). A sense of place: re-purposing and impacting historical research evidence through digital heritage and interpretation practice. International Journal of Intangible Heritage, 8, 165–177. 24. King, L., Stark, J. F., & Cooke, P. (2016). Experiencing the digital world: The cultural value of digital engagement with heritage. Heritage & Society, 9(1), 76–101. 25. Lomb, N. (2009). Dip circle used to study the earth’s magnetic field at Parramatta Observatory. 26. Majors, Y. J. (2015). Shoptalk: Lessons in teaching from an African American hair salon. Teachers College Press. 27. Marty, P. F. (2008). Museum websites and museum visitors: digital museum resources and their use. Museum Management and Curatorship, 23(1), 81–99. 28. Moqtaderi, H. (2019). Citizen curators: Crowdsourcing to bridge the academic/public divide. University Museums and Collections Journal, 11(2), 204–210. 29. Müller, K. (2013). Museums and virtuality. In Museums in a digital age (pp. 295–305). Routledge. 30. Nasir, N. S., Rosebery, A. S., Warren, B., & Lee, C. D. (2006). Learning as a cultural process: Achieving equity through diversity. 31. O’Brien, H. L., & Toms, E. G. (2008). What is user engagement? A conceptual framework for defining user engagement with technology. Journal of the American Society for Information Science and Technology, 59(6), 938–955. 32. O’Neill, R. (2017). The Rise of the Citizen Curator: Participation as Curation on the Web. University of Hull. 33. Opie, I., & Opie, P. (2000). The lore and language of schoolchildren. New York Review of Books. 34. Pallud, J. (2017). Impact of interactive technologies on stimulating learning experiences in a museum. Information & Management, 54(4), 465–478. 35. Pallud, J., & Straub, D. W. (2014). Effective website design for experience-influenced environments: The case of high culture museums. Information & Management, 51(3), 359–373. 36. Pozzi, F. (2017). Final Report on User Requirements: Identification and Analysis. Unpublished I-Treasures Project Report. 37. Proctor, N. (2010). Digital: Museum as platform, curator as champion, in the age of social media. Curator: The Museum Journal, 53(1), 35. 38. Rogoff, B., Callanan, M., Gutiérrez, K. D., & Erickson, F. (2016). The organization of informal learning. Review of Research in Education, 40(1), 356–401. 39. Schugurensky, D. (2000). The forms of informal learning: Towards a conceptualization of the field. 40. Scribner, S., & Cole, M. (1973). Cognitive Consequences of Formal and Informal Education: New accommodations are needed between school-based learning and learning experiences of everyday life. Science, 182(4112), 553–559. 41. Song, M., Elias, T., Martinovic, I., Mueller-Wittig, W., & Chan, T. K. Y. (2004). Digital heritage application as an edutainment tool. Proceedings of the 2004 ACM SIGGRAPH International Conference on Virtual Reality Continuum and Its Applications in Industry, 163–167. 42. Taheri, B., Jafari, A., & O’Gorman, K. (2014). Keeping your audience: Presenting a visitor engagement scale. Tourism Management, 42, 321–329. 43. Tan, B.-K., & Rahaman, H. (2009). Virtual heritage: Reality and criticism. 44. Tarlowski, A. (2006). If it’s an animal it has axons: Experience and culture in preschool children’s reasoning about animates. Cognitive Development, 21(3), 249–265. 45. Tate. (2007). How We Are Now at Tate Britain Museum. 46. Taylor, J., & Gibson, L. K. (2017). Digitisation, digital interaction and social media: embedded barriers to democratic heritage. International Journal of Heritage Studies, 23(5), 408–420. 47. UNESCO. (2011). What is Intangible Cultural Heritage? 48. Vygotsky, L. S. (2012). Thought and language. MIT press. 49. Wenger-Trayner, E., Wenger-Trayner, B., & W.-T. (2015). Communities of practice: A brief introduction. 50. Wenger, E. (1999). Communities of practice: Learning, meaning, and identity. Cambridge university press. 51. Yin, R. K. (2009). Case study research: Design and methods (Vol. 5). sage.

O objetivo central deste artigo é tentar compreender por meio da visão dos colaboradores de uma pequena empresa de produtos ortopédicos, as suas principais percepções, relacionadas ao compartilhamento de conhecimento organizacional. O método escolhido para a pesquisa é qualitativo com a tipologia qualitativa básica. Para a análise de resultados, foi utilizada a técnica de análise temática de Braun e Clarke. Os principais resultados encontrados demonstram que o compartilhamento de conhecimento na organização é realizado por intermédio da utilização das tecnologias de comunicações comuns ao público, assim como, com a realização frequente da técnica de brainstorming, conversas rápidas e outras estratégias para resolução de problemas conforme identificados nesta pesquisa. Referências Alavi, M., & Leidn, D. E. (2001). Knowledge management and knowledge management systems: Conceptual foundations and research issues. MIS Quarterly, 25, 107–136. Allameh, S. M.; Khozani, M. K.; Baniasadi, B. (2020) Consequences of knowledge processes in small businesses: the role of knowledge acquisition, dynamic capabilities, knowledge sharing and creativity. Int. J. Process Management and Benchmarking, Vol. 10, No. 1. Braun, V.; Clarke, V. (2012) Thematic analysis. In: Cooper, H. et al. (Eds.). APA handbook of research methods in psychology, v. 2, Research designs: Quantitative, qualitative, neuropsychological, and biological. Washington, DC: American Psychological Association, v. 2 p. 57-71. Creswell, J. W. (2007) Projeto de pesquisa: Métodos qualitativo, quantitativo e misto. 2. ed. Porto Alegre: Artmed. Cummings, J. (2003) Knowledge Sharing: A Review of the Literature. Washington D. C.: The World Bank Operations Evaluation Department. Dalkir, K. (2005) Knowledge Management in Theory and Practice. Oxford, UK: Elsevier. Drucker, P. F. (1993) Sociedade Pós-Capitalista. São Paulo: Pioneira. Gold H. A.; Malhotra, A; Segars, A, H.; (2001). Knowledge management: An Organizational Capabilities Perspective. Journal of Management Information Systems, 18 (1), 185-214. Gray, C. (2006). Absorptive capacity, knowledge management and innovation in entrepreneurial small firms. International Journal of Entrepreneurial Behavior & Research, 12 (6),345-360. Harel, R.; Schwartz, D.; Kaufmann, D. (2020) Sharing knowledge processes for promoting innovation in small businesses. European Journal of Innovation Management. ISO 30401:2018. (2018) International Organization For Standardization. Knowledge Management Systems – Requirements. Genebra: ISO. Kayas, O, G.; Wright, G. (2018) Knowledge Management and Organisational Culture. The Palgrave Handbook of Knowledge Management. ISBN 978-3-319-71434-9 (eBook). Merriam, S. B. (2009) Qualitative research: a guide to design and implementation. San Francisco: Jossey-Bass/Wiley, 2009. Morgan, G. (1980) Paradigms, metaphors, and puzzle solving in organization theory. Administrative Science Quarterly, v. 25, n. 4, p. 605-622. Na Ubon, A.; Kimble, C. (2002) Knowledge Management in Online Distance Education. Proceedings of the 3rd International Conference Networked Learning, University of Sheffield, UK, pp. 465-473. Ngah e Ibrahim (2010). The Effect of Knowledge Sharing on Organizational Performance in Small and Medium Enterprises. Santos, N.; Rados, G. J. V. (2020) Fundamentos teóricos de gestão do conhecimento. E-book. – 1. ed. – Florianópolis: Pandion, 114 p. Takeuchi, H.; Nonaka, I. (2008) Criação e dialética do conhecimento. In: Takeuchi, H.; Nonaka, I. Gestão do conhecimento. Porto Alegre: Bookman. Utami, Y.; Rofik, M.; Cahyaningtyas, N. W.; Darminto, D. P. (2021). Impact of Knowledge Sharing and Innovation on Small Business Performance. CISIS 2020: Complex, Intelligent and Software Intensive Systems pp 408-411.

Pracę oparto na doświadczeniu polowym przeprowadzonym w latach 2002–2004 na glebie o składzie piasku gliniastego lekkiego. Porównywano dwa sposoby uprawy roli – tradycyjny (orka odwrotka + orka przedzimowa + bronowanie + kultywatorowanie + bronowanie) i uproszczony (orka odwrotka + kultywatorowanie) oraz siedem sposobów pielęgnacji z udziałem herbicydów (Plateen 41,5 WG, Plateen 41,5 WG + Fusilade Forte 150 EC, Plateen 41,5 WG + Fusilade Forte 150 EC + Atpolan 80 EC, Barox 460 SL, Barox 460 SL + Fusilade Forte 150 EC, Barox 460 SL + Fusilade Forte 150 EC + Atpolan 80 EC, obiekt kontrolny). Zawartość wapnia i magnezu w suchej masie chwastów przed zbiorem bulw zależała istotnie od sposobów uprawy, sposobów pielęgnacji i warunków pogodowych. Pobranie tych makroelementów przez chwasty z powierzchni 1 hektara zależało od czynników doświadczenia, biomasy chwastów i ich składu chemicznego.

The concept of plants and microbes utilization for remediation measure of pollutant contaminated soil is the newest development in term of petroleum waste management technique. The research objective was to obtain wild grass types and hydrocarbonoclastic bacteria which are capable to synergize in decreasing petroleum concentration within petroleum contaminated soil. This research was conducted by using randomized completely block design. This research was conducted by using randomized completely block design. The first factor treatments were consisted of without plant, Tridax procumbens grass and Lepironia mucronata grass. The second factor treatments were consisted of without bacterium, single bacterium of Alcaligenes faecalis, single bacterium of Pseudomonas alcaligenes, and mixed bacteria of Alcaligenes faecalis with P. alcaligenes. The results showed that mixed bacteria (A. faecalis and P. alcaligenes) were capable to increase the crown and roots dry weights of these two grasses, bacteria population, percentage of TPH (total petroleum hydrocarbon) decrease as well as TPH decrease and better pH value than that of single bacterium. The highest TPH decrease with magnitude of 70.1% was obtained on treatment of L. mucronata grass in combination with mixed bacteria.[How to Cite: Gofar N. 2013.Synergism of Wild Grass and Hydrocarbonoclastic Bacteria in Petroleum Biodegradation. J Trop Soils 18 (2): 161-168. Doi: 10.5400/jts.2013.18.2.161][Permalink/DOI: www.dx.doi.org/10.5400/jts.2013.18.2.161]REFERENCESBello YM. 2007. Biodegradation of Lagoma crude oil using pig dung. Afr J Biotechnol 6: 2821-2825.Gerhardt KE, XD Huang, BR Glick and BM Greenberg. 2009. Phytoremediation and rhizoremediation of organic soil contaminants: Potential and challenges. Plant Sci 176: 20-30.Glick BR. 2010. Using soil bacteria to facilitate phytoremediation. Biotechnol Adv 28: 367-374. Gofar N. 2011. Characterization of petroleum hydrocarbon decomposing fungi isolated from mangrove rhizosphere. J Trop Soils 16(1): 39-45. doi: 10.5400/jts.2011.16.1.39Gofar N. 2012. Aplikasi isolat bakteri hidrokarbonoklastik asal rhizosfer mangrove pada tanah tercemar minyak bumi. J Lahan Suboptimal 1: 123-129 (in Indonesian). Hong WF, IJ Farmayan, CY Dortch, SK Chiang and JL Schnoor. 2001. Environ Sci Technol 35: 1231.Khashayar T and T Mahsa. 2010. Biodegradation potential of petroleum hydrocarbons by bacterial diversity in soil. Morld App Sci J 8: 750-755.Lal B and S Khanna. 1996. Degradation of Crude Oil by Acinetobacter calcoaceticus and Alcaligenes odorans, J Appl Bacteriol 81: 355- 362.Mackova M, D Dowling and T Macek. 2006. Phytoremediation and rhizoremediation: Theoretical background. Springer, Dordrecht, Netherlands. 300 p. Malik ZA and S Ahmed. 2012. Degradation of petroleum hydrocarbons by oil field isolated bacterial consortium. Afr J Biotechnol 11: 650-658.Mendez MO and RM Maier. 2008. Phytostabilization of mine tailings in arid and semiarid environment an emerging remediation technology. Environ Health Prospect 116: 278-283.Milic JS, VP Beskoski, MV Ilic, SM Ali, GDJ Cvijovic and MM Vrvic. 2009. Bioremediation of soil heavily contaminated with crude oil and its products: composition of the microbial consortium. J Serb Chem Soc 74: 455-460.Mukre AM, AA Hamid, A Hamzah and WM Yusoff. 2008. Development of three bacteria consortium for the bioremediation of crude petroleum-oil in contaminated water. J Biol Sci 8: 73-79.Ndimele PE. 2010. A review on the phytioremediation of petroleum hydrocarbon. Pakistan J Biol Sci 12: 715-722.Newman LA and CM Reynolds. 2004. Phytoremediation of organic compounds. Curr Opin Biotechnol 15: 225-230.Onwuka F, N Nwachoko, and E Anosike. 2012. Determination of total petroleum hydrocarbon (TPH) and some cations (Na+, Ca2+ and Mg2+) in a crude oil polluted soil and possible phytoremediation by Cynodon dactylon L (Bermuda grass). J Environ Earth Sci 2: 12-17.Pezeshki SR, MW Hester, Q Lin and JA Nyman. 2000. The effect of oil spill and clean-up on dominant US Gulf Coast Marsh Macrophytes: a review. Environ Pollution 108: 129-139.Pikoli MR, P Aditiawati and DI Astuti. 2000. Isolasi bertahap dan identifikasi isolat bakteri termofilik pendegradasi minyak bumi dari sumur bangko. Laporan Penelitian pada Jurusan Biologi, ITB, Bandung (unpublished, in Indonesian).Pilon-Smits E and JL Freeman. 2006. Environmental cleanup using plants: biotechnological advances and ecological considerations. Front Ecol Environ 4: 203-10. Rahman KSM, JT Rahman, P Lakshmanaperumalsamy, and IM Banat. 2002. Towards efficient crude oil degradation by a mixed bacterial consortium. Bioresource Technol 85: 257-261.Rossiana N. 2004. Oily Sludge Bioremediation with Zeolite and Microorganism and It’s Test with Albizia Plant (Paraserianthes falcataria) L (Nielsen). Laboratory of Environmental Microbiology, Department of Biology Padjadjaran University, Bandung (unpublished).Rossiana, N. 2005. Penurunan Kandungan Logam Berat dan Pertumbuhan Tanaman Sengon (Paraserianthes falcataria L (Nielsen) Bermikoriza dalam Media Limbah Lumpur Minyak Hasil Ekstraksi. Laboratorium Mikrobiologi dan Biologi Lingkungan Jurusan Biologi Fakultas Matematika dan Ilmu Pengetahuan Alam Universitas Padjajaran, Bandung (in Indonesian).Sathishkumar M, B Arthur Raj, B Sang-Ho, and Y Sei-Eok. 2008. Biodegradation of crude oil by individual bacterial strains and a mixed bacterial consortium isolated from hydrocarbon contaminated areas clean. Ind J Biotechnol 36: 92-96.Shirdam R, AD Zand, GN Bidhendi and N Mehrdadi. 2008. Phytoremediation of hydrocarbon-contaminated soils with emphasis on effect of petroleum hydrocarbons on the growth of plant species. Phytoprotection 89: 21-29.Singer AC, DE Crowley and IP Thompson. 2003. Secondary plant metabolites in phytoremediation and biotransformation. Trends Biotechnol 21: 123-130.Singh A and OP Ward. 2004. Applied Bioremediation and Phytoremediation. Springler, Berlin, 281p.Surtikanti H and W Surakusumah. 2004. Peranan Tanaman dalam Proses Bioremediasi Oli Bekas dalam Tanah Tercemar. Ekol Biodivers Trop 2: 48-52 (in Indonesian).Wenzel WW. 2009. Rhizosphere processes and management in plant-assisted bioremediation (phytoremediation) of soil. Plant Soil 321: 385-408.Widjajanti H, I Anas, N Gofar and MR Ridho. 2010. Screening of petroleum hydrocarbons degrading bacteria as a bioremediating agents from mangrove areas. Proceeding of International Seminar, workshop on integrated lowland development and management, pp. C7 1-9.Widjajanti H. 2012. Bioremediasi Minyak Bumi Menggunakan Bakteri dan Kapang Hidrokarbonoklastik dari Kawasan Mangrove Tercemar Minyak Bumi. [Disertasi]. Universitas Sriwijaya (in Indonesian).

