Letteratura scientifica selezionata sul tema "Warren County (Ohio)"

A deep core from Warren County, Ohio, has yielded numerous fossils of Cambrian age. The specimens, which are among the first recorded from Cambrian rocks of Ohio, suggest revisions in the inferred ages of the Eau Claire and Mount Simon Formations in the Cincinnati Arch region. Trilobites indicative of Dresbachian (late Middle Cambrian to early Late Cambrian) and possibly Franconian (Late Cambrian) age are present in the upper Eau Claire Formation. By implication, the underlying Mount Simon Formation must be of earlier Dresbachian age or perhaps older. Identified trilobites from the Eau Claire Formation seem to be characteristic of inner-shelf lithofacies of Laurentia. Other body fossils from the Eau Claire Formation include inarticulate brachiopods and a graptolite. Body fossils in the lower Knox Dolomite include trilobite sclerites and echinoderm ossicles. Trace fossils are present in both units.

Recent excavations in Warren County, Ohio, within the shadow of monumental Fort Ancient have brought to light a large prehistoric alignment of limestone flagstones forming an effigy of a serpent. Radiocarbon dates indicate that this effigy was constructed in 1200 A.D. presumably by local peoples archaeologically designated as being of the Anderson focus (or phase) of the Fort Ancient aspect. Strong evidence indicates that this large “artifact” may have seen use as an astronomical ground marker for determining the summer solstice and important dates related thereto. A set of general and site specific hypotheses is presented to support this contention and to briefly discuss its cultural setting.

Boxwood (Buxus sempervirens L. and other species) is a popular evergreen shrub used in landscaping. In January 2012, three nursery-grown plants of cv. Green Gem boxwood were submitted from Warren County, Ohio to the C. Wayne Ellet Plant and Pest Diagnostic Clinic at The Ohio State University, an Ohio Plant Diagnostic Network laboratory. The plants, established for 4 years, exhibited orange to bronze discoloration of the foliage; foliage was not desiccated and dieback was not evident although stunting was present. Plant root symptoms ranged from nearly complete necrosis to distinct black lesions on living roots. A root scraping showed nematodes present in the lesions. Nematodes were extracted from root and soil subsamples with a Baermann funnel apparatus for 48 h (3). A high number of lesion nematodes (Pratylenchus sp.) were observed from both soil and root samples. Individual nematodes were handpicked and identified under a compound light microscope as Pratylenchus vulnus Allen & Jensen, 1951 according to morphologic and morphometric characteristics (2). Males and females were observed with stylets having rounded knobs, labial regions continuous with the body contour, and three to four lip annuli. The lateral field contained four incisures, with the two inner incisures closer to each other than to the outer ones. The esophagus overlapped the intestine ventrally. Female (n = 12) body length ranged from 410.3 to 654.5 μm (mean 583.0 μm), stylet length from 15.0 to 17.8 μm (mean 16.8 μm), tail length from 23.2 to 37.5 μm (mean 29.2 μm), vulva position from 78.9 to 85.6% (mean 81.7%), dorsal esophageal outlet (DGO) from 2.6 to 3.5 μm (mean 3.1 μm), and with functional oblong spermathecae. De Man ratios were as follows: a = 25.3 to 33.3 (mean 28.4), b = 4.1 to 7.6 (mean 6.0), c = 16.1 to 23.5 (mean 20.1), and c′ = 1.8 to 2.6 (mean 2.1). Male (n = 16) body length ranged from 478.0 to 589.0 μm (mean 537.9 μm), stylet length from 15.0 to 17.2 μm (mean 16.2 μm), tail length from 22.7 to 28.1 μm (mean 25.5 μm), spicule from 15.0 to 17.5 μm (mean 16.4 μm), gubernaculum from 3.5 to 4.7 μm (mean 4.0 μm), and DGO from 2.6 to 3.7 μm (mean 3.1 μm). De Man ratios were as follows: a = 26.4 to 36.3 (mean 30.5), b = 5.0 to 7.9 (mean 5.8), c = 19.1 to 23.0 (mean 21.1), and c′ = 1.6 to 2.4 (mean 2.0). DNA was extracted from single adult females and the D2-D3 expansion region of the 28S rRNA gene was amplified using forward primer ACAAGTACCGTGAGGGAAAGTTG and reverse primer TCGGAAGGAACCAGCTACTA (4). The PCR product was purified and sequenced. The sequence was deposited in GenBank (Accession No. JQ692308) and was compared with sequences previously deposited in GenBank by means of BLAST search. The comparison revealed a sequence similarity of 98 to 99% with P. vulnus (e.g., GenBank Accession Nos. HM469437.1, EU130886.1, and JQ003994.1). P. vulnus is a known pathogen of boxwood (1). To our knowledge, this is the first report of P. vulnus in Ohio. References: (1) K. R. Barker. Plant Dis. Rep. 58:991, 1974. (2) P. Castillo and N. Vovlas. Pratylenchus (Nematoda: Pratylenchidae): Diagnosis, Biology, Pathogenicity and Management. Koninklijke Brill NV, Leiden, the Netherlands, 2007. (3) D. J. Hooper. In: Laboratory Methods for Work with Plant and Soil Nematodes. J. F. Southey, ed. Reference book 402. Ministry of Agriculture, Fisheries and Food, London, 1986. (4) G. C. Tenente et al. Nematropica 34:1, 2004.

