Articoli di riviste sul tema "W 20.5 f596d 1986"

Opracowanie niniejsze stanowi kontynuację badań skrajnych wartości temperatury powietrza w profilu pionowym. Wykorzystano tu wyniki badań prowadzonych od 1963 r. w Obserwatorium Agrometeorologicznym w Felinie k. Lublina. Dane obejmują maksymalną i minimalną temperaturę powietrza z termometrów cieczowych umieszczonych: w klatce meteorologicznej (200 cm), w klatkach sytemu Geigera-Tomanka (20, 50 i 150 cm) oraz w drewnianej żaluzjowej osłonie radiacyjnej na czarnym ugorze (5 cm). Odczyty wykonywano w terminach: 7(8), 13(14), 19(20) odpowiednio w półroczu zimowym i letnim. Pomiary wykorzystane w pracy obejmują okres od 1 stycznia 1986 r. do 31 grudnia 1995 r. Zastosowano tu podstawowe miary statystyczne: średnią arytmetyczną, odchylenie standardowe, skośność, kurtozę oraz regresję wielokrotną. Ponadto w postaci wykresów ramkowych przedstawiono rozkłady amplitudy dobowej temperatury powietrza na wszystkich wysokościach. W badanym okresie najwyższe średnie wartości temperatury wystąpiły w lipcu oraz na wysokości 150 cm. Zawsze najniższą średnią minimalną temperaturę obserwowano na poziomie 5 cm. W ciepłej połowie roku najwyższą średnią maksymalną temperaturę powietrza odnotowano na wysokości 20 cm, w połowie chłodnej najwyższe wartości wystąpiły na poziomie 50 cm. Największe amplitudy występowały w porze ciepłej z maksimum w lipcu. Wysokość 5 cm odznaczała się największą średnią amplitudą w całym roku. Amplituda dobowa temperatury powietrza największą zmienność wykazuje na wysokości 5 cm; w miarę wzrostu wysokości jej zmienność maleje. W przebiegu rocznym największą zmienność obserwowano w lecie – do wysokości 50 cm, natomiast powyżej największą zmienność zarejestrowano wiosną i jesienią. Przez większość roku rozkład amplitudy jest normalny, jedynie w zimie staje się prawostronnie asymetryczny, a w styczniu ponadto silnie skoncentrowany. Zauważa się znaczące różnice w zmienności amplitudy dobowej w warstwach powietrza 5–50 cm oraz 150–200 cm. Wyraźniejszy wpływ zachmurzenia i wilgotności na amplitudę dobową notuje się w półroczu ciepłym, a najsłabszy w zimie. Na wiosnę (III) oraz w lecie (V–VII) wilgotność względna nie wpływa na wartości amplitudy temperatury powietrza.

Celem badań była ocena wpływu stosowania kwalifikowanego materiału siewnego zbóż jarych i ziemniaków na plony i wyniki ekonomiczne produkcji. Analizę przeprowadzono na podstawie informacji o nakładach i produkcji zebranych na poziomie pojedynczych pól w postaci 28 tys. kart w latach 1986-2003 z około 500 gospodarstw prowadzących rachunkowość dla IERiGŻ. Stwierdzono, że na plantacjach, na których stosowano kwalifikowany materiał siewny lub sadzeniakowy uzyskiwano plony o 15-20% wyższe (o około 5 dt/ha). Wyniki ekonomiczne produkcji były jednak niższe o 3-10%.

Abstract Movse-Cuterebra Animal Systemic Insecticide Test, 1986: White mice are infested ocularly with 5 newly hatched larvae of Cuterebra fontinella Clark. Two days later, female mice are weighed and treated orally with candidate insecticides usually formulated in Tween 20; male mice have i plastic collar placed around their necks to prevent grooming, and their bodies are dipped into 80-200 ml of an emulsion of the candidate insecticide usuallv formulated as an EC (w/v) in xylene (65 parts), Triton X-100 (10 parts), and AI (25 parts). Highest dosages are 100 mg/kg orally and 1% dermally. Four days later, mice are killed and bodies examined carefully for encapsulated larvae usually found in the inguinal region. Effectiveness is determined by comparing numbers of larvae in treated mice with numbers in untreated mice. Probit analysis is conducted with corrected percent-kill data.

Abstract. We applied a global three-dimensional chemical transport model (GEOS-Chem) to examine the impacts of the East Asian monsoon on the interannual variations of mass concentrations and direct radiative forcing (DRF) of black carbon (BC) over eastern China (110–125° E, 20–45° N). With emissions fixed at the year 2010 levels, model simulations were driven by the Goddard Earth Observing System (GEOS-4) meteorological fields for 1986–2006 and the Modern Era Retrospective-analysis for Research and Applications (MERRA) meteorological fields for 1980–2010. During the period of 1986–2006, simulated June–July–August (JJA) and December–January–February (DJF) surface BC concentrations were higher in MERRA than in GEOS-4 by 0.30 µg m−3 (44 %) and 0.77 µg m−3 (54 %), respectively, because of the generally weaker precipitation in MERRA. We found that the strength of the East Asian summer monsoon (EASM; East Asian winter monsoon, EAWM) negatively correlated with simulated JJA (DJF) surface BC concentrations (r = −0. 7 (−0.7) in GEOS-4 and −0.4 (−0.7) in MERRA), mainly by the changes in atmospheric circulation. Relative to the 5 strongest EASM years, simulated JJA surface BC concentrations in the 5 weakest monsoon years were higher over northern China (110–125° E, 28–45° N) by 0.04–0.09 µg m−3 (3–11 %), but lower over southern China (110–125° E, 20–27° N) by 0.03–0.04 µg m−3 (10–11 %). Compared to the 5 strongest EAWM years, simulated DJF surface BC concentrations in the 5 weakest monsoon years were higher by 0.13–0.15 µg m−3 (5–8 %) in northern China and by 0.04–0.10 µg m−3 (3–12 %) in southern China. The resulting JJA (DJF) mean all-sky DRF of BC at the top of the atmosphere was 0.04 W m−2 (3 %; 0.03 W m−2, 2 %) higher in northern China but 0.06 W m−2 (14 %; 0.03 W m−2, 3 %) lower in southern China. In the weakest monsoon years, the weaker vertical convection at the elevated altitudes led to the lower BC concentrations above 1–2 km in southern China, and therefore the lower BC DRF in the region. The differences in vertical profiles of BC between the weakest and strongest EASM years (1998–1997) and EAWM years (1990–1996) reached up to −0.09 µg m−3 (−46 %) and −0.08 µg m−3 (−11 %) at 1–2 km in eastern China.

Abstract Several formulations of Bacillus thuringiensis var. kurstaki (B.t.k.) and Thuringiensin (|3-exotoxin), a secondary metabolite of certain B.t. strains, were tested for control of tobacco budworm and tobacco hornworm larvae on ‘Speight G-28’ flue-cured tobacco at Oxford, NC. These materials were: Dipel 2X (wettable powder; 32.0 billion international units (BIU)/kg), Dipel 4L (emulsifiable suspension; 8.5 BlU/liter), Dipel 10G (granular; 1.6 BlU/kg), ABG-6158 (emulsifiable suspension; Dipel 8ES; 16.9 BlU/liter), ABG-6167 (aqueous flowable; Dipel 8AF; 16.9 BlU/liter), ABG-6181 (granular; Dipel 14G; 2.24 BIU/ kg), ABG-6200 (granular; Thuringiensin-G; 0.3% w/w Thuringiensin), ABG-6206 (wettable powder; Thuringiensin Calcium, 10% w/w), Bactospeine FC (flowable concentrate; 9.3 BlU/liter), Bactospeine WP (wettable powder; 16.0 BlU/kg), Bactospeine G 12/14 (granular; 2.8 BlU/kg; 12/14 mesh carrier), and Bactospeine G 14/40 (granular; 2.8 BlU/kg; 14/40 mesh carrier). Orthene Tobacco Insect Spray (TIS)(75SP) was used as an insecticide check. Tobacco was transplanted on 19 and 27 May into a field of Helena sandy loam which had been treated with isopropalin (Paarlan, 1.68 kg Al/ha) and metalaxyl (Ridomil 2E, 0.56 kg Al/ha) for weed and disease control. Diphenamid (Enide 90W, 4.48 kg Al/ha) was applied on 16 Jun for additional weed control. Plants were placed on 55.9-cm centers with 1.22 m between rows. Single row plots of 30 plants (experiments 1-4) or 20 plants (experiments 5 and 6) were set up in randomized complete block designs with 4 (experiment 4) or 5 (Experiments 1-3, 5, and 6) replicates. On 24 Jul, plants in one half of the field were cut off ca. 10 cm above the ground. One sucker was allowed to regrow from each plant, and this regrowth was used in experiments 5 and 6. Plants were infested with two 2 to 3-day-old tobacco budworm larvae (Experiments 1, 2, 5, and 6) or two 3-4-day-old tobacco hornworm larvae (experiments 3 and 4) from laboratory colonies on 25 Jun, and 1, 15, 22 Jul, and 11 and 12 Aug for experiments 1-6, respectively. Seldom does more than one budworm larvae survive per plant in the untreated controls. A new tobacco budworm laboratory colony is started yearly from larvae collected from tobacco in the late summer. The tobacco hornworm colony has been in continuous culture for 21 years. Plots were treated on 27 Jun, 3, 17, 24 Jul, and 14 and 15 Aug. Spray applications were made by a CO2-powered backpack sprayer with an adjustable nozzle at a rate of 233.8 l/ha with 4.1 × 105 Pa. Granular materials were measured into individual 30-ml cups for each plant, then sprinkled by hand from a height of 15-30 cm over each tobacco bud. There were no buffer rows between plots, but spraying was done in the early mornings when winds were negligible. An additional set of unsprayed check plots were set up for the hornworm experiments (3 and 4) in a remote field to help identify drift problems between plots. No drift problems were encountered in either experiment. Live larvae were counted 3 or 4 days after spraying for all experiments. Live larvae were also counted on day 7 for experiment 1, and damage ratings (0-7) were made on day 7 for experiment 2. All data were transformed to Vx + 0.5 before analysis of variance, but data are presented in the tables as untransformed means. Means were separated using Waller-Duncan k-ratio t-test; k = 100, a = 0.05.

Dynamic one-legged knee extension (DKE) is commonly used to examine physiological responses to “aerobic” exercise. Muscle blood flow during DKE is often expressed relative to quadriceps femoris muscle mass irrespective of work rate. This is contrary to the notion that increased force is achieved by recruitment in large muscles. The purpose of this study, therefore, was to determine muscle use during DKE. Six subjects had magnetic resonance images taken of their quadriceps femoris before and after 4 min of DKE at 20 and 40 W. Muscle use was determined by shifts in T2. The cross-sectional area of quadriceps femoris that had an elevated T2 was 16 ± 1% (mean ± SE) preexercise, and 54 ± 5 and 94 ± 4% after 20- and 40-W DKE, respectively. Volume of quadriceps femoris increased 11.4 ± 0.2% ( P = 0.006), from 2,230 ± 233 cm3before exercise to 2,473 ± 232 cm3 after 40-W DKE. Extrapolation of these data indicates that 1,301 ± 111 cm3 of quadriceps femoris were engaged during 20-W DKE compared with 2,292 ± 154 cm3 during 40-W DKE. By using muscle blood flow data for submaximal DKE at 20 W [P. Andersen and B. Saltin. J. Physiol. (Lond.)366: 233–249, 1985; and L. B. Rowell, B. Saltin, B. Kiens, and N. J. Christensen. Am. J. Physiol. 251 ( Heart Circ. Physiol. 20): H1038–H1044, 1986] and estimating muscle use in those studies from our data (total muscle mass × 0.54), extrapolated blood flow to active muscle (263 and 278 ml ⋅ min−1 ⋅ 100 g−1, respectively) is comparable to that obtained during peak aerobic DKE when expressed relative to total muscle mass (243 and 250 ml ⋅ min−1 ⋅ 100 g−1, respectively). These findings indicate that increased power during aerobic DKE is achieved by recruitment. Additionally, they suggest that blood flow to the active quadriceps femoris muscle does not increase with increases in submaximal work rate but instead is maximal to support aerobic metabolism. Thus increases in muscle blood flow are directed to newly recruited muscle, not to increased perfusion of muscle already engaged.

In May 1997, ascochyta blight incited by Ascochyta lentis Vassiljevsky was observed at an incidence of less than 5% in lentil (Lens culinaris Medik.) fields in Umbria (Central Italy). Symptoms appeared on leaves and stems as tan spots surrounded by a dark margin. Small black pycnidia that produced a pink exudate containing hyaline, 1 septate, 14.2 to 15.8 × 3.5 μm conidia under high humidity were visible in the center of the spots. The fungus was consistently isolated on potato dextrose agar from diseased leaves or stems. To satisfy Koch's postulates, a conidial suspension (106 conidia per ml) of the fungus was sprayed on leaves of 20-day-old lentil plants (landrace Castelluccio) that were maintained in a humidity chamber for 96 h after inoculation. Lesions resembling symptoms that occurred in the field were observed on plants 3 weeks after inoculation. Symptoms were not observed on control plants sprayed with water. The fungus reisolated from the diseased plants was identical to the original isolates. Based on morphological characteristics of pycnidia and conidia as well as pathogenicity, the fungus was identified as A. lentis. A deep-freeze blotter method (2) was used to detect A. lentis in lentil seeds of 20 local landraces used by Umbrian farmers and two accessions from Canada and Turkey, as well as in seed collected from infected fields. The fungus was present only in the two lentil accessions with an incidence of about 5%. Although the fungus had been isolated from Italian seed germplasm in 1986 (1), this is the first report of ascochyta blight occurring in lentil crops in Italy. The heavy rainfalls that characterize the first stage of lentil cultivation in Umbria are favorable for disease development while hot and dry conditions that usually occur during flowering and maturation prevent the dissemination of inoculum and the infection of the seeds. For these reasons, some Umbrian areas could be more suitable for production of ascochyta-free lentil seeds. References: (1) W. J. Kaiser and R. M. Hannan. Phytopathology 76:355, 1986. (2) T. Limonard. Proc. Int. Seed Test. Assoc. 33:343, 1968.

A total of 57 comparative hauls using a rectangular midwater trawl with a fishing mouth area of 50 m2 (RMT 50) were carried out along the sides of an imaginary triangle south of Madeira in 1986. A total of 1258 cephalopods were caught, giving a mean of 22 per haul with a range from 0 to 67. The nets were used with a diver's light on the top bar which was either switched off or was operated with a 20, 70 or 150 W bulb, powered by a car battery. A significantly greater number of individuals per haul was caught with lights on than without lights, increasing from a mean of 13·5–25·1, a factor of 1·8. Similarly, the number of species caught was increased from a mean of 7 to 10·4, a factor of 1·5 and the volume of cephalopods was increased from a mean of 41·1–162·3ml, a factor of 3·9. Similar comparisons made for catches during day or night separately and on the three courses separately also showed marked increases with the lights. Samples show that increase in power of the lights increased the total number of cephalopod individuals caught. In the 12 species with more than ten individuals, in 33 of the 36 comparisons (of number of individuals, species and volumes) there is an increase with the light. The most influenced species was Taonius pavo which increased in numbers by a mean factor of 3·9 times with 20W, 4·0 times with 70W and 6·1 times with 150W when compared with the numbers caught with no light.

The basidiomycete Heterobasidion annosum (Fr.) Bref. (=Fomes annosus (Fr.) Cooke), one of the most important pathogens in coniferous forests in Europe, Asia, and North America, causes root and butt rot. H. annosum was first recorded on Pinus pinaster Ait. (commonly known as Maritime pine) in France and Great Britain in 1961 (4) and Portugal in 1986 (2). P. pinaster is the most widespread conifer in Spain, with more than 700,000 and 600,000 ha in pure and mixed stands, respectively. Over the last few years, P. pinaster decline was observed in several stands in the center of the Iberian Peninsula. Unusual crown transparency, small needles, foliage discoloration, and early tree death are characteristic decline symptoms associated with the high mortality rate on this species. In June of 2010, 11 trees (40 to 60 years old) with a different degree of decline were felled in two zones (42°2′41″N, 3°18′14″W, elevation 1,096 m and 41°55′40″N, 3°12′3″W, elevation 1,128 m) and cut into sections (stump height, breast height, and near the top). Wood slices were removed from each section and taken to the laboratory. Samples were placed in moist chambers with optimal conditions of humidity and temperature to enhance pathogen growth. After 20 days of incubation in darkness at 25°C, H. annosum (anamorph Spiniger meineckellum [A. Olson] Stalpers) occurred on most of these slices. Conidiophores with subglobose to pyriform conidia (5.8 × 4.2 μm) were observed with a compound microscope. The fungus was isolated to extract DNA by disruption of the mycelium followed by washes with phenol/chloroform/isoamyl alcohol solution (25:24:1). DNA was precipitated with 20% polyethylene glycol solution. PCR was carried out according to the instructions of the manufacturer of Dynazyme II DNA polymerase (Finnzymes Ltd, Espoo, Finland) with ITS primers, 1F (5′-CTTGGTCATTTAGAGGAAGTAA-3′) and 4 (5′-TCCTCCGCTTATTGATATGC-3′). After DNA purification, samples were sequenced (SECUGEN, Madrid, Spain) and aligned and corrected with Geneious Pro 5.3 to obtain the consensus sequences. Resulting DNA sequences of two isolates were deposited in GenBank (Nos. FR850494 and FR850495), and compared with a Blastn search at GenBank showing 100% identity and 100% coverage with H. annosum sensu stricto, former ISG-P (intersterility group of pines). For pathogenicity tests, 10 seedlings (2 year old) were inoculated with autoclaved P. pinaster wood chips colonized by H. annosum, and 10 control seedlings were inoculated with noncolonized wood chips. Inoculums were prepared by growing H. annosum on 4-mm-diameter wood chips placed on potato dextrose agar media for 3 weeks. The wood chips were put inside an oblique incision made at 6 cm above the soil line and wrapped with Parafilm. After 8 weeks in a growth chamber at 22.5°C with a 14-h photoperiod, the inoculated seedlings showed typical symptoms and 3 seedlings of 10 were dead. H. annosum was previously recorded on P. sylvestris in central Spain (1), causing needle drop, swelling at the stump height, and presence of dead trees by circular areas. This pathogen was also reported on P. nigra in northeastern Spain, associated with defoliation and mortality (3). To our knowledge, this is the first record of H. annosum on P. pinaster in Spain. References: (1) J. Benito-Martínez. An. Jardín Bot. Madrid 3:23, 1943. (2) N. Neves et al. EPPO Bull. 16:505, 1986. (3) J. Oliva et al. Bol. Sanidad Vegetal. Plagas. 34:415, 2008. (4) P. Spaulding. US Dep. Agric. Agric. Handb. 197:100, 1961.

U7 small nuclear RNA (snRNA) is an essential component of the RNA-processing machinery which generates the 3' end of mature histone mRNA in the sea urchin. The U7 small nuclear ribonucleoprotein particle (snRNP) is classified as a member of the Sm-type U snRNP family by virtue of its recognition by both anti-trimethylguanosine and anti-Sm antibodies. We analyzed the function-structure relationship of the U7 snRNP by mutagenesis experiments. These suggested that the U7 snRNP of the sea urchin is composed of three important domains. The first domain encompasses the 5'-terminal sequences, up to about nucleotides 7, which are accessible to micrococcal nuclease, while the remainder of the RNA is highly protected and hence presumably bound by proteins. This region contains the sequence complementarities between the U7 snRNA and the histone pre-mRNA which have previously been shown to be required for 3' processing (F. Schaufele, G. M. Gilmartin, W. Bannwarth, and M. L. Birnstiel, Nature [London] 323:777-781, 1986). Nucleotides 9 to 20 constitute a second domain which includes sequences for Sm protein binding. The complementarities between the U7 snRNA sequences in this region and the terminal palindrome of the histone mRNA appear to be fortuitous and play only a secondary, if any, role in 3' processing. The third domain is composed of the terminal palindrome of U7 snRNA, the secondary structure of which must be maintained for the U7 snRNP to function, but its sequence can be drastically altered without any observable effect on snRNP assembly or 3' processing.

U7 small nuclear RNA (snRNA) is an essential component of the RNA-processing machinery which generates the 3' end of mature histone mRNA in the sea urchin. The U7 small nuclear ribonucleoprotein particle (snRNP) is classified as a member of the Sm-type U snRNP family by virtue of its recognition by both anti-trimethylguanosine and anti-Sm antibodies. We analyzed the function-structure relationship of the U7 snRNP by mutagenesis experiments. These suggested that the U7 snRNP of the sea urchin is composed of three important domains. The first domain encompasses the 5'-terminal sequences, up to about nucleotides 7, which are accessible to micrococcal nuclease, while the remainder of the RNA is highly protected and hence presumably bound by proteins. This region contains the sequence complementarities between the U7 snRNA and the histone pre-mRNA which have previously been shown to be required for 3' processing (F. Schaufele, G. M. Gilmartin, W. Bannwarth, and M. L. Birnstiel, Nature [London] 323:777-781, 1986). Nucleotides 9 to 20 constitute a second domain which includes sequences for Sm protein binding. The complementarities between the U7 snRNA sequences in this region and the terminal palindrome of the histone mRNA appear to be fortuitous and play only a secondary, if any, role in 3' processing. The third domain is composed of the terminal palindrome of U7 snRNA, the secondary structure of which must be maintained for the U7 snRNP to function, but its sequence can be drastically altered without any observable effect on snRNP assembly or 3' processing.

Bitar FF, Jawdi RA. Dbaibo GS, Yunis KA, Gharzeddine W. Obeid M. Paediatric infective endocarditis: 19‐year experience at a tertiary care hospital in a developing country. Acta Pædiatr 2000; 89: 427‐30. Stockholm ISSN 0803‐5253A retrospective study was undertaken to study children who presented with infective endocarditis (IE) to a university teaching hospital in Beirut, Lebanon, between January 1977 and May 1995. Of 41 patients with IE (24f, 17M), 28 (68%) were diagnosed between 1977 and 1985. Patients' ages ranged from 3 to 18 y (mean age 11.3 ± 2.8 y), and 13 patients were <10 y of age. Clinical presentations included: fever (in 88%), heart failure (in 39%), neurologic findings (in 20%) and embolic phenomena (in 22%). Nineteen patients (46%) had underlying congenital heart disease (CHD) with tetralogy of Fallot and pulmonary stenosis being the most common. Sixteen patients (39%) had underlying rheumatic heart disease (RHD). A total of 5 children (12%) with normal cardiac anatomy had IE. One had underlying acquired viral myocarditis with mitral insufficiency. Echocardiography showed vegetations in 60%. Blood cultures were positive in 31 patients (76%). IE occurred in three patients following cardiac surgery. In one patient it occurred within 2 mo of surgery and in the other two it occurred within 6 mo. Streptococcus viridans and Staphylococcus aureus were the two most commonly isolated bacteria. Overall mortality rate was 29% (not statistically significant between patients presenting between 1977‐1985 and 1986‐1995; p = 0.17). There was no statistically significant difference in mortality among the groups (five in the group with CHD, six with RHD and one with structurally normal heart).

Abstract The recent sedimentary basins in Central Tunisia correspond to a set of depocenters with complex geometry which are bounded by E-W, N070 and N-S brittle structures. These bordering faults, active during Eocene and Cretaceous times, have been rejuvenated at the end of the Neogene and during Quaternary in a relay pattern system associated with compressive and extensive deformations according to the alternance of extension and compression phases (Tortonian Atlasic Phase of compression, post tectonic top Miocene-early Pleistocene extension associated to the rifting of the Tyrrhenian Basin, and Pleistocene Phase of compression). These tectonic regime changes involve subsidence inversions. Moreover, the neotectonic study carried out along the strike-slip faults corridories and their associated structures enable us : – to precise the timing of the tectonic deformations ; – to establish tectono-sedimentary relationships of Mio-Plio-Quaternary age. Introduction : geodynamical context and objectives of the study. – In Central Tunisia as in the whole Maghreb [Piqué et al., 1998 ; Piqué et al., 2002], the Mesozoic and Cenozoic evolution of sedimentary basins is largely controlled by tectonic heredity due to rejuvenation of basement discontinuities. In fact, previous studies have shown that the normal kinematics activity of The Sbiba-Cherichira fault has governed the opening and the distribution of the Cretaceous and the Eocene basins evolving in a globally extensive tectonic regime [Boltenhagen, 1981 ; El Ghali, 1993]. These old tectonics is proven, also, by the interpretation of NNE-SSW seismic profiles through this collapsed zone [Ben Ayed, 1986, fig. 3] and who reveal that subsidence had been active during the Lower Cretaceous and continued up to the Albian. In the late Miocene and early Quaternary, following the Langhian collision of Sardinia against the Northern Platform of Tunisia [Cohen et al., 1980], the Atlasic and Villafranchian Phases of compression are the most important. They were responsible for the formation of important N040° to N070°E Atlasic folds , N040° to N090°E thrusts , the opening of N120° to N150° E basins parallel to the shortening axis and E-W strike slip fault [Burollet, 1956 ; Ben Ayed, 1986]. In this paper, we present and discuss results of research carried out in the Sbiba-Cherichira area. This research combines interpretation of sedimentological observations and microtectonic or structural field studies [El Ghali et Batik, 1992] carried out along and near the Sbiba-Cherichira faults system, which corresponds to two separated master faults (fig. 2): – the « Southern Sbiba Fault » developed to the west with a direction N090°E which acted as is the southern boundary of the “Sbiba Trough” subsident area as early as the Albian (fig. 3) ; – the “Cherichira Fault” developed to the north-east with a direction N070°E. These faults are connected by the N040°E Labaied-Trozza Fault. Tortonian tectonic activity. – During Tortonian compression (orientation of the shortening axis N120°to N140°E) [Burollet, 1956 ; Ben Ayed, 1986 ; Philip et al., 1986 ; Martinez et al., 1990], many transformations were induced in the studied area (fig. 4a). In fact, the E-W faults of Sbiba and the N070 to N90°E faults of Cherichira, disposed in left relay, were reactivated as dextral strike-slip faults inducing simultaneous distensive deformations (normal faults, grabens, half-grabens…) and compressive ones (folds, reverse faults, overlappings….) localised at fracturing extremity [El Ghali, 1993]. Compressive structures. – The brittle structures are associated with ductile deformations of two types : *The first one corresponds to en echelon folds including : – to the south of the E-W Sbiba Fault, in J. Tiouacha and J. Labaied, Eocene and Neogene strata which are involved in hectometric folds with a N040° to N060°E axial direction (fig. 4a) and an axial westward dip changing from 05° to 60°E ; – to the west of the J. Rebeiba fault, Lutetian and Oligocene to Lower Miocene Strata which are affected by hectometric folds with a N070° to N090°E direction (fig. 4a) and an axial westward dip, changing from 05°to 20°E [El Ghali, 1993]. All these folds are abruptly cut up by the master faults and they can be interpreted as en echelon fault propagation folds. * The second includes plurikilometric folds parallel to the strike slip faults : – the E-W anticline of J. Labaied due to the transpression responsible for reactivation of the southern Sbiba Fault with a dextral strike slip component (fig. 4a); – the N040°E anticline of J. Trozza and the N070°E anticline of J. Cherichira respectively associated with the Trozza-Labaied fault and the Cherichira fault. Because of their orientation approximatively normal to the shortening axis, these faults are reactivated reversed faults giving fault-bend folds [Suppe, 1983] thrusted to the SE with a decollement level in Triassic evaporites extruded along the fault between J. M’Rhila and J. Cherichira (fig. 4a). Distensive structures : syntectonic depocenters associated to dextral strike-slip faults. – The dextral strike-slip faults extremities develop as normal faults N140 to N160°E in the dampening zone (fig. 4a). The east and west endings of Sbiba strike slip fault are two distensive extremities the opening mecanism of which is compatible with that of a megasplit basin at a strike-slip extremity [Harding, 1973 ; Odonne, 1981 ; Granier, 1985 ; Faugère et al., 1986…]. Top Miocene to early Pleistocene tectonic activity. – During upper top Miocene and early Pleistocene times, the Sbiba Trough was characterized by a subsidence more important than in any other place in Tunisia and was filled by continental deposits of the Segui Formation (conglomerates, sands, black clays and lacustrine limestones, fig. 5). Subsidence (500m near Haffouz, 3000m in Sbiba Trough, fig. 4b) was controlled by the activity of synsedimentary normal and strike-slip faults, forming small grabens, monoclinal grabens N090° to N130°E trending often cut by the Sbiba Fault (figs. 4b and 7). This extension can be considered as a post-tectonic extension relative to the Atlasic phase of compression, the orientation of the tensile axis being the same. Pleistocene tectonic activity. – In Central Tunisia, a NNW-SSE compressive phase, intervening in early Quaternary, has been demonstrated out [Burollet, 1956 ; Ben Ayed, 1986 ; Philip et al., 1986]. This “Villafranchian phase” follows distensive strike-slip tectonics of top Miocene Lowermost Pleistocene [El Ghali, 1993] and involves subsidence inversion. This phase is manifested by reverse dextral strike-slip faults on E-W segments (Sbiba and Ain Grab faults, fig. 4c) and by SE vergence overlappings on the NE-SW segments of J. Trozza (fig. 6) and N070°E ones of Cherichira (fig. 8). In other places the top Miocene-early Pleistocene deposits of the Segui Formation are folded, producing in the Sbiba basin N070° to N090°E en echelon folds (fig. 4c) with westward or eastward axial dipping between 05° and 15°. In Jebel Ain Grab area, the folds are overturned and locally thrusted northwards producing a morphostructural dam. This latter limits to the south a sag filled with fluviatile and lacustrine deposits (fig. 9). Comparison with neighbouring regions and conclusions. – The Sbiba-Cherichira faults system correspond to an en-echelon strike slip fault inherited from a basement discontinuity. It recorded most of the main tectonic processes which affected the southern margin of the Tethys. In Central Tunisia, this faults system constitutes an evolution model of one of the major scars which affects the sedimentary cover and controls basins distribution and evolution since the Cretaceous to the Quaternary. * The Tortonian compressional episode corresponding to the Compression Atlasic Phase described from the Rif in Morocco to northern Tunisia [Viguier et al., 1980 ; Philip, 1983 ; Ben Ayed, 1986 ; Morel, 1989 ; Aite, 1995 ; Piqué et al., 2002]. The N120° to N130°E orientation of the shortening axis induced the most important transpression which has triggered the rejuvenation of the Sbiba-Cherichira system as a very active fault driving halokinesis of Triassic evaporites and large development of brittle and folded structures associated to wrench faulting activity as in the eastern platform of Tunisia (fig. 10) [Ellouz, 1984]. * During the top Miocene-early Pleistocene postectonic extension, the rejuvenation of older faults generated a multidirectional extension near the Sbiba-Cherichira faults system as in northern Tunisian platform [Tricart et al., 1994] or in the north-eastern platform and in the strait of Sicily [Bobier et Martin, 1976 ; Ellouz, 1984]. In the Sbiba and Haffouz basins, the multidirectional extension is responsible for the development, along the N070°E dextral strike slip faults and N120°E left lateral strike slip faults, of depocenters for the Segui Formation which is superimposed to Middle Cretaceous subident areas [El Ghali, 1993]. * The Upper-Pleistocene episode which corresponds to the Villafranchian Phase with a N170° to N180°E shortening axis in agreement with the convergence of the European and African Plate and very well documented from the southern margin of Grande Kabilie [Aite, 1995] to northern Tunisia [Ben Ayed, 1986]. Near Sbiba it induced formation of folds, thrusts or reversed faults forming morphostructural dams in which fluvio-lacustrine deposits are accumulated.