W latach 2002–2004 prowadzono badania nad wpływem sposobów uprawy roli i niektórych herbicydów i ich mieszanin (Plateen 41,5 WG, Plateen 41,5 WG + Fusilade Forte 150 EC, Plateen 41,5 WG + Fusilade Forte 150 EC + Atpolan 80 EC, Barox 460 SL, Barox 460 SL + Fusilade Forte 150 EC, Barox 460 SL + Fusilade Forte 150 EC + Atpolan 80 EC) na porażenie bulw ziemniaka odmiany Wiking przez Rhizoctonia solani. Oceniano: procent bulw porażonych, średni stopień porażenia próby i średni stopień porażenia bulw porażonych. Uzyskane wyniki wykazały, że zastosowanie uprawy uproszczonej (dwa zabiegi uprawowe) w porównaniu z tradycyjną (pięć zabiegów uprawowych) istotnie ograniczało stopień porażenia bulw przez rizoktoniozę. Warunki meteorologiczne panujące w okresie wegetacji były zróżnicowane i wpłynęły na intensywność porażenia bulw przez ocenianą chorobę. Herbicydy nie wpłynęły istotnie na porażenie bulw rizoktoniozą.

The aim of the present study was to evaluate the protective effects of linseed oil on lipid peroxidation, antioxidative capacity, as well as serum glucose, total cholesterol (TC), LDL-C and TG levels, in cafeteria-diet-fed dams during gestation and lactation, and in their offspring throughout adulthood. Food and energy intakes were also evaluated. The cafeteria diet led to higher energy intake, body weight, hyperglycemia and hyperlipidemia (higher TC, LDL-C and TG) in dams’ rats and their pups. Plasma vitamin C, Erythrocyte GSH levels and catalase activity were lower, whereas plasma diene conjugates (DC), Malondialdehyde and protein carbonyl levels (PC) in plasma and erythrocytes were higher in cafeteria-diet-fed mothers and their pups compared to controls. Supplement of linseed oil significantly enhanced plasma antioxidant defense capacities, as evaluated by the marked increase in the levels of plasma vitamin C and erythrocyte GSH as well as the activities of CAT and the significant reduction in lipid peroxidation (lower DC and MDA) and PC in CAFL-diet-fed mothers and their offspring. Simultaneous intake of linseed oil also reduced body weight, plasma TG, TC and LDL-C contents in obese pregnant and lactating dams and their pups at day 30 and day 90. The flaxseed oil supplementation may prevent lipid peroxidation and metabolic disorders which might be helpful in preventing obesity complications in mothers during pregnancy and lactation and in their offspring. REFERENCES:Adeoye, O., Olawumi, J., Opeyemi, A., & Christiania, O. (2016). Review on the role ofglutathione on oxidative stress and infertility. JBRA Assisted Reproduction, 22(1), 61-66.Aebi, H. (1974). Catalase. In Methods of Enzymatic Analysis, 2nd edn, vol. 2 (Bergmeyer, H.U., ed.), pp. 673–684, Verlag Chemie, WeinheimAmbrozova, G., Pekarova, M., & Lojek, A. (2010). Effect of polyunsaturated fatty acids onthe reactive oxygen and nitrogen species production by raw 264.7 macrophages.European Journal of Nutrition, 49,133–139.Ayad, A., Merzouk, H., Merzouk, S.A., & Narce, M. (2013). Blood Oxidant/AntioxidantStatus in overfed Aging Rats: Comparative Effects of Sunflower and Olive-LinseedMixture Oil Rich Diets. Biomedical and Environmental Sciences, 9, 765–768Benkalfat, N.B, Merzouk, H., Bouanane, S., Merzouk, S.A., Bellenger, J., Gresti, J., Tessie,C., & Narce, M. (2011). Altered adipose tissue metabolism in offspring of dietary obeserat dams. Clinical Science, 121, 19–28.Bouanane, S., Benkalfat, N.B., Baba Ahmed, F.Z., Merzouk, H., Soulimane Mokhtari, N.,Merzouk, S., Gresti, J., Tessier, C., & Narce M. (2009). Time course of changes in serum oxidant/antioxidant status in overfed obese rats and their offspring. ClinicalScience, 116, 669–680.Bradlee, M.L, Singer, M.R, Qureshi, M.M, & Moore, L.L. (2010). Food group intake andcentral obesity among children and adolescents in the Third National Health andNutrition Examination Survey (NHANES III). Public Health Nutrition, 22, 1–9.Cetin, I., Alvino, G., & Cardellicchio, M. (2009). Long chain fatty acids and dietary fats infetal nutrition. Journal of Physiology, 14, 3441–3451.Catalano, PM., & Shankar, K. (2017). Obesity and pregnancy: Mechanisms of short term andlong term adverse consequences of mother and child. British Medical Journal, 8, 356.D’Archivio, M., Annuzzi, G., Varì, R., Filesi, C., Giacco, R., Scazzocchio, B., Santangelo, C.,Giovannini, C., Rivellese, A.A., & Masella, R. (2012). Predominant role ofobesity/insulin resistance in oxidative stress development. European Journal ofClinical Investigation, 42, 70–78.Denisenko, Y.K., & Novgorodtseva, T.P. (2013). Effect of Prolonged High-Fat Diet onThiol-Disulfide Homeostasis in Rats. International Journal of BioMedicine, 3, 197–200.Duttaroy, A.K. (2009). Transport of fatty acids across the human placenta. Progress in LipidResearch, 48, 52–61.Falcone, V., Stopp, T., Feichtinger, M ., Kiss,H., Eppel,W., Husslein,PW., Prager,G., & Göbl,CS. (2018). Pregnancy after bariatric surgery: a narrative literature review anddiscussion of impact on pregnancy management and outcome. BMC PregnancyChildbirth, 18, 507.Fang, Y.Z., Yang, S., & Wu, G. (2002). Free radicals, antioxidants, and nutrition.Nutrition,18, 872– 879.Galtier-Dereure, F., Boegner, C., & Bringer J. (2000). Obesity and pregnancy: complicationsand cost. American Journal of Clinical Nutrition, 71, 1242–1248Goutzourelas, N., Orfanou, M., Charizanis, I., Leon, G., Spandidos, DA., Kouretas, D. (2018).GSH levels affect weight loss in individuals with metabolic syndrome and obesityfollowing dietary therapy. Experimental and Therapeutic Medicine, 16(2), 635-642.Haggarty, P. (2002). Placental regulation of fatty acid delivery and its effect on fetal Growth- a review. Placenta, 23, 28–38.Havel, R.J, Eder, H.A., & Bragdon, J.H. (1955). The distribution and chemical compositionof ultra centrifugally separated lipoproteins in human serum. Journal of ClinicalInvestigation, 34, 1345–1353Khan, N.I, Naz, L., & Yasmeen, G. (2006). Obesity: an independent risk factor for systemicoxidative stress. Pakistan Journal of Pharmaceutical Sciences, 19, 62–65Laissouf, A., Mokhtari-Soulimane, N., Merzouk, H., & Benhabib, N. (2013). Dietary flaxseedoil supplementation improves the oxidant/antioxidant status in obese aged rats.International Journal of Medicine and Pharmaceutical Sciences, 2, 87–94.Levine, R.L, Garland, D., Oliver, C.N., Amici, A., Climent, I., Lenz, A.G., Ahn, B.W.,Shaltiel, S., & Stadtman, E.R. (1990). Determination of carbonyl content in oxidativelymodified proteins. Methods in Enzymology, 186, 464–478Jones, M.L., Mark, P.J., Mori, T.A., & Keelan, J.A., Waddell, B.J. (2013). Maternal dietaryomega-3 fatty acid supplementation reduces placental oxidative stress and increasesfetal and placental growth in the rat. Biology of Reproduction, 88 (2):1–8.Meghelli-Bouchenak, M., Boquillon, M., & Belleville., J. (1989). Serum lipoproteincomposition and amounts during the consumption of two different low protein dietsfollowed by a balanced diet. Nutrition Reports International, 39, 323–34.Moll, U., Olsson, H., & Landin-Olsson, M. (2017). Impact of Pregestational Weight andWeight Gain during Pregnancy on Long-Term Risk for Diseases. PLOS One, 3, 12(1). Ohkawa, H., Ohishi, N., & Yagi, K. (1979). Assay for lipid peroxides in animal tissues bythiobarbituric acid reaction. Analytical Biochemistry, 95, 351–351.Oken, E., Ning, Y., Rifas-Shiman, S.L., Rich-Edwards, J.W., Olsen, S.F., & Gillman, M.W.(2007). Diet during pregnancy and risk of preeclampsia or gestational hypertension.Annals of Epidemiology, 17, 663-668.Rasmy, G.E. (2007). Protective effect of linseed oil on hyperlipidemia in experimentalanimals. Journal of Genetic Engineering and Biotechnology, 5, 9–17.Redgrave, T.G, Robert, D.C.K, & West, C.E. (1975). Separation of plasma lipoproteins bydensity-gradient ultracentrifugation. Analytical Biochemistry, 65, 42–49Rezaei, A., & Heidarian, E. (2013). Co-administration of trientine and flaxseed oil onoxidative stress, serum lipids and heart structure in diabetic rats. Indian Journal ofExperimental Biology, 51,646–652.Roe, J.H, & Kuether, C.A. (1943). The determination of ascorbic acid in whole blood andurine through the 2,4- dinitrophenylhydrazine derivatives of dehydroascorbic acid.Journal of Biological Chemistry,14, 399–407.Ross, S.R., Lexin, W., & Herbert, J. (2007). Erythrocyte Oxidative Damage in ChronicFatigue Syndrome. Archives of Medical Research, 38, 94–98.Savini, I., Catani, M.V., Evangelista, D., Gasperi, V., & Avigliano, L. (2013). ObesityAssociated Oxidative Stress: Strategies Finalized to Improve Redox State. InternationalJournal of Molecular Sciences, 14, 10497–10538.Sen, S., & Simmons, R.A. (2010). Maternal Antioxidant Supplementation Prevents Adiposityin the Offspring of Western Diet–Fed Rats. Diabetes, 59, 3058–3065.Simko, M., Totka, A., Vondrova, D., Samohyl, M., Jurkovicova, J., Trnka, M., Cibulkova, A.,Stofko, J., & Argalasova, L. (2019). Maternal Body Mass Index and Gestational WeightGain and Their Association with Pregnancy Complications and Perinatal Conditions.International Journal of Environmental Research and Public Health,16 (10), 1751.Song, J.H., Fujimoto, K., & Miyazawa, T. (2000). Polyunsaturated (n-3) Fatty AcidsSusceptible to Peroxidation Are Increased in Plasma and Tissue Lipids of Rats FedDocosahexaenoic Acid Containing Oils. Journal of Nutrition, 130, 3028–3033.Tang, Z., Ying, R.F., Lv, B.F., Yang, L.H., Xu, Z., Yan, L.Q ., Bu, J.Z., & Wei, Y.S. (2021).Flaxseed oil: Extraction, Health benefits and products. Quality Assurance and Safety ofCrops & Foods, 13(1), 1-19.Tran, B., Oliver, S., Rosa, J., & Galassetti, P. (2012). Aspects of inflammation and oxidativestress in pediatric obesity and type 1 diabetes: An overview of ten years of studies.Experimental Diabetes Research, 683–680.Vincent, H.K., & Taylor, A.G. (2006). Biomarkers and potential mechanisms of obesityinduced oxidant stress in humans. International Journal of Obesity, 30,400–418Whitaker, R.C. (2004) Predicting preschooler obesity at birth: the role of maternal obesity inearly pregnancy. Pediatrics, 114, 29–36Xu, J., Gao, H., Song, L., Yang, W., Chen, C., Deng, Q., Huang, Q., Yang, J., & Huang, F.(2013). Flaxseed oil and alpha-lipoic acid combination ameliorates hepatic oxidativestress and lipid accumulation in comparison to lard. Lipids in Health and Disease,12, 581–7Xu, J., Yang, W., Deng, Q., Huang, Q., Yang, J, & Huang, F. (2012). Flaxseed oil and αlipoic acid combination reduces atherosclerosis risk factors in rats fed a high-fat diet.Lipids in Health and Disease, 11,148–155Yagi, K. (1987). Lipid peroxides and human diseases. chemistry physics lipids, 45, 337–51.Yanes, O., Clark, J., Wong, D.M., Patti, G.J., Sanchez-Ruiz, A., Benton, H.P.0, Trauger, S.A.,Desponts, C., Ding, S., & Siuzdak, G. (2010) Metabolic oxidation regulates embryonicstem cell differentiation. Nature Chemical Biology, 6, 411–41 Yang, W., Fu, J., Yu, M., Huang, Q., Wang, D., Xu, J., Deng, Q., Yao, P., Huang, F., & Liu,L. (2012). Effects of flaxseed oil on anti-oxidative system and membrane deformationof human peripheral blood erythrocytes in high glucose level. Lipids in Health andDisease, 11, 88.Yessoufou, A., Soulimane, N., Merzouk, S., Moutairou, K., Ahissou, H., Prost, J., Simonin,AM., Merzouk, H., Hichami, A., & Khan, N.A. (2006). N-3 Fatty acids modulateantioxidant status in diabetic rats and their macrosomic offspring. International Journalof Obesity, 30, 739–750.