Abstract Abstract 1386 Background: Hyperacute TLS, defined as a rise in uric acid, potassium, lactate dehydrogenase (LDH), and/or phosphate that occurs within 4.5 hours and peaks 24–48 hours after flavopiridol, has been described in up to 40% of pts with CLL treated with this agent. Methods: A retrospective analysis of 116 pts with relapsed or refractory CLL treated with single agent flavopiridol at the Ohio State University on phase I or II protocols was conducted to determine predictive factors for TLS. Pts received flavopiridol 30–50 mg/m2 bolus + 30–50 mg/m2 4-hour continuous IV infusion (CIVI) on days 1, 8, 15, and 22 every 35 days or days 1, 8, and 15 every 28 days. Results: In 116 pts, the median age was 60 (range, 31–84), median number of prior therapies was 4 (range, 1–14), 69% pts were male, 79% were Rai stage III-IV, 53% had bulky disease ≥ 10 cm, 52% had splenomegaly, and 69% had del(17p) and/or del(11q). Median pre-treatment laboratory values included B2-microglobulin (B2M) 4.4 (range, 0.8–14.9), absolute lymphocyte count (ALC) 7134/mm3 (range, 0–266,310), white blood cell count (WBC) 13,950/mm3 (range, 1,300-314,500), and LDH 199 U/L (range, 102–654). The incidence of TLS was 46% (95% CI: 36%-55%), with 14 of 53 pts (26%) with TLS requiring dialysis. In univariable analyses using logistic regression, variables associated with the occurrence of TLS were female gender (p<0.001), number of prior therapies (p<0.001), Rai stage III-IV (p<0.001), bulky disease ≥ 10 cm (p<0.001), splenomegaly (p=0.04), del(11q) (p=0.03), ALC (p=0.004), WBC (p<0.001), B2M (p<0.001), and LDH (p=0.003). 72% of females, 36% of males, 59% pts with lymphadenopathy ≥ 10 cm, 31% pts with lymphadenopathy < 10 cm, 55% pts with del(11q), and 35% pts with del(17p) developed TLS. Median B2M and WBC values in pts without TLS were 3.1 and 8,300/mm3 compared to 5.3 and 27,000/mm3 in pts with TLS, respectively. In a multivariable analysis using limited backwards selection (Table 1), female gender, bulky adenopathy ≥ 10 cm, WBC, and B2M were significantly associated with TLS (p<0.05). Notably, only 3 of 24 pts with Rai stage I/II disease developed TLS, and the small numbers of Rai stage I-II pts precluded the use of this variable in the multivariable analysis. Therefore, the multivariable analysis was restricted to pts with Rai stage III/IV (n=92), and the same 4 variables in Table 1 remained significantly associated with TLS. TLS occurred in all pts (n=8) with WBC > 150,000/mm3, 75% pts with WBC 100–150,000, and 38% pts with WBC < 100,000/mm3. TLS rates were 74% and 19% in pts with B2M above and below the median (4.4), respectively. In a secondary analysis, we examined if peak flavopiridol and its glucoronide metabolite (flavo-G) levels correlated with TLS or gender. In a subset of 85 pts with available data, flavo-G levels were associated with TLS (p=0.001), but this was independent of pt gender. When peak flavo-G levels were distributed into quartiles, 50% women in the lowest quartile developed TLS compared to 93% in the highest quartile. Likewise, 14% of men with the lowest flavo-G levels developed TLS as opposed to 57% in the highest quartile. With respect to pt outcomes, 49% with TLS and 44% without TLS responded to flavopiridol. In a multivariable model controlling for number of prior treatments, cytogenetic risk group, Rai stage, age, and gender, response rates were not significantly different (p=0.34) in patients with and without TLS. However, overall survival (OS) and progression-free survival (PFS) were inferior in pts with TLS (p=0.03 and p=0.04, respectively). Eighty-six pts have died, including 13 of 14 pts with TLS who required dialysis. For pts with TLS that did not require dialysis, OS was not significantly different (p=0.88), although PFS was still worse in this subgroup (p=0.03, Figure 1). Conclusions: Female pts and pts with B2M ≥ 4.4, WBC ≥ 100,000/mm3, or bulky adenopathy ≥ 10 cm were at highest risk and should be monitored for hyperacute TLS with flavopiridol. TLS does not appear to be predictive of response or improved PFS in pts receiving flavopiridol. Supported by NCI K23 CA109004, NCI U01 CA076576, NCI N01 CM62207, LLS SCOR 7080-06, and the D. Warren Brown Foundation. Disclosures: Off Label Use: The efficacy of the cyclin dependent kinase inhibitor, flavopiridol is under investigation in CLL.

Although Diane Gilliam Fisher’s family migrated after World War II from the Appalachian Mountains to Columbus, Ohio, where she was born and reared, they maintained strong ties to Mingo County, West Virginia, and Johnson County, Kentucky. Fisher earned a PhD in Romance languages and literature from Ohio State University and an MFA from Warren Wilson College in Swannanoa, North Carolina, before settling into her professional life as a poet....