Transferrin receptors in detergent extracts of subcellular membrane fractions prepared from 3T3-L1 adipocytes were measured by a binding assay. There was a small but significant increase (1.2-fold) in the amount of receptor in a crude plasma membrane fraction and a 40% decrease in the number of transferrin receptors in microsomal membranes prepared from insulin-treated cells, when compared with corresponding fractions from control cells. Intracellular vesicles containing insulin-responsive glucose transporters (GT) have been isolated by immunoadsorption from the microsomal fraction (Biber, J. W., and G. E. Lienhard. 1986. J. Biol. Chem. 261:16180-16184). All of the transferrin receptors in this fraction were localized in these vesicles; however, because the GT vesicles contain approximately 30-fold fewer transferrin receptors than GT, on the average only one vesicle in three contains a transferrin receptor. The binding of 125I-pentamannose 6-phosphate BSA to 3T3-L1 adipocytes at 4 degrees C was used to monitor surface insulin-like growth factor II (IGF-II)/mannose 6-phosphate receptors. Exposure of cells to insulin at 37 degrees C for 5 min resulted in a 2.5-4.5-fold increase in surface receptors. There was a corresponding 20% decrease in the amount of IGF-II receptors in the microsomal membranes prepared from insulin-treated cells, as assayed by immunoblotting. Moreover, the IGF-II receptors and GT were located in the same intracellular vesicles, since antibodies to the carboxyterminal peptide of either protein immunoadsorbed vesicles containing 70-95% of both proteins initially present in the microsomal fraction. In conjunction with other studies, these results indicate that in 3T3-L1 adipocytes, three membrane proteins (the GT, the transferrin receptor, and the IGF-II receptor) respond similarly to insulin, by redistributing to the surface from intracellular compartment(s) in which they are colocalized.

In 2001, soybean fields were surveyed to determine the incidence of viruses because soybean aphids (Aphis glycines Matsamura), known to transmit Soybean mosaic virus (SMV) (2), were found in Ontario. In addition, bean leaf beetle (Cerotoma trifurcata Forster) was found during 2000 to be contaminated with Bean pod mottle virus (BPMV), although soybean plants, on which the beetles were feeding, tested negative (3). In the current survey, young soybean leaves were selected at random in July and August from 20 plants per site at growth stages R4 to R5 (1) from 415 sites representing the entire soybean-producing area in Ontario. Samples were maintained under cool conditions until received at the laboratory, where they were promptly processed. A combined sub-sample was obtained from the 20 plants per site. The 415 sub-samples were tested for SMV, BPMV, Tobacco ringspot virus (TRSV), and Tobacco streak virus (TSV) using polyclonal antibody kits for double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) (Agdia Inc., Elkart, IN). The ELISA plates were read with a plate reader (MRX, Dynex Technologies Inc., Chantilly, VA), and results were analyzed using ELISA software (Leading Edge Research, Merrickville, Ontario) and compared positive and negative controls (Agdia). TRSV was detected in one sample from Essex County and another sample from Middlesex County. SMV, BPMV, and TSV were not found in commercial soybean fields. However, SMV and BPMV were found in samples originating from two soybean breeding nurseries, one in Essex County and one in Kent County. Seedlings of soybean cv. Williams 82 were inoculated in the greenhouse with sap from leaf samples that tested positive for BPMV. Leaves of plants that developed mosaic symptoms were retested using ELISA and confirmed to be positive for BPMV. SMV and TRSV have been found previously in commercial soybean fields in Ontario (4). To our knowledge, this is the first report of BPMV on soybean plants in Canada. References: (1) W. R. Fehr et al. Merr. Crop. Sci. 11:929, 1971. (2) J. H. Hill et al. Plant Dis. 85:561, 2001. (3) A. U. Tenuta. Crop Pest. 5 (11):8, 2000. (4) J. C. Tu. Can. J. Plant Sci. 66:491, 1986.

Abstract The overall unfavorable prognosis of CD10 negative (CD10−) precursor B-cell acute lymphoblastic leukemia (BCP-ALL) is well known. We analyzed 4473 pediatric patients (pts) <18 years (y) with BCP-ALL and immunophenotyping of CD10 enrolled from 1986 to 2000 in three consecutive ALL-BFM trials to explore prognostic factors in the CD10− subset. CD10 negativity was defined by CD10 expression in <20% of blasts. 233 pts (5.2%) were CD10−. In comparison to CD10 positive (CD10+) BCP-ALL pts, CD10− pts comprised more infants (age <1y 34% vs. 1%, p(X2)<0.001), more cases with hyperleukocytosis (WBC ≥100/nl 43% vs. 6%, p<0.001), more CNS involvement (CNS positive 10% vs. 2%; p<0.001) and an impaired treatment response (prednisone poor response (PPR) 22% vs. 5%, p<0.001; induction failure 6% vs. 1%, p<0.001). Estimated probability of 5 years event free survival (5y-pEFS) was significantly lower in pts with CD10− as compared to CD10+ BCP-ALL (49±3% vs 81±0.6%, p(log-rank)<0.001). Cox regression analysis including age, WBC, prednisone response (PR) and MLL/AF4 status as covariables revealed CD10 negativity as independent prognostic factor (RR 1.5, 95% confidence interval (CI) 1.1–2.1, p=0.01). Further analyses were performed within the CD10− group: 83% of infants and 60% of pts ≥1y were successfully analyzed for MLL/AF4. MLL/AF4 was detected in 55% of pts <1y and 27% of pts ≥1y. The well known risk factors for BCP-ALL (sex, age, WBC, CNS involvement, MLL/AF4 and PPR) also had prognostic impact within the CD10− group: n* 5y-pEFS* (%) SE (%) p (log-rank) *5 pts w/o reinduction were excluded sex female 109 55 5 0.022 male 119 40 5 age <1y 78 25 5 <0.001 ≥1y 150 62 4 WBC <100/nl 128 62 4 <0.001 ≥100/nl 100 33 5 CNS neg 181 54 4 0.011 pos 21 33 10 MLL/AF4 neg 95 53 5 0.001 pos 61 29 6 PR good 170 57 4 <0.001 poor 50 30 6 Out of a number of immunophenotypic markers, analyzed at different expression cut-off points, CD24 at missing or weak expression of <40% and CD65 at high expression of ≥40% were significantly correlated with unfavorable clinical characteristics and worse outcome within the CD10− group. Significant correlation with PR could only be demonstrated for expression of CD24, which is presumed to act as negative regulator in B-cell development through mediation of apoptosis. age<1y* WBC ≥100/nl* MLL/AF4 pos* PPR# pEFS§ n/total (%) n/total (%) n/total (%) n/total (%) % ±SE * all p(X2)<0.01, #CD24 p=0.01, CD65 n.s., §all p(log-rank]<0.001 CD24 <40% 37/77 (48) 52/77 (68) 33/56 (59) 24/73 (33) 32 ±5 CD24 ≥40% 34/122 (28) 35/122 (29) 18/76 (24) 20/119 (17) 59 ±5 CD65 <40% 56/180 (31) 67/180 (37) 39/120 (33) 39/175 (22) 30 ±7 CD65 ≥40% 22/44 (50) 32/44 (73) 21/34 (62) 10/41 (24) 54 ±4 Including age, WBC, PR and MLL/AF4 status as covariables, out of the analyzed markers only CD65 proved to be an independent prognostic factor in CD10− BCP-ALL (Cox regression analysis: RR 1.5, 95% CI 1.1–2.9, p=0.018). The identification of additional prognosis associated immunophenotypic markers may contribute to further refinement of treatment strategies for CD10− BCP-ALL pts.

During 2009 and 2010, a survey (n = 520) of diseased grapevines (Vitis vinifera L.) was done in vineyards located in Maipo and Colchagua valleys (33°43′ to 34°36′S) in Chile. Symptoms of trunk diseases (TD) were observed on >10-year-old grapevines and consisted of short internodes, dead spurs and arms, and dieback. In cross sections, diseased arms and trunks exhibited brown, V-shaped cankers of hard consistency. Collected canker samples from cvs. Cabernet Sauvignon, Carménère, Red Globe, Syrah, and Thompson Seedless were surface sterilized in 75% ethanol for 45 s and plated onto potato dextrose agar modified with 0.005% tetracycline, 0.01% streptomycin, and 0.1% Igepal CO-630 (MPDA; Sigma-Aldrich, St. Louis, MO) for 7 days at 20°C. White-to-gray colonies with aerial mycelium growth turned dark gray after 3 to 5 days and tentatively identified as Botryosphaeriaceae. Hyphal tips of these colonies were transferred to MPDA and kept at 20°C with continuous light. After 30 days, colonies developed black, globose pycnidia with unicellular, hyaline, ellipsoidal, densely granulate, externally smooth, and thin-walled conidia that measured (16.3) 19.3 ± 2.3 (25.9) × (5.8) 7.4 ± 0.8 (9.2) μm (n = 20). Morphologically, these isolates were identified as Neofusicoccum parvum (Pennycook & Samuels) Crous, Slippers & A.J.L. Phillips (2). Nucleotide BLAST analysis of the region ITS1-5.8S-ITS2 of rDNA of N. parvum isolates HMUC-104 and HMUC-105 (GenBank Accession Nos. JF273631 and JF273632) were amplified with ITS4 and ITS5 primers and revealed >99% similarity with the sequence of reference isolate (EU833984). Pathogenicity tests were conducted using isolates HMUC-104 and HMUC-105 on 30-day-old Carménère grapevines (n = 8) rooted in vitro by placing a 3- to 5-mm mycelial plug on the surface of the propagation medium. Additionally, detached green shoots (GS) (n = 5) and dormant canes (DC) (n = 6) 15-cm long were inoculated by placing a 3- to 5-mm mycelial plug underneath a cut aseptically made in the cortex. The GS and DC were placed in humidity chambers at 20 and 25°C, respectively. For controls, an equal number of rooted vines, in vitro vines, GS, and DC were treated with sterile agar plugs. Leaf number (LN), shoot length (SL), and root length (RL) were assessed on rooted plants in vitro after 30 days at 20°C. The extent of vascular discoloration (VD) of GS and DC were determined 15 and 45 days, respectively. N. parvum significantly (P < 0.05) reduced the LN, SL, and RL relative to the control plants. The length of VD varied from 54.86 to 55.39 mm and 14.8 to 15.48 mm in inoculated GS and DC, respectively. No VD symptoms were observed on the controls. N. parvum was reisolated from 100% of the inoculated in vitro plants, GS, and DC, completing Koch's postulates. N. parvum has been documented as a canker pathogen on V. vinifera and is known to contribute to the decline of grapevines. To our knowledge, this is the first report of N. parvum causing bot canker on grapevines in Chile, but has previously been reported in Australia, Spain, and the United States. Of 520 diseased plants in this study, 10 to 15% prevalence was estimated for TD and almost 2% prevalence was associated to N. parvum. Other Botryosphaeriaceae spp. were isolated with N. parvum from grapevine TD in Chilean vineyards (1,3,4). References: (1) J. Auger et al. Plant Dis. 88:1286, 2004. (2) P. W. Crous et al. Stud. Mycol. 55:235, 2006. (3) B. A. Latorre et al. Phytopathology 76:1112, 1986. (4) A. Morales et al. Phytopathol. Mediterr. 49:112, 2010.

Black pepper (Piper nigrum L.) is a popular spice native of India, and Brazil is one of its most important producing countries. The main disease of black pepper in Brazil is fusariosis, caused by Fusarium solani f. sp. piperis. Symptoms include leaf chlorosis and defoliation, blight of stems or stem cuttings, and root and foot decay. During surveys conducted in the south of the state of Bahia, municipalities of Taperoá (13°34'S, 39°10'W) and Valencia (13°20'S, 39°14'W), stems of diseased plants covered with red or salmon-colored perithecia were observed, while twigs showed leaf chlorosis, leading to early death of the plants. Ascomata were solitary or in groups, mostly superficial or surrounded by mycelia, globose, subglobose, ovoid, and 122 to 400 μm diameter. Microscopic examination revealed unitunicate, cylindric asci, 60 to 90 × 8.5 to 16 μm, thin-walled, containing eight ascospores arranged obliquely in two rows. Ascospores are hyaline, elliptical to oblong, one-septate, constricted at the central septum, 10 to 16 × 4 to 6.5 μm (means ± S.D.: 13.1 ± 1.4 × 5.1 ± 0.6 μm), length/width (L/W) 1.9 to 3.7. Single-spored cultures were transferred to SNA medium (incubated at 20°C for 7 days with 12-h photoperiod) and on potato dextrose agar (25°C in dark) for characterization. The anamorph is characterized by the presence of chlamydospores, canoe-shaped sporodochial macroconidia with three to four septae, and microconidia formed on long monophialidic conidiophores. Based on morphological markers, isolates were identified as F. solani. The partial fragment of the TEF-1α gene of single-spored isolates (CML 2186, 2187, 2188, 2189, 2190, and 2191) were sequenced. BLAST analysis of the sequence resulted in 94 to 99% identity with a reference strain of F. solani f. sp. piperis (NRRL 22570, CML 1888). For pathogenicity tests, cv. Bragantina was used and two isolates were inoculated as 5-mm diameter mycelial plugs on the stem of four plants each. Four control plants were treated only with sterile culture medium. Plants were maintained in the greenhouse at 25°C and 75 to 85% relative humidity under 70% shade. All inoculated plants showed initial symptoms of stem necrosis in inoculated branches 7 days after inoculation. Symptoms were not observed on stems of control plants. Isolates were successfully reisolated and identified as F. solani f. sp. piperis, fulfilling Koch's postulates. Representative isolates were deposited at the Coleção Micológica de Lavras (CML) at Universidade Federal de Lavras, Brazil. Production of perithecia of the pathogen has been previously reported only in Pará and Espírito Santo States (1,3). It is not yet confirmed if this taxon is homothallic or heterothallic. To our knowledge, this is the first report of the associated teleomorph of F. solani f. sp. piperis infecting and causing black pepper fusariosis in Bahia, Brazil. The results suggest that the spread of ascospores from perithecia is likely to be one of the main inoculum sources of the disease on adjacent vines. There is evidence that this special form of F. solani actually represents a distinct species pathogenic to black pepper (2). References: (1) F. C. Albuquerque and S. Ferraz. Experientiae 22:133, 1976. (2) K. O'Donnell. Mycologia 92:919, 2000. (3) J. A. Ventura et al. Fitopatol. Bras. 11:361, 1986.

Lavender cotton, Santolina chamaecyparissus, is an evergreen shrub growing primarily in dry, calcareous habitats and is grown in rock gardens and mixed borders mainly for its ornamental and aromatic foliage. During 2004, several commercial nurseries in Valencia Province (eastern Spain) reported high mortality of lavender cotton. The foliage of the diseased plants turned brown, wilted, and died. A Phytophthora sp. was isolated consistently from the soil and roots of infected plants using apple baits and the selective medium PARBH (1), respectively. Four pure cultures (PS-31, PS-32, PS-33, and PS-34) were established from hyphal tips and characterized. Colony morphology on potato dextrose agar (PDA) at 24°C was stoloniferous (short stubby branches) with a growth rate of 2.2 mm per day. Sporangia, chlamydospores, and oospores were produced on V8 agar. The sporangia were ovoid to obpyriform, 27.5 to 64.8 (48.3) × 25 to 52.5 (37.5) μm, length/breadth ratio of 1.3:1, and papillate, from which 20% were caducous with a short pedicel (<5 μm). Hyphal swellings and chlamydospores (22 to 38 μm in diameter) were present. Isolates were homothallic, oogonia were globose, mostly terminal 27.5 to 40 (36.2) μm in diameter, 88% of the antheridia were paragynous, monoclinous, or diclinous, and occasionally with two paragynous antheridia per oogonium. Amphigynous antheridia (12%) were also observed. Oospores were aplerotic, 25 to 35 (32.3) μm in diameter, and thin walled. These characteristics and measurements conformed to the description of P. tentaculata described by Kröber and Marwitz (2). Sequencing the internal transcribed spacer region of Santolina isolates PS-32 and PS-34 and comparison of these sequences with other sequences available in GenBank revealed that they were identical to P. tentaculata (AF266775). Pathogenicity tests used 10 4-to-5-month-old potted lavender cotton and two methods. In the first method, inoculum was prepared on a media of 200 g of oats and 120 ml of V8 juice to 1 liter of distilled water. The medium was inoculated with P. tentaculata grown on PDA and incubated in the dark at 20°C for 4 weeks. Inoculum was buried into the compost mixture around the roots at a rate of 3% (w/v). The second method applied a zoospore drench of 50 ml per plant (1 × 104 zoospores per ml) obtained by inducing zoospores in sterile soil extract from cultures of V8 juice agar. The control plants were inoculated with sterile media and sterile distilled water. The following day, the pots were flooded for 2 days, plants were maintained in a glasshouse at 24 ± 5°C, and watered twice a week. All plants inoculated with the first method had wilted foliage and died within 2 months after inoculation, while plants inoculated with zoospores died after 3 months. P. tentaculata was reisolated and the test was repeated twice. The control plants did not show any symptoms of the disease. P. tentaculata was first reported causing root and stalk rot on Chrysanthemum frutescens hybrids, C. leucanthemum, Delphinium ajacis, and Verbena hybrids in Germany (2). It has also been reported on Verbena hybrids in Spain (3). To our knowledge, this is the first report of P. tentaculata causing root rot on lavender cotton. References: (1) S. N. Jeffers and S. B. Martin. Plant Dis. 70:1038, 1986. (2) H. Kröber and R. Marwitz. Z. Pflanzenkr. Pflanzenschutz 100:250, 1993. (3) E. Moralejo et al. Plant Pathol. 53:806, 2004.

Miconia calvescens (Melastomataceae), from the Neotropics, is a noxious forest weed in Hawaii. We evaluated an isolate of Colletotrichum gloeosporioides that causes leaf spots on Miconia spp. in Brazil for its potential in biological control. Hawaii has no native Melastomataceae genera but does have members of 12 introduced genera. Following Wapshere's centrifugal phylogenetic method (2), eight species of Melastomataceae genera in Hawaii were inoculated in addition to Miconia spp. Naturalized and native Hawaiian members of the order Myrtales also were inoculated to determine host specificity, including Terminalia catappa (Combretaceae); Cuphea hysopifolia and C. ignea (Lythraceae); Arthrostema ciliatum, Clidemia hirta, Dissotis rotundifolia, Heterocentron subtriplinervium, Medinilla scortechenii, Melastoma candidum, Pterolepsis glomerata, and Tibouchina herbaceae (Melastomataceae); Eucalyptus grandis, Eucalyptus microcorys, Eugenia reinwardtiana, Eugenia uniflora, Leptospermum laevigatum, Melaleuca quinquenervia, Metrosideros polymorpha, Psidium guajava, and Syzgium malaccanse (Myrtaceae); Fuchsia magellanica and Oenothera stricta (Onagraceae); and Wikstroemia oahuensis and W. uva-ursi (Thymelaeaceae). All M. calvescens plants were grown from seed collected in Hawaii. Other test plants were grown from seeds or cuttings in artificial potting medium in a greenhouse. Plants had 6 to 8 mature leaves when inoculated. C. gloeosporioides was cultured on 10% potato dextrose agar supplemented with plain agar (35 g/liter) and incubated under constant fluorescent illumination at 20°C. Conidia were harvested by flooding 10-to 14-day-old cultures with sterile tap water, followed by light scraping with a scalpel. Conidial suspensions were adjusted to 106 conidia per ml and applied to both leaf surfaces with a hand-held sprayer. Inoculated plants were kept at 100% relative humidity and 16 to 25°C for 48 h. Four replicate plants and one plant of M. calvescens per species were inoculated. Plants were observed for symptom development for up to 6 weeks. The entire test was repeated once. Lesions were visible after 7 to 10 days. Young lesions had chlorotic halos and expanded in a roughly circular pattern to diameters of 5 to 10 mm. Mature lesions developed necrotic centers, coalesced, and became dry and brittle with age, resulting in extensive leaf necrosis. Defoliation of moderately to severely infected leaves occurred ≈ 30 days after inoculation. With the exception of M. calvescens, C. gloeosporioides did not produce visible symptoms on test plants. The failure of Clidemia hirta, the taxonomic species most closely related to M. calvescens, to become symptomatic was particularly significant relative to the centrifugal phylogenetic concept. The results demonstrate that our pathogen (VIC 19306) is distinct from C. gloeosporioides f. sp. clidemiae (1), which did not infect M. calvescens. We designate our pathogen C. gloeosporioides f. sp. miconiae. Voucher specimens (VIC 19306, Sana, RJ, 24.II.1998, and R. W. Barreto) and cultures are maintained at the Departamento de Fitopatologia, Universidade Federal de Viçosa MG, Brazil. References: (1) E. E. Trujillo et al. Plant Dis. 70:974, 1986. (2) A. J. Wapshere. Ann. Appl. Biol. 77:201, 1974.

The work describes the technology of a liquid crystal cell with a tapered optical fiber as an element providing light. The tapered optical fiber with the total optical loss of 0.22 ± 0.07 dB, the taper waist diameter of 15.5 ± 0.5 μm, and the elongation of 20.4 ± 0.3 mm has been used. The experimental results are presented for a liquid crystal cell filled with a mixture 1550* for parallel orientation of LC molecules to the cross section of the taper waist. Measurement results show the influence of the electrical field with voltage in the range of 0-200 V, without, as well as with different modulation for spectral characteristics. The sinusoidal and square signal shapes are used with a 1-10 Hz frequency range. Full Text: PDF ReferencesZ. Liu, H. Y. Tam, L. Htein, M. L.Vincent Tse, C. Lu, "Microstructured Optical Fiber Sensors", J. Lightwave Technol. 35, 16 (2017). CrossRef T. R. Wolinski, K. Szaniawska, S. Ertman1, P. Lesiak, A. W. Domański, R. Dabrowski, E. Nowinowski-Kruszelnicki, J. Wojcik "Influence of temperature and electrical fields on propagation properties of photonic liquid-crystal fibres", Meas. Sci. Technol. 17, 5 (2006). CrossRef K. Nielsen, D. Noordegraaf, T. Sørensen, A. Bjarklev,T. Hansen, "Selective filling of photonic crystal fibres", J. Opt. A: Pure Appl. Opt. 7, 8 (2005). CrossRef A. A. Rifat, G. A. Mahdiraji, D. M. Chow, Y, Gang Shee, R. Ahmed, F. Rafiq, M Adikan, "Photonic Crystal Fiber-Based Surface Plasmon Resonance Sensor with Selective Analyte Channels and Graphene-Silver Deposited Core", Sensors 15, 5 (2015) CrossRef Y. Huang, Z.Tian, L.P. Sun, D. Sun, J.Li, Y.Ran, B.-O. Guan "High-sensitivity DNA biosensor based on optical fiber taper interferometer coated with conjugated polymer tentacle", Opt. Express 23, 21 (2015). CrossRef X. Wang, O. S. Wolfbeis, "The 2016 Annual Review Issue", Anal. Chem., 88, 1 (2016). CrossRef Ye Tian, W. Wang, N. Wu, X. Zou, X.Wang, "Tapered Optical Fiber Sensor for Label-Free Detection of Biomolecules", Sensors 11, 4 (2011). CrossRef O. Katsunari, Fundamentals of Optical Waveguides, (London, Academic Press, (2006). DirectLink A. K. Sharma, J. Rajan, B.D. Gupta, "Fiber-Optic Sensors Based on Surface Plasmon Resonance: A Comprehensive Review", IEEE Sensors Journal 7, 8 (2007). CrossRef C. Caucheteur, T. Guo, J. Albert, "Review of plasmonic fiber optic biochemical sensors: improving the limit of detection", Anal. Bioanal.Chem. 407, 14 (2015). CrossRef S. F. Silva L. Coelho, O. Frazão, J. L. Santos, F. X.r Malcata, "A Review of Palladium-Based Fiber-Optic Sensors for Molecular Hydrogen Detection", IEEE SENSORS JOURNAL 12, 1 (2012). CrossRef H. Waechter, J. Litman, A. H. Cheung, J. A. Barnes, H.P. Loock, "Chemical Sensing Using Fiber Cavity Ring-Down Spectroscopy", Sensors 10, 3 (2010). CrossRef S. Zhu, F. Pang, S. Huang, F.Zou, Y.Dong, T.Wang, "High sensitivity refractive index sensor based on adiabatic tapered optical fiber deposited with nanofilm by ALD", Opt. Express 23, 11 (2015). CrossRef L. Zhang, J. Lou, L. Tong, "Micro/nanofiber optical sensors", Photonics sensor 1, 1 (2011). CrossRef L.Tong, J. Lou, E. Mazur, "Single-mode guiding properties of subwavelength-diameter silica and silicon wire waveguides", Opt. Express 11, 6 (2004). CrossRef H. Moyyed, I. T. Leite, L. Coelho, J. L. Santos, D. Viegas, "Analysis of phase interrogated SPR fiber optic sensors with bimetallic layers", IEEE Sensors Journal 14, 10 (2014). CrossRef A. González-Cano, M. Cruz Navarette, Ó. Esteban, N. Diaz Herrera , "Plasmonic sensors based on doubly-deposited tapered optical fibers", Sensors 14, 3 (2014). CrossRef K. A. Stasiewicz, J.E. Moś, "Threshold temperature optical fibre sensors", Opt. Fiber Technol. 32, (2016). CrossRef L. Zhang, F. Gu, J. Lou, X. Yin, L. Tong, "Fast detection of humidity with a subwavelength-diameter fiber taper coated with gelatin film", Opt. Express 16, 17 (2008). CrossRef S.Zhu, F.Pang, S. Huang, F. Zou, Q. Guo, J. Wen, T. Wang, "High Sensitivity Refractometer Based on TiO2-Coated Adiabatic Tapered Optical Fiber via ALD Technology", Sensors 16, 8 (2016). CrossRef G.Brambilla, "Optical fibre nanowires and microwires: a review", J. Optics 12, 4 (2010) CrossRef M. Ahmad, L.L. Hench, "Effect of taper geometries and launch angle on evanescent wave penetration depth in optical fibers", Biosens. Bioelectron. 20, 7 (2005). CrossRef L.M. Blinov, Electrooptic Effects in Liquid Crystal Materials (New York, Springftianer, 1994). CrossRef L. Scolari, T.T. Alkeskjold, A. Bjarklev, "Tunable Gaussian filter based on tapered liquid crystal photonic bandgap fibre", Electron. Lett. 42, 22 (2006). CrossRef J. Moś, M. Florek, K. Garbat, K.A. Stasiewicz, N. Bennis, L.R. Jaroszewicz, "In-Line Tunable Nematic Liquid Crystal Fiber Optic Device", J. of Lightwave Technol. 36, 4 (2017). CrossRef J. Moś, K A Stasiewicz, K Garbat, P Morawiak, W Piecek, L R Jaroszewicz, "Tapered fiber liquid crystal hybrid broad band device", Phys. Scripta. 93, 12 (2018). CrossRef Ch. Veilleux, J. Lapierre, J. Bures, "Liquid-crystal-clad tapered fibers", Opt. Lett. 11, 11 (1986). CrossRef R. Dąbrowski, K. Garbat, S. Urban, T.R. Woliński, J. Dziaduszek, T. Ogrodnik, A,Siarkowska, "Low-birefringence liquid crystal mixtures for photonic liquid crystal fibres application", Liq. Cryst. 44, (2017). CrossRef S. Lacroix, R. J. Black, Ch. Veilleux, J. Lapierre, "Tapered single-mode fibers: external refractive-index dependence", Appl. Opt., 25, 15 (1986). CrossRef J.F. Henninot, D. Louvergneaux , N.Tabiryan, M. Warenghem, "Controlled Leakage of a Tapered Optical Fiber with Liquid Crystal Cladding", Mol. Cryst.and Liq.Cryst., 282, 1(1996). CrossRef

Cathodic synthesis is a highly attractive technique for N,O bond reduction.[1] Especially, electro-reductions of nitro arenes enable the access to high-valuable products like nitrones and N-heterocycles.[2] These substances are in general unique structural motifs in natural products or in compounds with significant biological properties, such as antibiotic, antiplasmodial, antimycotic, antihypertensive, hyperglycemic and cytotoxic activities.[3] Commonly used synthesis methods require large amounts of metallic reducing agents, expensive transition metal catalysts, or hazardous oxidizers in case the corresponding heterocycles are accessible otherwise.[4] Several examples have been described with constant potential conditions using mercury or sacrificial lead electrodes.[5] Due to cathodic corrosion of heavy metals, this proves to be a critical aspect and mercury is banned in the most countries for technical applications.[6] Therefore, the urge for more sustainable processes is of high focus. We describe an access to 1H-1-hydroxyquninolin-4-ons by cathodic reaction of nitrobenzoyl acetones synthesized from broad available nitrobenzoic acids. Using metal-free BDD cathodes (boron-doped diamond), sulfuric acid as a simple supporting electrolyte, in addition to an aqueous electrolyte system with an environmentally benign co-solvent agree with sustainable and green aspects. The scalability under constant current conditions in an undivided cell has been shown in a twentyfold scale. The electrochemical synthesis protocol was applied to 18 examples including the antibiotic substance HQNO (1H-2-heptyl-1-hydroxy quinolin-4-ons) and various precursors for enzymatic aurachine synthesis.[7] Furthermore, we developed a method to a novel substance class of 4H-4-hydroxy-1,2,4-benzothiadiazine-1,1-dioxides. Reduction of the nitro precursors applying BDD cathodes result in hydroxylamines using divided cells with glass frits as separators. The applicability of this electro-reductive cyclisation is demonstrated by the synthesis of a broad product scope with activated, deactivated, labile and sterically demanding substitution patterns for potential further modification towards pharmaceutical applications.[8] Particularly, we described the synthesis of the N-Hydroxy analogues of diazoxide, a medication on the WHO list of essential medicines.[8,9] Studies on the biological activities of these new compounds are currently performed. References: [1] T. Wirtanen, E. Rodrigo, S. R. Waldvogel, Adv. Synth. Catal. 2020, 362, 2088–2101. [2] E. Rodrigo, S. R. Waldvogel, Green Chem. 2018, 20, 2013–2017. [3] a) A. Schmoldt, H. F. Benthe, G. Haberland, Biochem. Pharmacol. 1975, 24, 1639–1641; b) B. Kunze, G. Höfle, H. Reichenbach, J. Antibiot. 1987, 40, 258–265; c) K. C. Majumdar, S. Mondal, Chem. Rev. 2011, 111, 7749–7773; d) E. E. Hays, I. C. Wells, P. A. Katzman, C. K. Cain, F. A. Jacobs, S. A. Thayer, E. A. Doisy, W. L. Gaby, E. C. Roberts, R. D. Muir, C. J. Carroll, L. R. Jones, N. J. Wade, J. Biol. Chem. 1945, 159, 725–750. [4] a) J.-C. Jung, Y.-J. Jung, O.-S. Park, J. Heterocycl. Chem. 2001, 38, 61–67; b) M. Enomoto, W. Kitagawa, Y. Yasutake, H. Shimizu, Biosci., Biotechnol., Biochem. 2014, 78, 1324–1327; c) H. G. Walker, C. R. Hauser, J. Am. Chem. Soc. 1946, 68, 2742–2743; d) A. Woschek, M. Mahout, K. Mereiter, F. Hammerschmidt, Synthesis 2007, 1517–1522. [5] a) R. Hazard, M. Jubault, C. Mouats, A. Tallec, Electrochim. Acta 1986, 31, 489–497; b) R. Hazard, M. Jubault, C. Mouats, A. Tallec, Electrochim. Acta 1988, 33, 1335–1341; c) H. Lund, L. G. Feoktistov, P. H. Nielsen, Acta Chem. Scand. 1969, 23, 3482–3492; d) B. Hyo Kim, Y. Moo Jun, Y. Rack Choi, D. Byung Lee, W. Baik, Heterocycles 1998, 48, 749–754. [6] T. Wirtanen, T. Prenzel, J.-P. Tessonnier, S. R. Waldvogel, Chem. Rev. 2021, 121, 10241–10270. [7] a) T. Prenzel, S. R. Waldvogel 2021, in preparation; b) E. Stec, D. Pistorius, R. Müller, S.-M. Li, ChemBioChem 2011, 12, 1724–1730. [8] T. Prenzel, T. Wirtanen, S. R. Waldvogel 2021, in preparation. [9] World Health Organization, Model List of Essential Medicines – 22nd List, 2021, World Health Organization, Geneva, 2021. Figure 1