In this article, reflectivity is considered as an individual general ability to develop different attitudes to life events in order to reduce an external and internal uncertainty in situations. The objective of the research is to examine the self-assessment criteria for reflectivity with psychosemantic procedure. The author designs a modified version of the Ch. Osgood’s (1957) Semantic Differential (SD) for examining the content and formal features of the self-assessment criteria of reflectivity. This study suggests two main processes of self-assessment of reflectivity, notably differentiation and integration. The results of factor analysis indicate that individuals with high reflectivity level are aligned with low differentiation of the semantic space and monolithic nature of self-assessment criteria. The coherence and consistency of self-assessment criteria reduce the individuals’ level of inner uncertainty, transform external problems to familiar tasks and increase an efficient decision-making. A high level of differentiation is related to individual readiness to make a correct decision in the situation of multiple choice. High differentiation increases the individual adjustment and prevents from poor effects of high reflectivity. Consequently, a high level of reflectivity is associated with a low level of differentiation of self-assessment criteria. References Грановская Р.М. Психология веры. Санкт-Петербург: Питер, 2010. Карпов А.В. Психология рефлексивных механизмов деятельности. Москва: Изд-во «Институт психологии РАН», 2004. Карпов А.В., Пономарева В.В. Психология рефлексивных механизмов управ­ления. М.: Изд­во ИП РАН, 2000. Лактионов А.Н. Координаты индивидуального опыта. Харьков: Харьк. нац. ун-т им. В. Каразина, 2010. Леонтьев Д.А. Психологические ресурсы преодоления стрессовых ситуаций: к уточнению базовых конструктов. Психология стресса и совладающего поведения в современном российском обществе: Материалы II Междун. научно-практич. конференции. Кострома: КГУ им. Н.А. Некрасова, 2010, 2, 40–42. Леонтьев Д.А., Аверина А.Ж. Феномен рефлексии в контексте проблемы саморегуляции. Психологические исследования. 2011. №2(16). Режим доступа: http://psystudy.ru/index.php/num/2011n2-16/463-leontiev-averina16.html. Петренко В.Ф. Основы психосемантики. Москва: Эксмо, 2010. Похилько В. И., Федотова Е.О. Техника репертуарных решеток в экспериментальной психологии личности. Вопросы психологии, 1984. № 3, 151–157. Проблемы психологической герменевтики / Под ред. Н.В. Чепелевой. Киев : Изд-во Национального педагогического университета им. Н. П. Драгоманова, 2009. Савченко О.В. Рефлексивна компетентність особистості. Херсон : ПП Вишемирський В. С., 2016 Савченко О. Структура семантичного простору, що відображає уявлення суб’єкта про власну рефлексивну активність // East European Journal of Psycholinguistics. 2015. Т. 2 (1), 114–123. Чуприкова Н.И. Психология умственного развития: Принцип дифференциации. Москва : АО «Столетие», 1997. Gawronski, B. & Bodenhausen, G. (2006). Associative and propositional processes in evaluation: An integrative review of implicit and explicit attitude change. Psychological Bulletin, 132(5), 692-731. Halpern, D. F. (2001). Assessing the Effectiveness of Critical Thinking Instruction. The Journal of General Education, 50(4), 270–286. Harvey, O.J., Hunt, D. E., & Schroder, H. M. (1961). Conceptual System and Personality Organization. New York: Wiley & Sons. Janzen, G. (2006). The Representational Theory of Phenomenal Character: A Phenomenological Critique. Phenomenology and the Cognitive Sciences, 5, 321–339 [in English]. Kriegel, U. (2003). Consciousness as Intransitive Self-Consciousness: Two views. Canadian Journal of Philosophy, 33, 103-132. Lieberman, M. D., Gaunt, R., Gilbert, D. T., & Trope, Y. (2002). Reflexion and reflection: A social cognitive neuroscience approach to attributional inference. In Advances in experimental social psychology (Vol. 34, pp. 199-249). Academic Press. Nolen-Hoeksema, S., Wisco, B. E., & Lyubomirsky, S. (2008). Rethinking rumination. Perspectives on Psychological Science, 3(5), 400–424. Peters, F. (2013). Theories of consciousness as reflexivity. The Philosophical Forum, 44, 341-372. Savchenko O. (2016b) The formation level of the components of the reflective experience as a factor of the students` educational success. Psychological Prospects, 28, 269-282. References (translated and transliterated) Granovskaya, R. M. (2010). Psihologiya Very [Psychology of Faith]. S.-Petersburg: Piter. Karpov, A. V. (2004). Psihologiya Refleksivnyh Mehanizmov Deyatelnosti [Psychology of Reflective Activity Mechanisms]. Moscow: Institute of Psychology of the Russian Academy of Sciences. Karpov, A. V., Ponomareva, V. V. (2000). Psihologiya Refleksivnyh Mehanizmov Upravleniya [Psychology of Reflective Management Mechanisms]. Moscow: Institute of Psychology of the Russian Academy of Sciences. Laktionov, A.N. (2010). Koordinaty Individualnogo Opyta [Coordinates of Individual Experience]. Kharkiv: Karazin National University of Kharkiv. Leontyev, D. A. (2010). Psihologicheskie resursyi preodoleniya stressovyih situatsiy: k utochneniyu bazovyih konstruktov [Psychological resources of stressful situations overcoming: to clarify the basic constructs]. Psychology of Stress and Coping Behavior in Modern Russian Society. Book of Abstracts of the 2nd International Scientific and Applied Conference, 2. Kostroma: Nekrasov Kostroma State University. (40-42). Leontyev, D.A., Averina, A. Zh. (2011). Fenomen refleksii v kontekste problemyi samoregulyatsii [The phenomenon of reflection in the context of the problem of self-regulation]. Psihologicheskie Issledovaniya, 2(16). Retrieved from http://psystudy.ru/index.php/num/2011n2-16/463-leontiev-averina16.html. Petrenko, V.F. (2010). Osnovyi Psihosemantiki [Fundamentals of Psychosemantics]. Moscow: Eksmo. Pohilko, V. I., Fedotova, E. O. (1984). Tehnika repertuarnyih reshetok v eksperimentalnoy psihologii lichnosti [Repertory grid technique in experimental psychology of personality.]. Voprosy Psihologii, 3, 151–157. Chepeleva, N. V. (Ed.). (2009). Problemy Psihologicheskoy Germenevtiki [Issues of Psychological Hermeneutics]. Kyiv: Drahomanov National Pedagogical University. Savchenko, O.V. (2016a). Refleksyvna Kompetentnist Osobystosti [Personality`s Reflective Competence]. Kherson: Vyshemyrskyi. Savchenko, O. (2015). Struktura semantychnoho prostoru, shcho vidobrazhaie uiavlennia subyekta pro vlasnu refleksyvnu aktyvnist [The Semantic space structure of the subject’s sonception of his own mental activity]. East European Journal of Psycholinguistics, 2(1), 114–123. Chuprikova, N. I. (1997). Psihologiya Umstvennogo Razvitiya: Printsip Differentsiatsii [Psychology of Mental Development: The Principle of Differentiation.]. Moscow: Stoletiye. Gawronski, B. & Bodenhausen, G.V. (2006). Associative and propositional processes in evaluation: An integrative review of implicit and explicit attitude change. Psychological Bulletin, 132(5), 692-731. Halpern, D. F. (2001). Assessing the effectiveness of critical thinking instruction. The Journal of General Education, 50(4), 270–286. Harvey, O.J., Hunt, D. E., & Schroder, H. M. (1961). Conceptual System and Personality Organization. New York: Wiley & Sons. Janzen, G. (2006). The Representational Theory of Phenomenal Character: A Phenomenological Critique. Phenomenology and the Cognitive Sciences, 5, 321–339. Kriegel, U. (2003). Consciousness as Intransitive Self-Consciousness: Two views. Canadian Journal of Philosophy, 33, 103-132. Lieberman, M. D., Gaunt, R., Gilbert, D. T., & Trope, Y. (2002). Reflexion and reflection: A social cognitive neuroscience approach to attributional inference. In M. P. Zanna (Ed.), Advances in experimental social psychology, 34 (pp. 199–249). Academic Press. Nolen-Hoeksema, S., Wisco, B. E., & Lyubomirsky, S. (2008). Rethinking rumination. Perspectives on Psychological Science, 3(5), 400–424. Peters, F. (2013). Theories of consciousness as reflexivity. The Philosophical Forum, 44, 341-372. Savchenko O. (2016b) The formation level of the components of the reflective experience as a factor of the students` educational success. Psychological Prospects, 28, 269-282.

Esta investigación se planteó la extracción de manteca a partir de almendras infestadas al 25% con monilla (Moniliophthora roreri Cif & Par.). Se aplicó un diseño completamente al azar con cinco tratamientos y cuatro repeticiones, para la diferenciación entre medias se empleó el test Tukey y para el análisis sensorial el test de Kruscal Wallis. Respecto a los resultados, en el rendimiento de manteca extraída en pasta (g/kg), no existieron diferencias. En cuanto a variables físico-químicas el mejor tratamiento fue T3(CCAT-46-88) con 81,88% de grasa, 1.03% en proteína, 807,80 Kcal/100g de energía y 0,22% de índice de acidez. En el contenido de humedad destacó el testigo (EET-103) con 0.07%. Por otro lado, T4 (CCAT-49-98) presentó el mejor registro de materia seca (99,83%) y carbohidratos (9,52%). Mientras que en contenido de ceniza no existieron diferencias. Finalmente, el análisis sensorial demostró que T1 (CCAT-46-57) obtuvo el mejor perfil sensorial. Palabras Clave: análisis sensorial, análisis físico-químicos, cacao, rendimiento. Referencias [1]Wil, «Agropecuarios.net,» 29 Septiembre 2013. [En línea]. Disponible en: http://agropecuarios.net/enfermedades-del-cultivo-de-cacao.html. [Último acceso: 27 Septiembre 2017]. [2]M. Bernal, «Hongo monilla, 1ª causa en pérdida de cacao, dice experto,» Julio 2011. [3]F. Sánchez y F. Gárces, «Moniliophtera roreri (Cif y Par) Evans et al. en el cultivo de cacao,» Scientia Agropecuaria, vol. 3, nº 3, Agosto 2012. [4]S. Ramírez, «La moniliasis un desafio para lograr la sostenibilidad del sistema cacao en México,» Tecnología en Marcha, vol. 21, nº 1, pp. 97-110, Marzo 2008. [5]M. Codini, F. Díaz, M. Ghirardi y I. Villavicencio, «Obtención y utilizacion de la manteca de cacao,» Invenio, vol. 7, nº 12, Junio 2004. [6]A. Casanova, J. Rafael, P. Parrales y V. Katherine, «Obtención de la manteca de cacao a partir de semillas de cacao (Theobroma cacao L.), usando extracción supercrítica y extracción convencional.,» Caracas, 2008. [7]DDL, «Especificaciones técnicas, manteca vegetal de palma,» 2005. [8]FAO, «Codex Standard for cocoa butter,» Codex Stan 86, 2001. [9]M. Bernal, «Monilla, problema que afecta al cacao,» El Universo, 24 Abril 2010. [10]M. Lucero, «Caracterización de la manteca de cacao de tres variedades Trinitario (CCN-51), Nacional (EET-103) Y Forastero (IMC-67), Quevedo - Ecuador,» Quevedo, 2014. [11]A. Sánchez, J. Naranjo, V. Córdoba, D. Ávalos y J. Zaldívar, «Caracterización bromatológica de los productos derivados de cacao (Theobroma cacao L.) en la Chontalpa, Tabasco, México,» Revista Mexicana de Ciencias Agrícolas, nº 14, pp. 2817-2830, 2016. [12]M. Egas, «Evaluación y análisis técnico financiero del proceso de prensado de licor de cacao (Theobroma cacao) para la obtención de manteca y polvo de cacao.,» Quito, 2015. [13]M. Jahurul, I. Zaidul, N. Norulaini, F. Sahena, J. Jaffri y A. Omar, «Supercritical carbon dioxide extraction and studies of mango seed kernel for cocoa butter analogy fats,» CyTA- Journal of Food, vol. 12, nº 1, pp. 97-103, 2014. [14]A. Solís, «Elaboración de mantequilla de maní (Arachis hypogaea) variedad virginia con adición parcial de manteca de palma,» Tingo María, 2003. [15]E. Bejarano, M. Bravo, M. Huamán, C. Huapaya, A. Roca y E. Rojas, Tablas de composición de alimentos industrializados, L. Lecca, Ed., Lima, 2002, p. 56. [16]Fundación Universitaria Iberoamericana, n. [En línea]. Disponible en: https://www.composicionnutricional.com/alimentos/MANTECA-DE-CACAHUETE-1. [17]«Botanical Online,» 2014. [En línea]. Disponible en: http://www.botanical-online.com/tabladecalorias.htm. [Último acceso: 25 Noviembre 2018]. [18]«Alimentación sana,» Tabla de calorías, 2013. [En línea]. Disponible en: http://www.alimentacionsana.org/PortalNuevo/actualizaciones/tabladecalorias.htm. [Último acceso: 25 Noviembre 2018]. [19]S. Zuriday, «Extraccion de manteca a partir de las semillas del cacao (Theobroma cacao L.) utilizando dioxido de carbono en condiciones supercríticas como solvente,» Caracas, 2007. [20]R. Cuamba, «Caracterización de grasas alternativas de la manteca de cacao,» México D.F., 2008. [21]C. Arriaga, «Contenido de Ácidos Grasos de la manteca provinientes de mezclas, en distintas fracciones,de semillas de Theobroma cacao y Theibroma bicolor y su uso en la manufactura de chocolate.,» Guatemala, 2007. [22]S. Lannes, M. Medeiros y L. Gioielli, «Physical interactions between cupuassu and cocoa fats,» Grasas y Aceites, vol. 62, nº 4, pp. 467-478, 2011.

W okresie kryzysu ekonomicznego nastąpił spadek tempa wzrostu przyjazdów turystówzagranicznych, zarówno na świecie (np. w okresie 2008–2009 liczba przyjazdów turystów zagranicznychspadła z 919 do 880 mln), jak i w Unii Europejskiej (spadek z 486 do 462 mln). Celem niniejszegoartykułu jest ukazanie wpływu światowego kryzysu ekonomicznego na natężenie i przestrzenne zróżnicowaniemiędzynarodowego ruchu turystycznego do krajów Unii Europejskiej na początku XXI wieku,ze szczególnym uwzględnieniem lat 2007–2011. Przeanalizowano przyjazdy turystów zagranicznychdo Unii Europejskiej i jej wybranych krajów, generujących największy ruch przyjazdowy, oraz omówionozmiany w strukturze tych przyjazdów. Przedstawiono także zróżnicowanie wpływów z turystykimiędzynarodowej wybranych krajów UE w badanym okresie. Na ruch turystyczny wpływają takżeprzemiany demograficzne, zwłaszcza proces starzenia się ludności. W związku z tym przebadano równieżzróżnicowanie ruchu turystycznego i wydatków na turystykę zagraniczną według wieku.

Sob o viés metodológico da etnossociologia clínica (ANDRADE, 2019), este artigo analisa narrativas de vida coletadas em uma disciplina de estágio de observação do curso de Letras: Língua Portuguesa da Universidade Federal do Ceará. Em vista da impossibilidade das aulas presenciais, por conta da pandemia de Covid-19, as práticas de formação docente tiveram que ser repensadas. Nesse contexto, as narrativas de vida surgem como catalisadoras de experiências, permitindo ao professor em formação reconfigurar saberes e conhecimentos adquiridos em seu itinerário, (res)significando concepções de linguagem. Assim, as narrativas de vida podem se tornar um produtivo meio de prática (auto)(trans)formativa. O estudo se abaliza nos postulados teóricos de Koch (2013), Geraldi (2011) e Volóchinov (2018) sobre concepções de linguagem, e em Andrade, Lima e Serra (2020a, 2020b), Kleiman (2008), Josso (2004), Ribeiro (2008), Signorini (2006) e Delory-Momberger (2008) sobre a possibilidade (auto)(trans)formativa das narrativas de vida. Os resultados apontam que os professores em formação afirmam ter experienciado o ensino de língua sob o prisma da linguagem como expressão do pensamento e/ou instrumento de comunicação, desejando, por isso, quando em exercício de sua docência, efetivarem práticas mais afeitas à perspectiva sociointeracional, utilizando o potencial reflexivo dos planos de aula, amparados na metodologia sequência didática.Referências:ANDRADE, F. R. da S. Autoconceitos de leitura erigidos a partir de narrativas de vida de professores alfabetizadores. 2019. 192 f. – Dissertação (Mestrado) – Universidade Federal do Ceará, Departamento de Letras Vernáculas, Programa de Pós-graduação em Linguística, Fortaleza, 2019.ANDRADE, F. R. da S.; LIMA, P. S. R. de; SERRA, D. G. A ressignificação do ensino de leitura propiciada pela formação docente: um estudo de caso a partir de narrativas de vida. Fólio - Revista de Letras, v. 12, n. 1, p. 441-463, jan./jul. 2020.ANDRADE, F. R. da S.; LIMA, P. S. R. de; SERRA, D. G. A narrativa de vida como construtora das concepções docentes de leitura: um estudo de casa. Letra Magna, v. 16, n. 25, p. 1-21, jan./jun. 2020.BRASIL. Ministério da Educação. Parâmetros Curriculares Nacionais: 3º e 4º ciclos do Ensino Fundamental: Língua Portuguesa. Brasília/DF: MEC/SEF, 1998.BRASIL. Ministério da Educação. Base nacional comum curricular. Brasília/DF: MEC/SEF, 2018.CAVALCANTE, M. C. B.; MELO, C. T. V. Gêneros orais na escola. In: SANTOS, C.F.; MENDONÇA, M.; CAVALCANTE, M. C. B. Diversidade Textual: os gêneros na sala de aula. Belo Horizonte: Au­têntica; 2007. p. 89-102.DELORY-MOMBERGER, C. Biografia e educação: figuras do indivíduo-projeto. Tradução: M. da Conceição Passeggi, J. G. da Silva Neto e Luís Passeggi. Natal: EDUFRN; São Paulo: Paulus, 2008.FREITAS, L. P. de; LUNA, T. S. e. Concepções de texto e escrita nas propostas de produção textual do novo Enem. In: MARCUSCHI, B.; SIMÕES, T. (Org.) Avaliação de Língua Portuguesa no Novo Enem. São Paulo: UniAnchieta, 2017, p. 243-280.GERALDI, J. W. Concepções de linguagem e ensino de português. In: GERALDI, J. W. (org.) O texto na sala de aula. São Paulo: Ática, 2011, p. 33-38.JOSSO, M. C. Experiências de vida e formação. Tradução: José Cláudio e Júlia Ferreira. São Paulo: Cortez, 2004.KLEIMAN, Â. (Org.). A formação do professor: perspectivas da lingüística aplicada. Campinas, SP: Mercado de Letras, 2008.KOCH, I. V. A inter-ação pela linguagem. 11. ed. São Paulo: Contexto, 2013.RIBEIRO, P. B. O discurso docente (re)velado no gênero memorial. 2008. 293 f. Tese (Doutorado em Letras) – Programa de Pós-Graduação em Letras, Pontifícia Universidade Católica de Minas Gerais, Belo Horizonte, 2008.SCHNEUWLY, B; DOLZ, J. Gêneros orais e escritos na escola. Tradução e organização de Roxane Rojo e Glaís Cordeiro. Campinas: Mercado de Letras, 2004.SIGNORINI, I. Prefácio. In: SIGNORINI, I. (org.) Gêneros catalisadores, letramento e formação do professor. São Paulo: Parábola, 2006, p. 7-16.SILVA, E. T. Concepções de leitura e suas consequências no ensino. Perspectiva, Florianópolis, v. 17, n. 31, p. 11-19, jan./jun. 1999.STREET, B. V. Letramentos sociais: abordagens críticas do letramento no desenvolvimento, na etnografia e na educação. Tradução de Marcos Bagno. São Paulo: Parábola Editorial, 2014.VASCONCELOS, S. M. F. Clínica do Discurso: a arte da escuta. Fortaleza: Premius, 2005.VASCONCELOS, S. M. F. Professor: que história é essa? Revista Educação em Questão, Natal, v. 25, n. 11, p. 62-79, jan./abr. 2006.VOLÓCHINOV, V. Marxismo e filosofia da linguagem. Tradução, notas e glossário de Sheila Grillo e Ekaterina Vólkova Américo. 2. ed. São Paulo: Editora 34, 2018.Recebido em 04-02-2021Revisões requeridas em 07-04-2021Aceito em 10-05-2021

During 2006 and 2007 in the region of Sumaré, state of São Paulo, Brazil, surveys were done on tomato (Solanum lycopersicum L.) virus diseases in three open field-grown crops. The data revealed low incidence (0.25 to 3.42%) of randomly distributed plants exhibiting interveinal chlorosis and some necrosis on the basal leaves. Symptoms were only observed on old fruit-bearing plants. Preliminary analysis of thin sections of symptomatic leaves from one plant by transmission electron microscopy revealed the presence of aggregates of thin, flexible, and elongated particles in some phloem vessels, suggesting infection with a member of the genus Crinivirus, family Closteroviridae. Total RNA was extracted separately from leaves of 10 symptomatic plants and used for one-step reverse transcription (RT)-PCR using the HS-11/HS-12 primer pair, which amplifies a fragment of 587 bp from the highly conserved region of the heat shock protein (HSP-70) homolog gene reported for Tomato infectious chlorosis virus (TICV) and Tomato chlorosis virus (ToCV) (1). The RT-PCR product was subsequently tested by nested-PCR for single detection of TICV and ToCV using primer pairs TIC-3/TIC-4 and ToC-5/ToC-6, respectively (1). Only one fragment of approximately 463 bp was amplified from 7 of the 10 plants with the primer pair specific for ToCV. No amplification was obtained with the primers specific for TICV. Two amplicons of 463 bp were purified and directly sequenced in both directions. Sequence comparisons of the 463-bp consensus sequence (GenBank Accession No. EU868927) revealed 99% identity with the reported sequence of ToCV from the United States (GenBank Accession No. AY903448) (3). Virus-free adults of Bemisia tabaci biotype B confined on symptomatic tomato leaves for a 24-h acquisition access period were able to transmit the virus to healthy tomato plants, which reproduced the original symptoms on the bottom leaves 65 days after inoculation under greenhouse conditions. Infection from transmission was confirmed by RT-PCR using the HS-11/HS-12 primer pair. In addition to B. tabaci biotype B, the greenhouse whitefly, Trialeurodes vaporariorum, has also been reported as a vector of ToCV, although it is less efficient than the B. tabaci biotype B in transmission of this virus (4). T. vaporariorum, which was previously considered limited to greenhouses, was recently reported in tomato and green bean (Phaseolus vulgaris L.) crops under field conditions in São Paulo State (2). Therefore, it might also contribute to the spread of ToCV in tomato crops in São Paulo. To our knowledge, this is the first report of ToCV in Brazil and South America. References: (1) C. I. Dovas et al. Plant Dis.86:1345, 2002. (2) A. L. Lourenção et al. Neotrop. Entomol. 37:89, 2008. (3) W. M. Wintermantel et al. Arch. Virol. 15:2287, 2005. (4) W. M. Wintermantel and G. C. Wisler. Plant Dis. 90:814, 2006.

Abstract Abstract 2855 Background: Fludarabine-based therapies prolong survival of patients (pts) with chronic lymphocytic leukemia (CLL), but deplete CD4 T-cells causing immunosuppression which increases the risk of infection and may limit control of minimal residual disease by the immune system. Adoptive immunotherapy using autologous CD3/CD28-costimulated T-cells expanded ex vivo (ACTC) enhances immune reconstitution after fludarabine-based therapy of lymphoma (Schuster et al Blood abstract 2007). Methods: We conducted a multicenter phase I/II trial of ACTC following fludarabine-based therapy of CLL. After leukapheresis, pts received fludarabine-based therapy. 8 – 12 weeks after last chemotherapy, responding pts (CR, PR) received a single dose of ACTC prepared from autologous T-cells collected before chemotherapy. Results: 34 pts are enrolled (median age 61; male 24, female 10). To date, 19 pts are evaluable for studies of immune reconstitution at ≥90 days after ACTC infusion. Prior to ACTC, 11 pts received FCR and 1 pt FR as first therapy, while 5 pts received FCR and 2 pts FCR + bevacizumab for previously treated CLL. Median ACTC dose was 6.8E+9 CD3 cells (range: 4.88E+07 −1.05E+10). After chemotherapy, before ACTC infusion (day 0), median CD4 and CD8 counts for all evaluable pts were 119 (range: 12–573) and 80 (range: 4–682), respectively; 30 days after ACTC (day 30), median CD4 and CD8 counts were 373 (range 141–846) and 208 (range: 25–879), respectively. The increases in CD4 and CD8 counts between days 0 and 30 were statistically significant (p = 0.0003 for both CD4 and CD8 cell counts) and remained significantly increased between days 0 and 90 for both CD4 (p = 0.0004) and CD8 (p = 0.005) cell counts. ACTC dose was not associated with change in CD4 or CD8 count. Pts in complete remission (CR) at the time of ACTC infusion had significantly higher CD4 counts on day 30 than pts in partial remission (PR) [median day 30 CD4 count for CR = 464 (range: 194–846) vs PR = 190 (range: 141–395), p = 0.02], but not on days 0 and 90. There was no difference in CD8 counts for pts in CR or PR on days 0, 30, and 90. There were no SAEs; 1 pt developed AIHA after ACTC. For 19 evaluable pts at a median follow-up of 12 months (range: 3.2–22), PFS from ACTC infusion is 80%. Conclusions: ACTC infusion results in a dose-independent acceleration of CD4 and CD8 T-cell recovery after fludarabine-based chemotherapy compared to historical controls. CD4 counts on day 30 are significantly higher for pts in CR at the time of ACTC infusion. Further studies of immune reconstitution and function following ACTC are in progress. Disclosures: No relevant conflicts of interest to declare.

Este artículo ofrece una aproximación a las diferentes perspectivas de los salvadoreños migrantes sobre el tema del voto en el exterior y el papel de los medios de comunicación en el espacio transnacional. Particularmente, este artículo se enfoca en la construcción de una esfera pública transnacional, las nuevas prácticas políticas desterritorializadas y las necesidades de información que expresan los salvadoreños migrantes que residen en Estados Unidos. Este trabajo fue presentado en el I Congreso Centroamericano de Ciencias Políticas, celebrado en San Salvador en julio de 2007.Realidad: Revista de Ciencias Sociales y Humanidades No. 117, 2008: 441-462

Настоящая работа посвящена реконструкции способа обогрева жилища-землянки и возможным вариантам функционального назначения таких помещений в хозяйственно-бытовых традициях древнего населения Илейского Алатау. В 2018 г. авторами проводились исследования древних поселений в устье ущелья Узын-Каргалы, которые позволяют реконструировать хозяйственную структуру населения данного микрорайона. Была расчищена землянка в долине ручья Кайнарбулак, в конструкции которой отсутствовал очаг для обогрева помещения. В домостроительстве древних скотоводов горной зоны региона существовала традиция сооружения малогабаритных землянок с системой внешнего обогрева каменных стен. Пристенный очаг с дымоходом позволяет сохранить положительные факторы (быстрый обогрев, малый расход топлива) помещения небольшого объема и увеличивает полезную площадь в пользу обитателей. Данные помещения могли использоваться как для проживания, так и в хозяйственных целях, например, в качестве коптильни. Хронологические параметры возникновения подобной традиции по материалам комплекса древних стоянок скотоводов в долине ручья Кайнарбулак позволяют отнести ее к усуньскому периоду раннего железного века. Библиографические ссылки 1. Аванесова Н.А. Культура пастушеских племен эпохи бронзы азиатской части СССР (по металлическим изделиям). Ташкент: «Фан» УзССР, 1991. 200 с. 2. Бернштам А.Н. Золотая диадема из шаманского погребения на р. Карагалинке // КСИИМК. 1940. Вып. 5. С. 23-31. 3. Бернштам А.Н. Историко-археологические очерки Центрального Тянь-Шаня и Памиро-Алтая // МИА СССР. 1952. № 26. 346 с. 4. Вайнштейн С.И. Мир кочевников центра Азии. М.: Наука, 1991. 296 с. 5. Валиханов Ч.Ч. Тенкри (бог) // Собр. соч. в 5 т. Алма-Ата: Главная ред. Казахской советской энциклопедии, 1984. Т. 1. С. 208-215. 6. Горячев А.А., Мотов Ю.А. Археологический комплекс Бутакты-I. Алматы: ТОО «KazBookTrade», 2018. 264с. 7. Горячев А.А., Потапов С.А. К вопросу о реконструкции жилища эпохи бронзы поселения Талапты-I // Казахское ханство в потоке истории: сб. матер. междунар. научн. конф., посвящ. 550-летию Казахского ханства. Алматы: Институт археологииим. А.Х. Маргулана, 2015. С. 342-351. 8. Горячев А.А., Сараев В.В. К вопросу о хозяйственно-культурном развитии древнего населения Алматы // Известия НАН РК. Сер. обществ. и гум. наук. 2015. № 6 (304). С. 5-18. 9. Горячев А.А., Чернов М.А. Орудия кожевенного ремесла и ткачества из археологического комплекса Тургень-II // История и археология Семиречья. Алматы: ОФ «Родничок», 2007. Вып. 3. С. 106-119. 10. Горячев А.А., Чернов М.А. Металлический инвентарь из погребальных комплексов эпохи бронзы Жетысу // Известия НАН РК. Сер. обществ. и гум. наук. 2017. № 1 (311). С. 5-24. 11. Итина М.А. История степных племен Южного Приаралья во II тыс. до н.э. М.: Наука, 1977. ТХАЭЭ. Т. 10. 240 с. 12. Кузьмина Е.Е. Металлические изделия энеолита и бронзового века Средней Азии. М.: Наука, 1966. 139 с. 13. Кузьмина Е.Е. Гончарное производство у племен андроновской культурной общности // Восточный Туркестан и Средняя Азия в системе культур древнего и средневекового Востока. М.: Гл. ред. восточн. лит. изд-ва «Наука», 1986. С. 152-182. 14. Кузьмина Е.Е. Откуда пришли индоарии? Материальная культура племен андроновской общности и происхождение индоиранцев. М.: МГП «Калина» ВИНИТИ РАН, 1994. 464 с. 15. Марьяшев А.Н, Горячев А.А. Поселения эпохи бронзы в верховьях ущелья Тургень и на плато Асы // История и археология Семиречья. Алматы: ОФ «Родничок», 2001. Вып. 2. С. 112-123. 16. Сараев В.В. Перспектива выявления фактов развитого оросительного земледелия в предгорьях Семиречья // Роль номадов в формировании культурного наследия Казахстана: научн. чтения памяти Н.Э. Масанова: сб. матер. междунар. научн. конф. Алматы: Print-S, 2010. С. 82-88. 17. Сараев В.В. Каргалинский древний историко-географический микрорайон // История и археология Семиречья. Алматы, 2017. Вып. 5. С. 68-90. 18. Сараев В.В., Горячев А.А. Шамсунский клад эпохи поздней бронзы у северных склонов Заилийского Алатау // Известия НАН РК. Сер. обществ. наук. 2011. № 3. С. 37-47. 19. Свод памятников истории и культуры Республики Казахстан. Алматинская область. Алматы: Агентство «Маматай», 2009. 106 с.

9077 Background: New tyrosine kinase inhibitors (TKIs) targeting ALK and ROS1 alterations in non-small cell lung cancer (NSCLC) have emerged over the last decade. Given the rarity of these genetic changes in NSCLC, data on long term outcomes with sequential therapies are limited. Methods: We conducted a multicenter retrospective cohort study of patients with metastatic NSCLC and ALK or ROS1 alterations across 12 Academic Thoracic Oncology Medical Investigators Consortium (ATOMIC) sites between 1/29/2007 and 3/31/2021. Data were abstracted from the electronic medical record. Median time to treatment discontinuation (TTD) of 1st TKI, overall survival (OS), and time to brain metastases were estimated using Kaplan-Meier methodology from start date of 1st TKI. Results: 566 patients with ALK (n = 464) or ROS1 (n = 102) were included. The majority (ALK: 426/464, 92%; ROS1: 88/102, 86%) received a TKI at some point during therapy (1st line TKI n = 262 ALK, 48 ROS1). Crizotinib was the most common 1st TKI (ALK: 57%; ROS1: 88%). Following crizotinib, alectinib (64%) and lorlatinib (41%) were the most common subsequent TKIs for ALK and ROS1, respectively. Alectinib (38%) and entrectinib (10.2%) were the 2nd most common initial TKIs used in ALK and ROS1, respectively. Additional treatment patterns presented in table. With a median follow up time of 31.1 (ALK, 95% CI, 27.6-35.0) and 32.6 (ROS1, 95% CI, 25.7-39.6) months, median OS from start of 1st TKI was 53.3 (ALK, 95% CI, 40.0-68.9) and 42.0 (ROS1, 95% CI, 31.8-NA) months. Out of the 321 patients with brain imaging prior to 1st line therapy, 40% (105/262, ALK) and 39% (23/59, ROS1) had CNS disease. Median time to development of brain metastases from start of 1st TKI in those without previous CNS disease (ALK: 278; ROS1: 58) was 30.0 (ALK, 95% CI, 25.3-39.1) and 27.0 (ROS1, 95% CI, 18.2-NA) months. Median TTD of 1st TKI was 11.2 (ALK) and 10.8 (ROS1) months. Conclusions: This is the largest retrospective cohort of NSCLC patients with ALK or ROS1 rearrangements treated in the real world setting. CNS metastases are common and subset analyses by agent and by year of diagnosis will be presented. Median time to CNS metastasis of > 2 years supports revision of the NCCN guidelines to include regular surveillance brain MRIs in this population. [Table: see text]