This paper presents the influence of temperature on optical power spectrum propagated in a tapered optical fiber with twisted nematic liquid crystal cladding (TOF-TNLCC) modulated by an electric field. The measurements were performed for a liquid crystal cell with the twisted orientation of ITO layers, filled with E7 mixture. The induced reorientation of liquid crystal (LC) n-director was measured for visible and near-infrared wavelength range [550-1100 nm] at the electric field range of 0–160 V and temperature range of 20-60 °C. The relation between temperature and the optical power spectrum of the investigated device has been established. Full Text: PDF ReferencesV.J. Tekippe, "Passive fiber optic components made by the fused biconical taper process", Proc. SPIE 1085 (1990). CrossRef T. A. Birks, Y. W. Li, The shape of fiber tapers, Journal of Lightwave Technology 10, 4 (1992). CrossRef J. Korec, K. A. Stasiewicz, O. Strzeżysz, P. Kula, L. R. Jaroszewicz, Electro-Steering Tapered Fiber-Optic Device with Liquid Crystal Cladding, Journal of Sensors 2019: 1-11 (2019) CrossRef Ch. Veilleux, J. Lapierre, J. Bures, Liquid-crystal-clad tapered fibers, Opt. Lett. 11, 733-735 (1986) CrossRef J. F Henninot, D. Louvergneaux, N. Tabiryan, M. Warenghem, Controlled leakage of a tapered optical fiber with liquid crystal cladding, Molecular Crystals and Liquid Crystals, 282, 297-308. (1996). CrossRef Y. Wang, et.al., Tapered optical fiber waveguide coupling to whispering gallery modes of liquid crystal microdroplet for thermal sensing application, Opt. Express 25, 918-926 (2017) CrossRef J. Korec, K. A. Stasiewicz, O. Strzeżysz, P. Kula, L. R. Jaroszewicz, . E. Moś, Tapered fibre liquid crystal optical device, Proc. SPIE 10681 (2018) CrossRef G. Assanto, A. Picardi, R. Barboza, A. Alberucci, Electro-optic steering of Nematicons, Phot. Lett. Poland 4, 1 (2012). CrossRef A.Ghanadzadeh Gilani, M.S. Beevers, The Electro-optical kerr effect in eutectic nematic mixtures of E7 and E8,J ournal of Molecular Liquids, 92, 3 (2001). CrossRef E. C. Mägi, P. Steinvurzel, and B.J. Eggleton, Tapered photonic crystal fibers, Opt. Express 784, 12, 5 (2004). CrossRef Y. Li and J. Lit, Transmission properties of a multimode optical-fiber taper, J. Opt. Soc. Am. A 2, (1985). CrossRef J. Korec, K. A. Stasiewicz, and L. R. Jaroszewicz, Temperature influence on optical power spectrum of the tapered fiber device with a liquid crystal cladding, Proc. SPIE 11045, 110450I (2019) CrossRef L.M. Blinov, Liquid crystals: physical properties and their possibilities in application, Advances in Liquid Crystal Research and Applications, (1981). CrossRef

В настоящей работе представлена новая методика построения решетки совпадающих узлов для кристаллов простой кубической, ОЦК, ГЦК структур, имеющих моноэлементные и полиэлементные составы. Разработан метод нахождения атомов различных элементов в межкристаллитных границах на основе специально построенной кристаллографической группы. Указаны возможные элементные составы специальных межкристаллитных границ, зарядовые состояния сопрягающихся плоскостей ЛИТЕРАТУРА1. Bollmann W. On the geometry of grain and phase boundaries // Phil. Mag., 1967, v. 16(140), pp. 363–381.DOI: https://doi.org/10.1080/147864367082297482. Bollmann W. On the geometry of grain and phase boundaries // Phil. Mag., 1967, v. 16(140), pp. 383–399.https://doi.org/10.1080/147864367082297493. Grimmer H. A method of determining the coincidence site lattices for cubic crystals // Acta Cryst. A,1974, v. 30(2), pp. 680–680. DOI: https://doi.org/10.1107/s056773947400163x4. Grimmer H., Bollmann W., Warrington D. T. Coincidence-site lattices and complete pattern-shiftin cubic crystals // Acta Cryst. A, 1974, v. 30(2), pp. 197–207. DOI : https://doi.org/10.1107/s056773947400043x5. Орлов А. Н., Перевезенцев В. Н., Рыбин В. В. Границы зерен в металлах. М.: Металлургия, 1980, 224 с.6. Глейтер Г., Чалмерс Б. Большеугловые границы зерен. М.: Мир, 1975, 376 с.7. Страумал Б. Б., Швиндлерман Л. С. Термическая стабильность и области существования специальных границ зерен // Поверхность. Физика, химия, механика, 1986, т. 10, с. 5–14.8. Fortes M. A. Coincidence site lattices in noncubic lattices // Phys. Stat. Sol. B, 1977, v. 82(1).pp. 377–382. DOI: https://doi.org/10.1002/pssb.22208201439. Bonnet R., Durand F. A general analytical method to fi nd a basis for the DSC lattice // ScriptaMet., 1975, v. 9(9), pp. 935–939. DOI: https://doi.org/10.1016/0036-9748(75)90548-710. Bonnet R. Note on a general analytical method to fi nd a basis for the DSC lattice. Derivation of a basisfor the CSL // Scripta Met., 1976, v. 10(9), pp. 801–806. DOI: https://doi.org/10.1016/0036-9748(76)90297-011. Bonnet R., Cousineau E. Computation of coincident and near-coincident cells for any two lattices– related DSC-1 and DSC-2 lattices // Acta Cryst. A, 1977, v. 33(5), pp. 850–856. DOI: https://doi.org/10.1107/s056773947700205812. Рыбин В. В., Перевезенцев В. Н. // ФТТ, 1975,т. 17, c. 3188–3193.13. Андреева А. В., Фионова Л. К. Анализ межкристаллитных границ на основе теории решетоксовпадающих узлов // ФММ, 1977, т. 44, с. 395–400.14. Кайбышев О. А., Валиев Р. З. Границы зерен и свойства металлов. М.: Металлургия, 1987, 214 c.15. Копецкий Ч. В., Орлов А. Н., Фионова Л. К. Границы зерен в чистых материалах. М.: Наука, 1987,160 c.16. Бокштейн Б. С. Структура и свойства внутренних поверхностей раздела в металлах. М.: Металлургия, 1988, 272 с.17. Kobayashi S., Tsurekawa S., Watanabe T. A new approach to grain boundary engineering for nanocrystallinematerials // Beilstein J. Nanotechnol., 2016, v. 7, pp. 1829–1849. DOI: https://doi.org/10.3762/bjnano.7.17618. Сухомлин Г. Д. Специальные границы в феррите низкоуглеродистых сталей // Металлофизика, новейшие технологии, 2013, т. 35, с. 1237–1249.19. Watanabe T. Grain boundary engineering: historical perspective and future prospects // Journalof Materials Science, 2011, v. 46, pp. 4095–4115. DOI: https://doi.org/10.1007/s10853-011-5393-z20. Waser R. Electronic properties of grain boundaries in SrTiO3 and BaTiO3 ceramics // Solid State Ionics,1995, v. 75, pp. 89–99. DOI: https://doi.org/10.1016/0167-2738(94)00152-i21. Daniels J., Wemicke R. New Aspects of an Improved PTC Model // Philips Res. Rep., 1976, v. 31,pp. 544–559.22. Vikrant K. S. N., Edwin G. R. Charged grain boundary transitions in ionic ceramics for energy applications// Computational Materials, 2019, v. 5(1), pp. 24. DOI: https://doi.org/10.1038/s41524-019-0159-223. Kim M., Duscher G., Browning N.D., Sohlberg K., Pantelides S. T., Pennycook S. J. Nonstoichiometryand the electrical activity of grain boundaries in SrTiO3 // Physical Review Letters, 2001, v. 86,pp. 4056–4059. DOI: https://doi.org/10.1103/physrevlett.86.405624. Oyama T., Wada N., Takagi H. Trapping of oxygen vacancy at grain boundary and its correlationwith local atomic confi guration and resultant excess energy in barium titanate: A systematic computationalanalysis // Physical Review B, 2010, v. 82, pp. 134107. DOI: https://doi.org/10.1103/physrevb.82.13410725. Duffy D.M., Tasker P.W. Space-charge regions around dipolar grain boundaries // Journal of AppliedPhysics, 1984, v. 56, pp. 971–977. DOI: https://doi.org/10.1063/1.33403726. Даринский Б. М., Ефанова Н. Д., Прижимов А. С. Систематика решеток совпадающих узловдля ОЦК и ГЦК кристаллов // Конденсированные среды и межфазные границы, 2018, т. 20(4), с. 581–586. DOI: https://doi.org/10.17308/kcmf.2018.20/632

Activins are dimers of inhibin β subunits and are growth and differentiation factors belonging to the transforming growth factor-β (TGF-β) superfamily (1). Both βA and βB subunits are highly expressed in rat granulosa cells, while theca cells express little or no β subunit mRNAs (2). Oocytes lack expression of either subunit (3, 4). Activin is suggested to facilitate the responsiveness of granulosa cells to FSH (5). We hypothesized that activin, with or without FSH, could enhance the transition from the primordial to later preantral stages of follicle development. In two independent experiments, day 4 rat ovaries (n = 3 from different rats per treatment) were randomly assigned and cultured (6, 7) for 10 days in DMEM/Hams F-12 media with either no additives, FSH (100 ng/mL), activin A (50 ng/mL), or both. Day 4 fresh ovaries were also used as controls. Media and treatments were refreshed every alternate day. Ovaries were fixed andsectioned, or placed into Ultraspec for RNA extraction and real-time PCR analysis. Follicle numbers were counted as described previously (7). The proportion of atretic follicles (TUNEL staining) was determined in 3 randomly selected sections per ovary. Primordial follicles in all treatment groups were approximately 20% of those in Day 4 fresh ovaries. Primary follicles increased significantly (P < 0.05) only in the combined treatment group, where preantral follicles increased significantly (P < 0.0001) only when treated with activin A alone. Activin A alone decreased the proportion of atretic follicles in the primary and preantral classes, where the combined treatment increased the proportion of atretic preantral follicles. Real-time analysis revealed that expression levels of follistatin, FSH receptor and activin βA and βB subunits were all expressed at significantly higher levels in the Activin A-only treated group (P < 0.05). In summary, there was no effect on primordial follicle activation by any treatment. Activin alone had a stimulatory effect in vitro on subsequent folliculogenesis, but in the presence of FSH its effect was counteracted shown by an increase in atresia. Reasons for an increase in atretic preantral follicles in the combined treatment group are unclear. These studies support a stimulatory role for activin A in early follicle development and confirm the in vivo effects of activin on folliculogenesis (4). NHMRC program grant # 494802 and Fellowship (# 441101) provided financial support. (1) Vale W et al. 1986. Nature 321: 776–779.(2) Meunier H et al. 1988. Proc Natl Acad Sci USA 85: 547–251.(3) Roberts V et al. 1993. Journal of Clinical Endocrinology & Metabolism 7: 1402–1410.(4) Sidis Y et al. 1998. Biology of Reproduction 59(4): 807–812.(5) Drummond A et al. 2002. Endocrinology 143 (4): 1423–1433.(6) Nilsson E et al. 2001. Molecular and Cellular Endocrinology 182 (2): 145–155.(7) Rosairo D et al. 2008. Reproduction 136: 799–809.

This research is aimed to discover the interrelation between marital satisfaction, religiouscommitment and marital commitment globally and based on its types, personal, moral, andstructural. The sampling of the research is 315 persons, with age 20 until 58 years old. The resultof the research shows there is a significant correlation between marital satisfaction and maritalcommitment, religious commitment and marital commitment, marital satisfaction together withreligious commitment and marital commitment. It is also discovers that marital commitmentinfluences personal commitment and moral commitment, while religious commitment influencespersonal commitment, moral commitment, and structural commitment.Keywords: marital satisfaction, religious commitment, marital commitment Abstrak Penelitian ini bertujuan untuk mengetahui hubungan antara kepuasan pernikahan, komitmen beragama, dan komitmen pernikahan secara global dan menurut tipenya, komitmen personal, moral, dan struktural. Partisipan penelitian ini adalah berjumlah 315 orang, berusia 20 hingga 58 tahun. Hasil penelitian ini menunjukan bahwa terdapat hubungan signifikan antara kepuasan pernikahan dan komitmen pernikahan, komitmen beragama dan komitmen pernikahan, kepuasan pernikahan bersama dengan komitmen beragama dan komitmen pernikahan. Juga diketahui bahwa kepuasan pernikahan memiliki pengaruh terhadap komitmen personal dan komitmen moral. Sementara komitmen beragama memiliki pengaruh terhadap komitmen personal, komitmen moral, dan komitmen struktural. Kata kunci: kepuasan pernikahan, komitmen beragama, komitmen pernikahan References Abbott, D., Berry, M. and Meredith, W. (1990). Religious Belief and Practice: A Potential Assetin Helping Families. Family Relations, 39(4), p.443.Adams, J. M. & Jones, W. H. (1999). Interpersonal commitment in historichal perspectives. InHandbook of Interpersonal Commitment and Relationship Stability. New York: SpringerScience+Business Media.Agnew, H. (2009). Commitment, Theories and Typologies. Department of PsychologicalSciences Faculty Publications. Diunduh dari: http://docs.lib.purdue.edu/psychpubs/28Allgood, S. M., Harris, S.,Skogrand, L., & Lee, T.R. (2008). Marital commitment andreligiosity in a religiously homogenous population. Marriage & Family Review, 45(1),52-67. doi: 10.1080/01494920802537472.Amato, P. R. 2010. Research on divorce: continuing developments and newtrends. Journal ofMarriage and Family 72(3): 650-666. doi:10.1111/j.1741-3737.2010.00723.xAmato, P. and Sobolewski, J. (2001). The Effects of Divorce and Marital Discordon AdultChildren's Psychological Well-Being. American SociologicalReview, 66(6), p.900.Andrea, S.G. (2014). Hubungan antara religiositas dan komitmen pernikahan pada individuyang menikah melalui ta’aruf. Skripsi. Depok: Fakultas Psikologi Universitas Indonesia.Argue, A., Johnson, D. and White, L. (1999). Age and Religiosity: Evidence froma Three-WavePanel Analysis. Journal for the Scientific Study of Religion, 38(3), p.423.Aron, A., Aron, E. and Smollan, D. (1992). Inclusion of Other in the Self Scaleand the structureof interpersonal closeness. Journal of Personality and Social Psychology, 63(4), pp.596- 612.Arriaga, X. and Agnew, C. (2001). Being Committed: Affective, Cognitive, and ConativeComponents of Relationship Commitment. Personality and Social Psychology Bulletin, 27(9), pp.1190-1203.Benokraitis, N. (1996). Marriages and families. Upper Saddle River, N.J.: Prentice Hall.Beveridge, A., Campbell, A., Converse, P. and Rodgers, W. (1976). The Quality of AmericanLife: Perceptions, Evaluations, and Satisfactions. Political Science Quarterly, 91(3),p.529.Bilqisthi, H. (2014). Hubungan antara komitmen pernikahan dengan kepuasanpernikahan padaindividu yang menikah melalui ta’aruf. Skripsi. Depok: Fakultas Psikologi UniversitasIndonesia.Bimas Islam Dalam Angka. (2012). Kementerian Agama Republik Indonesia.www.bimasislam.kemenag.go.idBKKBN (2011, Desember). Policy brief pusat penelitian dan pengembangan kependudukan.20 Februari 2015. http://www.bkkbn.go.id/ViewBerita.aspx?BeritaID=967Badan Pusat Statistik. (2010). Survey agama berdasarkan provinsi di Indonesia. www.bps.go.idBurpee, L. and Langer, E. (2005). Mindfulness and Marital Satisfaction. Journalof AdultDevelopment, 12(1), pp.43-51.Carp, F. and Carp, A. (1982). Test of a Model of Domain Satisfactions and WellBeing: EquityConsiderations. Research on Aging, 4(4), pp.503-522. Cho, D. W. (2014). The influence of religiosity and adult attachment style on maritalsatisfaction among Korean Christian couples living in South Korea. A Dissertation. Liberty University.Chomeya, R. (2010). Quality of psychology test between likert scale 5 and points. Journal ofSocial Sciences, 6 (3), 399-403.Chung, R. H. (2008). Religiosity as predictor of marital commitment andsatisfaction in KoreanAmerican couples. University of Southern CaliforniaClements, R. and Swensen, C. (2000). Commitment to one’s spouse as a predictorof maritalquality among older couples. Curr Psychol, 19(2), pp.110-119.DeGenova, M. and Rice, F. (2005). Intimate relationships, marriages, andfamilies. New York:McGraw-Hill.DeGenova, M. (2008). Intimate relationships, marriages & families. Boston, MA: McGrawHill.Diener, E. (1984). Subjective well-being. Psychological Bulletin, 95(3), pp.542575.Duvall, E. and Miller, B. (1985). Marriage and family development. New York: Harper & Row.Fowers, B. and Olson, D. (1993). ENRICH Marital Satisfaction Scale: A brief research andclinical tool. Journal of Family Psychology, 7(2), pp.176-185.Gravetter, F.J. & Forzano, L.B. (2009). Research methods for the behavioral sciences (Edisike-3). Belmont, CA: Wadsworth.Goltz, J.W. (1987). Correlates in marital commitment. Disertasi Doktoral.Kanada: UniversitasAlberta.Hansen, D., Kelley, H. and Thibaut, J. (1982). Interpersonal Relations: A Theory ofInterdependence. Journal of Marriage and the Family, 44(1), p.246.Hassan, R. (2007). On Being Religious: Patterns of Religious Commitment in MuslimSocieties. The Muslim World, 97(3), pp.437-478.Hatch, R., James, D. and Schumm, W. (1986). Spiritual Intimacy and MaritalSatisfaction. Family Relations, 35(4), p.539.Harris, S. S. (2005). Marital commitment and religiosity in a sample of adults in Utah. AllGraduate Theses and Dissertations. Paper 2851. http://digitalcommons.usu.edu/etd/2851Haseley, J. and Riggs, S. (2006). Marital satisfaction among newly married couples. Denton:University of North Texas.Hawkins, M. (1981). Care of the dying. BMJ, 282(6280), pp.1969-1969.Heaton, T. and Albrecht, S. (1991). Stable Unhappy Marriages. Journal of Marriage and theFamily, 53(3), p.747.Heaton, T., Albrecht, S. and Martin, T. (1985). The Timing of Divorce. Journal of Marriageand the Family, 47(3), p.631.Hoge, D. and Hoge, J. (1984). Period Effects and Specific Age Effects Influencing Values ofAlumni in the Decade after College. Social Forces, 62(4), p.941Impett, E., Beals, K. and Peplau, L. (2001). Testing the investment model of relationshipcommitment and stability in a longitudinal study of married couples. Curr Psychol, 20(4),pp.312-326.Johnson, M. P. (1973). Commitment: A conceptual structure and empirical application. TheSociological Quarterly, 14(3), 395-406.

Este estudo descreve e analisa o processo variável da vogal epentética em palavras na língua inglesa iniciadas por clusters por aprendizes brasileiros de inglês como segunda língua (L2). O objetivo dessa pesquisa é, então, identificar a frequência de inserção da vogal de apoio na posição inicial das palavras em língua inglesa que se iniciam com um dos seguintes clusters: /sp/, /st/, /sk/, /sl/, /sm/, e /sn/. O corpus deste estudo é constituído por 18 informantes paraibanos, aprendizes de inglês como L2, estratificados nos níveis básico, intermediário e avançado de proficiência. Os dados mostram que as variáveis sonoridade do encontro consonantal, nível de proficiência, instrução explícita na L2 e contexto precedente foram as mais relevantes à realização do fenômeno. REFERÊNCIASALLAN, D. Oxford placement test 1. Oxford: Oxford University Press, 2004.ALVES, U. K. O que é consciência fonológica. IN: LAMPRECHT et. al. Consciência dos sons da língua: subsídios teóricos e práticos para alfabetizadores, fonoaudiólogos e professores de língua inglesa. 2 ed. Porto Alegre: EDIPUCRS, 2012, p. 29-41.BOUDAOUD, M.; CARDOSO, W. Vocalic [e] epenthesis and variation in Farsi-English interlanguage speech. Concordia Working Papers in Applied Linguistics, 2, 2009.CARDOSO, W. The variable development of English word-final stops by Brazilian Portuguese speakers:A stochastic optimality theoretic account. Language variation and change, v.19, 2007, p. 1-30.______, W. The Development of sC Onset Clusters in interlanguage: markedness vs. frequency effects. Proceedings of the 9th Generative Approaches to Second Language Acquisition Conference, (GASLA 2007), ed. Roumyana Slabakova et al., 15-29. Somerville, MA: Cascadilla Proceedings Project, 2008.CARLISLE, R. The effects of markedness on epenthesis in Spanish/English interlanguage phonology. Issues and Developments in English and Applied Linguistics, 3, 1988, 15-23._______, R.S. The Influence of Environment on Vowel Epenthesis in Spanish/English Interphonology. Applied linguistics, v.12, n.1, 1991, p. 76-95._______, R. Environment and markedness as interacting constraints on vowel epenthesis. In:_______ J. Leather; JAMES, A (Eds.), New sounds 92 (p. 64–75). Amsterdam: University of Amsterdam Press, 1992._______, R. S. Markedness and environment as internal constraints in the variability of interlanguage phonology. In:_____. M. Yavas (ed.) First and Second Language Phonology. San Diego: Singular Publishing Company, 1994 p. 223-249.______, R. The modification of onsets in a markedness relationship: Testing the interlanguage structural conformity hypothesis. Language learning, v.47, 1997, p. 327-361.______, R. The acquisition of onsets in a markedness relationship. A longitudinal study. Studies in second language acquisition. 20, 1998, 245–260.COLLISCHONN, G. Um estudo da epêntese à luz da teoria da sílaba de Junko Ito (1986). Letras de hoje, Porto Alegre: v. 31, n.2, 1996, p. 149-158.CORNELIAN JR, D. Brazilian learners’ production of initial /s/ clusters: Phonological structure and environment. New Sounds 2007: Proceedings of the Fifth International Symposium on the Acquisition of Second Language Speech, 2007.DUBOIS, J. et al. Dicionário de lingüística. São Paulo: Cultrix, 2006.ESCARTÍN, C. I. The development of sC onset clusters in Spanish English. Tese – Concordia University, Canadá, 2005.GASS, S.; SELINKER, L. (eds). Language transfer in language vs learning. Newbury House, Rowley, Massachusetts, 2008.LABOV, W. Padrões sociolinguísticos. Tradução de Marcos Bagno; Mª Marta Pereira Scherre e Caroline Rodrigues Cardoso. São Paulo: Parábola Editorial, (1972) 2008.LUCENA, R. M; ALVES, F. C. Análise Variacionista da Aquisição do /p/ em Coda Silábica por Aprendizes de Inglês Como LE. Revista Intertexto. v. 5, n. 2, 2012.PEREYRON, L. Epêntese vocálica em encontros consonantais mediais por falantes porto-alegrenses de inglês como língua estrangeira. Dissertação (Mestrado) – Pontifícia Universidade Católica do Rio Grande do Sul, Porto Alegre: 2008.RAUBER, A. S. The production of English initial /s/ clusters by Portuguese and Spanish EFL speakers. Unpublished Master's thesis, Universidade Federal de Santa Catarina, Florianópolis, SC: Brazil, 2002.RAUBER S.; BAPTISTA. The production of English initial /s/ clusters by Portuguese and Spanish EFL speakers. Rev. Est. Ling. Belo Horizonte: v. 12, n. 2, 2004, p. 459-473.REBELLO, J. T. The acquisition of English initial /s/ clusters by Brazilian EFL learners. Florianópolis: UFSC, 1997.SANKOFF, D.; TAGLIAMONTE, S.; SMITH, E. GoldVarb X: a variable rule application for Macintosh and Windows. Department of Linguistics. University of Toronto, 2005.SELINKER, L. Rediscovering interlanguage. New York: Longman, 1972.SILVA. T. C. Dicionário de fonética e fonologia. São Paulo: Contexto, 2011. Recebido em 30-10-2018.Aceito em 22-02-2019.