Ключові слова: Чорне море, геополітика, М. Грушевський, С. Рудницький, політична арена, Українськареволюція 1917-1921 рр. У статті показано основні політико-ідеологічні засади геополітичного проєкту «Чорноморськоїфедерації», що був створений в працях українського історика М. Грушевського та його учня С. Рудницького вперіод Національно-визвольних змагань та Інтербелума, а також похідні ідеї цього проєкту що існують в XXIстолітті. Проаналізовано передумови, які викликали необхідність розробки концепції співпраці різних країнБалтійсько-Чорноморського регіону на початку ХХ ст. Окреслено основні перспективи імовірності розвиткуспівпраці в межах регіону у майбутньому. Зроблено висновок про те, що щоб бути міцною та незалежноюдержавою, Україна повинна міцно триматися за ті геополітичні переваги, які має, а винайдення новогоформату співробітництва між європейськими державами означеного регіону не може відбуватися безосвоєння досвіду попередників. Посилання Vynar, 1995 – Vynar L. Mykhaylo Hrushevsʹkyy: istoryk i budivnychyy natsiyi: statti i materiyaly [MykhailoHrushevskyi: historian and nation builder: articles and materials]. Kyyiv; Nʹyu-York; Toronto: Fundatsiya im. O.Olʹzhycha. 1995. 302 s. [in Ukrainian].Hrushevsʹkyy, 1920 – Hrushevsʹkyy M. V pershiy delehatsiyi Ukrayinsʹkoyi partiyi sots. revolyutsioneriv (kvitenʹ 1919r. – lyutyy 1920 r.) [In the first delegation of the Ukrainian Socialist Party. revolutionaries (April 1919 - February1920)] // Boritesya – poborete! Videnʹ. 1920. №3. S. 47–60. [in Ukrainian].Hrushevsʹkyy, 1918 – Hrushevsʹkyy M. Na porozi novoyi Ukrayiny: hadki i mriyi [On the threshold of a new Ukraine:ugliness and dreams]. Kyyiv: Druk. akts. t-va «Petro Barsʹkyy u Kyyivi», 1918. 120 s. [in Ukrainian].Hrushevsʹkyy, 2007 – Hrushevsʹkyy M. Na porozi Novoyi Ukrayiny. Hadky ta mriyi [On the threshold of New Ukraine.Abominations and dreams] // Tvory u 50 tomakh. – T.4 (1). Lʹviv. 2007. S. 225–267. [in Ukrainian].Hrushevsʹkyy, 1917 – Hrushevsʹkyy M. Khto taki ukrayintsi i choho vony khochutʹ [Who are Ukrainians and what dothey want]. Kyyiv. T-vo «Znannya» Ukrayiny. 1991. 240 s. [in Ukrainian].Hrushevsʹkyy, 2005 – Hrushevsʹkyy M. Ukrayina, Bilorusʹ, Lytva. [Ukraine, Belarus, Lithuania]. Tvory: u 50 t.;redkol.: P. Sokhanʹ, YA. Dashkevych, I. Hyrych ta in.. Lʹviv. Vydavnytstvo «Svit». T 3. S. 65–68. [in Ukrainian].Dashkevych, 1997 – Dashkevych YA. Chornomorsʹki problemy v mynulomu i suchasnomu [Black Sea problems in thepast and present] // Shlyakh peremohy. K., Myunkhen, Nʹyu-York, 1997. − 26 chervnya (№ 26), S. 6. [in Ukrainian].Domashchenko, 2008 – Domashchenko L. M. Kontseptsiyi chornomorsʹkoyi oriyentatsiyi Ukrayiny u vitchyznyaniypolitychniy dumtsi pershoyi polovyny ХХ stolittya [Concepts of Ukraine's Black Sea Orientation in the NationalPolitical Thought of the First Half of the 20th Century]. Kyyiv. 2008. 204 s. [in Ukrainian].Kovalevsʹka, 2017 – Kovalevsʹka O. Stepan Rudnytsʹkyy ta yoho naukovyy dorobok // Stepan Rudnytsʹkyy (1877–1937). Istoriya. Heopolityka. Heohrafiya [Stepan Rudnytskyi and his scientific achievements // Stepan Rudnytskyi(1877–1937). History. Geopolitics. Geography]. T. 1. Kyyiv. 2017. S. 7–69. [in Ukrainian].Korolʹov, 2011 – Korolʹov H. Ukrayinsʹkyy piruet nad Baltiysʹko-Chornomorsʹkym Mizhmor'yam [Ukrainian pirouetteover the Baltic-Black Sea]. URL: https://www.pravda.com.ua/articles/2011/06/8/6247374/ [in Ukrainian].Levenetsʹ, 2001 – Levenetsʹ YU. A. Teoretyko-metodolohichni zasady ukrayinsʹkoyi suspilʹno-politychnoyi dumky:problemy stanovlennya ta rozvytku (druha polovyna ХІХ – pochatok ХХ stolittya) [Theoretical and methodologicalfoundations of Ukrainian social and political thought: problems of formation and development (second half of the 19th -beginning of the 20th century)].Kyyiv. Styslos. 2001. 285 s. [in Ukrainian].Novikova, Trybus, 2016 – Novikova K., Trybus V. Arkhitektory Mizhmorʺya [Architects of the Mediterranean]// Ukrayinsʹkyy tyzhdenʹ. 2016. № 36 (460). URL: https://tyzhden.ua/History/173436 [in Ukrainian].Potulʹnytsʹkyy, 1992 – Potulʹnytsʹkyy V. A. Istoriya ukrayinsʹkoyi politolohiyi (kontseptsiyi derzhavnosti v ukrayinsʹkiyzarubizhniy istoryko-politychniy nautsi) [History of Ukrainian political science (concepts of statehood in Ukrainian andforeign historical and political science).]. Kyyiv. Lybidʹ, 1992. 232 s. [in Ukrainian].Rudnytsʹkyy, 2017 – Rudnytsʹkyy S. Istoriya. Heopolityka. Heohrafiya [History. Geopolitics. Geography]. V 5-kh kn.Kn. 2. Kyyiv: Tempora. 736 s. [in Ukrainian].

RESUMENEl presente trabajo trata de mostrar los nexos entre el republicanismo político y el movimiento obrero en la provincia de Toledo. A través de las diferentes manifestaciones en la prensa, el posicionamiento de individuos o las acciones colectivas desde el nacimiento del republicanismo político y el asociacionismo de los trabajadores, se analiza un espacio compartido que se mantuvo hasta las primeras décadas del siglo xx en el que se prestó atención la mayoría de las veces a los mismos intereses. Palabras clave: republicanismo, movimiento obreroTopónimos: España, ToledoPeríodo: siglo xix, siglo xix ABSTRACTThe present work tries to show the links between political republicanism and the labor movement in the province of Toledo. Through the different manifestations in the press, the positioning of individuals or the collective actions since the birth of political republicanism and workers’ associations, a shared space is analyzed being maintained until the first decades of the 20th century, where most of the time attention was paid to the same interests. Keywords: republicanism, labor movementPlace name: Spain, ToledoPeriod: 19th century, 20th century REFERENCIASÁlvarez Junco, J., La ideología política del anarquismo español, 1868-1919, Madrid, Siglo XXI, 1976.Aróstegui, J., Miseria y conciencia del campo castellano, Madrid, Narcea, 1977.Barrio Alonso, Á. “Anarquistas, republicanos y socialistas en Asturias”, en El anarquismo español y sus tradiciones culturales, Frankfurt am Main, Vervuet, 1995.Bascuñán Añover, O., Protestas y supervivencia. Movilización y desorden en una sociedad rural: Castilla-La Mancha, 1875-1923, Valencia, Fundación Instituto Historia Social-UNED, 2008.Buylla, A., Memoria acerca de la información agraria en ambas Castillas, Madrid, Instituto de Reformas Sociales, 1904.Correa y Zafrilla, P., Democracia, federación y socialismo, Madrid, 2ª ed., 1891.Crespo Jiménez, L., “Los espacios de la sociabilidad republicana en la España provinciana de la Restauración. El caso de Toledo”, en J. S. Pérez Garzón (dir.), Experiencia republicanas en la historia de España, Madrid, La Catarata, 2015, pp. 212-248.De Felipe Redondo, J., “La orientación del movimiento obrero hacia el republicanismo en España en el siglo xix (1840-1860)”, Historia y Política: ideas, procesos y movimientos sociales, 25 (2011), pp. 119-148.___ Trabajadores. Lenguaje y experiencia en la formación del movimiento obrero español, Pamplona, Genueve, 2012.Del Valle Calzado, A.R., “Los orígenes del conflicto. El problema de la tierra en Castilla-La Mancha”, en La Guerra Civil en Castilla-La Mancha, 70 años después”, Cuenca, Universidad de Castilla-La Mancha, 2008, pp. 189-234.Díaz Díaz, B., Talavera de la Reina durante la Restauración (1875-1923), Talavera de la Reina, Ayto. de Talavera de la Reina, 1994.Esteban Barahona, L., La I Internacional en Castilla-La Mancha, Madrid, Celeste, 1998.Fernández García, A., “El siglo xix en Castilla-La Mancha: problemas historiográficos y horizontes de la investigación”, en I Congreso de Historia de Castilla-La Mancha, vol. IX, Transformaciones burguesas, cambios políticos y evolución social (I), Toledo, Junta de Comunidades de Castilla-La Mancha, 1988, pp. 5-23.Gabriel Sirvent, P., “Republicanismo popular, socialismo, anarquismo”, en Cultura social y política en el mundo del trabajo, Valencia, Fundación Instituto Historia Social-UNED, 1999, pp. 211- 222.Hennesy, C.A.M., La República Federal en España. Pi i Margall y el movimiento republicano federal. 1868-1874, Madrid, La Catarata, 2010.Herrerín López, A., Anarquía, dinamita y revolución social, Madrid, La Catarata, 2011.Higueras Castañeda, E. “Radicales y federales: el ejemplo de Cuenca en el proceso democratizador de 1868 a 1873”, Hispania Nova, 12 (2014).— “El republicanismo histórico español: orígenes y actualidad de una tradición política recuperada”, en Espacio, tiempo y forma, Serie V, Historia Contemporánea, 28 (2016) UNED, pp.15-22.— “La cuestión del siglo: el federalismo español y las respuestas a la cuestión social en el siglo xix”, Libre Pensamiento, 4 (2018), pp. 9-15.Higueras Castañeda, E. y Anchorena Morales, O., “Los estudios sobre el republicanismo histórico en las dos Castillas y Madrid: aproximación historiográfica”, en El republicanismo en el espacio ibérico contemporáneo: Recorridos y perspectivas, Madrid, Casa de Velázquez, 2021.Higueruela del Pino, L., “El movimiento obrero católico en la diócesis de Toledo hasta la II República”, Toletum, 11 (1981), pp. 291-344.Inarejos Muñoz, J.A., “¿Demócratas en La Mancha? En torno a los orígenes de la cultura política republicana en Castilla-La Mancha (1854-1868)”, Espacio, Tiempo y Forma, Serie V, Historia Contemporánea, UNED, n.º 18 (2006), pp.111-134.Jaén Milla, S., “Republicanismo en una sociedad agraria (Jaén 1868-1931)”, (2008), Historia Contemporánea, n.º 37, (2008), pp. 469-497.Ladrón de Guevara, M. P. y Alia Miranda, F., “Movimiento obrero y conflictividad social en Castilla-La Mancha”, en Movimientos sociales y Estado en la España Contemporánea, Cuenca, Universidad de Castilla-La Mancha, 2001, pp. 529-564.Largo Alonso, M. T. y Faraldo Jarillo, J., “Balance historiográfico. La historiografía y el centenario de la Revolución rusa”, Vínculos de Historia, 7 (2018), pp. 391-402.López Estudillo, A., Republicanismo y anarquismo en Andalucía, Córdoba, La Posada, 2001.Lorenzo, A., El Proletario Militante, Madrid, Confederación Sindical Solidaridad Obrera, 2013.Los diputados pintados por sus hechos: colección de estudios biográficos sobre los elegidos por el sufragio universal en las constituyentes de 1869, Madrid, tomo I, 1869.Martín Nájera, A., “Fuentes para la historia del primer socialismo en España”, Ayer, 54 (2004), pp. 23-48.Martorell, M. y Juliá, S., Manual de historia política y social de España (1808-2011), Barcelona, RBA, 2012.Menéndez Pelayo, M., Historia de los heterodoxos españoles, Alicante, Biblioteca Virtual Miguel de Cervantes, 2003, tomo VI.Miguel González, R., “Las culturas políticas del republicanismo español”, Ayer, 53 (2004), pp. 207-236.— “Las concepciones de la representación política”, Ayer, 61 (2006), pp. 139-162.— “Historia, discurso y prácticas sociales. Una contribución a los futuros debates sobre el republicanismo decimonónico y las culturas políticas”, Ayer, 37 (2008), pp. 373-408.Ortiz, M., Ruiz, D. y Sánchez, I. (coords.), Movimientos sociales y estado en la España Contemporánea, Cuenca, Universidad de Castilla-La Mancha, 2001.Paniagua Fuentes, F. J., Anarquistas y socialistas, Madrid, Historia 16, 1989.— “Republicanos, socialistas, anarquistas: ¿qué revolución?”, en Cultura social y política en el mundo del trabajo, Valencia, Fundación Instituto Historia Social-UNED, 1999, 243-270.Peyrou Tubert, F., Tribunos del pueblo. Demócratas y republicanos durante el reinado de Isabel II, Madrid, Centro de Estudios Políticos y Constitucionales, 2008.— “La formación del partido democrático español: ¿crónica de un conflicto anunciado?”, Historia Contemporánea, 37 (2008), pp. 343-372.— “¿Voto o barricada? Ciudadanía y revolución en el movimiento demo-republicano del período de Isabel II”, Ayer, 70 (2008), pp. 171-198.Piqueras, J.A., La Revolución democrática (1868-1874), cuestión social, colonialismo y grupos de presión, Madrid, Ministerio de Trabajo y Seguridad Social, 1992.Reig, R., “Republicanos, socialistas y sindicalistas ante los cambios del sistema productivo”, Cultura social y política en el mundo del trabajo, Valencia, Biblioteca Historia Social, 1999, pp. 223-242.— “El republicanismo popular”, Ayer, 39 (2000), pp. 83-102.Rivas Lara, L., 1890-2010. El Primero de Mayo en España, 120 aniversario, Madrid, Fundación 1º de Mayo, 2010.Rodríguez González, A., “Beneficencia, crisis y conflictividad social. Toledo a finales del siglo xix”, en Anales toledanos, 36 (1998), pp. 139-174.Rojas, P., “Un escritor y político talaverano de la Restauración: don Jacinto Bonilla Sánchez. (1841-1916)”, Alcalibe, 3 (2003), pp. 229-250.Sánchez Lubián, E., Besteiro. Años de juventud, 1898-1912, Toledo, Junta de Comunidades de Castilla-La Mancha, 2002.— Domingo Alonso, apóstol del socialismo toledano. Apuntes sobre los orígenes del Partido Obrero, Toledo, Añil, 2013.Sánchez Sánchez, I., Castilla La Mancha en la época contemporánea, 1808-1939, Toledo, Junta de Comunidades de Castilla-La Mancha, 1986.Sánchez Sánchez, J., “Agitaciones campesinas y movimiento obrero en Toledo en 1904: Manuel Puñal, un revolucionario en Villamiel”, Almud, 5 (1982), pp. 112-148.— “Los orígenes del sindicalismo católico en Toledo: el proyecto del ‘protectorado obrero’ de 1904”, Anales Toledanos, 15 (1982), Diputación de Toledo, pp. 243-280.Sancho Rodríguez, J. Memoria del Centro de Artistas e Industriales, Toledo, 1916.Tuñón de Lara, M., Historia del movimiento obrero español, Madrid, Siglo XXI, 1971.Villena Espinosa, R., “¿Obreros poco conscientes? Orígenes del movimiento obrero en Castilla La Mancha (1868-1900)”, en Movimientos sociales y estado en la España Contemporánea, Cuenca, Universidad de Castilla-La Mancha, 2001, pp. 501-528.— Anselmo Lorenzo (1841-1914). El proletario militante, Toledo, Almud, 2008.

Whitefly-transmitted viruses have caused severe losses in tomato crops (Solanum lycopersicum) in Cuba. In 2006 and 2007, tomato greenhouses across eastern Cuba exhibited high levels of Bemisia tabaci (B biotype) infestation. Some plants showed interveinal chlorosis and a severe yellow mosaic, combined with leaf brittleness. These symptoms were different from those induced by Tomato yellow leaf curl virus (TYLCV-IL(CU)). Only 12 of 31 symptomatic samples resulted in positive PCR assays with TYLCV-specific primers (CTGAATGTTTGGATGGAAATGTGC and GCTCGTAAGTTTCCTCAACGGAC). A reverse transcription (RT)-PCR analysis for Tomato chlorosis virus (ToCV) with generic (HS-11/HS-12) and specific primers (ToC-5/ToC-6) was also carried out (2). Sequence analysis of the cloned RT-PCR products (463 bp) confirmed the presence of ToCV in Cuba. The fragment had 97 to 98% identity with GenBank isolates from Spain (DQ136146), Florida (AY903448), and Reunion Island, France (AJ968396). Cloned TYLCV and ToCV amplicons were used as probes to reanalyze the selected 31 samples by a dot-blot hybridization assay in search of mixed infections (1). The assay showed 16 samples to be positive for ToCV, 4 for TYLCV, 8 for both, and 3 samples were negative. To our knowledge, this is the first report of ToCV and TYLCV/ToCV mixed infections in Cuba. References: (1) Y. Abou-Jawdha et al. Plant Dis. 90:378, 2006. (2) C. I. Dovas et al. Plant Dis. 86:1345, 2002.

The aim of this study was to identify spatial patterns in the incidence of childhood tuberculosis in cities in the state of São Paulo. An ecological and exploratory study was carried with data on new cases of tuberculosis in children 0 to 14 years old for the period 2001 to 2005 and from 2006 to 2010, obtained from DATASUS. Data of the population of this age group were collected and raised rates per 100 000 inhabitants. Moran's index (I) was calculated for both periods. Thematic maps with the rates and its difference besides Moran maps, maps with Kernel densities, educational level and income were constructed using using TerraView software. The average rates were 3.23 / 100 000 inhabitants in the first period (2881 cases reported) and 2.13 / 100 000 inhabitants in the second period (2513 cases reported); the Moran index in the first period was I = 0.03 (p = 0.16) and I = 0.06 (p = 0.01) in the second period; the thematic map identified 462 municipalities with higher interest rates in the second period; the kernel map identified higher density rates in the metropolitan region of São Paulo, west coastal cities and in the first period and the second period, the metropolitan region of São Paulo and coastal cities. The data presented in this study provide informations to local and regional managers to implement policies for tuberculosis control.

Purpose - The purpose of this study is to see the descriptionof the level ofbrand personality,andpurchase decision in consumers of Pixy powder in Indonesia. Design/methodology/approachh - The design of this study was cross sectional method. This research uses descriptive approach with explanatory survey method. The nurses analysis unit is 130 people. Data collection using questionnaire. The analysis technique used is descriptive technique by using frequency distributionFindings - Based on the results of the research using descriptive analysis, the results obtained that brand personality in the high category, and purchase decision in the good category.Originality/value - The differences in this study located on an object research , time research , a measuring instrument , literature that used , the theory that is used and the results of the study.Aaker, J. L. (1997). Dimensions of brand personality. Journal of Marketing Research, 347.Al-rasyid, H. (1994). Teknik Penarikan Sampel dan Penyusunan Skala. Bandung: Universitas Padjajaran.Arora, S., Neha. (2016). Determinants of Customer-based Brand Equity: A Study of Public and Private Banks. Global Business Review, 17(4), 905–920. Retrieved from http://doi.org/10.1177/0972150916645693Blackwell, R. D. (2005). Consumer Behaviour. Mason: Permissions Department.Buchari Alma. (2008). Mnajemen Pemasaran dan Pemasaran Jasa. Bandung: Alfabeta.Cravens, Piercy. (2013). Strategic Marketing (10th ed.) (10th ed). New York: Mc Graw Hil.Dirgantari, P. D. (2016). PERANAN BAURAN PEMASARAN JASA PENDIDIKAN TERHADAP UPAYA MENINGKATKAN EKUITAS MEREK BERBASIS PELANGGAN PERGURUAN TINGGI (STUDI PADA PERGURUAN TINGGI DI JAWA BARAT). Jurnal Pendidikan Manajemen Bisnis, 11, 22–31.Guthrie, M., Hye-shin, K., Jaehee, J. (2007). The effects of facial image andcosmetic usage on perceptions ofbrand personality. Journal of Fashion Marketing and Management, 12(2), 164–181. http://doi.org/10.1108/13612020810874863Hawkins, D. I. (2010). Building Marketing Strategy Consumer Behavior.Heding, T., Knudtzen, C. F., Bjerre, M. (2009). Brand Management.Hegner, S. M., Jevons, C., Hegner, S. M., Jevons, C. (2016). Brand trust : a cross-national validation in Germany , India , and South Africa. http://doi.org/10.1108/JPBM-02-2015-0814Karjaluoto, H., Munnukka, J., Salmi, M. (2016). Article information : Journal of Service Theory and Practice, 26(1).Kartajaya, H. (2010). Perjalanan Pemikiran Konsep Pemasaran Hermawan Kertajaya. Jakarta: Penerbit Erlangga.Keller, K. L. (2013). Strategic Brand Management (4th ed.). England: Pearson Education Inc. Retrieved from http://doi.org/10.2307/1252315Keller, K. L., Kotler, P. (2016). Marketing Management (15e ed.). England: Pearson Education Limited.Kotler, P., Keller, K., Brady, M., Goodman, M., Hansen, T. (2012). Marketing management. England: Pearson Education Limited.Kotler, P., Keller, K. L. (n.d.). Marketing Management.Kwong, M. Z., Candinegara, I. (2014). elationship between Brand Experience , Brand Personality , Consumer Satisfaction , and Consumer Loyalty of DSSMF Brand. iBuss Management, 2(2), 89–98.Laios, L. G., Moschuris, S. J. (2015). The influence of enterprise type on the purchasing decision process. International Journal of Operations Production Management.Lamb, C. W., Hair, J. F. (2011). Marketing.Malhotra, N. K. (2010). Marketing Research (6th ed.). United States of America.Mulyadi, H., Saktiawati, D. (2008). Pengaruh Brand Personality terhadap Loyalitas Pelanggan Sampo Sunsilk. Jurnal Pendidikan Manajemen Bisnis, 7.Noel, H. (2009). Consumer behaviour. Switzerland: AVA Publishing SA.Orozoco-Gomez, M., Toldos-Romeo Ma, M. de l P. (2015). Brand personality and purchase intention, 27(5), 462–467. http://doi.org/10.1108/EBR-03-2013-0046Peter, J. P., Jerry, C. O. (2008). Consumer Behaviour perilaku konsumen dan strtegi pemasaran. Jakarta: Erlangga.Rampl, L. V., Kenning, P. (2014). Employer brand trust and affect : linking brand personality to employer brand attractiveness. http://doi.org/http://doi.org/10.1108/EJM-02-2012-0113Ratih, H., Irna, W. (2008). pengaruh pemasaran eksperiensial terhadp retensi pelanggan pada pengunjung resort spa kampung sampireun garut. Jurnal Pendidikan Manajemen Bisnis, 7, 1–19.Razati, G., Ruhimat, R. (2008). pengaruh sales promotion terhadap keputusan pengguna kartu kredit bni. Pendidikan Manajemen Bisnis, 7.Sangadji, E. M., Sopiah. (2013). Perilaku Konsumen Pendekatan Praktis Disertai Himpunan Jurnal Penelitan. Yogyakarta: Andi offset.Schiffman, L. ., Kanuk, L. L. (2007). Consumer Behaviour. New Jersey: Pearson Prestice Hall.Solomon, M. R., Bamossy, G., Askegaard, S., Hogg, M. K. (2013). Consumer Behaviour.Sugiyono. (2010). Metode Penelitian Bisnis. Bandung: Alfabetha.Suharno. (2010). Marketing in Practice (edisi pert). Yogyakarta: Graha Ilmu.Surakhmad, W. (2004). Pengantar Penelitian Ilmiah Dasar Metode Teknik. Bandung: Tarsito.Utama, D. H., Amelia, F. (2009). ENGARUH ATRIBUT PRODUK TERHADAP KEPUASAN PELANGGAN PRODUK TEH CELUP SOSRO DAN 2 TANG (Survei Pada Pelanggan Teh Celup di Griya Pahlawan dan Giant Pasteur Bandung). Urnal Pendidikan Manajemen Bisnis, 8(30-40).Yin, C., Mansori, S. (2016). Factor that influences consumers ’ brand loyalty towards cosmetic products. Journal of Marketing Management and Customer Behavior, 1, 12–29.

To improve online learning pedagogy within the field of paralegal education, this study investigated how paralegal students and paralegal instructors perceived the effectiveness of synchronous and asynchronous online paralegal courses. This study intended to inform paralegal instructors and course developers how to better design, deliver, and evaluate effective online course instruction in the field of paralegal studies.Survey results were analyzed using independent samples t-test and correlational analysis, and indicated that overall, paralegal students and paralegal instructors positively perceived synchronous and asynchronous online paralegal courses. Paralegal instructors reported statistically significant higher perceptions than paralegal students: (1) of instructional design and course content in synchronous online paralegal courses; and (2) of technical assistance, communication, and course content in asynchronous online paralegal courses. Instructors also reported higher perceptions of the effectiveness of universal design, online instructional design, and course content in synchronous online paralegal courses than in asynchronous online paralegal courses. Paralegal students reported higher perceptions of asynchronous online paralegal course effectiveness regarding universal design than paralegal instructors. No statistically significant differences existed between paralegal students’ perceptions of the effectiveness of synchronous and asynchronous online paralegal courses. A strong, negative relationship existed between paralegal students’ age and their perceptions of effective synchronous paralegal courses, which were statistically and practically significant. Lastly, this study provided practical applicability and opportunities for future research. Akyol, Z., & Garrison, D. R. (2008). The development of a community of inquiry over time in an online course: Understanding the progression and integration of social, cognitive and teaching presence. Journal of Asynchronous Learning Networks, 12, 3-22. Retrieved from https://files.eric.ed.gov/fulltext/EJ837483.pdf Akyol, Z., Garrison, D. R., & Ozden, M. Y. (2009). Online and blended communities of inquiry: Exploring the developmental and perceptional differences. The International Review of Research in Open and Distributed Learning, 10(6), 65-83. Retrieved from http://www.irrodl.org/index.php/irrodl/article/view/765/1436 Allen, I. E., & Seaman, J. (2014). Grade change: Tracking online education in the United States. Babson Park, MA: Babson Survey Research Group and Quahog Research Group, LLC. Retrieved from https://www.utc.edu/learn/pdfs/online/sloanc-report-2014.pdf Alreck, P. L., & Settle, R. B. (2004). The Survey Research Handbook (3rd ed.) New York, NY: McGraw-Hill Irwin. American Association for Paralegal Education (2013, Oct.). AAfPE core competencies for paralegal programs. Retrieved from https://cdn.ymaws.com/www.aafpe.org/resource/resmgr/Docs/AAfPECoreCompetencies.pdf American Bar Association, Standing Committee on Paralegals. (2017). https://www.americanbar.org/groups/paralegals.html American Bar Association, Standing Committee on Paralegals (2013, September). Guidelines for the approval of paralegal education programs. Retrieved from https://www.americanbar.org/content/dam/aba/administrative/paralegals/ls_prlgs_2013_paralegal_guidelines.authcheckdam.pdf Astani, M., Ready, K. J., & Duplaga, E. A. (2010). Online course experience matters: Investigating students’ perceptions of online learning. Issues in Information Systems, 11(2), 14-21. Retrieved from http://iacis.org/iis/2010/14-21_LV2010_1526.pdf Bailey, C. J., & Card, K. A. (2009). Effective pedagogical practices for online teaching: Perception of experienced instructors. The Internet and Higher Education, 12, 152-155. doi: 10.1016/j.iheduc.2009.08.002 Bernard, R., Abrami, P., Borokhovski, E., Wade, C., Tamim , R., Surkes, M., & Bethel, E. (2009). A meta-analysis of three types of interaction treatments in distance education. Review of Educational Research, 79, 1243-1289. doi: 10.3102/0034654309333844 Cherry, S. J., & Flora, B. H. (2017). Radiography faculty engaged in online education: Perceptions of effectiveness, satisfaction, and technological self-efficacy. Radiologic Technology, 88(3), 249-262. http://www.radiologictechnology.org/ Cohen, J. (1988). Statistical power analysis for the behavioral sciences (2nd ed.). New York: Taylor & Francis Group. Colorado, J. T., & Eberle, J. (2010). Student demographics and success in online learning environments. Emporia State Research Studies, 46(1), 4-10. Retrieved from https://esirc.emporia.edu/bitstream/handle/123456789/380/205.2.pdf?sequence=1 Dutcher, C. W., Epps, K. K., & Cleaveland, M. C. (2015). Comparing business law in online and face to face formats: A difference in student learning perception. Academy of Educational Leadership Journal, 19, 123-134. http://www.abacademies.org/journals/academy-of-educational-leadership-journal-home.html Faul, F., Erdfelder, E., Lang, A.-G., & Buchner, A. (2007). G*Power 3: A flexible statistical power analysis program for the social, behavioral, and biomedical sciences. Behavior Research Methods, 39, 175-191. Retrieved from http://www.gpower.hhu.de/fileadmin/redaktion/Fakultaeten/Mathematisch-Naturwissenschaftliche_Fakultaet/Psychologie/AAP/gpower/GPower3-BRM-Paper.pdf Field, A. (2009). Discovery statistics using SPSS. (3rd ed.). Thousand Oaks, CA: Sage Publications, Inc. Gall M., Borg, W., & Gall, J. (1996). Educational research: An introduction (6th ed.). White Plains, NY: Longman Press. Garrison, D. R., Anderson, T., & Archer, W. (2001). Critical thinking, cognitive presence, and computer conferencing in distance education. American Journal of distance education, 15(1), 7-23. Retrieved from http://cde.athabascau.ca/coi_site/documents/Garrison_Anderson_Archer_CogPres_Final.pdf Green, S. B., & Salkind, N. J. (2005). Using SPSS for Windows and Macintosh: Internal consistency estimates of reliability. Upper Saddle River, NJ: Pearson Prentice Hall. Harrell, I. L. (2008). Increasing the Success of Online Students. Inquiry, 13(1), 36-44. Retrieved from http://files.eric.ed.gov/fulltext/EJ833911.pdf Horspool, A., & Lange, C. (2012). Applying the scholarship of teaching and learning: student perceptions, behaviours and success online and face-to-face. Assessment & Evaluation in Higher Education, 37, 73-88. doi: 10.1080/02602938.2010.496532 Inman, E., Kerwin, M., & Mayes, L. (1999). Instructor and student attitudes toward distance learning. Community College Journal of Research & Practice, 23, 581-591. doi:10.1080/106689299264594 Institute of Legal Executives (ILEX). https://www.cilexcareers.org.uk/ Johnson, J. & Taggart, G. (1996). Computer assisted instruction in paralegal education: Does it help? Journal of Paralegal Education and Practice, 12, 1-21. Johnstone, Q. & Flood, J. (1982). Paralegals in English and American law offices. Windsor YB Access to Justice 2, 152. Jones, S. J. (2012). Reading between the lines of online course evaluations: Identifiable actions that improve student perceptions of teaching effectiveness and course value. Journal of Asynchronous Learning Networks, 16(1), 49-58. doi:http://dx.doi.org/10.24059/olj.v16i1.227 Krejcie, R. V., & Morgan, D. W. (1970). Determining sample size for research activities. Educational and psychological measurement, 30, 607-610. http://journals.sagepub.com/home/epm Liu, S., Gomez, J., Khan, B., & Yen, C. J. (2007). Toward a learner-oriented community college online course dropout framework. International Journal on ELearning, 6(4), 519-542. https://www.learntechlib.org/j/IJEL/ Lloyd, S. A., Byrne, M. M., & McCoy, T. S. (2012). Faculty-perceived barriers of online education. Journal of online learning and teaching, 8(1), 1-12. Retrieved from http://jolt.merlot.org/vol8no1/lloyd_0312.pdf Lockee, B., Burton, J., & Potter, K. (2010, March). Organizational perspectives on quality in distance learning. In D. Gibson & B. Dodge (Eds.), Proceedings of SITE 2010—Society for Information Technology & Teacher Education International Conference (pp. 659-664). San Diego, CA: Association for the Advancement of Computing in Education (AACE). https://www.learntechlib.org/p/33419/ Lowerison, G., Sclater, J., Schmid, R. F., & Abrami, P. C. (2006). Student perceived effectiveness of computer technology use in post-secondary classrooms. Computers & Education, 47(4), 465-489. doi:10.1016/j.compedu.2004.10.014 Retrieved from https://pdfs.semanticscholar.org/fc9c/13f0187d3967217aa82cc96c188427e29ec9.pdf Martins, L. L., & Kellermanns, F. W. (2004). A model of business school students' acceptance of a web-based course management system. Academy of Management Learning & Education, 3(1), 7-26. doi: 10.5465/AMLE.2004.12436815 Mayes, J. T. (2001). Quality in an e-University. Assessment & Evaluation in Higher Education, 26, 465-473. doi:10.1080/02602930120082032 McCabe, S. (2007). A brief history of the paralegal profession. Michigan Bar Journal, 86(7), 18-21. Retrieved from https://www.michbar.org/file/barjournal/article/documents/pdf4article1177.pdf McMillan, J. H. (2008). Educational Research: Fundamentals for the customer. Boston, MA: Pearson Education, Inc. Myers, C. B., Bennett, D., Brown, G., & Henderson, T. (2004). Emerging online learning environments and student learning: An analysis of faculty perceptions. Educational Technology & Society, 7(1), 78-86. Retrieved from http://www.ifets.info/journals/7_1/9.pdf Myers, K. (2002). Distance education: A primer. Journal of Paralegal Education & Practice, 18, 57-64. Nunnaly, J. (1978). Psychometric theory. New York: McGraw-Hill. Otter, R. R., Seipel, S., Graeff, T., Alexander, B., Boraiko, C., Gray, J., Petersen, K., & Sadler, K. (2013). Comparing student and faculty perceptions of online and traditional courses. The Internet and Higher Education, 19, 27-35. doi:10.1016/j.iheduc.2013.08.001 Popham, W. J. (2000). Modern educational measurement: Practical guidelines for educational leaders. Boston, MA: Allyn & Bacon. Rich, A. J., & Dereshiwsky, M. I. (2011). Assessing the comparative effectiveness of teaching undergraduate intermediate accounting in the online classroom format. Journal of College Teaching and Learning, 8(9), 19. https://www.cluteinstitute.com/ojs/index.php/TLC/ Robinson, C., & Hullinger, H. (2008). New benchmarks in higher education: Student engagement in online learning. The Journal of Education for Business, 84(2), 101-109. Retrieved from http://anitacrawley.net/Resources/Articles/New%20Benchmarks%20in%20Higher%20Education.pdf Salkind, N. J. (2008). Statistics for people who think they hate statistics. Los Angeles, CA: Sage Publications. Santos, J. (1999, April). Cronbach's Alpha: A tool for assessing the reliability of scales. Journal of Extension, 37, 2. Retrieved from https://www.joe.org/joe/1999april/tt3.php Seok, S., DaCosta, B., Kinsell, C., & Tung, C. K. (2010). Comparison of instructors' and students' perceptions of the effectiveness of online courses. Quarterly Review of Distance Education, 11(1), 25. Retrieved from http://online.nuc.edu/ctl_en/wp-content/uploads/2015/08/Online-education-effectiviness.pdf Sheridan, K., & Kelly, M. A. (2010). The indicators of instructor presence that are important to students in online courses. Journal of Online Learning and Teaching, 6(4), 767-779. Retrieved from http://jolt.merlot.org/vol6no4/sheridan_1210.pdf Shook, B. L., Greer, M. J., & Campbell, S. (2013). Student perceptions of online instruction. International Journal of Arts & Sciences, 6(4), 337. Retrieved from https://s3.amazonaws.com/academia.edu.documents/34496977/Ophoff.pdf?AWSAccessKeyId=AKIAIWOWYYGZ2Y53UL3A&Expires=1508119686&Signature=J1lJ8VO0xardd%2FwH35pGj14UeBg%3D&response-content-disposition=inline%3B%20filename%3DStudent_Perceptions_of_Online_Learning.pdf Song, L., Singleton, E. S., Hill, J. R., & Koh, M. H. (2004). Improving online learning: Student perceptions of useful and challenging characteristics. The Internet and Higher Education, 7, 59-70. doi:10.1016/j.iheduc.2003.11.003 Steiner, S. D., & Hyman, M. R. (2010). Improving the student experience: Allowing students enrolled in a required course to select online or face-to-face instruction. Marketing Education Review, 20, 29-34. doi:10.2753/MER1052-8008200105 Stoel, L., & Hye Lee, K. (2003). Modeling the effect of experience on student acceptance of web-based courseware. Internet Research, 13(5), 364-374. http://www.emeraldinsight.com/loi/intr Taggart, G., & Bodle, J. H. (2003). Example of assessment of student outcomes data from on-line paralegal courses: Lessons learned. Journal of Paralegal Education & Practice, 19, 29-36. Tanner, J. R., Noser, T. C., & Totaro, M. W. (2009). Business faculty and undergraduate students' perceptions of online learning: A comparative study. Journal of Information Systems Education, 20, 29-40. http://jise.org/ Tung, C.K. (2007). Perceptions of students and instructors of online and web-enhanced course effectiveness in community colleges (Doctoral dissertation). Retrieved from ProQuest Dissertations and Theses database (Publication No. AAT 3284232). Vodanovich, S. J. & Piotrowski, C., & (2000). Are the reported barriers to Internet-based instruction warranted? A synthesis of recent research. Education, 121(1), 48-53. http://www.projectinnovation.com/education.html Ward, M. E., Peters, G., & Shelley, K. (2010). Student and faculty perceptions of the quality of online learning experiences. The International Review of Research in Open and Distributed Learning, 11, 57-77. Retrieved from http://www.irrodl.org/index.php/irrodl/article/view/867/1610? Wilkes, R. B., Simon, J. C., & Brooks, L. D. (2006). A comparison of faculty and undergraduate students' perceptions of online courses and degree programs. Journal of Information Systems Education, 17, 131-140. http://jise.org/