[1] R. C. Dugan, H. W. Beaty, y S. Santoso, Electrical Power Systems Quality, Third edition. Tata McGraw Hill Education, 2012.[2] J. Arrilaga y N. R. Watson, Power System Harmonics. Jhon Wiley and Sons, 2003.[3] H. Kim, F. Blaabjerg, B. Bak-Jensen, y J. Choi, «Instantaneous power compensation in three-phase systems by using p-q-r theory», en Power Electronics Specialists Conference, 2001. PESC. 2001 IEEE 32nd Annual, 2001, vol. 2, pp. 478–485 vol.2.[4] J. G. Nielsen y F. Blaabjerg, «Comparison of system topologies for dynamic voltage restorers», en Conference Record of the 2001 IEEE Industry Applications Conference, 2001. Thirty-Sixth IAS Annual Meeting, 2001, vol. 4, pp. 2397–2403 vol.4.[5] M. Vilathgamuwa, A. A. . Ranjith Perera, S. S. Choi, y K. J. Tseng, «Control of energy optimized dynamic voltage restorer»,88presentado en The 25th Annual Conference of the IEEE Industrial Electronics Society, 1999. IECON ’99 Proceedings, 1999, vol. 2, pp. 873-878 vol.2.[6] N. H. Woodley, L. Morgan, y A. Sundaram, «Experience with an inverter-based dynamic voltage restorer», IEEE Trans. Power Deliv., vol. 14, n.o 3, pp. 1181-1186, jul. 1999.[7] M. D. Stump, G. J. Keane, y F. K. S. Leong, «The role of custom power products in enhancing power quality at industrial facilities», en 1998 International Conference on Energy Management and Power Delivery, 1998. Proceedings of EMPD ’98, 1998, vol. 2, pp. 507–517 vol.2.[8] UNE, Características de la Tensión Suministrada Por Las Redes Generales de Distribución, UNE-EN 50160. UNE, 1996.[9] M. P. Kazmierkowski y L. Malesani, «Current control techniques for three-phase voltage-source PWM converters: a survey», Ind. Electron. IEEE Trans. On, vol. 45, n.o 5, pp. 691–703, 1998.[10] G. A. de Almeida Carlos, E. C. dos Santos, C. B. Jacobina, y J. P. R. A. Mello, «Dynamic Voltage Restorer Based on Three-Phase Inverters Cascaded Through an Open-End Winding Transformer», IEEE Trans. Power Electron., vol. 31, n.o 1, pp. 188-199, ene. 2016.[11] S. Andrews y S. Joshi, «Performance Improvement of Dynamic Voltage Restorer using Proportional - Resonant Controller», en Renewable Energy and Energy Management; Proceedings of PCIM Europe 2015; International Exhibition and Conference for Power Electronics, Intelligent Motion, 2015, pp. 1-8.[12] A. M. Rauf y V. Khadkikar, «An Enhanced Voltage Sag Compensation Scheme for Dynamic Voltage Restorer», IEEE Trans. Ind. Electron., vol. 62, n.o 5, pp. 2683-2692, may 2015.[13] Craig Muller, User’s Guide on the Use of PSCAD. Manitoba, Canada: Manitoba HVDC Research Centre, 2010.[14] Rohitha Jayasinghe, User’s Guide. A Comprehensive Resourse for EMTDC. Manitoba, Canada: Manitoba HVDC Research Centre, 2010.[15] L. A. Moran, J. W. Dixon, y R. R. Wallace, «A Three-Phase Active Power Filter Operating with Fixed Switching Frequency for Reactive Power and Current Harmonic Compensation», Ind. Electron. IEEE Trans. On, vol. 42, n.o 4, pp. 402 -408, ago. 1995.[16] S. Bhattacharya y D. Divian, «Synchronous frame based controller implementation for hybrid series active filters system», Proceeding 1995 IEEEIAS Annu. Meet., pp. 2531-2540, 1995.[17] J. G. Nielsen y F. Blaabjerg, «A detailed comparison of system topologies for dynamic voltage restorers», IEEE Trans. Ind. Appl., vol. 41, n.o 5, pp. 1272- 1280, oct. 2005.[18] J. Arrillaga, N. R. Watson, y S. Chen, Power System Quality Assessment. Jhon Wiley and Sons, 2000.[19] V. B. Bhavaraju y P. Enjeti, «A Fast Active Power Filter to Correct Line Voltage Sag», IEEE Trans, vol. IE-41, n.o 3, pp. 333-338, 1994.[20] G. Blajszczak, «Direct Method for Voltage Distortion Compensation in Power Network Bay Series Converter Filter», IEE Proc Electr Power Appl, vol. 142, n.o 5, pp. 308-312, 1995.[21] H. Akagi, «New Trends in Active Filters for Power Conditioning», Ind. Appl. IEEE Trans. On, vol. 32, n.o 6, pp. 1312 -1322, nov. 1996.[22] A. Ghosh y G. Ledwich, «Compensation of distribution system voltage using DVR», IEEE Trans. Power Deliv., vol. 17, n.o 4, pp. 1030- 1036, oct. 2002.89[23] C. J. Melhorn, T. D. Davis, y G. E. Beam, «Voltage sags: their impact on the utility and industrial customers», IEEE Trans. Ind. Appl., vol. 34, n.o 3, p. 549, 1998.[24] W. E. Brumsickle, G. A. Luckjiff, R. S. Schneider, D. M. Divan, y M. F. McGranaghan, «Dynamic sag correctors: cost effective industrial power line conditioning», en Proceedings of 34th Annual Meeting of the IEEE Industry Applications, Phoenix, AZ, USA, 1999, vol. vol.2, p. 1339.[25] B. Singh, K. Al-Haddad, y A. 9 Chandra, «A Review of Active Filters for Power Quality Improvement», Ind. Electron. IEEE Trans. On, vol. 46, n.o 5, pp. 960-971, oct. 1999.[26] C. Zhan, C. Fitzer, V. K. Ramachandaramurthy, A. Arulampalam, M. Barnes, y N. Jenkins, «Software phase-locked loop applied to dynamic voltage restorer (DVR)», en IEEE Power Engineering Society Winter Meeting, 2001, 2001, vol. 3, pp. 1033-1038 vol.3.[27] V. Kaura y V. Blasko, «Operation of a phase locked loop system under distorted utility conditions», en Applied Power Electronics Conference and Exposition, 1996. APEC ’96. Conference Proceedings 1996., Eleventh Annual, 1996, vol. 2, pp. 703–708 vol.2.[28] A. C. Parsons, W. M. Grady, y E. J. Powers, «A wavelet-based procedure for automatically determining the beginning and end of transmission system voltage sags», en IEEE Power Engineering Society 1999 Winter Meeting, 1999, vol. 2, pp. 1310–1315 vol.2.[29] D. Gregory, C. Fitzer, y M. Barnes, «The static transfer switch operational considerations», en Power Electronics, Machines and Drives, 2002. International Conference on (Conf. Publ. No. 487), 2002, pp. 620–625.[30] C. Zhan, V. K. Ramachandaramurthy, A. Arulampalam, C. Fitzer, S. Kromlidis, M. Bames, y N. Jenkins, «Dynamic voltage restorer based on voltage-space-vector PWM control», IEEE Trans. Ind. Appl., vol. 37, n.o 6, pp. 1855-1863, nov. 2001.[31] C. Fitzer, A. Arulampalam, M. Barnes, y R. Zurowski, «Mitigation of saturation in dynamic voltage restorer connection transformers», IEEE Trans. Power Electron., vol. 17, n.o 6, pp. 1058- 1066, nov. 2002.[32] S. Gao, X. Lin, Y. Kang, Y. Duan, y J. Qiu, «Mitigation of inrush current in dynamic voltage restorer injection transformers», en 2012 IEEE Energy Conversion Congress and Exposition (ECCE), 2012, pp. 4093-4098.[33] Y. W. Li, «Control and Resonance Damping of Voltage-Source and Current-Source Converters With Filters», IEEE Trans. Ind. Electron., vol. 56, n.o 5, pp. 1511-1521, may 2009.[34] H. Akagi, «Control strategy and site selection of shunt active filter for damping of harmonic propagation in power distribution systems», Present. 1996 IEEEPES Winter Meet., 1996.[35] M. El-Habrouk, M. K. Darwish, y P. Mehta, «Active Power Filters: A Review», Electr. Power Appl. IEE Proc., vol. 147, n.o 5, pp. 403 -413, sep. 2000.[36] S. Buso, L. Malesani, y P. Mattavelli, «Comparison of current control techniques for active filter applications», Ind. Electron. IEEE Trans. On, vol. 45, n.o 5, pp. 722–729, 1998.[37] W. M. Grady, M. J. Samotyj, y A. H. Noyola, «Survey of active power line conditioning metodologies», IEEE Trans. Power Deliv., vol. 5, pp. 1536-1542, 1990.[38] H. Akagi, Y. Kanazawa, y A. Nabae, «Instantaneous reactive power compensators comprising switching devices without energy storange components», IEEE Trans. Ind. Appl., vol. IA-20, pp. 625-630, 1984.[39] A. Garcia-Cerrada, P. Garcia-Gonzalez, R. Collantes, T. Gomez, y J. Anzola, «Comparison of thyristor-controlled reactors and voltage-source inverters for compensation of flicker caused by arc furnaces», IEEE Trans. Power Deliv., vol. 15, n.o 4, p. 1225, 2000.[40] P. C. Krause, Analysis of Electric Machinery. New York: McGraw-Hill Inc., 1986.[41] H. Akagi, Y. Kanazawa, y A. Nabae, «Generalised theory of the instantaneous reactive power in three-phase circuits», Proceeding 1983 Int. Power Electron. Conf. Tokyo Jpn. 1983, pp. 1375-1386, 1983.[42] G. F. Franklin, J. D. Powell, y M. L. Workman, Digital Control of Dynamic Systems, 3rd ed. Addison-Wesley, 1997.[43] K. J. Astrom y B. Wittenmark, Computer-Controlled Systems: Theory and Design, 3rd ed. Prentice Hall Inc., 1997.[44] J. Svensson, «Grid-connected voltage source converter», PhD Thesis, Chalmers university of Technology, 1998.[45] J. Svensson y R. Ottersted, «Shunt Active Filtering of Vector Current-Controlled VSC at a Moderate Swiching Frequency», IEEE Trans. Ind. Appl., vol. 35, pp. 1083-1090, 1999.[46] J. Holtz, «Pulsewith modulation for electronic power convertion», Proceeding IEEE, vol. 82, n.o 8, pp. 1194-1214, ago. 1994.[47] Mathworks, Using Matlab vesion 8.4. Natick,MA: The Mathworks, Inc, 2014.[48] Mathworks, Using Simulink vesion 8.4. Natick,MA: The Mathworks, Inc, 2014.[49] G. Goodwin, S. Graebe, y M. Salgado, Control Systems Design. London: Prentice Hall, 2001.

Kumquat (Fortunella margarita (Lour.) Swingle) is an important citrus fruit crop of Iland County in northeastern Taiwan. Fruit produced in this area are mainly for making preserves, which is a well-known product in Taiwan. Decline of kumquat was first noticed in 1990. Since 1995, it has become an important problem affecting ≈80% of kumquat orchards. The problem was especially serious after the passage of a typhoon. Some orchards were abandoned due to death of many declining trees. Initial symptoms were yellowing and browning of leaves on some branches of affected trees. Abscission of leaves and fruits occurred, subsequently resulting in the appearance of dieback of affected branches. Disease symptoms could progress to other branches of the same tree, gummosis on the trunk, and eventually death of the tree. Previously, Phytophthora citrophthora (Smith & Smith) Leonian was reported to be a causal organism of kumquat decline (1). Recently, isolations from declining kumquat trees in several orchards failed to recover P. citrophthora and instead we isolated Lasiodiplodia theobromae (Pat.) Griffon & Maubl. (syn. Botryodiplodia theobromae Pat.) from tissue taken from the margin of discolored bark and wood on symptomatic branches. The fungus produced grayish black colonies on V8 agar and black ostiolate pycnidia (125 to 650 μm in diameter) with ovoid to elongate conidia (20 to 32 × 12 to 16 μm) on autoclaved whole wheat grains that were placed on V8 agar. Young conidia were hyaline and nonseptate, whereas mature conidia were brown, one septate, and striate. Pathogenicity tests were carried out on healthy kumquat trees located at the Taiwan Agricultural Research Institute experimental farm. Three isolates of L. theobromae were cultured on wheat-oat medium. Colonized grains (≈5 g) were held against a wound made by lightly scrapping a branch (5 to 7 mm in diameter) 200 to 250 cm above the ground by wrapping a sheet of clear plastic around the branch (2). Eighteen branches were used for each isolate, and the same number of branches similarly inoculated with sterile grains as a control. Healthy branches inoculated with L. theobromae showed disease symptoms similar to those observed on naturally infected plants. Discoloration of leaves on inoculated branches occurred within 1 week. Subsequently, all the leaves fell and infected branches died. The numbers of inoculated branches killed by the three isolates of L. theobromae tested were 18, 9, and 14 after 1 month. All control branches remained disease free. L. theobromae was reisolated from symptomatic tissues, completing Koch's postulates. The same isolates were used to inoculate trunks of kumquat trees with the method described above. Six trunks were inoculated with each isolate, and the same number of trunks similarly inoculated with sterile grains was used as the control. Gummosis on inoculated trunks occurred in 1 week. The numbers of inoculated trunks showing gummosis induced by the three isolates of L. theobromae tested were 6, 5, and 6 after 1 month. L. theobromae was reisolated from symptomatic tissue. All control trunks remained free of gummosis. Our results show that in addition to P. citrophthora, L. theobromae can also cause a dieback on kumquat. To our knowledge, this is the first report of disease caused by L. theobromae on kumquat or on any species in the Rutaceae family in Taiwan. References: (1) P. J. Ann et al. Plant Pathol. Bull. (Taiwan) 6:198, 1997. (2) W. H. Ko et al. Plant Pathol. 35:254, 1986.

The ascochyta blight complex on field pea (Pisum sativum) in Australia causes severe yield loss of up to 60% (1). This blight complex includes a range of different symptoms, including ascochyta blight, foot rot, and black stem and leaf and pod spot (together more commonly known as “black spot disease” in Australia). In Australia, disease is generally caused by one or more of the four fungi: Didymella pinodes, Phoma pinodella, Ascochyta pisi, and P. koolunga (1,2). However, in September 2012, from a field pea disease screening nursery at Medina, Western Australia, approximately 1% of isolates were a Phoma sp. morphologically different to any Phoma sp. previously reported on field pea in Australia. The remaining isolates were either D. pinodes or P. pinodella. Single spore isolations of two isolates of this Phoma sp. were made onto Coon's Agar and DNA extracted. Two PCR primers TW81 (5′GTTTCCGTAGGTGAACCTGC 3′) and AB28 (5′ATATGCTTAAGTTCAGCGGGT 3′) were used to amplify extracted DNA from the 3′ end of 16S rDNA, across ITS1, 5.8S rDNA, and ITS2 to the 5′ end of the 28S rDNA. The PCR products were sequenced and BLAST analyses used to compare sequences with those in GenBank. In each case, the sequence had ≥99% nucleotide identity with the corresponding sequence in GeneBank for P. glomerata. Isolates also showed morphological similarities to P. glomerata as described in other reports (3). The relevant information for a representative isolate has been lodged in GenBank (Accession No. KF424434). The same primers were used by Davidson et al. (2) to identify P. koolunga, but neither of our two isolates were P. koolunga. A conidial suspension of 106 conidia ml–1 from a single spore culture was spot-inoculated onto foliage of 20-day-old plants of P. sativum variety WAPEA2211 maintained under >90% RH conditions for 72 h post-inoculation. Symptoms on foliage first became evident by 8 days post-inoculation, consisting of dark brown lesions 1 to 2.5 mm in diameter. P. glomerata was readily re-isolated from infected foliage to fulfill Koch's postulates. No lesions occurred on foliage of control plants inoculated with only deionized water. A culture of this representative isolate has been lodged in the Western Australian Culture Collection Herbarium maintained at the Department of Agriculture and Food Western Australia (Accession No. WAC13652). While not reported previously on P. sativum in Australia, P. glomerata has been reported on other legume crop and pasture species in eastern Australia, including Cicer arietinum (1973), Lupinus angustifolius (1982), Medicago littoralis (1983), M. truncatula (1985), and Glycine max (1986) (Australian Plant Pest Database). Molecular analysis of historical isolates collected from P. sativum in Western Australia, mostly in the late 1980s and 1990s, did not show any incidence of P. glomerata, despite this fungus being previously reported on Citrus, Cocos, Rosa, Santalum, and Washingtonia in Western Australia (4). We believe this to be the first report of P. glomerata as a pathogen on field pea in Australia. The previous reports of P. glomerata on other crop legumes in eastern Australia and its wide host range together suggest potential for this fungus to be a pathogen on a range of leguminous genera/species. References: (1) T. W. Bretag et al. Aust. J. Agric. Res. 57:883, 2006. (2) J. A. Davidson et al. Mycologica 101:120, 2009. (3) G. Morgan-Jones. CMI Descriptions of Pathogenic Fungi and Bacteria No.134 Phoma glomerata, 1967. (4) R. G. Shivas. J. Roy. Soc. West. Aust. 72:1, 1989.

A study is presented that analyzed the characteristics of sexism; a descriptive, non-experimental cross-sectional methodology was used. The sample consisted of 3004 randomly chosen university students. A measurement scale with 12 items was used that allowed us to understand the current situation of the students in relation to sexism. The results indicate that sexism in university students is low, statistically significant differences were found between men and women, however, both groups present low scores. Likewise, there are differences in sexism by professional career, where engineering students score higher than social science students and age correlates directly and low with the variable under study. Keywords: Sexism, students, university. References [1]C. Silva Barreda and A. Zavala Calahorrano, «Machismo sexual y Marianismo en las relaciones de pareja, una revisión bibliográfica,» MEDWAVE, vol. 20, nº S1,2020. [2]B. Oblitas, «Machismo y violencia contra la mujer,» Investigaciones sociales, vol. 13, nº 23, pp. 301-322, 2009. [3]J. Calizaya, «Algunas ideas de investigación científica, » Minerva, vol. 1, nº 3, pp. 35-39, 2020. [4]G. W. Allport, The Nature of Prejudice. Reading, MA: Addison-Wesley, USA: MA: Addison-Wesley, 1954. [5]M. Sacoto and E. Mosquera, «Apego y sexismo en población adulta entre 18 y 60 años en Quito, Ecuador [Apego y sexismo en población adulta entre 18 y 60años en Quito, Ecuador],» Ciencias Psicológicas, vol. 15, nº 2, p. 2302, 2021. [6]F. Tougas, R. Brown, A. Beaton and S. Joly, «Neosexism: Plus ca change, plus c'est pareil.,» Personality and Social Psychology Bulletin, vol. 21, pp. 842-850,1995. [7]J. Swim, W. Aikin, W. HaII and B. Hunter, «Sexism, and Racism: Old-fashioned and Modern Prejudices.,» Journal of Personality and Social Psychology, vol. 8, nº2, pp. 199-214, 1995. [8]P. Glick and S. T. Fiske, «The Ambivalence toward Men Inventory: Differentiating hostile and benevolent beliefs about men,» Psychology of Women Quarterly,vol. 23, pp. 519-536, 1999. [9]J. McConahay, «Modern racism, ambivalence, and the modern racism scale.,» Prejudice, discrimination, and racism, vol. 1, pp. 91-125, 1986. [10]S. Ubillos-Landa, E. Goiburu-Moreno, A. Puente-Martínez and J. Pizarro-Ruiz, «Influence in sex education programs: An empirical study,» Revista de Psicodidactica, vol. 26, nº 2, pp. 123-131, 2021. [11]J. Cardona, L. Casas, S. Cañon, J. Castaño, A. Godoy, D. Henao and L. Valencia, «Sexismo y concepciones de la violencia de género contra la mujer en cuatro universidades de la ciudad de Manizales,» Archivos de Medicina, vol. 15, nº 2, pp. 200-219, 2015. [12] P. Rotaeche, J. Alboniga-Mayor, and N. Mondragon, «Representations of sexism in higher education and professional training,» Educacion XX1, vol. 24, nº 2, pp. 421-440, 2021. [13]J. Rojas and E. Carpintero, «Sexismo y agresiones físicas, sexuales y verbales-emocionales, en relaciones de noviazgo de estudiantes universitarios,» Electronic Journal of Research in Educational Psychology, vol. 9, nº 2, pp. 541-564, 2011. [14]C. Carpio, E. Bonilla-Algovia and M. Carrasco, «Ambivalent sexism in adolescents of castilla-la mancha,» Revista de Educacion, vol. 392, pp. 91-114, 2021. [15]C. Cruz Torres, F. Correa Romero and J. Padilla Bautista, «Sexism, fear of negative evaluation and destructive communication in the couple,» Revista de Psicologia, vol. 39, nº 1, pp. 9-34, 2021. [16]M. Lameiras-Fernández and Y. Rodríguez-Castro, «Evaluación del sexismo moderno en adolescentes,» Revista de Psicología Social, vol. 17, pp. 119-127, 2002. [17]M. Lameiras-Fernández and Y. Rodríguez-Castro, «Evaluación del sexismo ambivalente en estudiantes gallegos/as,» Acción Psicológica, vol. 2, nº 2, pp. 131-136, 2003. [18]S. De Lemus, M. Moya and P. Glick, «When Contact Correlates with Prejudice: Adolescents’ Romantic Relationship Experience Predicts Greater Benevolent Sexism in Boys and Hostile Sexism in Girls,» Sex Roles, vol. 63, nº 3-4, pp. 214-216, 2010. [19]M. Sánchez-Hernández, M. Herrera-Enríquez and F. Expósito, «Controlling Behaviors in Couple Relationships in the Digital Age: Acceptability of Gender Violence, Sexism, and Myths about Romantic Love,» Psychosocial Intervention, vol. 29, nº 2, pp. 67-81, 2021. [20]C. Diaz, M. Rosas and M. Gonzáles, «Escala de Machismo Sexual (EMS-Sexismo-12): diseño y análisis,» SUMMA Psicológica UST, vol. 7, nº 2, pp. 35-44, 2010. [21]H. Alvarado and C. Batanero, «Significado del Teorema Central del Límite en textos universitarios de probabilidad y estadística,» Estudios Pedagógicos, vol. 34, nº 2, pp. 7-28, 2008.

During the summer of 2001, leaf spots resembling those caused by Septoria musiva Peck. were observed on shining willow (Salix lucida Mühl. subsp. lucida) at Leclerville, Québec, Canada (46°34′19″N,71°59′35″W). Affected leaves had brown, necrotic leaf spots (>5mm in diameter) surrounded by a darker brown halo. Conidia were cylindrical, straight to curved with 1 to 4 septa, 28 to 54 × 3.5 to 4 μm, and were produced in pycnidia located on the abaxial surface in the center of the leaf spots. The causal agent of this disease was successfully isolated by germinating the conidia on corn meal agar that was supplemented with streptomycin (50mg/ml) and chloramphenicol (300mg/ml) and followed with the transfer of the germinated conidia to potato dextrose agar. Leaf symptoms and morphology matched those of S. musiva, the cause of leaf spot and stem canker of hybrid poplars in North America (2,4). The internal transcribed spacers and the 5.8S portion of the rDNA were amplified using PCR with the ITS1 (5′-TCC GTA GGT GAA CCT GCG G-3′) and ITS2 (5′-GCT GCG TTC TTC ATC GAT GC-3′) primer pair on total genomic DNA extracted from a pure culture of the pathogen. The rDNA sequence obtained (GenBank Accession No. AY555277) had 100% identity at 506 base positions with the ITS1, 5.8S, and ITS2 of three S. musiva isolates from Québec and one from Wisconsin (GenBank Accession Nos. AY549464 to AY549467). To test for pathogenicity, excised leaf disks from plants propagated by softwood cuttings of the source plant and from one hybrid poplar clone (Populus maximowiczii × P. xjackii) were inoculated with 3 μl of a suspension of ground mycelium or sterile water (control). Disks were placed in a 24-well tissue culture plate with 1 ml of distilled water per well and incubated in a growth room maintained at 22°C with a 16-h photoperiod. After 1 month, symptoms were similar to those previously observed. Isolates collected from shining willow or hybrid poplar were able to induce S. musiva leaf spot symptoms on leaf disks excised from shining willow or the hybrid poplar clone. From symptomatic leaf disks, S. musiva was consistently reisolated. To our knowledge, this is the first report of S. musiva on a member of the genus Salix. S. didyma, S. salicicola, and S. salicina have been reported from leaves of species of Salix (1,3). Only a vague morphological description of S. didyma was found (3). Moreover, conidia of S. salicicola (20 to 50 × 2.5 to 3.5 μm) and S. salicina (40 to 60 μm long, unspecified width) overlap dimensions of S. musiva conidia (1). There is a need to reexamine the relationships between these species of Septoria. Evidently, the complete host range of S. musiva is not yet known. References: (1) L. Lanier et al. Mycologie et Pathologie Forestières. Masson. Paris, 1978. (2) M. E. Ostry. Eur. J. For. Pathol. 17:158, 1987. (3) P. A. Saccardo. Sylloge fungurum omnium hucusque cognitorum. Patavii: Sumptibus Auctoris, 1882. (4) L. J. Spielman et al. Plant Dis. 70:968, 1986.

Abstract Background: Cardiovascular disease (CVD) is a major cause of morbidity and mortality among men diagnosed with prostate cancer. We evaluated the extent to which men with prostate cancer develop CVD accounting for potential factors that may contribute to the CVD burden in this population. Methods: We prospectively followed men diagnosed with prostate cancer and free from CVD (stroke and coronary heart disease, including myocardial infarction, coronary artery bypass graft, and percutaneous coronary intervention) before their cancer diagnosis in the Health Professionals Follow-up Study, between 1986 and 2016. Men were categorized by D’Amico prostate cancer risk groups as low-risk (stage T1-2a, Gleason score ≤6, and PSA at diagnosis ≤10 ng/mL), intermediate-risk (T2b and/or Gleason score 7 and/or PSA &gt;10-20), or high-risk (≥T2c/N1/M1 or Gleason score 8-10 or PSA &gt;20). Incident fatal and non-fatal CVD, defined as coronary heart disease and stroke after cancer diagnosis, were centrally adjudicated. CVD risk factors including smoking, hyperlipidemia, hypertension, diabetes mellitus, body mass index, were self-reported on biennial questionnaires. Deaths due to prostate cancer or other causes were treated as competing events when estimating cumulative incidence and cause-specific hazard ratios (HR). Results: Among 5,707 prostate cancer patients, 1,912 had low-risk, 2,261 had intermediate-risk, and 1,534 had high-risk cancer. 1,102 CVD events were documented over up to 30 years of follow-up after cancer diagnosis. The 10-year CVD risk was 8.1% for men with low-risk cancer, 8.8% for intermediate-risk, and 10.4% for high-risk cancer. The cause-specific HRs for CVD were 1.18 (95% CI 1.03, 1.36) in intermediate-risk and 1.59 (95% CI 1.36, 1.85) in high-risk prostate cancer, both compared to low-risk prostate cancer. Men with high-risk cancer tended to be older; after age adjustment, the HRs were 1.15 for intermediate-risk (95% CI 1.00, 1.33) and 1.35 for high-risk cancer (1.35, 95% CI 1.16, 1.58). Associations between cancer risk group and CVD were essentially unchanged after further adjustment for CVD risk factors present at cancer diagnosis, primary cancer treatment modality (surgery, radiation, androgen deprivation therapy, watchful waiting/active surveillance), and calendar year of diagnosis. Discussion: Despite the elevated risk of cancer mortality in men with intermediate-risk and high-risk prostate cancer compared to low-risk prostate cancer, CVD risk remains at least as common over time among these men as among men with low-risk prostate cancer. Incident CVD risk after cancer diagnosis among men with more aggressive cancers, which particularly occur in older men, is not primarily attributable to differences in pre-existing risk factor burden. These findings from a cohort with healthcare access and literacy indicate a need for continued clinical attention to CVD after cancer diagnosis. Citation Format: Caroline Himbert, Anna Plym, Jane B. Vaselkiv, Andreas Pettersson, Philip W. Kantoff, Lorelei A. Mucci, Kenneth J. Mukamal, Konrad H. Stosapck. Cardiovascular disease risk among men with prostate cancer: Differences by prostate cancer aggressiveness [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 2234.

В статье приведены результаты исследования процесса гидратирования водной фазы обратных эмульсий нефти природным газом с высоким содержанием метана (более 90 об.%). Целью работы являлось исследование кинетики кристаллизации эмульсий нефти при образовании в их среде гидратов природного газа с помощью метода дифференциальной сканирующей калориметрии (ДСК).Объектами исследования являлись обратные эмульсии нефти, содержащие 20, 40, 60 и 80 мас.% воды. Для изучения кинетики гидратирования эмульсий нефти газом был использован метод ДСК в условиях квази-равновесного эксперимента.Показана применимость модели Колмогорова–Джонсона–Мела–Аврами (КДМА) при описании процесса кристаллизации обратных эмульсий нефти в условиях квази-изотермического ДСК-эксперимента. Определены кинетические показатели модели КДМА в эмульсиях для процессов превращения капель воды в лед, а также их гидратирования природным газом. Показано, что в системе «природный газ-нефть-вода» процесс льдообразованияхарактеризуется высокими значениями показателя Аврами (n > 3) и степени свободы (l = 3), а процесс образования гидрата природного газа – низким показателем Аврами (n < 3) и средними показателями степени свободы (l = 1–3).Показано, что в непрерывной водной фазе гидраты природного газа формируются путем мгновенногозародышеобразования в виде отдельных одномерных кристаллов, а в нефти – гидраты нуклеируют с постоянной скоростью и, в зависимости от содержания воды, растут в виде разрозненных кристаллитов, корки или сферолитов. Полученные результаты исследований позволяют углубить уровень знаний о кинетике и механизмах гидратирования эмульсий нефти, и могут быть использованы в качестве дополнения к научным основам создания новых технологийсовместной транспортировки нефти и гидратированного в ней природного газа. ЛИТЕРАТУРА 1. Carroll J. Natural Gas Hydrates: A Guide for Engineers.Oxford, UK: Gulf Professional Publishing;2020. 392 р.2. Maninder K., Zhenyuan Y., Praveen L. A Reviewof clathrate hydrate nucleation. Sustainable Chemistry& Engineering. 2017;5(12): 11176–11203. DOI: https://doi.org/10.1021/acssuschemeng.7b032383. Straume E. O., Morales R., Sum A. K. Perspectiveson gas hydrates cold flow technology. Energy &Fuels. 2019;33(1): 1–15. DOI: https://doi.org/10.1021/acs.energyfuels.8b028164. Ribeiro C. P., Lage P. L. C. Modelling of hydrateformation kinetics: State-of-the-art and future directions.Chemical Engineering Science. 2008;63(8):2007–2034. DOI: https://doi.org/10.1016/j.ces.2008.01.0145. Englezos P., Kalogerakis N. E., Dholabhai P. D.,Bishnoi P. R. Kinetics of gas hydrate formation frommixtures of methane and ethane. Chemical EngineeringScience. 1987;42(11): 2659–2666. DOI: https://doi.org/10.1016/0009-2509(87)87016-16. Song G., Li Y., Wang W., Zhao P., Jiang K., Ye X.Experimental study of hydrate formation in oil-watersystems using a high-pressure visual autoclave. AIChEJournal. 2019;65(9): e16667. DOI: https://doi.org/10.1002/aic.166677. Liu Z., Song Y., Liu W., Lang C., Zhao J., Li Y.Formation of methane hydrate in oil–water emulsiongoverned by the hydrophilic and hydrophobic propertiesof non-ionic surfactants. Energy & Fuels.2019;33(6): 5777–5784. DOI: https://doi.org/10.1021/acs.energyfuels.9b010468. Talatori S., Barth T. Rate of hydrate formationin crude oil/gas/water emulsions with different watercuts. Journal of Petroleum Science and Engineering.2012;80(1): 32–40. DOI: https://doi.org/10.1016/j.petrol.2011.10.0109. Avrami M. Kinetics of phase change. II Transformation-time relations for random distribution ofnuclei. Journal of Chemical Physics. 1940;8(2): 212–224.DOI: https://doi.org/10.1063/1.175063110. Palodkar A. V., Mandal S., Jana A. K. Modelinggrowth kinetics of gas hydrate in porous media: Experimentalvalidation. Energy & Fuels. 2016;30(9):7656–7665. DOI: https://doi.org/10.1021/acs.energyfuels.6b0139711. Susilo R., Ripmeester J. A., Englezos P. Methaneconversion rate into structure H hydrate crystals fromice. AIChE Journal. 2007;53(9): 2451–2460. DOI:https://doi.org/10.1002/aic.1126812. Naeiji P., Varaminian F. Differential scanningcalorimetry measurements and modeling of methane +THF hydrate growth kinetics based on non-equilibriumthermodynamics. Journal of Molecular Liquids.2018;263: 22–30. DOI: https://doi.org/10.1016/j.molliq.2018.04.10713. Choupin T., Fayolle B., Régnier G., Paris C.,Cinquin J., Brule B. A more reliable DSC-based methodologyto study crystallization kinetics: Applicationto poly(ether-ketone-ketone) (PEKK) copolymers.Polymer. 2018;155: 109–115. DOI: https://doi.org/10.1016/j.polymer.2018.08.06014. Tan C., Zhu J., Wang Z., Zhang K., Tian X.,Cai W. The crystallization kinetics of Co doping onNi–Mn–Sn magnetic shape memory alloy thin films.RSC Advances. 2018;8(45): 25819–25828. DOI: https://doi.org/10.1039/c8ra04618b15. Derkach S. R., Kolotova D. S., Simonsen G.,Simon S. C., Sjöblom J., Andrianov A. V., Malkin A. Y.Kinetics of crystallization of aqueous droplets in water-in-crude oil emulsions at low temperatures. Energy& Fuels. 2018;32(2): 2197–2202. DOI: https://doi.org/10.1021/acs.energyfuels.7b0345716. Liu Z., Liu W., Lang C., Li Y., Yang M., Zhao J.,Song Y. DSC studies of methane hydrate formationand dissociation in water-in-mineral oil emulsions.In: Proc. 16th International Heat Transfer Conference(IHTC-16). 2018, 10–15 August, Beijing, China: 2018.p. 1607–1613. DOI: https://doi.org/10.1615/ihtc16.cat.02345317. Drelich A., Dalmazzone C., Pezron I., Liggieri L.,Clausse D. DSC (Differential Scanning Calorimetry)used to follow the evolution of W/O emulsions versustime on ground and in space in the ISS. Oil & GasSciences and Technology – Revue d’IFP Energies Nou-velles. 2018;73(16): 1–9. DOI: https://doi.org/10.2516/ogst/201800318. Leister N., Karbstein H. Evaluating the stabilityof double emulsions – A review of the masurementtechniques for the systematic investigation of instabilitymechanisms. Colloids and Interfaces. 2020;4(8):1–18. DOI: https://doi.org/10.3390/colloids401000819. Koryakina V.V., Ivanova I.K., Semenov M.E.,Rozhin I.I., Fedorova A.F., Shits E.Y. Specific featuresof the growth, composition, and content of natural gashydrates synthesized in inverted oil emulsions. RussianJournal of Applied Chemistry. 2017;90(8): 1258–1265. DOI: https://doi.org/10.1134/s107042721708011020. Dill E. D., Folmer J. C. W., Martin J. D. Crystalgrowth simulations to establish physically relevantkinetic parameters from the empirical Kolmogorov–Johnson–Mehl–Avrami Model. Chemistry of Materials.2013;25(20): 3941–3951. DOI: https://doi.org/10.1021/cm402751x21. 2. Сакович Г. В. Замечания о некоторыхуравнениях кинетики реакций с участием твердыхвеществ, применяемых в настоящее время. Ученыезаписки Томского университета. 1955; 26: 103–110.22. 3. Гройсман А. Г. Теплофизические свойствагазовых гидратов. Новосибирск: Наука, 1985. 95 с.23. 4. Principles and Applications of ThermalAnalysis. Ed. P. Gabbott. Oxford, UK: BlackwellPublishing Ltd.; 2008. 464 p.24. Ruitenberg G., Woldt E., Petford-Long A. K.Comparing the Johnson–Mehl–Avrami–Kolmogorovequations for isothermal and linear heating conditions.Thermochimica Acta. 2001;378(1–2): 97–105. DOI:https://doi.org/10.1016/s0040-6031(01)00584-625. Stoporev A. S., Manakov A. Yu., Kosyakov V. I.,Shestakov V. A., Altunina K. A., Strelets L. A. Nucleationof methane hydrate in water-in-oil emulsions:role of the phase boundary. Energy & Fuels. 2016;30(5):3735–3741. DOI: https://doi.org/10.1021/acs.energyfuels.5b0227926. Kislitsin A. A., Drachuk A. O., Molokitina N. S.,Podenko L. S. Diffusion model of methane hydrateformation in “Dry Water”. Russian Journal of PhysicalChemistry A. 2020;94(2): 405–411. DOI: https://doi.org/10.1134/s003602442002017x27. Kodama T., Ohmura R. Crystal growth ofclathrate hydrate in liquid water in contact withmethane + ethane + propane gas mixture. Journal ofChemical Technology & Biotechnology. 2014; 89(12):1982–1986. DOI: https://doi.org/10.1002/jctb.429228. Adamova T. P., Stoporev A. S., Manakov A. Y.Visual studies of methane hydrate formation on thewater – oil boundaries. Crystal Growth & Design.2018;18(11): 6713–6722. DOI: https://doi.org/10.1021/acs.cgd.8b0098629. Dong S., Liu C., Han W., Li M., Zhang J., Chen G.The effect of the hydrate antiagglomerant on hydratecrystallization at the oil–water interface. ACS Omega.2020;5(7): 3315–3321. DOI: https://doi.org/10.1021/acsomega.9b0339530. Guo D., Ou W., Ning F., Fang B., Liu Z., Fang X.,He Z. The effects of hydrate formation and dissociationon the water-oil interface: Insight into the stability ofan emulsion. Fuel. 2020;266: 116980. DOI: https://doi.org/10.1016/j.fuel.2019.116980

ABSTRACT The purpose of this study was to analyze the short-term and long-term relationship between the Islamic capital markets of 5 selected countries in the Covid-19 era. This study used a quantitative approach using weekly secondary data from January 2020 to December 2022. The data analysis model used Vector Auto Regression (VAR) analysis. The results of this study show that in the short term, variants in the capital market will change due to shocks in other ASEAN Islamic capital markets, but short-term deviations in the Islamic capital market will adjust in the long term. meanwhile, in the long run, Islamic capital markets in ASEAN countries that were tested, have integrated despite the occurrence of a health crisis that also has an impact on the financial crisis. This provides an opportunity for investors to mitigate risks and increase profit margins, especially in Islamic stock exchanges in ASEAN countries. On the other hand, this research allows investors to reformulate a more diversified portfolio after the Covid-19 pandemic. Keywords: Integration, Islamic Capital Market, ASEAN, Covid 19 ABSTRAK Tujuan dari penelitian ini adalah untuk menganalisis hubungan jangka pendek dan jangka panjang antara pasar modal syariah 5 negara terpilih di era Covid-19. Penelitian ini menggunakan pendekatan kuantitatif dengan menggunakan data sekunder mingguan januari 2020 sampai dengan desember 2022. Model analisis data menggunakan analisis Vector Auto Regression (VAR). Hasil penelitian ini menunjukkan bahwa dalam jangka pendek, varian di pasar modal akan berubah karena guncangan di pasar modal syariah ASEAN lainnya, namun penyimpangan jangka pendek di pasar modal syariah akan menyesuaikan dalam jangka panjang. sementara dalam jangka panjang, pasar modal syariah di negara-negara ASEAN yang teruji, memiliki integrasi meskipun terjadi krisis kesehatan yang juga berdampak pada krisis keuangan. Hal ini memberikan suatu kesempatan bagi para investor untuk memitigasi risiko dan memperbesar margin keuntungan terutama di bursa saham syariah negara ASEAN. Disisi lain, dengan adanya penelitian ini memungkinkan membantu para investor untuk merumuskan kembali portofolio yang lebih terdiversifikasi setelah terjadinya pandemi covid-19. Kata Kunci: Integrasi, Pasar Modal Syariah, ASEAN, Covid 19 REFERENCES Abd. Majid, M. S. (2018). Who Co-Moves The Islamic Stock Market of Indonesia -The US, The UK, or Japan? Al-Iqtishad: Jurnal Ilmu Ekonomi Syariah, 10(2), 267–284. doi:10.15408/aiq.v10i2.7288 Abdul Karim, B., & Abdul-Rahman, A. (2020). Market integration in asean-5: Evidence of Islamic and conventional stock markets. Polish Journal of Management Studies, 21(1), 186–198. doi:10.17512/pjms.2020.21.1.14 Abdulkarim, F. M., Akinlaso, M. I., Hamid, B. A., & Ali, H. S. (2020). The nexus between oil price and Islamic stock markets in Africa: A wavelet and Multivariate-GARCH approach. Borsa Istanbul Review, 20(2), 108–120. doi:10.1016/j.bir.2019.11.001 Ahmed, F. (2021). Assessment of Capital Market Efficiency in COVID-19. European Journal of Business and Management Research, 6(3), 42–46. doi:10.24018/ejbmr.2021.6.3.839 Awwal, M. A. F. (2021). The corona pandemic on sharia capital market in Indonesia. Iqtishoduna, 10(2), 95–104. doi:10.36835/iqtishoduna.v10i2.864 Aziz, A., Rachmat, N., Abu, A., Adnan, Y., Islam, M. H., Islam, U., Hasan, Z., & Indonesia, G. (2020). Does integration superpower stock market for index of sharia stock in Indonesia. International Journal of Management Science and Business Research, 9(10), 170–177. doi:10.5281/zenodo.4990752 Bekaert, G., Harvey, C. R., & Ng, A. (2005). Market integtation and cintagration. The Journal of Business, 78(1), 39-70. doi:10.1086/426519 Cahyaningrum, A., & Robiyanto, R. (2021). Pengujian integrasi pasar modal di Kawasan Asia sebelum dan selama pandemi Covid-19. Jurnal Akuntansi Keuangan Dan Bisnis, 14(2), 211–220. doi:10.35143/jakb.v14i2.4673 Chen, M. P., Lee, C. C., Lin, Y. H., & Chen, W. Y. (2018). Did the S.A.R.S. epidemic weaken the integration of Asian stock markets? Evidence from smooth time-varying cointegration analysis. Economic Research, 31(1), 908–926. doi:10.1080/1331677X.2018.1456354 Chen, N. F., Roll, R., & Ross, S. A. (1986). Economic Forces and the Stock Market. Journal of Bussiness, 59(3), 383–403. Climent, F., & Meneu, V. (2003). Has 1997 Asian crisis increased information flows between international markets. International Review of Economics & Finance, 12(1), 111–143. doi:10.1016/s1059-0560(02)00140-5 Dantes, R. (2019). Wawasan pasar modal syariah. Ponorogo: Wade Group. Elmizan, G. H., Rahmawati, V., & Talim, A. (2022). Understanding and interest in sharia capital market investment of PTKIN and PTKIS Students. Indonesisan Interdisciplinary Journal of Sharia Economics, 5(2), 441–458. doi:10.31538/iijse.v5i2.2165 Erdo, S., Gedikli, A., & Ismail, E. (2020). Volatility spillover effects between Islamic stock markets and exchange rates : Evidence from three emerging countries. Borsa Istanbul Review, 20(4), 322-333. doi:10.1016/j.bir.2020.04.003 Fama, E. F. (1970). Efficient capital markets: A review of theory and empirical Work. The Journal of Finance, 25(2), 383–417. doi:10.2307/2325486 Fathoni, H., & Sakinah, G. (2021). Peran pasar modal syariah dalam laju pertumbuhan ekonomi di Indonesia. Khazanah Multidisiplin, 2(1), 33–44. Gujarati, D. N., & Porter, D. C. (2009). Basic econometrics. New York: McGraw-Hill Companies,Inc. Gunawan, D., & Cahyadi, W. (2019). Integrasi pasar saham Indonesia dengan Pasar Saham Asia. Jurnal PasarModal Dan Bisnis, 1(2), 145–154. doi:10.37194/jpmb.v1i2.27 Handini, S., & Astawinetu, E. D. (2020). Teori portofolio dan pasar modal Indonesia. Surabaya: Scopindo Media Pustaka. Hartati, N. (2021). Investasi saham syariah di bursa efek Indonesia dalam perspektif hukum ekonomi syariah. J-HES (Jurnal Hukum Ekonomi Syariah), 5(1), 33–48. doi:10.26618/j-hes.v5i01.4819. Karim, B. A., & Karim, Z. A. (2012). Integration of ASEAN-5 stock markets: A revisit. Asian Academy of Management Journal of Accounting and Finance, 8(2), 21–41. Khan, K., Zhao, H., Zhang, H., Yang, H., Shah, M. H., & Jahanger, A. (2020). The impact of COVID-19 pandemic on stock markets: An empirical analysis of world major stock indices. Journal of Asian Finance Economics and Business, 7(7), 463–474. doi:10.13106/jafeb.2020.vol7.no7.463 Laopodis, N. T. (2020). Understanding investments (2nd Edition). London: Routledge. Liu, H., Manzoor, A., Wang, C., Zhang, L., & Manzoor, Z. (2020). The COVID-19 outbreak and affected countries stock markets response. International Journal of Environmental Research and Public Health, 17(8), 1–19. doi:10.3390/ijerph17082800 Majid, M. S. A., Meera, A. K. M., & Omar, M. A. (2008). Interdependence of asean-5 stock markets from the US and Japan. Global Economic Review, 37(2), 201–225. doi:10.1080/12265080802021201 Malik, A. D. (2017). Analisa faktor – faktor yang mempengaruhi minat masyarakat berinvestasi di pasar modal syariah melalui Bursa Galeri Investasi Uisi. JEBIS: Jurnal Ekonomi Dan Bisnis Islam, 3(1), 61-84. doi:10.20473/jebis.v3i1.4693 Mustapha, M. I., Bacha, O. I., & Masih, M. (2017). Dynamics of islamic stock market returns and exchange rate movements in the ASEAN Countries in a regime-switching environment : Implications for the islamic investors and risk hedgers. Munich Personal RePEc Archive: University Library of Munich, 82218. Noptriyani, I., Ahmadsyah, I., & Aufa, S. (2016). Faktor-Faktor yang menjadi penghambat bagi mahasiswa dalam memiliki investasi (Studi kasus pada mahasiswa Fakultas Ekonomi dan Bisnis Islam Universitas Islam Negeri Ar-Raniry). Global Journal of Islamic Banking and Finance, 2(1), 82–109. doi:10.22373/jihbiz.v2i1.8580 Nurlina., Abubakar, A., & Khalid, R. (2022). Investasi perspektif Al-Qur’an (Studi menggunakan metode Maudhu’i). E-QIEN: Jurnal Ekonomi dan Bisnis, 11(1), 997–1004. doi:10.34308/eqien.v11i1.832 Oceania, F. G., & Ardiansyah, M. (2023). Dampak shock pada indeks saham syariah global dan indeks saham syariah Regional Asean terhadap perubahan harga saham pada Jakarta Islamic Index Periode 2020-2022 2(03). (Thesis Magister, Universitas Islam Negeri Sunan Kali Jaga) https://digilib.uin-suka.ac.id/id/eprint/55880/ Pajar, R. C., & Pustikaningsih, A. (2017). Pengaruh Motivasi Investasi Dan Pengetahuan Investasi Terhadap Minat Investasi Di Pasar Modal Pada Mahasiswa Fe Uny. Profita: Kajian Ilmu Akuntansi, 5(1), 1–16. Pardal, P., Dias, R., Suler, P., Teixeira, N., & Krulicky, T. (2020). Integration in Central European capital markets in the context of the global COVID-19 pandemic. Equlibrium: Quarterly Journal of Economics and Economic Policy, 15(4), 627-650. doi:10.24136/eq.2020.027 Peristiwo, H. (2016). Analisis minat investor di kota Serang terhadap investasi syariah pada pasar modal syariah. Jurnal Ekonomi Keuangan dan Bisnis Islam, 7(1), 37–52. doi:10.32678/ijei.v7i1.7 Prasetyo, T. A. (2022). Analisis indeks harga saham syariah internasional dan variabel makro ekonomi terhadap Jakarta Islamic Index. At Tawazun, 10(01), 41–53. Qizam, I., Ardiansyah, M., & Qoyum, A. (2020). Integration of Islamic capital market in ASEAN-5 countries: Preliminary evidence for broader benefits from the post-global financial crisis. Journal of Islamic Accounting and Business Research, 11(4), 811–825. doi:10.1108/JIABR-08-2019-0149 Rabbani, I. A., & Saputra, I. (2022). Financial literacy dan overconfidence dalam keputusan investasi. Journal of International Management, 1(1),1–18. Romadhon, M. R., & Ardiansyah, M. (2022). Analisis Pasar Modal Syariah 5 Negara ASEAN di Era Pandemi. E-Journal Ekonomi Bisnis dan Akuntansi Universitas Jember, 9(1), 36–41. doi:10.19184/ejeba.v9i1.30412 Saiti, B. (2015). Cointegration of Islamic stock indices: Evidence from five ASEAN countries. International Journal of Scientific & Engineering Research. 6(7), 1392–1405. Sims, C. A. (1972). Money, income, causality. The American Economic Review, 62(4), 540–552. Siregar, P. A., Sari, S., & Batubara, M. (2022). Perspektif perkembangan dan tantangan pasar modal di Indonesia. Economic Reviews Journal, 2(1), 923–926. Sn, A., & Rahayu, S. E. (2022). Pengaruh indeks saham syariah Jepang (Djijp) dan inseks saham syariah Malaysia (Djmy25d) terhadap indeks saham syariah Indonesia (Issi). Point: Jurnal Ekonomi & Manajemen, 4(1), 53–66. Storey, I., & Choong, W. (2022). Russia’s invasion of ukraine : Southeast Asian responses and why the conflict matters to the region. ISEAS Yusof IShak Institute, 24, 1–13. Sugiyono. (2013). Metode Penelitian Kuantitatif, Kualitatif dan R&D. Bandung: Alfabeta. Sulistiana, I., Hidayati, & Sumar. (2017). Model vector auto regression (Var) and vector error correction model (Vecm) approach for inflation relations analysis, gross regional domestic product (Gdp), world tin price, Bi rate and Rupiah exchange rate. Integrated Journal of Business and Economics, 1(2), 17–32. doi:10.5281/zenodo.1147673 Suteja, J., & Gunardi, A. (2016). Manajemen investasi dan portofolio (Edisi Kesatu). Bandung: PT Refika Aditama. Tiwang, R. A., Karamoy, H., & Maramis, J. (2020). Analisis integrasi pasar modal Indonesia dengan pasar modal global (Nyse, Sse, Lse, dan Pse). JMBI UNSRAT: Jurnal Ilmiah Manajemen Bisnis dan Inovasi Universitas Sam Ratulangi, 7(3), 657–684. doi:10.35794/jmbi.v7i3.31442 Walewangko, E., Saerang, I. S., & Maramis, J. B. (2018). Analisi integrasi saham bursa efek Indonesia dan beberapa bursa efek Negara ASEAN periode Januari 2016 - Juni 2018. Jurnal EMBA: Jurnal Riset Ekonomi, Manajemen, Bisnis dan Akuntansi, 6(4), 3923–3932. doi:10.35794/emba.v6i4.21917 Waworundeng, J. H., & Rate, P. Van. (2018). Analisis hubungan pasar modal ASEAN dengan pasar modal Indonesia di Bursa Efek Indonesia. Jurnal EMBA: Jurnal Riset Ekonomi, Manajemen, Bisnis Dan Akuntansi, 6(1), 271–280. doi:10.35794/emba.v6i1.19049 Widarjono, A. (2018). Ekonometrika: Pengantar dan aplikasinya disertai Panduan Eviews (5th Edition). Yogyakarta: UPP STIM YKPN.

La fuga de clientes es un problema relevante al que enfrentan las empresas de servicios y que les puede generar pérdidas económicas significativas. Identificar los elementos que llevan a un cliente a dejar de consumir un servicio es una tarea compleja, sin embargo, mediante su comportamiento es posible estimar una probabilidad de fuga asociada a cada uno de ellos. Esta investigación aplica minería de datos para la predicción de la fuga de clientes en una empresa de distribución de gas natural, mediante dos técnicas de machine learning: redes neuronales y support vector machine. Los resultados muestran que mediante la aplicación de estas técnicas es posible identificar los clientes con mayor probabilidad de fuga para tomar sobre estas acciones de retenciónoportunas y focalizadas, minimizando los costos asociados al error en la identificación de estos clientes. Palabras Clave: fuga de clientes, minería de datos, machine learning, distribución de gas natural. Referencias [1]J. Miranda, P. Rey y R. Weber, «Predicción de Fugas de Clientes para una Institución Financiera Mediante Support Vector Machines,» Revista Ingeniería de Sistemas Volumen XIX, pp. 49-68, 2005. [2]P. A. Pérez V., «Modelo de predicción de fuga de clientes de telefonía movil post pago,» Universidad de Chile, Santiago, Chile, 2014. [3]Gas Sur S.A., «https://www.gassur.cl/Quienes-Somos/,» [En línea]. [4]J. Xiao, X. Jiang, C. He y G. Teng, «Churn prediction in customer relationship management via GMDH-based multiple classifiers ensemble,» IEEE IntelligentSystems, vol. 31, nº 2, pp. 37-44, 2016. [5]A. M. Almana, M. S. Aksoy y R. Alzahrani, «A survey on data mining techniques in customer churn analysis for telecom industry,» International Journal of Engineering Research and Applications, vol. 4, nº 5, pp. 165-171, 2014. [6]A. Jelvez, M. Moreno, V. Ovalle, C. Torres y F. Troncoso, «Modelo predictivo de fuga de clientes utilizando mineríaa de datos para una empresa de telecomunicaciones en chile,» Universidad, Ciencia y Tecnología, vol. 18, nº 72, pp. 100-109, 2014. [7]D. Anil Kumar y V. Ravi, «Predicting credit card customer churn in banks using data mining,» International Journal of Data Analysis Techniques and Strategies, vol. 1, nº 1, pp. 4-28, 2008. [8]E. Aydoğan, C. Gencer y S. Akbulut, «Churn analysis and customer segmentation of a cosmetics brand using data mining techniques,» Journal of Engineeringand Natural Sciences, vol. 26, nº 1, 2008. [9]G. Dror, D. Pelleg, O. Rokhlenko y I. Szpektor, «Churn prediction in new users of Yahoo! answers,» de Proceedings of the 21st International Conference onWorld Wide Web, 2012. [10]T. Vafeiadis, K. Diamantaras, G. Sarigiannidis y K. Chatzisavvas, «A comparison of machine learning techniques for customer churn prediction,» SimulationModelling Practice and Theory, vol. 55, pp. 1-9, 2015. [11]Y. Xie, X. Li, E. Ngai y W. Ying, «Customer churn prediction using improved balanced random forests,» Expert Systems with Applications, vol. 36, nº 3, pp.5445-5449, 2009. [12]U. Fayyad, G. Piatetsky-Shapiro y P. Smyth, «Knowledge Discovery and Data Mining: Towards a Unifying Framework,» de KDD-96 Proceedings, 1996. [13]R. Brachman y T. Anand, «The process of knowledge discovery in databases,» de Advances in knowledge discovery and data mining, 1996. [14]K. Lakshminarayan, S. Harp, R. Goldman y T. Samad, «Imputation of Missing Data Using Machine Learning Techniques,» de KDD, 1996. [15]B. Nguyen , J. L. Rivero y C. Morell, «Aprendizaje supervisado de funciones de distancia: estado del arte,» Revista Cubana de Ciencias Informáticas, vol. 9, nº 2, pp. 14-28, 2015. [16]I. Monedero, F. Biscarri, J. Guerrero, M. Peña, M. Roldán y C. León, «Detection of water meter under-registration using statistical algorithms,» Journal of Water Resources Planning and Management, vol. 142, nº 1, p. 04015036, 2016. [17]I. Guyon y A. Elisseeff, «An introduction to variable and feature selection,» Journal of machine learning research, vol. 3, nº Mar, pp. 1157-1182, 2003. [18]K. Polat y S. Güneş, «A new feature selection method on classification of medical datasets: Kernel F-score feature selection,» Expert Systems with Applications, vol. 36, nº 7, pp. 10367-10373, 2009. [19]D. J. Matich, «Redes Neuronales. Conceptos Básicos y Aplicaciones,» de Cátedra: Informática Aplicada ala Ingeniería de Procesos- Orientación I, 2001. [20]E. Acevedo M., A. Serna A. y E. Serna M., «Principios y Características de las Redes Neuronales Artificiales, » de Desarrollo e Innovación en Ingeniería, Medellín, Editorial Instituto Antioqueño de Investigación, 2017, pp. Capítulo 10, 173-182. [21]M. Hofmann y R. Klinkenberg, RapidMiner: Data mining use cases and business analytics applications, CRC Press, 2016. [22]R. Pupale, «Towards Data Science,» 2018. [En línea]. Disponible: https://towardsdatascience.com/https-medium-com-pupalerushikesh-svm-f4b42800e989. [23]F. H. Troncoso Espinosa, «Prediction of recidivismin thefts and burglaries using machine learning,» Indian Journal of Science and Technology, vol. 13, nº 6, pp. 696-711, 2020. [24]L. Tashman, «Out-of-sample tests of forecasting accuracy: an analysis and review,» International journal of forecasting, vol. 16, nº 4, pp. 437-450, 2000. [25]S. Varma y R. Simon, «Bias in error estimation when using cross-validation for model selection,» BMC bioinformatics, vol. 7, nº 1, p. 91, 2006. [26]N. V. Chawla, K. W. Bowyer, L. O. Hall y W. Kegelmeyer, «SMOTE: Synthetic Minority Over-sampling Technique,» Journal of Artificial Inteligence Research16, pp. 321-357, 2002. [27]M. Sokolova y G. Lapalme, «A systematic analysis of performance measures for classification tasks,» Information processing & management, vol. 45, nº 4, pp. 427-437, 2009. [28]S. Narkhede, «Understanding AUC-ROC Curve,» Towards Data Science, vol. 26, 2018. [29]R. Westermann y W. Hager, «Error Probabilities in Educational and Psychological Research,» Journal of Educational Statistics, Vol 11, No 2, pp. 117-146, 1986.

The effects of biochar and biochar combined with N-fertilizer on the content of soil organic matter in water-stable aggregates were investigated. A field experiment was conducted with different biochar application rates: B0 control (0 t ha-1), B10 (10 t ha-1) and B20 (20 t ha-1) and 0 (no N), 1st and 2nd levels of nitrogen fertilization on silt loam Haplic Luvisol (Dolna Malanta, Slovakia), in 2014. The N doses of level 1 were calculated on required average crop production using balance method. Level 2 included additional 100% of N in year 2014 and additional 50% of N in year 2016. The effects were investigated during the growing seasons of spring barley and spring wheat in 2014 and 2016, respectively. Results indicate that the B20N2 treatment significantly increased the proportion of water-stable macro-aggregates (WSAma) and reduced water-stable micro-aggregates (WSAmi). Aggregate stability increased only in the B20N1 treatment. The B20N2 treatment showed a robust decrease by 27% in the WSAma of 0.5-0.25 mm. On the other hand, an increase by 56% was observed in the content of WSAma with fractions 3-2 mm compared to the B0N0 treatment. The effect of N fertilizer on WSAma was confirmed only in the case of the B10N2 treatment. The proportion of WSAma with fractions 3-2 mm decreased by 42%, while the size fraction of 0.5-0.25 mm increased by 30% compared to the B10N0 treatment. The content of WSAma with fractions 1-0.5 mm decreased with time. On the contrary, the content of WSAma with particle sizes above 5 mm increased with time in all treatments except the B10N2 and B20N2 treatments. A statistically significant trend was identified in the proportion of WSA in the B10N2 and B20N2 treatments, which indicates that biochar with higher application levels of N fertilizer stabilizes the proportion of water-stable aggregates. In all treatments, the content of soil organic carbon (SOC) and labile carbon (CL) in WSAmi was lower than those in WSAma. A considerable decrease of SOC in the WSAma >5 mm and an increase of SOC in WSAmi were observed when biochar was applied at the rate of 10 t ha-1. Contents of SOC in WSAmi increased as a result of adding biochar combined with N fertilizer at first level. CL in WSA significantly increased in all size fractions of WSA.References Abiven S., Hund A., Martinsen V., Cornelissen G., 2015. Biochar amendment increases maize root surface areas and branching: a shovelomics study in Zambia. Plant Soil, 342, 1-11. Agegnehu G., Bass A.M., Nelson P.N., and Bird M.I., 2016. Benefits of biochar, compost and biochar–compost for soil quality, maize yield and greenhouse gas emissions in a tropical agricultural soil. Sci. Tot. Environ., 543, 295-306. Angers D.A., Samson N., Legere A., 1993. Early changes in water-stable aggregation induced by rotation and tillage in a soil under barley production. Can. J. Soil Sci., 73, 51-59. Atkinson Ch.J., Fitzgerald J.D., Hipps N.A., 2010. Potential mechanisms for achieving agricultural benefits from biochar application to temperate soils: a review. Plant Soil, 337, 1-18. Balashov E., Buchkina N., 2011. Impact of short- and long-term agricultural use of chernozem on its quality indicators. Int. Agrophys., 25, 1-5. Barrow C.J., 2012. Biochar: potential for countering land degradation and for improving agriculture. Appl. Geogr., 34, 21-28. Barthes B.G., Kouakoua E.T., Larre-Larrouy M.C., Razafimbelo T.M., De Luca E.F., Azontonde A., Neves C.S.V.J., De Freitas P.L., Feller C.L., 2008. Texture and sesquioxide effects on water-stable aggregates and organic matter in some tropical soils. Geoderma, 143, 14-25. Benbi D.K., Brar K., Toor A.S., Sharma S., 2015. Sensitivity of labile soil organic carbon pools to long-term fertilizer, straw and manure management in rice-wheat system. Pedosphere, 25, 534-545. Benbi D.K., Brar K., Toor A.S., Singh P., Singh H., 2012. Soil carbon pools under poplar-based agroforestry, rice-wheat, and maize-wheat cropping systems in semi-arid India. Nutr. Cycl. Agroecosys., 92, 107-118. Blanco-Canqui H., Lal L., 2004. Mechanisms of carbon sequestration in soil aggregates. Crit. Rev. Plant Sci., 23, 481-504. Brevik E.C., Cerda A., Mataix-Solera J., Pereg L., Quinton J.N., Six J., Van Oost K., 2015. The interdisciplinary nature of SOIL. SOIL, 1, 117-129. Brodowski S., John B., Flessa H., Amelung W., 2006. Aggregate-occluded black carbon in soil. Eur. J. Soil Sci., 57, 539-546. Bronick C.J., Lal R., 2005. The soil structure and land management: a review. Geoderma, 124, 3-22. Chenu C., Plante A., 2006. Clay-sized organo-mineral complexes in a cultivation chronosequece: revisiting the concept of the “primary organo-mineral complex”. Eur. J. Soil Sci., 56, 596-607. Dziadowiec H., Gonet S.S., 1999. Methodical guide-book for soil organic matter studies. Polish Society of Soil Science, Warszawa, 65p. Elliott E.T., 1986. Aggregate structure and carbon, nitrogen, and phosphorus in native and cultivated soils. Soil Sci. Soc. Am. J., 50, 627-633. Fischer D., Glaser B., 2012. Synergisms between compost and biochar for sustainable soil amelioration, In: Kumar S. (ed.): Management of Organic Waste, In Tech Europe, Rijeka, 167-198. Glaser B., Lehmann J., Zech W., 2002. Ameliorating physical and chemical properties of highly weathered soils in the tropics with charcoal - a review. Biol. Fertil. Soils., 35, 219-230. Heitkotter J., and B. Marschner, 2015. Interactive effects of biochar ageing in soils related to feedstock, pyrolysis temperature, and historic charcoal production. Geoderma, 245-246, 56-64. Herath H.M.S.K., Camps-Arbestain M., Hedley M., 2013. Effect of biochar on soil physical properties in two contrasting soils: an Alfisol and an Andisol. Geoderma, 209-210, 188-197. Hillel D., 1982, Introduction to soil physics. Academic Press, San Diego, CA , 364 p. Chenu C., Plante A., 2006. Clay-sized organo-mineral complexes in a cultivation chronosequence: revisiting the concept of the “primary organo-mineral complex”. Eur. J. Soil Sci., 56, 596-607. IUSS Working Group WRB., 2014. World reference base for soil resources 2014. International soil classification system for naming soils and creating legends for soil maps. World Soil Resources Reports, 106, FAO, Rome., 112p. Jeffery S., Verheijen F.G.A., Van der Velde M., Bastos A.C., 2011. A quantitative review of the effects of biochar application to soils on crop productivity using meta-analysis. Agr. Ecosys. Environ., 144, 175-187. Jien S.H., Wang Ch.S., 2013. Effects of biochar on soil properties and erosion potential in a highly weathered soil. Catena, 110, 225-233. Kammann C., Linsel S., Goßling J., Koyro H.W., 2011. Influence of biochar on drought tolerance of Chenopodium quinoa Willd and on soil-plant relations. Plant Soil, 345, 195-210. Kodesova R., Nemecek K., Zigova A., Nikodem A., Fer M., 2015. Using dye tracer for visualizing roots I pact on soil structure and soil porous system. Biologia, 70, 1439-1443. Krol, A., Lipiec, J., Turski, M., J. Kuoe, 2013. Effects of organic and conventional management on physical properties of soil aggregates. Int. Agrophys., 27, 15-21. Kurakov A.V., Kharin S.A., 2012. The Formation of Water-Stable Coprolite Aggregates in Soddy-Podzolic Soils and the Participation of Fungi in This Process. Eur. Soil Sci., 45, 429-434. Loginow W., Wisniewski W., Gonet S.S., Ciescinska B., 1987. Fractionation of organic carbon based on susceptibility to oxidation. Pol. J. Soil Sci., 20, 47-52. Lynch, J.M., and E. Bragg, 1985. Microorganisms and soil aggregate stability. Adv. Soil Sci., 2, 133-171. MHYPERLINK "about:blank"unkholm L.J., Schjonning P., Debosz K., Jensen H.E., Christensen B.T., 2002. Aggregate strength and mechanical behaviour of a sandy loam soil under long-term fertilization treatments. Eur. J. Soil Sci., 53, 129-137. Paradelo R., Van Oort F., Chenu C., 2013. Water-dispersible clay in bare fallow soils after 80 years of continuous fertilizer addition. Geoderma, 200-201, 40-44. Purakayastha T.J., Kumari S., Pathak H., 2015. Characterisation, stability, and microbial effects of four biochars produced from crop residues. Geoderma, 239-240, 293-303. Rees F., Germain C., Sterckeman T., Morel J.L., 2015. Plant growth and metal uptake by a non-hyperaccumulating species (Lolium perenne) and a Cd-Zn hyperaccumulator (Noccaea caerulescens) in contaminated soils amended with biochar. Plant Soil, 395, 57-73. Saha D., Kukal S.S., Sharma S., 2011. Land use impacts on SOC fractions and aggregate stability in typic Ustochrepts of Northwest India. Plant Soil, 339, 457-470. Six J., Bossuyt H., Degryze S., Denef K., 2004. A history of research on the link between (micro)aggregates, soil biota, and soil organic matter dynamics. Soil Till. Res., 79, 7-31. Six J., Elliott E.T., Paustian K., 2000. Soil macroaggregate turnover and microaggregate formation: A mechanism for C sequestration under no-tillage agriculture. Soil Biol. Biochem., 32, 2099-2103. Soinne H., Hovi J., Tammeorg P., Turtola E., 2014. Effect of biochar on phosphorus sorption and clay soil aggregate stability. Geoderma, 219-220, 162-167. Simansky V., 2013. Soil organic matter in water-stable aggregates under different soil management practices in a productive vineyard. Arch. Agron. Soil Sci., 59(9), 1207-1214. Simansky V., Jonczak J., 2016. Water-stable aggregates as a key element in the stabilization of soil organic matter in the Chernozems. Carp. J. Earth Environ. Sci., 11, 511-517. Simon T., Javurek M., Mikanova O., Vach M., 2009. The influence of tillage systems on soil organic matter and soil hydrophobicity. Soil Till, Res., 105, 44-48. Tiessen H., Stewart J.W.B., 1988. Light and electron microscopy of stainedmicroaggregates: the role of organic matter and microbes in soil aggregation. Biogeochemistry, 5, 312-322. Tisdall J.M., Oades J.M., 1980. The effect of crop rotation on aggregation in a red-brown earth. Austr. J. Soil Res., 18, 423-433. Vadjunina A.F., Korchagina Z.A., 1986. Methods of Study of Soil Physical Properties. Agropromizdat, Moscow, 415p. Vaezi A.R., Sadeghi S.H.R., Bahrami H.A., Mahdian M.H., 2008. Modeling the USLE K-factor for calcareous soils in northwestern Iran. Geomorphology, 97, 414-423. Von Lutzow M., Kogel-Knabner I., Ekschmitt K., Matzner E., Guggenberger G., Marschner B., Flessa H., 2006. Stabilization of organicmatter in temperate soils:mechanisms and their relevance under different soil conditions a review. Eur. J. Soil Sci., 57, 426-445.