The purpose of this article is to analyze the so-called human capital theory and to clarify the concept of public good, as well as the frequency of the expression "public" in the Declarations adopted at the Regional Conferences of Higher Education in Latin America and the Caribbean in 2008 and 2018. For this, in methodological terms, this article analyzes documents from certain International Organizations (UNESCO, World Bank and OECD) and seeks theoretical support in Reinhart Koselleck's History of Concepts and other authors such as Roger Dale, Susan Robertson, Bob Jessop, Stephen Gill, Paul Samuelson , Karl Polanyi and Pierre Bourdieu.ResumoO presente artigo tem o objetivo de analisar a chamada teoria do capital humano e precisar o conceito de bem público, bem como a frequência da expressão “público” nas Declarações aprovadas nas Conferências Regionais de Educação Superior na América Latina e Caribe, em 2008 e 2018. Para isto, em termos metodológicos, o presente artigo analisa documentos de determinadas Organizações Internacionais (UNESCO, Banco Mundial e OCDE) e busca apoio na História dos Conceitos de Reinhart Koselleck e em autores como Roger Dale, Bob Jessop, Stephen Gill, Paul Samuelson, Karl Polanyi, Pierre Bourdieu.Keywords: Public good, Human capital theory, Commodification, Education, CRES 2008 and CRES 2018.Palavras-chave: Bem público, Teoria do capital humano, Mercadorização, Educação, CRES 2008 e CRES 2018.ReferencesALVES, Giovanni. O que é o precariado? Blog da Boitempo. Extraído de <https://blogdaboitempo.com.br/2013/07/22/o-que-e-o-precariado/>, 22 Jul 2013, acesso em 28 fev 2019.ARENDT, Hannah. A crise na educação. In: Entre o passado e o futuro. Tradução: Mauro W. Barbosa de Almeida. 3ª reimpressão da 5ª ed. de 2000. São Paulo: Perspectiva, 2005.AUDITORIA CIDADÃ DA DÍVIDA. Dividômetro: quanto pagamos (juros e amortizações) – dívida pública federal. Auditoria Cidadã da Dívída. Extraído de <https://auditoriacidada.org.br/>. Acesso em 28 fev. 2019.AZEVEDO, M. L. N.. Transnacionalização e mercadorização da Educação Superior: examinando alguns efeitos colaterais do capitalismo acadêmico (sem riscos) no Brasil - A expansão privado-mercantil. Revista Internacional de Educação Superior - RIESup, v. 1, p. 86-102, 2015.AZEVEDO, M. L. N. O Novo Regime Fiscal: a retórica da intransigência, o constrangimento da oferta de bens públicos e o comprometimento do PNE 2014-2024. Tópicos Educacionais, v. 1, p. 234-258, 2016.AZEVEDO, M. L. N. Regionalismo, regionalização e regionalidade: da integração pela paz à Estratégia Europa 2020. In: BARREYRO, Gladys Beatriz; HIZUME, Gabriela de Camargo. (Orgs.). Regionalismos e Inter-Regionalismos na Educação Superior: projetos, propostas e influências entre a América Latina e a Europa. 1ed. Cascavel-PR: EDUNIOESTE, 2018, v. 1, p. 65-88.AZEVEDO, M. L. N. Universidade e Neoliberalismo: O Banco Mundial e a Reforma Universitária na Argentina (1989-1999). 2001. Tese (Doutorado em Educação), Faculdade de Educação da USP, 2001.AZEVEDO, M. L. N. Igualdade e equidade: qual é a medida da justiça social? Avaliação (UNICAMP), v. 18, p. 129-150, 2013.AZEVEDO, M. L. N.; CATANI, A. M. Políticas Públicas para o Ensino Superior no Brasil: de FHC a Lula. In: AZEVEDO, M. L. Política Educacional Brasileira. Maringá: EDUEM, 2005.BANQUE MONDIALE. Rapport Annuel 1996. Washington: Worl Bank: 1996.BID. Bienes Publicos Regionales: Promoviendo soluciones regionales para problemas regionales. 2007. Banco Interamericano de Desarrollo. Extraído de <http://www.iadb.org/int/bpr>. Acesso em 20 fev. 2019.BOURDIEU, Pierre. Questões de Sociologia. Tradução de Jeni Vaitsman. Rio de Janeiro: Ed. Marco Zero Ltda., 1983.BRÉMOND, Janine. Les économistes néo-classiques: de L. Walras à M. Allais, de F. Von Hayek à M. Friedman. Paris: Hatier, 1989.CAPUL, Jean-Yves; GARNIER, Olivier. Pratique de l'économie e des Sciences Sociales: de A a Z. Paris: Hatier, 1996.CERVO, Amado Luiz. Conceitos em Relações Internacionais. Revista Brasileira de Política Internacional. 51 (2): 8-25, 2008.CRES. Declaración de la Conferencia Regional de Educación Superior para América Latina y el Caribe - CRES 2008. Extraído de <www.iesalc.unesco.org.ve>. Acesso em junho 2008.DALE, Roger. Globalização e educação: demonstrando a existência de uma "Cultura Educacional Mundial Comum" ou localizando uma "Agenda Globalmente Estruturada para a Educação"?. Educação & Sociedade, ago. 2004, vol. 25, no. 87, p.423-460. ISSN 0101-7330.DIAS, M. A. R. Dez anos de antagonismo nas políticas sobre Ensino Superior em nível internacional. Educação e Sociedade, Campinas, vol. 25, nº. 88, p. 893-914, Especial - Out. 2004.DIAS, M. A. R. A universidade no século XXI: do conflito ao diálogo de divilizações. Documento on line: 2007. Extraído de <www.mardias.net>, acesso em 01 mai 2008.DIAS, M. A. R. Enseñanza superior como bien público: perspectivas para el centenário de la Declaración de Córdoba. Texto de conferência, 2016. Extraído de <http://grupomontevideo.org/sitio/wp-content/uploads/2017/08/Marco-Antonio-Rodrigues-Dias_ES-como-bien-p%C3%BAblico.pdf >. Acesso em 28 Fev 2019.EUROPEAN COMMISION. Putting the consumer first. Luxembourg: Publications Office of the European Union, 2016. Extraído de <http://europa.eu/pol/index_en.htm e http://europa.eu/!bY34KD>.FRANCE. Les biens publics mondiaux. Paris: Ministère des Affaires étrangères / Ministère de l’Économie, des Finances et de l’Industrie, fev. 2002.FRIEDMAN, M. Capitalismo e liberdade. São Paulo: Ed. Nova Cultural, 1983.FRIGOTTO, Gaudêncio. A produtividade da escola improdutiva. São Paulo: Cortez, 1993.GILL, S. Globalisation, Market Civilisation, and Disciplinary Neoliberalism. Millennium, 24(3), 399–423, 1995. https://doi.org/10.1177/03058298950240030801GOMES, A. M.; MORAES, K. N. Educação Superior no Brasil contemporâneo: transição para um sistema de massa. Educação & Sociedade, Campinas, v. 33, nº. 118, p. 171-190, jan-mar. 2012.HARVEY, David. Condição Pós-Moderna. São Paulo: Ed. Loyola, 1993.HETTNE, B. Beyond the ‘new’ regionalism. New Political Economy, v. 10, nº. 4, p. 543-571, Dec. 2005.IESALC-UNESCO. II Declaração da Conferência Regional de Educação Superior na América Latina e Caribe (CRES 2008). Instituto Internacional da UNESCO para a Educação Superior na América Latina e no Caribe (IESALC-UNESCO). Cartagena de Indias, Colômbia, 2008.IESALC-UNESCO. III Declaração da Conferência Regional de Educação Superior na América Latina e Caribe (CRES 2018). Instituto Internacional da UNESCO para a Educação Superior na América Latina e no Caribe (IESALC-UNESCO). Córdoba, Argentina, 2018.JAEDE, M. The Concept of Common Good. PSRP Working Paper n. 8. Edinburgo: Global Justice Academy, 2017. Extraído de: https://www.thebritishacademy.ac.uk/sites/default/files/Jaede.pdf. Acesso em 15 Jan 2019 .JESSOP, Bob. Knowledge as a fictitious commodity: insights and limits of a Polanyian perspective. In: BUGRA, Ayse; AGARTAN, Kaan. Reading Karl Polanyi for the twenty-first century: market economy as political project. Basingstoke, UK: Palgrave, 2007. p. 115-133.KOSELLECK, R. Uma história dos conceitos: problemas teóricos e práticos. Revista Estudos Históricos. PPHPBC/CPDOC, Fundação Getulio Vargas (FGV), v. 5, nº. 10. 1992.LABAREE, David F. School syndrome: Understanding the USA’s magical belief that schooling can somehow improve society, promote access, and preserve advantage. Journal of Curriculum Studies, (2012), nº 44:2, 143-163, DOI: 10.1080/00220272.2012.675358.LAMUCCI, Sérgio. Investimento público no Brasil é segundo menor entre 42 países. O Valor. 28 nov. 2018. Extraído de <https://www.valor.com.br/brasil/6002811/investimento-publico-no-brasil-e-segundo-menor-entre-42-paises>. Acesso em 28 Fev 2018.LAURENT, Alain. L'individualisme méthodologique. (Coleção: Que sais-je). Paris: PUF, 1994.LOBATO, E. Graduado ocupa emprego de nível médio. Folha de S. Paulo. Extraído de <www.uol.com.br/folha>, publicado em 04 fev. 2008, acesso em 04 fev. 2008.MARGINSON, S. Public/private in higher education: a synthesis of economic and political approaches. Working paper nº. 1, June 2016, London: Centre for Global Higher Education and HEFCE.MARX, K. O Capital, Vols. I a III, Livros Primeiro (Tomos 1 e 2) e Segundo, Ed. Nova Cultural, 2ª ed., São Paulo, 1985.NCES. Elementary and Secondary Education. National Center for Education and Statistics. Educational institutions Extraído de <https://nces.ed.gov/fastfacts/display.asp?id=372>). Acesso em 31 Jan 2019.NOSELLA, P.; AZEVEDO, M. L. N. A Educação em Gramsci. Revista Teoria e Prática da Educação, v. 15, nº. 2, p. 25-33, maio./ago. 2012.NYE, Joseph S., JR. Soft Power. Foreign Policy, nº. 80, Twentieth Anniversary (Autumn, 1990), pp. 153-171.OCDE. Human Capital Investment. Paris: OCDE, 1999.OECD. Education Indicators in Focus – January 2017. OECD 2017.OECD. Education at a Glance. OECD Indicators. OECD Publishing: Paris, 2018.OECD. Purchasing power parities (PPP). Extraído de <https://data.oecd.org/conversion/purchasing-power-parities-ppp.htm>. Acesso em 20 fev. 2019.PELEGRINI, T.; AZEVEDO, M. L. N. A Educação nos anos de chumbo: a Política Educacional ambicionada pela “Utopia Autoritária” (1964-1975). História e-História, v. 1, p. 1-15, 2006.POLANYI, K.. A Grande transformação. As origens da nossa época. Tradução de Fanny Wrobel. Rio de Janeiro, Campus, 1980.ROBERTSON, S.; DALE, R.. Toward a critical cultural political economy of the globalisation of education, Globalisation, Societies and Education, 13 (1), 149-170, 2015.ROSSI, Wagner G. Capitalismo e Educação. São Paulo: Moraes, 1980.SALM, Claúdio L. Escola e Trabalho. São Paulo: Brasiliense, 1980.SAMUELSON, P. A. The Pure Theory of Public Expenditure. The Review of Economics and Statistics, Vol. 36, nº. 4 (Nov., 1954), pp. 387-389.SCHULTZ, T. W. O capital humano: investimento em educação e pesquisa. Rio de Janeiro: Zahar, 1973.SCHULTZ. T. W. O valor econômico da educação. Rio de Janeiro: Zahar, 1973.STANDING, G. O precariado: a nova classe perigosa. São Paulo: Autêntica, 2013.STEIN, Luciana. Os mileuristas definem novo padrão de consumo. O Valor Econômico. Extraído de http://www.valoronline.com.br/valoreconomico/285, Acesso 21 fev. 2008.TAVARES, P. A. Papel do capital uumano na desigualdade salarial no Brasil no período de 1981 a 2006. Dissertação (Mestrado em Economia). São Paulo, FEA-USP, 2007.TROW, M. A. Reflections on the Transition from Elite to Mass to Universal Access: Forms and Phases of Higher Education in Modern Societies since WWII. 2005. UC Berkeley: Institute of Governmental Studies. Retrieved from https://escholarship.org/uc/item/96p3s213. Acesso em 01 Feb. 2019.UNESCO. Compendio Mundial de Educación. Montreal: Instituto de Estadística de la UNESCO (UIS), 2007.UNESCO. Educatin for All by 2015. Will we make it? Paris: UNESCO, 2008.UNESCO. Declaração de Incheon: Educação 2030: Rumo a uma Educação de Qualidade Inclusiva e Equitativa e à Educação ao Longo da Vida para Todos. Conference: World Education Forum, Incheon, Korea R, 2015.