Abstract Background: Androgens are considered ineffective for the treatment of severe aplastic anemia (SAA) and are currently acknowledged a minor place as adjuvants of immunosuppressive therapy (IST). However, many institutions in developing countries, like ours, have been forced to continue their use as monodrugs even for the severe forms of the disease due to the unavailability of stem cell transplantation (SCT) or IST. Objective: To evaluate the results of androgen therapy as monodrug in adult patients with acquired aplastic anemia (AAA) regardless of its severity. Materials and Methods: We carried out a retrospective study of adult patients with AAA treated with androgens with or without low doses of prednisone from January 1986 to December 2006 at Hospital General de México. We analyzed the records of patients who had a CBC and bone marrow study by aspiration and biopsy which allowed the diagnosis of AA and its classification as moderate (MAA), severe (SAA) or super severe (SSAA) and had been treated with androgens alone or associated with low doses of prednisone. The treatment consisted of either oxymetholone 150 mg/d P.O., mesterolone 100 mg/d P.O. or testosterone 150 mg/w I.M. until remission + 6 months after which they were tapered and eventually discontinued except for those who were dependent on minimal doses of androgens to sustain remission. Prenisone 5–20 mg/d was given intermittently for variable periods of time to control mucocutaneous bleeding. Complete remission (CR) was defined by Hb 310.0 gr/dL, TNC 31x109/L and BPC 3100x109/L, partial remission (PR) when the patient did not meet the criteria for CR but there was hematologic improvement and he became transfusion-independent and failure when there was no improvement or the condition of the patient worsened. For the statistical analysis we used Kaplan-Meier survival curves, results of log-rank tests and cumulative incidence curves. Results: We had 72 cases which fulfilled the inclusion criteria, 40 males and 32 females aged 17–75 (median 35) years. Twenty (28%) had MAA, 46 (64%) SAA and 6 (8%) VSAA. The overall response rate was 77.7% with 44.4% CR and 33.3% PR. The tendency to achieve remission was similar among patients with MAA, SAA and VSAA. The mean time to reach PR was 14.8 months and 25.58 months for CR. OS was 65% at two years and 46.9% at 5 years. The only adverse side effects recorded were mild liver and skin toxicity. There were 11(15.2%) deaths, 6 (8.3%) relapses, 8 (11.1%) evolved to PNH and 1 (1.3%) to MDS. No transformations to LA were seen. Discussion: Even with the limitations of a retrospective study, the high remission rate in patients with SAA and VSAA in this series of Mexican patients is remarkable. Furthermore, the quality of the remissions was excellent and the rate of relapses low. Besides, the fact that some patients needed very low doses of androgens to sustain their remission argues against the hypothesis that the remissions could be spontaneous. If we compare these results with our data three decades ago in a similar population with the same treatment at our hospital, with a median survival time of &lt; 6 months and &lt;1% alive at 2 years, it would seem that improvement in supportive therapy with blood derivatives and antibiotics helped these new patients buy time to allow their bone marrow to respond to androgens. This hypothesis is supported by the long time required to achieve remission. Besides, androgens are inexpensive and easy to use in an outpatient setting with minor adverse side effects in adults compared to SCT and IST. However, the time required to achieve remission and the longer need for supportive therapy with blood derivatives discourages their use as single agents for AAA but they might prove helpful in improving the quality and duration of remission with IST. Conclusion: These results show that androgens can induce long lasting remissions of MAA, SAA and SSAA in adult patients with minor adverse events and warrant further study with prospective randomized trials.

ABSTRACT Previous studies mostly measured sharia financial inclusion using an index consisting of three dimensions: accessibility, availability, and usage. This research develops it by adding a digitalization dimension so that there are 4 dimensions in measuring sharia financial inclusion in Indonesia using an index. The first objective of this study is to visually illustrate the results of calculating the sharia financial inclusion index (in map form) in 33 provinces in Indonesia, using GeoDa software. Second, analyze the impact of sharia financial inclusion variables (the 4 form dimensions) that are calculated, on economic fundamental variables (growth, unemployment, poverty, and inequality) through a quantitative approach based on panel data analysis methods (FEM and REM). The secondary data used comes from the Financial Services Authority (OJK) and the Central Statistics Agency (BPS), in the 2015-2020 period. The results of this study indicate that sharia financial inclusion in Indonesia needs to be increased more evenly, so that it is not stagnant and centered in Java or provinces with a communal Muslim base (viewed from the results of index calculations) because the values ​​are unequal between provinces. Meanwhile, the results of panel data analysis techniques show that variables reflecting the 4 dimensions of sharia financial inclusion have an impact on fundamental economic variables. Keywords: Sharia Financial Inclusion, Index, GeoDa, Panel data ABSTRAK Kajian sebelumnya banyak mengukur inklusi keuangan syariah dengan menggunakan indeks yang terdiri dari tiga dimensi: aksessibilitas, availabilitas, dan penggunaan. Penelitian ini mengembangkannya dengan menambah dimensi digitalisasi, sehingga terdapat 4 dimensi dalam mengukur inklusi keuangan syariah di Indonesia menggunakan indeks. Tujuan pertama penelitian ini menggambarkan visual hasil perhitungan indeks inklusi keuangan syariah (dalam bentuk peta) di 33 provinsi yang ada di Indonesia, dengan software GeoDa. Kedua, menganalisis pengaruh variabel inklusi keuangan syariah (4 dimensi pembentuknya) yang dihitung, terhadap variabel fundamental ekonomi (pertumbuhan, tingkat pengangguran, kemiskinan, dan ketimpangan) melalui pendekatan kuantitatif berbasis metode analisis data panel (FEM dan REM). Data yang digunakan bersumber dari Otoritas Jasa Keuangan (OJK) dan Badan Pusat Statistika (BPS), dalam periode 2015-2020. Hasil penelitian ini, menunjukkan bahwa bahwa inklusi keuangan syariah di Indonesia perlu ditingkatkan lebih merata, agar tidak stagnan terpusat di Java atau provinsi dengan basis muslim komunal, jika dilihat dari hasil perhitungan indeks yang nilainya timpang antar porvinsi. Sementara itu, hasil teknik analisis data panel menunjukkan bahwa variabel yang mencerminkan 4 dimensi inklusi keuangan syariah berdampak bagi variabel fundamental ekonomi. Kata Kunci: Inklusi Keuangan Sharia, Indeks, Geoda, Data Panel. REFERENCES Allen, J., Cars, G., & Madanipour, A. (2012). Social exclusion in European cities: processes, experiences and responses. London: Routledge. Alshyab, N., Sandri, S., & Daradkah, D. (2021). The effect of financial inclusion on unemployment reduction-evidence from non-oil producing Arab countries. International Journal of Business Performance Management, 22(2-3), 100-116. Amakor, I. C., & Eneh, O. (2021). Financial inclusion and unemployment rate in Nigeria. International Journal of Research (IJR), 8(11), 1-14. Ananzeh, I. E. N. (2016). Relationship between bank credit and economic growth: Evidence in Jordan. International Journal of Financial Research, 7(2), 53-63. doi:10.5430/ijfr.v7n2p53 Anwar, K., & Amri, A. (2017). Pengaruh inklusi keuangan terhadap PDB Indonesia. Jurnal Ilmiah Mahasiswa Ekonomi Pembangunan, 2(3), 454-462. Arsyad, L. (2014). Konsep dan pengukuran pembangunan ekonomi. Modul Lincolin Arsyad, 1-46. Bansal, S. (2014). Perspective of technology in achieving financial inclusion in rural India. Procedia Economics and Finance, 11, 472-480. Demirgüç-Kunt, A., Beck, T. H. L., & Honohan, P. (2008). Finance for all? Policies and pitfalls in expanding access (No. aec73d3a-d6eb-457f-9182-3946fd15f0bc). Tilburg: Tilburg University, School of Economics and Management. Dienillah, A. A., & Anggraeni, L. (2016). Dampak inklusi keuangan terhadap stabilitas sistem keuangan di Asia. BMEB: Bulletin of Monetery Economics and Banking, 18(4), 409-430. doi:10.21098/bemp.v18i4.574 Fauzan, I. F. (2020). Determinan inklusi keuangan di Indonesia dengan pendekatan panel spasial. Disertasi. Program Doktoral IPB University. Bogor. Fosu, S. B., & Hampshire, N. (2013). Financial development and economic growth in Africa: A dynamic causal relationship. Thesis. The Degree of Master of Arts in Economics University of New Hampshire. Durham. Gupta, A., Chotia, V., & Rao, N. M. (2014). Financial inclusion and human development: A state-wise analysis from India. International Journal of Economics, Commerce and Management, 2(5), 1-23. Gurley, J. G., dan Shaw E. S. (1955). Financial aspects of economic development. The American Economic Review, 45(4), 515–538. Honohan, P. (2004). Financial development, growth and poverty: How close are the links? In E. C. Goodhard, ed., Financial development and economic growth: Explaining the links. London: Palgrave. Honohan, P. (2008). Cross-country variation in household access to financial services. Journal of Banking & Finance, 32(11), 2493-2500. doi:10.1016/j.jbankfin.2008.05.004 Ka’abi, M. S. (2020). Relevansi pemikiran ekonomi muhammad baqir as-sadr dalam keadilan distribusi beras di Indonesia. Skripsi. Program Sarjana Program Studi Ekonomi Syari;ah Institut Agama Islam Negeri Jember. Jember. Kim, D. W., Yu, J. S., & Hassan, M. K. (2018). Financial inclusion and economic growth in OIC countries. Research in International Business and Finance, 43, 1-14. doi:10.1016/j.ribaf.2017.07.178 Lakshmi, P., & Visalakshmi, S. (2013). Impact of cooperatives in financial inclusion & comprehensive development. Journal of Finance and Economics, 1(3), 49-53. doi:10.12691/jfe-1-3-4 Leyshon, A., & Thrift, N. (1995). Geographies of financial exclusion: financial abandonment in Britain and the United States. Transactions of the Institute of British Geographers, 20(3), 312-341. doi:doi.org/10.2307/622654 Lucas, R. E. (1988). On the mechanics of economic development. Journal Of Monetary Economics, 22(1), 3-42. doi:10.1016/0304-3932(88)90168-7 Luo, J., & Li, B. Z. (2022). Impact of digital financial inclusion on consumption inequality in China. Social Indicators Research, 163(2), 529-553. doi:10.1007/s11205-022-02909-6 Masnita, Y., Triyowati, H., & Khomsiyah, K. (2020). Pemberdayaan lembaga keuangan syariah dalam meningkatkan peran inklusi keuangan. JUARA: Jurnal Wahana Abdimas Sejahtera, 1(1), 26-37. doi:10.25105/juara.v1i1.5911 McKinnon, R. I. (1973). Money and capital in economic development. Washington, DC: Brookings Institution. Mehry, E. B., Ashraf, S., & Marwa, E. (2021). The impact of financial inclusion on unemployment rate in developing countries. International Journal of Economics and Financial Issues, 11(1), 79-93. doi:10.32479/ijefi.10871 Miller, M. H. (1988). Financial markets and economic growth. Journal of Applied Corporate Finance, 11(5):8−15. doi:10.1111/j.1745-6622.1998.tb00498.x Mohieldin, M., Iqbal, Z., Rostom, A., & Fu, X. (2011). The role of Islamic finance in enhancing financial inclusion in Organization of Islamic Cooperation (OIC) countries. World Bank Group: Policy Research Working Paper. doi:10.1596/1813-9450-5920 Neaime, S. & Gaysset. (2018). Financial inclusion and stability in MENA: Evidence from poverty and inequality. Finance Research Letters, 24,230-237. doi:10.1016/j.frl.2017.09.007 Nkwede, F. (2015). Financial inclusion and economic growth in Africa: Insight from Nigeria. European Journal of Business and Management, 7(35), 71-80. Omar, M. A., & Inaba, K. (2020). Does financial inclusion reduce poverty and income inequality in developing countries? A panel data analysis. Journal of economic structures, 9(1), 1-25. doi:10.1186/s40008-020-00214-4 Park, C. Y., & Mercado Jr, R. (2018). Financial inclusion, poverty, and income inequality. The Singapore Economic Review, 63(01), 185-206. doi:10.1142/S0217590818410059 Patrick, H. T. (1966). Financial development and economic growth in underdeveloped countries. Economic development and Cultural change, 14(2), 174-189. Polloni-Silva, E., da Costa, N., Moralles, H. F., & Sacomano Neto, M. (2021). Does financial inclusion diminish poverty and inequality? A panel data analysis for Latin American countries. Social Indicators Research, 158(3), 889-925. Puspitasari, S., Mahri, A. J. W., & Utami, S. A. (2020). Indeks inklusi keuangan syariah di Indonesia tahun 2015-2018. Amwaluna: Jurnal Ekonomi dan Keuangan Syariah, 4(1), 15-31. doi:10.29313/amwaluna.v4i1.5094 Riswanto, A., Tanjung, H., & Devi, A. (2021). Dampak inklusi keuangan dan bank syariah terhadap kesehatan dan pendidikan nasional. El-Mal: Jurnal Kajian Ekonomi & Bisnis Islam, 2(2), 1-26. doi:10.47467/elmal.v2i2.518 Rostow, W. W. (1959). The stages of economic growth. The Economic History Review, 12(1), 1-16. doi:10.2307/2591077 Robinson, J. (1952). The generalization of the general theory. In The Rate of Interest and Other Essays. London: MacMillan. Romer, P. M. (1990). Endogenous technological change. Journal of Political Economy, 98(5):71−102. Romer, P. M. (1986). Increasing returns and long-run growth. Journal of Political, 94(5):1002−1037. Sanjaya, I. M., & Nursechafia, N. (2016). Financial inclusion and inclusive growth: A cross-province analysis in Indonesia. BMEB: Buletin of Monetary Economics and Banking, 18(3), 281-306. doi:10.21098/bemp.v18i3.551 Sarma, M. (2012). Index of financial inclusion–a measure of financial sector inclusiveness. Centre for International Trade and Development, School of International Studies Working Paper Javaharlal Nehru University. Delhi, India. Sarma, M., & Pais, J. (2011). Financial inclusion and development. Journal of International Development, 23(5), 613-628. doi:10.1002/jid.1698 Schumpeter, J. (1911). The theory of economic development: An inquiry into profits, capital, credit, interest and the business cycle. Cambridge: Harvard University Press. Sethi, D., & Acharya, D. (2018). Financial inclusion and economic growth linkage: Some cross country evidence. Journal of Financial Economic Policy, 10(3), 369-385. doi:10.1108/JFEP-11-2016-0073 Simatupang, M., Sinaga, B. M., Hartoyo, S. & Haryanto (2020). Impact of financial inclusion, government expenditures in education and health sectors on human development in Indonesia. Journal of Economic Development, Environment and People, 9(2), 5-17. doi:10.26458/jedep.v9i2.643 Singh, K., & Kondan, A. S. (2011). Financial inclusion, development and its determinants: An empirical evidence of indian states. The Asian Economic Review: Journal of the Indian Institute of Economics, 53(1), 115-134. Siswa, I., & Agustin, G. (2020). Analisis pengaruh inklusi keuangan terhadap indeks pembangunan manusia di Indonesia tahun 2015. Jurnal Ilmiah Ekonomi dan Bisnis, 17(2), 121-130. doi:10.31849/jieb.v17i2.4091 Umar, A. I. (2017). Index of syariah financial inclusion in Indonesia. BMEB: Buletin of Monetary Economics and Banking, 20(1), 99-126. doi:10.21098/bemp.v20i1.726

This research examines the rise of Islamic populism in Indonesia and understands it as an instrument to clear a new pathway for populism movement into popular culture. Ummi magazine is one of the religious media used to be political vehicles of stablishing constituencies, especially for the Tarbiyah movement in the Soeharto era to the current tendency to popularize the Tarbiyah identity as a new lifestyle. Historically, The Tarbiyah movement in Indonesia is a social and political movement among Indonesian Muslimah students, especially activists in the Suharto period. Muslim middle class entrepreneurs launched a campaign of ‘economic jihad. This research uses a qualitative approach by interpreting and studying the data contained in Ummi Magazine. Media studies were carried out in the January 2017 to 2018 editions. The data obtained were described and associated with the magazine's transformation as an ideological medium and Muslim women's lifestyle today. The result shows that the magazine's transformation from ideology magazine to lifestyle magazine can influence readers because there are more new readers. Whether Ummi as a media for da'wah and a women's magazine, it is still perceived by the readers to apply ideological coercion or simply provide an alternative lifestyle or consumption where religious independence is the main characteristic of the magazine. We argue that Islamic populism is mainly a medium for coercion ideology to gain tracks to power, while the poor remain as ‘floating mass’, and entrapped in many so-called 'empowerment' projects. Populism can be interpreted as a communication style in which a group of politicians considers themselves to represent the people’s interests contrasted with elite interests. Nevertheless, the populism approach is gaining momentum. Abdullah, I. (1996). Tubuh, Kesehatan, dan Struktur yang Melemahkan Wanita. Kumpulan Makalah Seminar Bulanan. Pusat Penelitian Kependudukan UGM.Al-Abani, S. M. N. (1999). Jilbab Wanita Muslimah. Pustaka At-Tibyan.Ahmed, L. (1992). Women and Gender in Islam: Historical Roots of Modern Debate. Yale University Press.Al-Ghifari, A. (2005). Kerudung Gaul, Berjilbab Tapi Telanjang. Mujahid Press.Armbrust, W. (2000). ‘Introduction’, Mass Mediation: New Approaches to Popular Culture In The Middle East and Beyond. University California Press.Askew, K. (2002). ‘Introduction’, The Anthropology of Media: A Reader.Blackwell.Astuti, S. N. A. . (2005). Membaca Kelompok Berjilbab Sebagai Komunitas Sub Kultur. Universitas Gadjah Mada.BPS. (2017). Statistika Pendapatan. BPS Publication. Banet-Weiser, S. (2006). “I just want to be me again!”: Beauty pageants, reality television and post-feminism. Feminist Theory, 7(2), 255–272. https://doi.org/10.1177/1464700106064423Banna, H. (2011). Majmu’ah Rasail Al Iman As Syahid (Risalah Pergerakan Ikhawanul Muslimin. Era Intermedia. Barthel, D. (1976) . The Impact of Colonialism on Women’s Status in Senegal.Ph.D Dissertation, Harvard University.Barthes, R. (1977). Image, Music, Text. Fortana Press.Bertrand, I., & Hughes, P. (2005). Media Research Methods: Audiences, Institutions, Texts. Palgrave Mecmillan.Bordo, S. (1995). Unbearable Weight : Feminism, Western Culture, and The Body. University of California Press.Branner, S. (1995). Why Women Rule the Roost: Rethiking Javanese Ideologies of Gender and Self-Control. In Bewitching Women, Pioner Men. University of California Press.______. (1996). ‘Reconstructing Self and Society, Javannese Muslim Women and The Veil’. American Ethnologist.Bruneinessen, M. v. (2002). ‘Genealogies of Islamic Radicalism in Post-Suharto Indonesia’. South East Asian Research. Champagne, J. (2004). Jilbab Gaul. Bali. Latitudes, 46, 114-123.Damanik, A. S. (2000). Fenomena Partai Keadilan: Transformasi 20 Tahun Gerakan Tarbiyah di Indonesia. Mizan.Durkin, K. (1985). Television and Sex Role Acquisition I: Content’. British Journal of Social Psycology, 24, 102-113.Effendi, B. (2003). ‘Islam Politik Pasca Suharto’. Refleksi, 5(2).El-Guindi, F. (1991). Veil, Modesty, Privacy, and Resistance. Berg.Frederick, W. H. (1982). Rhoma Irama and The Dangdut Style: Aspects of Contemporary Indonesian Popular Culture. Indonesia, 34, 103-130.Featherstone, M. (2001). The Body in Consumer Culture. In The Body: Social Process and Cultural Theory. SAGE Publication.Foucault, M. (1981). The Order of Discourse. Routledge and Keagon Paul.Fukuyama, F. (2018). Against Identity Politics. Foreign Affairs, Sptember/October, 1-25.Gough, Y. A. (2003). Understanding Women Magazine. Routledge.Gautlett, D. (2002). Media, Gender, and Identity: An Introduction. Routledge.Geetzt, C. (1973). The Interpretation of Culture. Verso.Gill, R. (2009). Mediated Intimacy and Post Feminism: a Discourse Analytic Examination of Sex and Relationship advice in Woman’s Magazine. Discourse and Communication Journal, 3(4), 345-369. https://doi.org/10.1177/1750481309343870Gramsci, A. (1992). Selection from The Prison on Notebooks. International Publisher.Gorham, B. W. (2004). The Social Psychology of Stereotypes: Implications for Media Audiences. In Race/Gender/Media: Considering Diversity Across Audiences, Content, and Producers. Pearson.Hall, S. (1997). The Work Of Representation. In Representation: Cultural Representations and Signifying Practices. SAGE Publication.Handayani, D. (2014). Performatifitas Muslimah dalam Majalah Ummi. At-Tabsyir. Jurnal Komunikasi Penyiaran Islam, 2(1), 73-98. http://doi.org/10.21043/at-tabsyir.v2i1.461.Hanifah, U. (2011). Konstruksi Ideologi Gender pada Majalah Wanita (Analisis Wacana Kritis Majalah Ummi). KOMUNIKA: Jurnal Dakwah dan Komunkasi, 5(2), 199-220. https://doi.org/10.24090/komunika.v5i2.170Imdadun, R. (2005). Arus Baru Iislam Radikal: Transmisi, Revivalisme Islam Timur Tengah ke Indonesiaan. Erlangga.Itzin, C.(1986). Media Images of Women: The Social Construction of Ageism and Sexism. In Feminist Social Psycology: Developing Theory and Practice. Milton Keynes. Open University Press.Kailani, N. (2008). Budaya Populer Islam di Indonesia: Jaringan Dakwah Foru Lingkar Pena. Jurnal Sosiologi Reflektif, 2(3). Kellner, D. (1995). Cultural Studies, Identities and Politics Between The Modern and Postmodern. Routledge.Machmudi, Y. (2006). Islamizing Indonesia: The Rise of Jamaah Tarbiyah and The Presperous Justice Party (PKS). PhD Dissertation, Australia National University.Maulidiyah, L. (2014). Wacana Relasi Gender Suami Istri dalam Keluarga Muslim di Majalah Wanita Muslim Indonesia. Universitas Airlangga.Parihatin, A. (2004). Ideologi Revivalisme Islam dalam Majalah Perempuan Islam (Analisis Wacana pada Majalah Ummi). Universitas Indonesia. Qadarawi, Y. (2004). Al Islamu wal Fannu. Islam Bicara Seni. Era Intermedia. Qutb, S. (1980). Ma’alim fi Al Tariq (Petunjuk Jalan-Milestone). Media Dakwah.Rozak, A. (2008). Citra Perempuan dalam Majalah Wanita Islam UMMI. Jurnal Penelitian Agama. VXII(2), 332-354.Storey, J. (2010). Culture and Power in Cultural Studies: The Politics of Signification. Edinburg University Press.Ulfa, N. M. (2016). Dakwah Melalui Media Cetak (Analisis Isi Rubrik Mutiara Islam Majalah Ummi). Islamic Communication Journal, 1(1), 73-89.

This study aims to increase children English vocabulary aged 5-6 years old by playing CABE or searching and whispering. This research is classroom action research that was conducted in Marsudirini Sang Timur Kindergarten, Salatiga. The Subjects of the study were 20 B1 kindergarten children. Data was collected by teaching English vocabulary by playing CABE in some cycles which includes four stages in the form of cycles, there are (1) planning; (2) implementation; (3) observation; and (4) reflection. Research instruments used in this research was in sheets observation checklist. The results of a percentage of pre-cycle was 13 %, cycle I was 31 % in first meeting and was 66 % in the second meeting, cycle II was 75 % performed in only one meeting. There is an improvement in pre-action and any action on each meeting until it reaches 75 %. Keywords: Early childhood, English vocabulary, “CABE” method, Learning English References Bawono, Y. (2017). Kemampuan berbahasa pada anak prasekolah : Sebuah kajian pustaka. Prosiding Temu Ilmiah X Ikatan Psikologi Perkembangan Indonesia. Chamot, A. U. (1987). Toward a Functional ESL Curriculum in the Elementary School, in Long, Michael H. & Richards, Jack C. (eds.) Methodology in TESOL. New York: Newburry House Publishers. Fromkin, V., Rodman, R., & H., & N. (1990). An Intoduction to Language. New York, NY: Avon Books. İlin, G., Kutlu, Ö., & Kutluay, A. (2013). An Action Research: Using Videos for Teaching Grammar in an ESP Class. Procedia - Social and Behavioral Sciences. https://doi.org/https://doi.org/10.1016/j.sbspro.2013.01.065 Imam, I. (2016). Meningkatkan Kemampuan Menyimak Siswa Kelas I Melalui Teknik Permainan Pesan Berantai Pada Pembalajaran Bahasa Indonesia. PEDAGOGIA: Jurnal Pendidikan. https://doi.org/https://doi.org/10.21070/pedagogia.v3i2.62 Khairani, A. I. (2016). Pendidikan Bahasa Inggris Untuk Anak Usia Dini. Digilib.Unimed.Ac.Id. Kurniawan, M., & Tanone, R. (2016). Mobile learning in TESOL: A golden bridge for enhancement of grammar awareness and vocabulary mastery? Asian EFL Journal. Kurniawan, M., & Tanone, R. (2016). Mobile learning in TESOL: A golden bridge for enhancement of grammar awareness and vocabulary mastery? Asian EFL Journal. Matondang, E. M. (2005). Menumbuhkan Minat Belajar Bahasa Inggris Anak Usia Dini melalui Lagu dan Gerak. Jakarta: Jurnal Pendidikan Penabur. Montessori, M. (1991). The discovery of the Child. New York: Ballatine Book. Muflihah, M. (2019). Pentingnya Peran BAhasa dalam Pendidikan Usia DIni (PAUD). ThufuLA: Jurnal Inovasi Pendidikan Guru Raudhatul Athfal. https://doi.org/https://doi.org/10.21043/thufula.v2i2.4642 Mustafa, B. (2007). Pendidikan Anak Usia Dini. Musthafa, B. (2010). Teaching English to Young Learners in Indonesia : Essential Requirements. Educationist. Nugrahani, D., Egar, N., Sumardiyani, L., & Wardoyo, S. L. (2017). PENDIDIKAN ANAK USIA DINI BERBASIS LIFE SKILLS. E-DIMAS. https://doi.org/https://doi.org/10.26877/e-dimas.v2i1.102 Nurjanah, N, Dwiastuty, Nina, Susilawati, S. (2015). Mengenalkan Model Pengajaran Edutainment Mengajarkan Bahasa Inggris Pada Anak–Anak Usia Dini. Faktor. Jurnal Ilmiah Kependidikan. Nurmadiah, N. (2018). Strategi Pembelajaran Anak Usia Dini. Al-Afkar : Jurnal Keislaman & Peradaban. https://doi.org/https://doi.org/10.28944/afkar.v3i1.101 Nurvitasari, M. D. (2016). Penerapan Aspek Perkembangan Anak Usia Dini Dalam Media Macca (Balok Susun Interaktif). O’Grady, W. (2008). Innateness, universal grammar, and emergentism. Lingua. https://doi.org/https://doi.org/10.1016/j.lingua.2007.03.005 Santrock, J. (n.d.). Adolesence (Fifth Edit). New York, NY: McGrawHill Company Inc. Sophya, I. V. (2019). Desain Pembelajaran BAhasa Inggris untuk Pendidikan Anak Usia Dini. ThufuLA: Jurnal Inovasi Pendidikan Guru Raudhatul Athfal. https://doi.org/https://doi.org/10.21043/thufula.v2i2.4639 Tomlinson, B. (2012). Materials development for language learning and languange teaching. https://doi.org/https://doi.org/10.1017/S0261444811000528 Vygotsky, L. S. (1986). Thought and Language. Cambridge, M.A.: The MIT Press Wiratno, T., & Santosa, R. (2003). Bahasa, Fungsi Bahasa, dan Konteks Sosial. Bahasa, Fungsi Bahasa, Dan Konteks Sosial Yamin, M. (2010). Panduan Pendidikan Anak Usia Dini. Jakarta: Gaung Persada Pers Zaini, A. (2015). Bermain sebagai metode pembelajaran bagi anak usia dini. ThufuLA: Jurnal Inovasi Pendidikan Guru Raudhatul Athfal

The paper presents results from an international research project looking at Roma children between the ages of 3 and 6 years old. Thirty Roma children from Southwest Bulgaria and 30 Roma children from East Slovakia were tested with a psycholinguistic test in Romani language, measuring the knowledge of different grammatical categories. In most East European countries, the children are tested employing psychological/IQ tests in the official languages of the country and if the child does not understand the test task, because of a lack of knowledge in that language, s/he is deemed to have “light mental retardation”. The knowledge of the children on different grammatical categories in their mother tongue is not taken into account. For the first time in Europe, a psycholinguistic test was developed for measuring the knowledge in Romani (comprehension and production). Categories such as wh-questions, wh-complements, passive verbs, possessiveness, tense and aspect, learning new nouns and verbs are measured with newly developed test. The knowledge of the children is connected with two theories: the ecological theory of Ogbu (1978) and the integrative theory of child development (García Coll et al. 1996). Ogbu’s theory stresses the importance of the home culture in the development of the children and the theory of García Coll and her collaborators presents the home environment and the SES of the families as an important predictor for language development and school readiness of the minority/migrant children. References Bafekr, S. (1999) Schools and their undocumented Polish and “Romany Gypsy” pupils.International Journal of Educational Research, 31, 295-302. Bakalar, P. (2004) The IQ of Gypsies in Central Europe. The Mankind Quarterly, XLIV,(3&4), 291-300. Berko, J. (1958). The child’s learning of English morphology. Word, 14, 150-177. Bronfenbrenner U (1979). The ecology of human development: Experiments by nature anddesign. Cambridge, MA: Harvard University Press. Bronfenbrenner U (1986). Ecology of the family as a context for human development:Research perspectives. Developmental Psychology, 22, 723-742. Cvorovic, J. (2014) The Roma: A Balkan Underclass. Ulster: Ulster Institute for SocialResearch. Forget-Dubois, N., Lemelin, J.-P., Perusse, D., Tremblay, R. E. & Boivin, M. (2009). EarlyChild Language Mediates the Relation Between Home Environment and SchoolReadiness. Child Development, 80 (3), 736-749. García Coll, C., Lamberty, G., Jenkins, R., McAdoo, H. P., Crnic, K., Wasik, B. H. andGarcía, H. V. (1996) An Integrative Model for the Study of Developmental Competenciesin Minority Children. Child Development, 67 (5), 1891-1914. Han, W.-J. (2006) Academic Achievements of Children in Immigrant Families.Educational Research and Review. 1 (8), 286-318. Hollo, L. (2006) Equality for Roma in Europe. A Roadmap for Action. Budapest: OSI Kezdi, G. and Kertesi, G. (2011) The Roma/non-Roma test score gap in Hungary.American Economic Review, 101 (3), 519-525. Kyuchukov, H (2006). Desegregation of Roma schools in Bulgaria. Sofia: SEGA Kyuchukov, H. (2014) Acquisition of Romani in a Bilingual Context. Psychology ofLanguage and Communication, 18 (3), 211-225. Kyuchukov, H., Kaleja, M. & Samko, M. (2016) Roma parents as educators of theirchildren. Intecultural education, 26 (5), 444-448. Neuman, S., & Marulis, L. M. (2010). The Effects of Vocabulary Intervention on YoungChildren’s Word Learning: A Meta-Analysis. Review of Educational Research, 80 (3),300-335. Ogbu J. U. (1978). Minority Education and Caste: The American System in Cross-culturalPerspective. New York: Academic Press. Ogbu J. U. (1981). Origins of human competence: A cultural ecological perspective. ChildDevelopment, 52, 413-429. Ogbu, J. U. (1988). Cultural diversity and human development. In: D. Slaughter (Ed.),Black children and poverty: A developmental perspective. San Francisco: Jossey-Bass.11-28. Parsons, Talcott. (1940). An Analytical Approach to the Theory of Social Stratification.American Journal of Sociology, 45 (6), 841-862. Roskos, K., & Neuman, S. (2005). The state of pre-kindergartens standard. EarlyChildhood Research Quarterly, 20, 125-145. Rushton, J. P. Cvorovic, J. and Bons, T. A. (2007). General mental ability in South Asians:Data from three Roma (Gypsy) communities in Serbia. Intelligence, 35(1), 1-12. Rydland, V. (2009). “Whow-when I was going to pretend drinking it tasted coke for real!”Second-language learners’ out-of-frame talk in peer pretend play: A developmental studyfrom preschool to first grade. European Journal of Developmental Psychology, 6 (2), 190-222. Tomasello, M. (2003). Constructing a Language: A Usage-Based Theory of LanguageAcquisition. Cambridge, MA: Harvard University Press.

У статті обґрунтовано актуальність вивчення чинників акультурації та мовної адаптації у контексті дослідження специфіки прояву прокрастинації іноземними студентами. Висвітлено особливості операціоналізації вказаних понять у сучасній науковій літературі. Вибірку дослідження склали іноземні студенти (n=41), які навчаються за освітнім рівнем «бакалавр» у двох вищих навчальних закладах України. Результати кореляційного аналізу свідчать про позитивний взаємозв’язок прокрастинації із загальним рівнем прояву стресу акультурації (r = 0.43, p<0,01), а також такими його аспектами як акультураційний страх (r = 0.46, p<0,01), сприйнята дискримінація (r = 0.37, p<0,05), почуття провини (r = 0.31, p<0,05). Вагоме значення аспектів мовної інтеграції у контексті вивчення тематики прокрастинації підтверджено зафіксованими прямими значущими кореляційними зв’язками із загальною шкалою мовної тривожності (r = 0.59, p<0,001), страхом негативної оцінки (r = 0.62, p<0,001), страхом спілкування (r = 0.62, p<0,001) та складання іспитів (r = 0.47, p<0,01). Література References Грабчак О. Особливості академічної прокрастинації студентів-першокурсників// Педагогіка і психологія професійної освіти. 2016. № 4. С. 210-218 Колтунович Т.А., Поліщук О. М. Прокрастинація – конфлікт між «важливим» і «приємним»// Young Scientist. 2017. Вип. 5, № 45. С. 211-218. Ряднова В. В., Безега Н. М., Безкоровайна І. М., Воскресенська Л. К., Пера-Васильченко А. В. Психологічні особливості процесу адаптації й організації навчання студентів-іноземців// Актуальні питання медичної (фармацевтичної) освіти іноземних громадян: проблеми та перспективи. Збірник наукових статей. 2018. С. 74-76. Balkis, M., Duru, E. (2019). Procrastination and Rational/Irrational Beliefs: A Moderated Mediation Model. Journal of Rational-Emotive & Cognitive-Behavior Therapy. doi:10.1007/s10942-019-00314-6 Berry, J. W. (2005). Acculturation: Living successfully in two cultures. International Journal of Intercultural Relations, 29(6), 697-712. http://dx.doi.org/10.1016/j.ijintrel.2005.07.013 Chowdhury, S.F., Pychyl, T.A. (2018). A critique of the construct validity of active procrastination. Personality and Individual Differences, 120, 7-12. DOI: https://doi.org/ 10.1016/j.paid.2017.08.016. DuBow, F. McCabe, E., Kaplan, G. (1979). Reactions to Crime: A Critical Review of the Literature, Unpublished report. Center for Urban Affairs, Northwestern University, Evanston, IL. Ferrari J.R., Crum K.P., Pardo M.A. (2018), Decisional procrastination: Assessing characte­rological and contextual variables around indecision. Current Psychology, 37(2), doi: 10.1007/s12144-017-9681-x. Ferrari, J. R., Johnson, J. L., McCown, W. G. (1995). The Plenum series in social/clinical psychology. Procrastination and task avoidance: Theory, research, and treatment. N.Y.: Plenum Press. doi: 10.1007/978-1-4899-0227-6 Ferrari, J. R., O'Callaghan, J., Newbegin, I. (2005). Prevalence of Procrastination in the United States, United Kingdom, and Australia: arousal and avoidance delays among adults. North American Journal of Psychology, 7(1), 1-6. Gamst-Klaussen, T., Steel, P., Svartdal, F. (2019). Procrastination and personal finances: Exploring the roles of planning and financial self-efficacy. Frontiers in Psychology, 10, 1-10. https://doi.org/10.3389/fpsyg.2019.00775 Goldin, C., Katz, L. F., Kuziemko, I. (2006), The homecoming of American college women: The reversal of the college gender gap. The Journal of Economic Perspectives, 20(4), 133-157. Haghbin, M. (2015). Conceptualization and operationalization of delay: Development and validation of the multifaceted measure of academic procrastination and the delay questionnaire. (Unpublished Ph.D. thesis). Carleton University, Ottowa, Canada. Hashemi, M., Abbasi, M. (2013). The role of the teacher in alleviating anxiety in language classes. International Journal of Applied and Basic Sciences, 4(3), 640-646. Horwitz, E. K., Horwitz, M.B., Cope, J. (1986). Foreign language classroom anxiety. The Modern Language Journal, 70(2), 125-132. Klingsieck, K. B. (2013). Procrastination: When good things don’t come to those who wait. European Psychologist, 18(1), 24-34. doi: 10.1027/1016-9040/a000138 Kornienko, A. A., Shamrova, D. P., Kvesko, S. B., Kornienko, A. A., Nikitina, Y. A., Chaplinskaya, Y. I. (2016). Adaptation Problems Experienced by International Students in Aspect of Quality Management. The European Proceedings of Social & Behavioral Sciences, 48, 358-361 doi: 10.15405/epsbs.2017.01.48 Kráľová, Z., Sorádová D. (2015). Foreign Language Learning Anxiety. In: Teaching Foreign Languages in Inclusive Education: (A teacher-trainee´s handbook), Nitra: Constantine the Philosopher University. doi: 10.17846/SEN.2015.91-100 Lee, S. (2008). Relationship between selected predictors and adjustment/acculturation stress among East Asian international students. (Doctoral dissertation). University of Kentucky, Lexington. Lindblom-Ylänne, S., Saariaho, E., Inkinen, M., Haarala-Muhonen. A., Hailikari., T (2015). Academic procrastinators, strategic delayers and something betwixt and between: An interview study. Frontline Learning Research, 3(2), 47-62. Markiewicz, K. (2018). Prokrastynacja i prokrastynatorzy. Definicja, etiologia, epidemiologia i terapia. Annales Universitatis Mariae Curie-Skłodowska, 31(3), 195-213. Markiewicz, K., Dziewulska, P. (2018). Procrastination Predictors and moderating effect of personality traits. Polskie Forum Psychologiczne, 23(3), 593-609 doi: 10.14656/ PFP20180308 Pychyl, T.A., Sirois, F. M. (2016). Procrastination, emotion regulation, and well-being. In: Procrastination, Health, and Well-Being, (pp. 163-188). Academic Press, Rorer, L. G. (1983). “Deep” RET: A reformulation of some psychodynamic explanations of procrastination. Cognitive Therapy and Research, 7, l-10. Russell, J., Rosenthal, D., Thomson, G. (2010). The international student experience: Three styles of adaptation. Higher Education, 60, 235-249 Sandhu, D. S., Asrabadi, B. R. (1994). Development of an acculturative stress scale for international students: Preliminary findings. Psychological Reports, 75(1,2), 435-448. doi: 10.2466/pr0.1994.75.1.435 Schouwenburg, H. C., Lay, C. H., Pychyl, T. A., Ferrari, J. R. (Eds.). (2004). Counseling the Procrastinator in Academic Settings. Washington, DC: American Psychological Association. doi: 10.1037/10808-000 Sirois, F.M., Pychyl, T.A. (2013). Procrastination and the Priority of Short-Term Mood Regulation: Consequences for Future Self. Social and Personality Psychology Compass, 7(2), 115-127. Steel, P. (2007). The nature of procrastination: a meta-analytic and theoretical review of quintessential selfregulatory failure. Psychological Bulletin, 133, 65–94. doi: 10.1037/0033-2909.133.1.65 Steel, P., Ferrari, J. (2013). Sex, education and procrastination: An epidemiological study of procrastinators’ characteristics from a global sample. European Journal of Personality, 27(1), 51-58. doi: 10.1002/per.1851. Tibbett, T. P., Ferrari, J. R. (2015). The portrait of the procrastinator: Risk factors and results of an indecisive personality. Personality and Individual Differences, 82, 175–184 Van Eerde, W., Klingsieck, K. B. (2018). Overcoming procrastination? A meta-analysis of intervention studies. Educational Research Review, 25, 73-85. Zhanibek, A. (2001). The relationship between language anxiety and students’ participation in foreign language classes. (Master thesis). Bilkent University, Ankara. References (translated and transliterated) Hrabchak, O. (2016). Osoblyvosti akademichnoji prokrastynaciji studentiv-pershokursnykiv [Academic procrastination features in first-year students]. Pedaghohika i Psykholohiya Profesiynoyi Osvity, 4, 210-218 Koltunovych, T.A., Polishhuk, O.M (2017). Prokrastynacija – konflikt mizh “vazhlyvym” i “pryjemnym” [Procrustination - the conflict between “important” and “pleasant”]. Young Scientist, 5 (45), 211-218. Riadnova, V.V., Bezeha, N.M., Bezkorovaina, I.M., Voskresens’ka, L.K., Pera-Vasylchenko, A.V. (2018). Psykhologhichni osoblyvosti procesu adaptaciyi i orghanizaciyi navchannia studentiv-inozemtsiv [Psychological features of the process of adaptation and organization of international students’ training]. Issues of Medical (Pharmaceutical) Education of International Citizens: Problems and Prospects. Book of abstracts (74-76). Poltava, Ukraine. Balkis, M., Duru, E. (2019). Procrastination and Rational/Irrational Beliefs: A Moderated Mediation Model. Journal of Rational-Emotive & Cognitive-Behavior Therapy. doi:10.1007/s10942-019-00314-6 Berry, J. W. (2005). Acculturation: Living successfully in two cultures. International Journal of Intercultural Relations, 29(6), 697-712. http://dx.doi.org/10.1016/j.ijintrel.2005.07.013 Chowdhury, S.F., Pychyl, T.A. (2018). A critique of the construct validity of active procrastination. Personality and Individual Differences, 120, 7-12. DOI: https://doi.org/ 10.1016/j.paid.2017.08.016. DuBow, F. McCabe, E., Kaplan, G. (1979). Reactions to Crime: A Critical Review of the Literature, Unpublished report. Center for Urban Affairs, Northwestern University, Evanston, IL. Ferrari J.R., Crum K.P., Pardo M.A. (2018), Decisional procrastination: Assessing characte­rological and contextual variables around indecision. Current Psychology, 37(2), doi: 10.1007/s12144-017-9681-x. Ferrari, J. R., Johnson, J. L., McCown, W. G. (1995). The Plenum series in social/clinical psychology. Procrastination and task avoidance: Theory, research, and treatment. N.Y.: Plenum Press. doi: 10.1007/978-1-4899-0227-6 Ferrari, J. R., O'Callaghan, J., Newbegin, I. (2005). Prevalence of Procrastination in the United States, United Kingdom, and Australia: arousal and avoidance delays among adults. North American Journal of Psychology, 7(1), 1-6. Gamst-Klaussen, T., Steel, P., Svartdal, F. (2019). Procrastination and personal finances: Exploring the roles of planning and financial self-efficacy. Frontiers in Psychology, 10, 1-10. https://doi.org/10.3389/fpsyg.2019.00775 Goldin, C., Katz, L. F., Kuziemko, I. (2006), The homecoming of American college women: The reversal of the college gender gap. The Journal of Economic Perspectives, 20(4), 133-157. Haghbin, M. (2015). Conceptualization and operationalization of delay: Development and validation of the multifaceted measure of academic procrastination and the delay questionnaire. (Unpublished Ph.D. thesis). Carleton University, Ottowa, Canada. Hashemi, M., Abbasi, M. (2013). The role of the teacher in alleviating anxiety in language classes. International Journal of Applied and Basic Sciences, 4(3), 640-646. Horwitz, E. K., Horwitz, M.B., Cope, J. (1986). Foreign language classroom anxiety. The Modern Language Journal, 70(2), 125-132. Klingsieck, K. B. (2013). Procrastination: When good things don’t come to those who wait. European Psychologist, 18(1), 24-34. doi: 10.1027/1016-9040/a000138 Kornienko, A. A., Shamrova, D. P., Kvesko, S. B., Kornienko, A. A., Nikitina, Y. A., Chaplinskaya, Y. I. (2016). Adaptation Problems Experienced by International Students in Aspect of Quality Management. The European Proceedings of Social & Behavioral Sciences, 48, 358-361 doi: 10.15405/epsbs.2017.01.48 Kráľová, Z., Sorádová D. (2015). Foreign Language Learning Anxiety. In: Teaching Foreign Languages in Inclusive Education: (A teacher-trainee´s handbook), Nitra: Constantine the Philosopher University. doi: 10.17846/SEN.2015.91-100 Lee, S. (2008). Relationship between selected predictors and adjustment/acculturation stress among East Asian international students. (Doctoral dissertation). University of Kentucky, Lexington. Lindblom-Ylänne, S., Saariaho, E., Inkinen, M., Haarala-Muhonen. A., Hailikari., T (2015). Academic procrastinators, strategic delayers and something betwixt and between: An interview study. Frontline Learning Research, 3(2), 47-62. Markiewicz, K. (2018). Prokrastynacja i prokrastynatorzy. Definicja, etiologia, epidemiologia i terapia. Annales Universitatis Mariae Curie-Skłodowska, 31(3), 195-213. Markiewicz, K., Dziewulska, P. (2018). Procrastination Predictors and moderating effect of personality traits. Polskie Forum Psychologiczne, 23(3), 593-609 doi: 10.14656/ PFP20180308 Pychyl, T.A., Sirois, F. M. (2016). Procrastination, emotion regulation, and well-being. In: Procrastination, Health, and Well-Being, (pp. 163-188). Academic Press, Rorer, L. G. (1983). “Deep” RET: A reformulation of some psychodynamic explanations of procrastination. Cognitive Therapy and Research, 7, l-10. Russell, J., Rosenthal, D., Thomson, G. (2010). The international student experience: Three styles of adaptation. Higher Education, 60, 235-249 Sandhu, D. S., Asrabadi, B. R. (1994). Development of an acculturative stress scale for international students: Preliminary findings. Psychological Reports, 75(1,2), 435-448. doi: 10.2466/pr0.1994.75.1.435 Schouwenburg, H. C., Lay, C. H., Pychyl, T. A., Ferrari, J. R. (Eds.). (2004). Counseling the Procrastinator in Academic Settings. Washington, DC: American Psychological Association. doi: 10.1037/10808-000 Sirois, F.M., Pychyl, T.A. (2013). Procrastination and the Priority of Short-Term Mood Regulation: Consequences for Future Self. Social and Personality Psychology Compass, 7(2), 115-127. Steel, P. (2007). The nature of procrastination: a meta-analytic and theoretical review of quintessential selfregulatory failure. Psychological Bulletin, 133, 65–94. doi: 10.1037/0033-2909.133.1.65 Steel, P., Ferrari, J. (2013). Sex, education and procrastination: An epidemiological study of procrastinators’ characteristics from a global sample. European Journal of Personality, 27(1), 51-58. doi: 10.1002/per.1851. Tibbett, T. P., Ferrari, J. R. (2015). The portrait of the procrastinator: Risk factors and results of an indecisive personality. Personality and Individual Differences, 82, 175–184 Van Eerde, W., Klingsieck, K. B. (2018). Overcoming procrastination? A meta-analysis of intervention studies. Educational Research Review, 25, 73-85. Zhanibek, A. (2001). The relationship between language anxiety and students’ participation in foreign language classes. (Master thesis). Bilkent University, Ankara.