Bullying behaviour can have a negative impact on a child's physical and psychological health. Bullying in the classroom is a challenge for early-childhood educators. Preschool is the first place outside the home where children face social challenges when interacting with their classmates. Child-Friendly Class is the first step and part of the Children Friendly School (CSF) as a UNICEF program and an important Indonesian government policy to prevent the emergence of child bullying behaviour. This study aims to identify needs in the process of developing a Child-Friendly Classroom Management model to anticipate bullying behaviour. This research and development method uses an adaptation of the Rowntree model which includes three stages of the process and data collection techniques using interviews, questionnaires, and observation. The results of this study indicate that the preparation of an effective classroom management guidebook to create child-friendly classes needs to be followed up immediately. Several findings related to teachers' perceptions of classroom management, and child-friendly classes prove that child-friendly classes have not been implemented properly in PAUD institutions, with bullying behaviour still appearing in early childhood in PAUD institutions. PAUD teachers understand that it is important to implement classroom management but so far there has been no manual on how to manage effective classrooms as well as training related to the implementation of effective classroom management. The creation of child-friendly classes is believed to be able to help teachers suppress the emergence of bullying behaviour in early childhood. Keywords: Child-Friendly Classroom Management, Bullying Prevention, Early Childhood Education References: Allday, R. A., Hinkson-Lee, K., Hudson, T. M., Neilsen-Gatti, S., Kleinke, A., & Russel, C. S. (2012). Training General Educators to Increase Behavior-Specific Praise: Effects on Students with EBD. Behavioral Disorders, 37, 87–98. Alsaker, F. D., & Valkanover, S. (2012). The Bernese Program against Victimization in Kindergarten and Elementary School. New Directions for Youth Development, 2012(133), 15–28. https://doi.org/10.1002/yd.20004 Arseneault, L., Walsh, E., Trzesniewski, K., Newcombe, R., Caspi, A., & Moffitt, T. E. (2006). Bullying Victimization Uniquely Contributes to Adjustment Problems in Young Children: A Nationally Representative Cohort Study. PEDIATRICS, 118(1), 130–138. https://doi.org/10.1542/peds.2005-2388 Benedict, E., Horner, R. H., & Squires, J. (2007). Assessment and Implementation of Positive Behavior Support in Preschools. Topics in Early Childhood Special Education, 27, 174–192. Boz, Y. (2008). Turkish student teachers’ concerns about teaching. European Journal of Teacher Education, 31(4), 367–377. https://doi.org/10.1080/02619760802420693 Bradshaw, C. P., & Johnson, R. M. (2011). The Social Context of Bullying and Peer Victimization: An Introduction to the Special Issue. Journal of School Violence, 10(2), 107–114. https://doi.org/10.1080/15388220.2011.557145 Bradshaw, C. P., Sawyer, A. L., & O’Brennan, L. M. (2009). A Social Disorganization Perspective on Bullying-Related Attitudes and Behaviors: The Influence of School Context. American Journal of Community Psychology, 43(3–4), 204–220. https://doi.org/10.1007/s10464-009-9240-1 Bullock, J. R. (2002). Bullying among Children. Childhood Education, 78(3), 130–133. https://doi.org/10.1080/00094056.2002.10522721 Çobanoğlu, F., Ayvaz-Tuncel, Z., & Ordu, A. (2018). Child-friendly Schools: An Assessment of Secondary Schools. Universal Journal of Educational Research, 6(3), 466–477. https://doi.org/10.13189/ujer.2018.060313 Cothran, D. J., Kulinna, P. H., & Garrahy, D. A. (2003). “This is kind of giving a secret away...”: Students’ perspectives on effective class management. Teaching and Teacher Education, 19(4), 435–444. https://doi.org/10.1016/S0742-051X(03)00027-1 Cross, D., Monks, H., Hall, M., Shaw, T., Pintabona, Y., Erceg, E., Hamilton, G., Roberts, C., Waters, S., & Lester, L. (2011). Three‐year results of the Friendly Schools whole‐of‐school intervention on children’s bullying behaviour. British Educational Research Journal, 37(1), 105–129. https://doi.org/10.1080/01411920903420024 Cross, D., Pintabona, Y., Hall, M., Hamilton, G., & Erceg, E. (2004). Validated Guidelines for School-Based Bullying Prevention and Management. International Journal of Mental Health Promotion, 6(3), 34–42. https://doi.org/10.1080/14623730.2004.9721937 Cross, D., Runions, K. C., Shaw, T., Wong, J. W. Y., Campbell, M., Pearce, N., Burns, S., Lester, L., Barnes, A., & Resnicow, K. (2019). Friendly Schools Universal Bullying Prevention Intervention: Effectiveness with Secondary School Students. International Journal of Bullying Prevention, 1(1), 45–57. https://doi.org/10.1007/s42380-018-0004-z Evertson, C. M., & Weinstein, C. S. (2012). Handbook of Classroom Management: Research, Practice, and Contemporary Issues. Fox, B. H., Farrington, D. P., & Ttofi, M. M. (2012). Successful Bullying Prevention Programs: Influence of Research Design, Implementation Features, and Program Components. Research Design, 6, 10. Georgiou, S. N. (2008). Bullying and victimization at school: The role of mothers. The British Journal of Educational Psychology, 78 Pt 1, 109–125. Hammarberg, T. (1998). A School for Children with Rights. UNICEF International Child Development Centre. Hymel, S., & Swearer, S. M. (2015). Four decades of research on school bullying: An introduction. American Psychologist, 70(4), 293–299. https://doi.org/10.1037/a0038928 Johansen, A., Little, S. G., & Akin-Little, A. (2011). An Examination of New Zealand Teachers’ Attributions and Perceptions of Behaviour, Classroom Management, and the Level of Formal Teacher Training Received in Behaviour Management. King, E. (2020). Implications for the child friendly schools policy within Cambodia’s cultural and primary school context. Asia-Pacific Journal of Teacher Education, 48(4), 375–388. https://doi.org/10.1080/1359866X.2019.1645811 Kirves, L., & Sajaniemi, N. (2012). Bullying in early educational settings. Early Child Development and Care,182(3–4), 383–400. https://doi.org/10.1080/03004430.2011.646724 MacSuga, A. S., & Simonsen, B. (2011). Increasing Teachers’ Use of Evidence-Based Classroom Management Strategies through Consultation: Overview and Case Studies. Beyond Behavior, 20, 4–12. Maida, P. (2006). Child-Friendly-School-Manual. UNICEF. Modipane, M., & Themane, M. (2014). Teachers’ social capital as a resource for curriculum development: Lessons learnt in the implementation of a Child-Friendly Schools programme. South African Journal of Education, 34(4), 1–8. https://doi.org/10.15700/201412052105 Monks, C. P., Smith, P. K., & Swettenham, J. (2005). Psychological correlates of peer victimisation in preschool: Social cognitive skills, executive function and attachment profiles. Aggressive Behavior, 31(6), 571–588. https://doi.org/10.1002/ab.20099 Olweus, D. (1994). Bullying at School: Basic Facts and Effects of a School Based Intervention Program. Journal of Child Psychology and Psychiatry, 35(7), 1171–1190. https://doi.org/10.1111/j.1469-7610.1994.tb01229.x O’Neill, S. C., & Stephenson, J. (2011). Classroom behaviour management preparation in undergraduate primary teacher education in Australia: A web-based investigation. Australian Journal of Teacher Education, 36(10). https://doi.org/10.14221/ajte.2011v36n10.3 O’Neill, S., & Stephenson, J. (2012). Does classroom management coursework influence pre-service teachers’ perceived preparedness or confidence? Teaching and Teacher Education, 28(8), 1131–1143. https://doi.org/10.1016/j.tate.2012.06.008 Osher, D., Kelly, D. L., Tolani-Brown, N., Shors, L., & Chen, C.-S. (2009). American Institutes for Research 1000 Thomas Jefferson Street , NW Washington, DC 20007-3835. 13. Perren, S., Stadelmann, S., & Von Klitzing, K. (2009). Child and family characteristics as risk factors for peer victimization in kindergarten. Swiss Journal of Educational Research, 36(1), 13–32. https://doi.org/10.24452/sjer.36.1.4806 Reinke, W. M., Lewis-Palmer, T., & Merrell, K. (2008). The Classroom Check-up: A Classwide Teacher Consultation Model for Increasing Praise and Decreasing Disruptive Behavior. School Psychology Review, 37(3), 315–332. PubMed. Repo, L., & Sajaniemi, N. (2015). Prevention of bullying in early educational settings: Pedagogical and organisational factors related to bullying. European Early Childhood Education Research Journal, 23(4), 461–475. https://doi.org/10.1080/1350293X.2015.1087150 Rigby, K. (2003). Consequences of Bullying in Schools. The Canadian Journal of Psychiatry, 48(9), 583–590. https://doi.org/10.1177/070674370304800904 Rowntree, D. (1994). Preparing Materials for Open, Distance and Flexible Learning: An Action Guide for Teachers and Trainers. Kogan Page. https://books.google.com.jm/books?id=6Tf1kH6MQZ0C Sainio, M., Veenstra, R., Huitsing, G., & Salmivalli, C. (2011). Victims and their defenders: A dyadic approach. International Journal of Behavioral Development, 35(2), 144–151. https://doi.org/10.1177/0165025410378068 Salmivalli, C. (2002). Is there an age decline in victimization by peers at school? Educational Research, 44(3), 269–277. https://doi.org/10.1080/00131880210135331 Saracho, O. (2016). Contemporary Perspectives on Research on Bullying and Victimization in Early Childhood Education. Information Age Publishing, Incorporated. https://books.google.co.id/books?id=dalCDQAAQBAJ Saracho, O. N. (2017). Bullying Prevention Strategies in Early Childhood Education. Early Childhood Education Journal, 45(4), 453–460. https://doi.org/10.1007/s10643-016-0793-y Sempowicz, T., & Hudson, P. (2011). Analysing Mentoring Dialogues for Developing a Preservice Teacher’s Classroom Management Practices. Australian Journal of Teacher Education, 36(8). https://doi.org/10.14221/ajte.2011v36n8.4 Smith, J. D., Schneider, B. H., Smith, P. K., & Ananiadou, K. (2004). The Effectiveness of Whole-School Antibullying Programs: A Synthesis of Evaluation Research. School Psychology Review, 33, 547–560. Sourander, A., Ronning, J., Brunstein-Klomek, A., Gyllenberg, D., Kumpulainen, K., Niemelä, S., Helenius, H., Sillanmäki, L., Ristkari, T., Tamminen, T., Moilanen, I., Piha, J., & Almqvist, F. (2009). Childhood Bullying Behavior and Later Psychiatric Hospital and Psychopharmacologic Treatment. ARCH GEN PSYCHIATRY, 66(9), 9. Tauber, R. T. (2007). Classroom Management: Sound Theory and Effective Practice. Praeger Publishers. https://books.google.la/books?id=XiQFyR41kysC Ttofi, M. M., & Farrington, D. P. (2011). Effectiveness of school-based programs to reduce bullying: A systematic and meta-analytic review. Journal of Experimental Criminology, 7(1), 27–56. https://doi.org/10.1007/s11292-010-9109-1 Ttofi, M. M., & Farrington, D. P. (2012). Bullying prevention programs: The importance of peer intervention, disciplinary methods and age variations. Journal of Experimental Criminology, 8(4), 443–462. https://doi.org/10.1007/s11292-012-9161-0 Unal, Z., & Unal, A. (2012). The Impact of Years of Teaching Experience on the Classroom Management Approaches of Elementary School Teachers. International Journal of Instruction, 5, 41–60. UNICEF. (2007). Implementation Handbook for The Convention on The Rights of The Child (3th Edition). UNICEF. Vaillancourt, T., McDougall, P., Hymel, S., Krygsman, A., Miller, J., Stiver, K., & Davis, C. (2008). Bullying: Are researchers and children/youth talking about the same thing? International Journal of Behavioral Development, 32(6), 486–495. https://doi.org/10.1177/0165025408095553 Vlachou, M., Andreou, E., Botsoglou, K., & Didaskalou, E. (2011). Bully/Victim Problems Among Preschool Children: A Review of Current Research Evidence. Educational Psychology Review, 23(3), 329–358. https://doi.org/10.1007/s10648-011-9153-z Vlachou, M., Botsoglou, K., & Andreou, E. (2014). Bullying/Victimization in Preschool Children. https://doi.org/10.13140/2.1.5086.1764 Vreeman, R. C., & Carroll, A. E. (2007). A systematic review of school-based interventions to prevent bullying. Archives of Pediatrics & Adolescent Medicine, 161 1, 78–88. Witvliet, M., Olthof, T., Hoeksma, J. B., Goossens, F. A., Smits, M. S. I., & Koot, H. M. (2010). Peer Group Affiliation of Children: The Role of Perceived Popularity, Likeability, and Behavioral Similarity in Bullying. Social Development, 19(2), 285–303. https://doi.org/10.1111/j.1467-9507.2009.00544.x Yaşar, M. (2017). Adaptation of General System Theory and Structural Family Therapy Approach to Classroom Management in Early Childhood Education* *. 32.