The pandemic of COVID-19 has afflicted every individual and has initiated a cascade of directly or indirectly involved events in precipitating mental health issues. The human species is a wanderer and hunter-gatherer by nature, and physical social distancing and nationwide lockdown have confined an individual to physical isolation. The present review article was conceived to address psychosocial and other issues and their aetiology related to the current pandemic of COVID-19. The elderly age group has most suffered the wrath of SARS-CoV-2, and social isolation as a preventive measure may further induce mental health issues. Animal model studies have demonstrated an inappropriate interacting endogenous neurotransmitter milieu of dopamine, serotonin, glutamate, and opioids, induced by social isolation that could probably lead to observable phenomena of deviant psychosocial behavior. Conflicting and manipulated information related to COVID-19 on social media has also been recognized as a global threat. Psychological stress during the current pandemic in frontline health care workers, migrant workers, children, and adolescents is also a serious concern. Mental health issues in the current situation could also be induced by being quarantined, uncertainty in business, jobs, economy, hampered academic activities, increased screen time on social media, and domestic violence incidences. The gravity of mental health issues associated with the pandemic of COVID-19 should be identified at the earliest. Mental health organization dedicated to current and future pandemics should be established along with Government policies addressing psychological issues to prevent and treat mental health issues need to be developed. References World Health Organization (WHO) Coronavirus Disease (COVID-19) Dashboard. Available at: https://covid19.who.int/ [Accessed on 23 August 2020] Sim K, Chua HC. The psychological impact of SARS: a matter of heart and mind. CMAJ. 2004; 170:811e2. https://doi.org/10.1503/cmaj.1032003. Wu P, Fang Y, Guan Z, Fan B, Kong J, Yao Z, et al. The psychological impact of the SARS epidemic on hospital employees in China: exposure, risk perception, and altruistic acceptance of risk. Can J Psychiatr. 2009; 54:302e11. https://doi.org/10.1177/070674370905400504. Brooks SK, Webster RK, Smith LE, Woodland L, Wessely S, Greenberg N, et al. The psychological impact of quarantine and how to reduce it: rapid review of the evidence. Lancet. 2020; 395:912e20. https://doi.org/10.1016/S0140-6736(20)30460-8. Robertson E, Hershenfield K, Grace SL, Stewart DE. The psychosocial effects of being quarantined following exposure to SARS: a qualitative study of Toronto health care workers. Can J Psychiatr. 2004; 49:403e7. https://doi.org/10.1177/070674370404900612. Barbisch D, Koenig KL, Shih FY. Is there a case for quarantine? Perspectives from SARS to Ebola. Disaster Med Public Health Prep. 2015; 9:547e53. https://doi.org/10.1017/dmp.2015.38. Jeong H, Yim HW, Song YJ, Ki M, Min JA, Cho J, et al. Mental health status of people isolated due to Middle East Respiratory Syndrome. Epidemiol Health. 2016;38: e2016048. https://doi.org/10.4178/epih.e2016048. Liu X, Kakade M, Fuller CJ, Fan B, Fang Y, Kong J, et al. Depression after exposure to stressful events: lessons learned from the severe acute respiratory syndrome epidemic. Compr Psychiatr. 2012; 53:15e23. https://doi.org/10.1016/j.comppsych.2011.02.003 Chadda RK, Deb KS. Indian family systems, collectivistic society and psychotherapy. Indian J Psychiatry. 2013;55: S299‑ https://dx.doi.org/10.4103%2F0019-5545.105555. Grover S, Sahoo S, Mehra A, Avasthi A, Tripathi A, Subramanyan A, et al. Psychological impact of COVID‑19 lockdown: An online survey from India. Indian J Psychiatry. 2020; 62:354-62. https://doi.org/ 10.4103/psychiatry.IndianJPsychiatry _427_20. Hawkley LC, Cacioppo JT. Loneliness matters: a theoretical and empirical review of consequences and mechanisms. Ann Behav Med. 2010; 40: 218–27. https://dx.doi.org/10.1007%2Fs12160-010-9210-8. Chen N, Zhou M, Dong X, Qu J, Gong F, Han Y, et al. Epidemiological and clinical characteristics of 99 cases of 2019 novel coronavirus pneumonia in Wuhan, China: a descriptive study. Lancet. 2020;395(10223):507-13. https://doi.org/10.1016/S0140-6736(20)30211-7. Bhandari S, Sharma R, Singh Shaktawat A, Banerjee S, Patel B, Tak A, et al. COVID-19 related mortality profile at a tertiary care centre: a descriptive study. Scr Med. 2020;51(2):69-73. https://doi.org/10.5937/scriptamed51-27126. Baumeister RF, Leary MR. The need to belong: desire for interpersonal attachments as a fundamental human motivation. Psychol Bull. 1995; 117: 497–529. https://doi.org/10.1037/0033-2909.117.3.497. Caspi A, Harrington H, Moffitt TE, Milne BJ, Poulton R. Socially isolated children 20 years later: risk of cardiovascular disease. Arch Pediatr Adolesc Med. 2006; 160(8):805-11. https://doi.org/10.1001/archpedi.160.8.805. Eaker ED, Pinsky J, Castelli WP. Myocardial infarction and coronary death among women: psychosocial predictors from a 20-year follow-up of women in the Framingham Study. Am J Epidemiol. 1992; 135(8):854-64. https://doi.org/10.1093/oxfordjournals.aje.a116381. Luo Y, Hawkley LC, Waite LJ, Cacioppo JT. Loneliness, health, and mortality in old age: a national longitudinal study. Soc Sci Med. 2012 Mar; 74(6):907-14. https://dx.doi.org/10.1016%2Fj.socscimed.2011.11.028. Olsen RB, Olsen J, Gunner-Svensson F, Waldstrøm B. Social networks and longevity. A 14-year follow-up study among elderly in Denmark. Soc Sci Med. 1991; 33(10):1189-95. https://doi.org/10.1016/0277-9536(91)90235-5. Patterson AC, Veenstra G. Loneliness and risk of mortality: a longitudinal investigation in Alameda County, California. Soc Sci Med. 2010; 71(1):181-6. https://doi.org/10.1016/j.socscimed.2010.03.024. Savikko N, Routassalo P, Tilvis RS, Strandberg TE, Pitkalla KH. Predictors and subjective causes of loneliness in an aged population. Arch Gerontol Geriatrics. 2005; 41:3;223-33. https://doi.org/10.1016/j.archger.2005.03.002. Health Advisory for Elderly Population of India during COVID19. Available at: https://www.mohfw.gov.in/pdf/AdvisoryforElderlyPopulation.pdf [Accessed on 13 August 2020]. Dicks D, Myers R, Kling A. Uncus and amygdala lesions: effects on social behavior in the free-ranging rhesus monkey. Science. 1969; 165:69–71. https://doi.org/10.1126/science.165.3888.69. Kanai R, Bahrami B, Duchaine B, Janik A, Banissy MJ, Rees G. Brain structure links loneliness to social perception. Curr Biol. 2012; 22(20):1975-9. https://dx.doi.org/10.1016%2Fj.cub.2012.08.045. Bender AR, Daugherty A, Raz N. Vascular risk moderates associations between hippocampal subfield volumes and memory. J Cogn Neurosci. 2013; 25:1851–62. https://doi.org/10.1162/jocn_a_00435. Raz N. Diabetes: brain, mind, insulin–what is normal and do we need to know? Nat Rev Endocrinol. 2011; 7:636–7. https://doi.org/10.1038/nrendo.2011.149. Colcombe SJ, Erickson KI, Naftali R, Andrew GW, Cohen NJ, McAuley E, et al. Aerobic fitness reduces brain tissue loss in aging humans. J Gerontol A Biol Sci Med Sci. 2003; 58:176–80. https://doi.org/10.1093/gerona/58.2.m176. Maass A, Düzel S, Goerke M, Becke A, Sobieray U, Neumann K, et al. Vascular hippocampal plasticity after aerobic exercise in older adults. Mol Psychiatry. 2015; 20, 585–93. https://doi.org/10.1038/mp.2014.114. Wilson RS, Krueger KR, Arnold SE, Schneider JA, Kelly JF, Barnes LL, et al. Loneliness and Risk of Alzheimer Disease. Arch Gen Psychiatry. 2007;64(2):234–240. https://doi.org/10.1001/archpsyc.64.2.234. Kogan JH, Frankland PW, Silva AJ. Long-term memory underlying hippocampus-dependent social recognition in mice. Hippocampus. 2000;10(1):47-56. https://doi.org/10.1002/(sici)1098-1063(2000)10:1%3C47::aid-hipo5%3E3.0.co;2-6. Yorgason JT, España RA, Konstantopoulos JK, Weiner JL, Jones SR. Enduring increases in anxiety-like behavior and rapid nucleus accumbens dopamine signaling in socially isolated rats. Eur J Neurosci. 2013;37(6):1022-31. https://doi.org/10.1111/ejn.12113. Bledsoe AC, Oliver KM, Scholl JL, Forster GL. Anxiety states induced by post-weaning social isolation are mediated by CRF receptors in the dorsal raphe nucleus. Brain Res Bull. 2011;85(3-4):117-22. https://dx.doi.org/10.1016%2Fj.brainresbull.2011.03.003. Lukkes JL, Engelman GH, Zelin NS, Hale MW, Lowry CA. Post-weaning social isolation of female rats, anxiety-related behavior, and serotonergic systems. Brain Res. 2012; 1443:1-17. https://dx.doi.org/10.1016%2Fj.brainres.2012.01.005. Ago Y, Araki R, Tanaka T, Sasaga A, Nishiyama S, Takuma K, et al. Role of social encounter-induced activation of prefrontal serotonergic systems in the abnormal behaviors of isolation-reared mice. Neuropsychopharmacology. 2013; 38(8):1535-47. https://doi.org/10.1038/npp.2013.52. Veenema AH. Early life stress, the development of aggression and neuroendocrine and neurobiological correlates: what can we learn from animal models? Front Neuroendocrinol. 2009;30(4):497-518. https://doi.org/10.1016/j.yfrne.2009.03.003. Zhao X, Sun L, Jia H, Meng Q, Wu S, Li N, et al. Isolation rearing induces social and emotional function abnormalities and alters glutamate and neurodevelopment-related gene expression in rats. Prog Neuropsychopharmacol Biol Psychiatry. 2009;33(7):1173-1177. https://doi.org/10.1016/j.pnpbp.2009.06.016. Sciolino NR, Bortolato M, Eisenstein SA, Fu J, Oveisi F, Hohmann AG, et al. Social isolation and chronic handling alter endocannabinoid signaling and behavioral reactivity to context in adult rats. Neuroscience. 2010;168(2):371-86. https://dx.doi.org/10.1016%2Fj.neuroscience.2010.04.007. Ghasemi M, Phillips C, Trillo L, De Miguel Z, Das D, Salehi A. The role of NMDA receptors in the pathophysiology and treatment of mood disorders. Neurosci Biobehav Rev. 2014; 47:336-358. https://doi.org/10.1016/j.neubiorev.2014.08.017. Olivenza R, Moro MA, Lizasoain I, Lorenzo P, Fernández AP, Rodrigo J, et al. Chronic stress induces the expression of inducible nitric oxide synthase in rat brain cortex. J Neurochem. 2000;74(2):785-791. https://doi.org/10.1046/j.1471-4159.2000.740785.x. Maeng S, Zarate CA Jr, Du J, Schloesser RJ, McCammon J, Chen G, et al. Cellular mechanisms underlying the antidepressant effects of ketamine: role of alpha-amino-3-hydroxy-5-methylisoxazole-4-propionic acid receptors. Biol Psychiatry. 2008;63(4):349-352. https://doi.org/10.1016/j.biopsych.2007.05.028. Kalia LV, Kalia SK, Salter MW. NMDA receptors in clinical neurology: excitatory times ahead. Lancet Neurol. 2008;7(8):742-755. https://dx.doi.org/10.1016%2FS1474-4422(08)70165-0. Waxman EA, Lynch DR. N-methyl-D-aspartate Receptor Subtypes: Multiple Roles in Excitotoxicity and Neurological Disease. The Neuroscientist. 2005; 11(1), 37–49. https://doi.org/10.1177/1073858404269012. Hermes G, Li N, Duman C, Duman R. Post-weaning chronic social isolation produces profound behavioral dysregulation with decreases in prefrontal cortex synaptic-associated protein expression in female rats. Physiol Behav. 2011;104(2):354-9. https://dx.doi.org/10.1016%2Fj.physbeh.2010.12.019. Sestito RS, Trindade LB, de Souza RG, Kerbauy LN, Iyomasa MM, Rosa ML. Effect of isolation rearing on the expression of AMPA glutamate receptors in the hippocampal formation. J Psychopharmacol. 2011;25(12):1720-1729. https://doi.org/10.1177/0269881110385595. Toua C, Brand L, Möller M, Emsley RA, Harvey BH. The effects of sub-chronic clozapine and haloperidol administration on isolation rearing induced changes in frontal cortical N-methyl-D-aspartate and D1 receptor binding in rats. Neuroscience. 2010;165(2):492-499. https://doi.org/10.1016/j.neuroscience.2009.10.039. Alò R, Avolio E, Mele M, Storino F, Canonaco A, Carelli A et al. Excitatory/inhibitory equilibrium of the central amygdala nucleus gates anti-depressive and anxiolytic states in the hamster. Pharmacol Biochem Behav. 2014; 118:79-86. https://doi.org/10.1016/j.pbb.2014.01.007. St JP, Petkov VV. Changes in 5-HT1 receptors in different brain structures of rats with isolation syndrome. General pharmacology. 1990;21(2):223-5. https://doi.org/10.1016/0306-3623(90)90905-2. Miachon S, Rochet T, Mathian B, Barbagli B, Claustrat B. Long-term isolation of Wistar rats alters brain monoamine turnover, blood corticosterone, and ACTH. Brain Res Bull. 1993;32(6):611-614. https://doi.org/10.1016/0361-9230(93)90162-5. Van den Berg CL, Van Ree JM, Spruijt BM, Kitchen I. Effects of juvenile isolation and morphine treatment on social interactions and opioid receptors in adult rats: behavioural and autoradiographic studies. Eur J Neurosci. 1999;11(9):3023-3032. https://doi.org/10.1046/j.1460-9568.1999.00717.x. Vanderschuren LJ, Stein EA, Wiegant VM, Van Ree JM. Social play alters regional brain opioid receptor binding in juvenile rats. Brain Res. 1995;680(1-2):148-156. https://doi.org/10.1016/0006-8993(95)00256-p. Moles A, Kieffer BL, D'Amato FR. Deficit in attachment behavior in mice lacking the mu-opioid receptor gene. Science. 2004;304(5679):1983-1986. https://doi.org/10.1126/science.1095943. Panksepp J, Herman BH, Vilberg T, Bishop P, DeEskinazi FG. Endogenous opioids and social behavior. Neurosci Biobehav Rev. 1980;4(4):473-487. https://doi.org/10.1016/0149-7634(80)90036-6. Gong JP, Onaivi ES, Ishiguro H, Liu Q, Tagliaferro PA, Brusco A, et al. Cannabinoid CB2 receptors: immunohistochemical localization in rat brain. Brain Res. 2006;1071(1):10-23. https://doi.org/10.1016/j.brainres.2005.11.035. Breivogel CS, Sim-Selley LJ. Basic neuroanatomy and neuropharmacology of cannabinoids. Int Rev Psychiatry 2009; 21:2:113-121. https://doi.org/10.1080/09540260902782760. Haj-Mirzaian A, Amini-Khoei H, Haj-Mirzaian A, Amiri S, Ghesmati M, Zahir M, et al. Activation of cannabinoid receptors elicits antidepressant-like effects in a mouse model of social isolation stress. Brain Res Bull. 2017; 130:200-210. https://doi.org/10.1016/j.brainresbull.2017.01.018. Banach M, Piskorska B, Czuczwar SJ, Borowicz KK. Nitric Oxide, Epileptic Seizures, and Action of Antiepileptic Drugs. CNS & Neurological Disorders - Drug Targets 2011;10: 808. https://doi.org/10.2174/187152711798072347. Förstermann U, Sessa WC. Nitric oxide synthases: regulation and function. Eur Heart J. 2012;33(7):829-37, 837a-837d. https://dx.doi.org/10.1093%2Feurheartj%2Fehr304. Hu Y, Wu D, Luo C, Zhu L, Zhang J, Wu H, et al. Hippocampal nitric oxide contributes to sex difference in affective behaviors. PNAS. 2012, 109 (35) 14224-14229. https://doi.org/10.1073/pnas.1207461109. Khan MI, Ostadhadi S, Zolfaghari S, Mehr SE, Hassanzadeh G, Dehpour, A et al. The involvement of NMDA receptor/NO/cGMP pathway in the antidepressant like effects of baclofen in mouse force swimming test. Neuroscience Letters. 2016; 612:52-61. https://doi.org/10.1016/j.neulet.2015.12.006. Matsumoto K, Puia G, Dong E, Pinna G. GABAA receptor neurotransmission dysfunction in a mouse model of social isolation-induced stress: Possible insights into a non-serotonergic mechanism of action of SSRIs in mood and anxiety disorders. Stress. 2007; 10:1:3-12. https://doi.org/10.1080/10253890701200997. Zlatković J, Filipović D. Chronic social isolation induces NF-κB activation and upregulation of iNOS protein expression in rat prefrontal cortex. Neurochem Int. 2013;63(3):172-179. https://doi.org/10.1016/j.neuint.2013.06.002. Haj-Mirzaian A, Amiri S, Kordjazy N, Momeny M, Razmi A, Balaei MR, et al. Lithium attenuated the depressant and anxiogenic effect of juvenile social stress through mitigating the negative impact of interlukin-1β and nitric oxide on hypothalamic-pituitary-adrenal axis function. Neuroscience. 2016; 315:271-285. https://doi.org/10.1016/j.neuroscience.2015.12.024. Larson HJ. The biggest pandemic risk? Viral misinformation. Nature 2018; 562:309. https://doi.org/10.1038/d41586-018-07034-4. Zarocostas J. How to fight an infodemic. Lancet 2020; 395:676. https://doi.org/10.1016/S0140-6736(20)30461-X. World Health Organization, 2019. Ebola Virus Disease – Democratic Republic of the Congo. Geneva, Switzerland: WHO. Available at: https://www.who.int/csr/don/28-november-2019-ebola-drc/en/ [Accessed on August 8, 2020] Times of India. Covid-19: doctors gone to collect samples attacked in Indore. Available at: https://timesofindia.indiatimes.com/videos/news/covid-19-doctors-goneto- collect-samples-attacked-in-indore/videoshow/74942153.cms; 2020 [Accessed on August 8, 2020]. Withnall A. Coronavirus: why India has had to pass new law against attacks on healthcare workers. The Independent. April 23, 2020. Semple K. “Afraid to be a nurse”: health workers under attack. The New York Times. 2020 Apr 27. The Economist. Health workers become unexpected targets during COVID-19. The Economist. May 11, 2020. Turan B, Budhwani H, Fazeli PL, Browning WR, Raper JL, Mugavero MJ, et al. How does stigma affect people living with HIV? The mediating roles of internalized and anticipated HIV stigma in the effects of perceived community stigma on health and psychosocial outcomes. AIDS Behav. 2017; 21: 283–291. https://doi.org/10.1007/s10461-016-1451-5. James PB, Wardle J, Steel A, Adams J. An assessment of Ebola-related stigma and its association with informal healthcare utilisation among Ebola survivors in Sierra Leone: a cross sectional study. BMC Public Health. 2020; 20: 182. https://doi.org/10.1186/s12889-020-8279-7. Aljazeera, 2020. Iran: Over 700 Dead after Drinking Alcohol to Cure Coronavirus. Aljazeera. Available at: https://www.aljazeera.com/ news/2020/04/iran-700-dead-drinking-alcohol-cure-coronavirus200427163529629.html. (Accessed June 4, 2020) Delirrad M, Mohammadi AB, 2020. New methanol poisoning outbreaks in Iran following COVID-19 pandemic. Alcohol Alcohol. 55: 347–348. https://doi.org/10.1093/alcalc/agaa036. Hassanian-Moghaddam H, Zamani N, Kolahi A-A, McDonald R, Hovda KE. Double trouble: methanol outbreak in the wake of the COVID-19 pandemic in Iran-a cross-sectional assessment. Crit Care. 2020; 24: 402. https://doi.org/10.1186/s13054-020-03140-w. Soltaninejad K. Methanol Mass Poisoning Outbreak: A Consequence of COVID-19 Pandemic and Misleading Messages on Social Media. Int J Occup Environ Med. 2020;11(3):148-150. https://dx.doi.org/10.34172%2Fijoem.2020.1983. Islam MS, Sarkar T, Khan SH, Kamal AM, Hasan SMM, Kabir A, et al. COVID-19–Related Infodemic and Its Impact on Public Health: A Global Social Media Analysis. Am J Trop Med Hyg. 2020; 00(0):1–9. https://doi.org/10.4269/ajtmh.20-0812. Hawryluck L, Gold W, Robinson S, Pogorski S, Galea S, Styra R. SARS control and psychological effects of quarantine, Toronto, Canada. Emerg Infect Dis. 2004;10(7):1206–1212. https://dx.doi.org/10.3201%2Feid1007.030703. Lee S, Chan LYY, Chau AAM, Kwok KPS, Kleinman A. The experience of SARS-related stigma at Amoy Gardens. Soc Sci Med. 2005; 61(9): 2038-2046. https://doi.org/10.1016/j.socscimed.2005.04.010. Yoon MK Kim SY Ko HS Lee MS. System effectiveness of detection, brief intervention and refer to treatment for the people with post-traumatic emotional distress by MERS: a case report of community-based proactive intervention in South Korea. Int J Ment Health Syst. 2016; 10: 51. https://doi.org/10.1186/s13033-016-0083-5. Reynolds DL, Garay JR, Deamond SL, Moran MK, Gold W, Styra R. Understanding, compliance and psychological impact of the SARS quarantine experience. Epidemiol Infect. 2008; 136: 997-1007. https://dx.doi.org/10.1017%2FS0950268807009156. Marjanovic Z, Greenglass ER, Coffey S. The relevance of psychosocial variables and working conditions in predicting nurses' coping strategies during the SARS crisis: an online questionnaire survey. Int J Nurs Stud. 2007; 44(6): 991-998. https://doi.org/10.1016/j.ijnurstu.2006.02.012. Bai Y, Lin C-C, Lin C-Y, Chen J-Y, Chue C-M, Chou P. Survey of stress reactions among health care workers involved with the SARS outbreak. Psychiatr Serv. 2004; 55: 1055-1057. https://doi.org/10.1176/appi.ps.55.9.1055. Ministry of Health and Family Welfare. Available at: https://www.mohfw.gov.in/pdf/Guidelinesforhomequarantine.pdf [Accessed on 25 August 2020]. Ministry of Health and Family Welfare. Available at: https://www.mohfw.gov.in/pdf/RevisedguidelinesforHomeIsolationofverymildpresymptomaticCOVID19cases10May2020.pdf [Accessed on 25 August 2020]. Ministry of Health and Family Welfare. Available at: https://www.mohfw.gov.in/pdf/AdvisoryformanagingHealthcareworkersworkinginCOVIDandNonCOVIDareasofthehospital.pdf (Accessed on 25 August 2020). Ministry of Health and Family Welfare. Available at: https://www.mohfw.gov.in/pdf/RevisedguidelinesforInternationalArrivals02082020.pdf [Accessed on 25 August 2020]. Cost of the lockdown? Over 10% of GDP loss for 18 states. Available at: https://timesofindia.indiatimes.com/india/cost-of-the-lockdown-over-10-of-gdp-loss-for-18-states/articleshow/76028826.cms [Accessed on 21 August 2020]. Jorda O, Singh SR, Taylor AM. Longer-Run Economic Consequences of Pandemics. Federal Reserve Bank of San Francisco Working Paper. 2020-09. https://doi.org/10.24148/wp2020-09. Firdaus G. Mental well‑being of migrants in urban center of India: Analyzing the role of social environment. Indian J Psychiatry. 2017; 59:164‑ https://doi.org/10.4103/psychiatry.indianjpsychiatry_272_15. National Crime Record Bureau. Annual Crime in India Report. New Delhi, India: Ministry of Home Affairs; 2018. 198 migrant workers killed in road accidents during lockdown: Report. Available at: https://www.hindustantimes.com/india-news/198-migrant-workers-killed-in-road-accidents-during-lockdown-report/story-hTWzAWMYn0kyycKw1dyKqL.html [Accessed on 25 August 2020]. Qiu H, Wu J, Hong L, Luo Y, Song Q, Chen D. Clinical and epidemiological features of 36 children with coronavirus disease 2019 (COVID-19) in Zhejiang, China: an observational cohort study. Lancet Infect Dis. 2020; 20:689-96. https://doi.org/10.1016/S1473-3099(20)30198-5. Dalton L, Rapa E, Stein A. Protecting the psychological health of through effective communication about COVID-19. Lancet Child Adolesc Health. 2020;4(5):346-347. https://doi.org/10.1016/S2352-4642(20)30097-3. Centre for Disease Control. Helping Children Cope with Emergencies. Available at: https://www.cdc.gov/childrenindisasters/helping-children-cope.html [Accessed on 25 August 2020]. Liu JJ, Bao Y, Huang X, Shi J, Lu L. Mental health considerations for children quarantined because of COVID-19. Lancet Child & Adolesc Health. 2020; 4(5):347-349. https://doi.org/10.1016/S2352-4642(20)30096-1. Sprang G, Silman M. Posttraumatic Stress Disorder in Parents and Youth After Health-Related Disasters. Disaster Med Public Health Prep. 2013;7(1):105-110. https://doi.org/10.1017/dmp.2013.22. Rehman U, Shahnawaz MG, Khan NH, Kharshiing KD, Khursheed M, Gupta K, et al. Depression, Anxiety and Stress Among Indians in Times of Covid-19 Lockdown. Community Ment Health J. 2020:1-7. https://doi.org/10.1007/s10597-020-00664-x. Cao W, Fang Z, Hou, Han M, Xu X, Dong J, et al. The psychological impact of the COVID-19 epidemic on college students in China. Psychiatry Research. 2020; 287:112934. https://doi.org/10.1016/j.psychres.2020.112934. Wang C, Zhao H. The Impact of COVID-19 on Anxiety in Chinese University Students. Front Psychol. 2020; 11:1168. https://dx.doi.org/10.3389%2Ffpsyg.2020.01168. Kang L, Li Y, Hu S, Chen M, Yang C, Yang BX, et al. The mental health of medical workers in Wuhan, China dealing with the 2019 novel coronavirus. Lancet Psychiatry 2020;7(3): e14. https://doi.org/10.1016/s2215-0366(20)30047-x. Lai J, Ma S, Wang Y, Cai Z, Hu J, Wei N, et al. Factors associated with mental health outcomes among health care workers exposed to coronavirus disease 2019. JAMA Netw Open 2020;3(3): e203976. https://doi.org/10.1001/jamanetworkopen.2020.3976. Lancee WJ, Maunder RG, Goldbloom DS, Coauthors for the Impact of SARS Study. Prevalence of psychiatric disorders among Toronto hospital workers one to two years after the SARS outbreak. Psychiatr Serv. 2008;59(1):91-95. https://dx.doi.org/10.1176%2Fps.2008.59.1.91. Tam CWC, Pang EPF, Lam LCW, Chiu HFK. Severe acute respiratory syndrome (SARS) in Hongkong in 2003: Stress and psychological impact among frontline healthcare workers. Psychol Med. 2004;34 (7):1197-1204. https://doi.org/10.1017/s0033291704002247. Lee SM, Kang WS, Cho A-R, Kim T, Park JK. Psychological impact of the 2015 MERS outbreak on hospital workers and quarantined hemodialysis patients. Compr Psychiatry. 2018; 87:123-127. https://dx.doi.org/10.1016%2Fj.comppsych.2018.10.003. Koh D, Meng KL, Chia SE, Ko SM, Qian F, Ng V, et al. Risk perception and impact of severe acute respiratory syndrome (SARS) on work and personal lives of healthcare workers in Singapore: What can we learn? Med Care. 2005;43(7):676-682. https://doi.org/10.1097/01.mlr.0000167181.36730.cc. Verma S, Mythily S, Chan YH, Deslypere JP, Teo EK, Chong SA. Post-SARS psychological morbidity and stigma among general practitioners and traditional Chinese medicine practitioners in Singapore. Ann Acad Med Singap. 2004; 33(6):743e8. Yeung J, Gupta S. Doctors evicted from their homes in India as fear spreads amid coronavirus lockdown. CNN World. 2020. Available at: https://edition.cnn.com/2020/03/25/asia/india-coronavirus-doctors-discrimination-intl-hnk/index.html. [Accessed on 24 August 2020] Violence Against Women and Girls: the Shadow Pandemic. UN Women. 2020. May 3, 2020. Available at: https://www.unwomen.org/en/news/stories/2020/4/statement-ed-phumzile-violence-against-women-during-pandemic. [Accessed on 24 August 2020]. Gearhart S, Patron MP, Hammond TA, Goldberg DW, Klein A, Horney JA. The impact of natural disasters on domestic violence: an analysis of reports of simple assault in Florida (1999–2007). Violence Gend. 2018;5(2):87–92. https://doi.org/10.1089/vio.2017.0077. Sahoo S, Rani S, Parveen S, Pal Singh A, Mehra A, Chakrabarti S, et al. Self-harm and COVID-19 pandemic: An emerging concern – A report of 2 cases from India. Asian J Psychiatr 2020; 51:102104. https://dx.doi.org/10.1016%2Fj.ajp.2020.102104. Ghosh A, Khitiz MT, Pandiyan S, Roub F, Grover S. Multiple suicide attempts in an individual with opioid dependence: Unintended harm of lockdown during the COVID-19 outbreak? Indian J Psychiatry 2020; [In Press]. The Economic Times. 11 Coronavirus suspects flee from a hospital in Maharashtra. March 16 2020. Available at: https://economictimes.indiatimes.com/news/politics-and-nation/11-coronavirus-suspects-flee-from-a-hospital-in-maharashtra/videoshow/74644936.cms?from=mdr. [Accessed on 23 August 2020]. Xiang Y, Yang Y, Li W, Zhang L, Zhang Q, Cheung T, et al. Timely mental health care for the 2019 novel coronavirus outbreak is urgently needed. The Lancet Psychiatry 2020;(3):228–229. https://doi.org/10.1016/S2215-0366(20)30046-8. Van Bortel T, Basnayake A, Wurie F, Jambai M, Koroma A, Muana A, et al. Psychosocial effects of an Ebola outbreak at individual, community and international levels. Bull World Health Organ. 2016;94(3):210–214. https://dx.doi.org/10.2471%2FBLT.15.158543. Kumar A, Nayar KR. COVID 19 and its mental health consequences. Journal of Mental Health. 2020; ahead of print:1-2. https://doi.org/10.1080/09638237.2020.1757052. Gupta R, Grover S, Basu A, Krishnan V, Tripathi A, Subramanyam A, et al. Changes in sleep pattern and sleep quality during COVID-19 lockdown. Indian J Psychiatry. 2020; 62(4):370-8. https://doi.org/10.4103/psychiatry.indianjpsychiatry_523_20. Duan L, Zhu G. Psychological interventions for people affected by the COVID-19 epidemic. Lancet Psychiatry. 2020;7(4): P300-302. https://doi.org/10.1016/S2215-0366(20)30073-0. Dubey S, Biswas P, Ghosh R, Chatterjee S, Dubey MJ, Chatterjee S et al. Psychosocial impact of COVID-19. Diabetes Metab Syndr. 2020; 14(5): 779–788. https://dx.doi.org/10.1016%2Fj.dsx.2020.05.035. Wright R. The world's largest coronavirus lockdown is having a dramatic impact on pollution in India. CNN World; 2020. Available at: https://edition.cnn.com/2020/03/31/asia/coronavirus-lockdown-impact-pollution-india-intl-hnk/index.html. [Accessed on 23 August 2020] Foster O. ‘Lockdown made me Realise What’s Important’: Meet the Families Reconnecting Remotely. The Guardian; 2020. Available at: https://www.theguardian.com/keep-connected/2020/apr/23/lockdown-made-me-realise-whats-important-meet-the-families-reconnecting-remotely. (Accessed on 23 August 2020) Bilefsky D, Yeginsu C. Of ‘Covidivorces’ and ‘Coronababies’: Life During a Lockdown. N. Y. Times; 2020. Available at: https://www.nytimes.com/2020/03/27/world/coronavirus-lockdown-relationships.html [Accessed on 23 August 2020]

King sago palm or sago cycas are the other name of Kangi palm (Cycas revoluta) sago palm has been used as an indoor and outdoor landscape plant for centuries. The present study was conducted to estimate the effect of different priming treatments on seed germination of sago palm (Cycas revoluta L.) in the research area of Department of Horticulture PMAS, University of Arid Agriculture Rawalpindi, Pakistan. The Experiment consisted of ten treatments; the seeds without pulp were soaked in solution of 500, 750 and 1000 ppm GA3 and 2%, 3% and 4% solution of KNO3 for 24 hr at room temperature. In case of hot water treatment, seeds were primed at 80oC, 90oC and 100oC for 30, 20 and 10 minutes respectively. The effect of different concentrations of gibberellic acid (GA3), potassium nitrate (KNO3) and hot water on various parameters like germination rate, germination percentage, germination value, decayed seed percentage, time of germination, number of leaves and seedling height were studied. Significant results of germination rate (55.56 days), germination value (192.19) were achieved from 500 ppm GA3. Maximum germination percentage (73.33%) and number of leaves (2) were observed in KNO3 at 2% followed by 500 ppm GA3. Similarly lowest decayed seed percentage (26.66%) and time of germination (59.41 days) were noted in 2% KNO3. The seedling height was optimum (19.33 cm) in 3% KNO3 followed by 2% KNO3. Best germination results were obtained due to permeability of hard seed coat made by low concentrations of priming treatments (KNO3 @ 3%).Key wordCycas revoluta, gibberellic acid, potassium nitrate, germination parametersINTRODUCTIONThe sago palm (Cycas revoluta L.) is one of the important cycad commonly known as Kanghi palm or Japanese sago or simply sago palm. The cold hardy sago palm has been used as an indoor and outdoor landscape plant for centuries. It is used as a significant or focal point in any landscape design. Despite its importance in ornamental industry, it is facing certain problems regarding its germination due to its hard seed coat. It has been estimated that over 25% of all palm species require over 100 days for germination and they have less than 20% total germination (Tomlinson, 1990). So, there is a serious need of consideration to sort out this major issue. The reasons for this remain obscure, as little research work has been accomplished on seed dormancy in palms. Certain mechanical and chemical scarification, pretreatments were proved to be effective in germination of the hard-seeded species of Cycas and some other species (Frett, 1987; Chauhan et al., 2009; Rouhi et al., 2010). Cycad seeds respond to various pretreatment, including scarification, depulping and exposure to some chemical materials like gibberellic acid (GA3), potassium nitrate (KNO3) and soaking in hot water for specific period of time.The overall development of plant is regulated by the growth hormones, nutrient and environmental factors. They also vary in their germination requirement (Chauhan et al., 2009). KNO3 is most widely used chemical for promoting germination. Solutions of 0.1 to 0.2% KNO3 are common in routine germination testing and are recommended by the Association of Official Seed Analysts and the International Seed Testing Association for germination tests of many species (Copeland and McDonald, 1995).OBJECTIVESThe objectives of the present research was to minimize the time period of seed germination and to enhance percentage of germination by breaking the external dormancy through different levels of chemicals including GA3, KNO3 and hot water.MATERIALS AND METHODSThis study was conducted in the research field of Department of Horticulture PMAS, Arid Agriculture University Rawalpindi. An experiment was conducted by using Completely Randomized Design (CRD).The seeds of sago palm were collected from 10-15 years old female stocks growing at a commercial garden located in suburb of Islamabad city. Uniform, equal and the same weight and healthy seeds were selected. The seeds had diameter 2.54 to 5.08 cm. Seeds were soaked in fresh water for two weeks to remove pulp from the upper surface of hard seed coat. Seeds without pulp were soaked in solution of 500, 750 and 1000 ppm GA3 and 2%, 3% and 4% solution of KNO3 for 24 hr at room temperature. In case of hot water treatment, seeds were primed at 80oC, 90oC and 100oC for 30, 20 and 10 minutes respectively (Table 1). Then seeds were washed with few drops of tween twenty in order to remove surface tension. Seeds were dried at 24oC room temperature. After sterilization, 10 seeds of sago palm were planted in each pot of 14 inch diameter containing sterilized soil media ( Sand, soil, FYM 1:1:1) at 4-8 cm depth and incubated in a greenhouse at daytime temperature of 25±2°C and relative humidity of 60-80% and watered weekly depending on weather conditions. Germination was evaluated at the end of 10 months. Seed emergence was recorded as germination index. The data for germination rate (days), germination percentage (%), germination value, seed decayed percentage (%) and time of germination (days) were recorded during the course of study. After seed germination, observations were recorded for number of leaves an d seedling height. The data collected was compiled and analysed statistically by using computer software germination; observations were recorded for number of leaves (Steel and Torrie, 1980).RESULTS AND DISCUSSIONAnalysis of data showed that parameters related to germination significantly affected by hydro and chemical priming treatments (Table 2). Seeds treated with 500 ppm GA3 showed maximum germination rate (55.56 days) which was statistically significant with control. Hot water treatments observed average germination rate. Minimum germination rate (159.88 days) was recorded in unprimed seeds. Gibberellin encourage germination by inducing hydrolytic enzymes that weaken the hurdle tissues such as the endosperm or seed coat, inducing mobilization of food reserves in seed and stimulating expansion of the embryo (Bewley and Black, 1994; Dhoran and Gudadhe, 2012).Germination rate (days) and germination percentage (%): The data regarding germination percentage indicated that difference between primed and non-primed seeds was statistically significant. Lower concentrations of potassium nitrate (KNO3) @ 2% and gibberellic acid (GA3) @ 500 ppm treatments significantly affected the germination percentage 73.33% and 70% respectively as compared to control (33.33%). Significant improvement in seed germination might be due to enhanced breakdown of reserve metabolites present in seed. The lower concentration of KNO3 has promoting effect on seed germination as compared to its higher concentration. This leads to supposition that higher concentrations exercise decreasing effects on seed germination by causing death of cells and ultimately result in loss of seed viability (Nascimento, 2003; Ramzan et al., 2010).Germination value: Analysis of variance revealed that germination value was affected by various priming treatments (Table 2). Result regarding germination value (192.19) was highest in T1 (500 ppm GA3) followed by 186.42 in T4 (3% KNO3) and 184.12 in T2 (750 ppm GA3). Minimum germination (74.43) was noted in control. The gibberellic acid has positive effect on germination value due to its hormonal regulation capability and retarding effect against abscisic acid present in dormant seeds (Var et al., 2010; Zarchini et al., 2013; Pipinis et al., 2015).Decayed seed percentage (%): Data regarding decayed seed percentage have displayed in Table 2. The difference between primed and non-primed seed was significant and primed seed have minimum decayed seed percentage as compared to non-primed seeds. Lowest decayed seed percentage (26.66%) was recorded when 2% KNO3 was applied followed by 30% when 500 ppm GA3) was applied. Whereas maximum decayed (66.66%) of seeds was occurred in untreated seeds. It is reported that scarified treatments have improved germination as compared to non-scarified seeds. Decayed seed percentage might be highest in control due to impermeability of hard seed coat (Fallahabadi et al., 2012).Time of germination (days): Potassium nitrate showed a statistically significant effect on reducing the germination time (Table 2). Minimum time of germination (59.41 days) was recorded in seeds treated with 2% KNO3 followed by 3% and 4% KNO 3 levelswhich took 63.81 days and 72.15 days respectively while maximum time duration was taken by control (204.58 days). Reduction in seed germination time was occurred when seeds of Descurainia sophia and Plantago ovate were primed with 0.3% KNO3 (Ali et al., 2010; Gashi et al., 2012). Stimulating effect of nitrate for seed germination might be due to dormancy breakage (Hilhorst, 1990). It stimulates oxygen uptake (Hilton and Thomas, 1986) and KNO3 act as co-factor for phytochrome (Mavi et al., 2006).Number of leaves: Analysis of data showed that number of leaves influenced by different treatments. Hormonal priming with 2% KNO3 gave maximum number of leaves per seedling followed by priming with 3% KNO3, 4% KNO3 and in 500 ppm GA3, 750 ppm GA3 and 1000 ppm GA3 in improving number of leaves per seedling as compared to other physical priming treatments, while results of minimum number of leaves were achieved in non-primed seeds. It was suggested that potassium is an important macronutrient that plays a key role in carbohydrate metabolism and photosynthesis (Marschner, 2011; Kazemi, 2013).Seedling height (cm): Analysis of variance exposed that there was a significant difference between primed and non-primed seed for seedling height (Table. 2). It was found that maximum seedling height was 19.33 cm influenced by 3% KNO3 while minimum 11.33 cm observed in 90oC hot water. It is reported that foliar application of K, improved the chlorophyll and fruits-NK content (Sarrwy et al., 2010; Marschner, 2011; Kazemi, 2013).CONCLUSIONThe present study was undertaken to assess the effect of different priming treatments on seed germination of Cycas revoluta L. The results of the study clearly indicated that germination rate and germination value were maximum at lower concentration of gibberellic acid (500 ppm GA3). While, germination percentage, maximum number of leaves, maximum seedling height , decayed seed percentage and time required for seed germination were observed minimum at lower concentration of potassium nitrate (2% and 3% KNO3). Hot water treatments had least effect on seed germination. CONFLICT OF INTERESTAuthors have no conflict of interest.REFERENCES Ali, T., P. Hossein, F. Asghar, Z. Salman and Z. C. M. Ali, 2010. The effect of different treatments on improving seed germination characteristics in medicinal species of Descurainia sophia and Plantago ovata. African Journal of Biotechnology, 9(39): 6588-6593.Bewley, J. and M. Black, 1994. Seeds: Physiology of development and germination plenum. Plenum Press New York, USA.Chauhan, J., Y. Tomar, N. I. Singh and S. Ali, 2009. Effect of growth hormones on seed germination and seedling growth of black gram and horse gram. Journal of American Science, 5(5): 79-84.Copeland, L. and M. McDonald, 1995. Seed science and technology (3rd eds.). Chapman and Hall.Dhoran, V. and S. Gudadhe, 2012. Effect of plant growth regulators on seed germination and seedling vigour in Asparagus Sprengeri regelin. Research Journal of Biologicalical Sciences 1(7): 6-10.Fallahabadi, P., D. Hashemabadi, R. Onsinejad, M. Zarchini and B. R. Kaviani, 2012. Improving germination rate of Cycas revoluta L. By using different cultivation media and scarification. Annals of Biological Research, 3(7): 3187-3191.Frett, J. J., 1987. Seed germination of Cyeas revoluta. Journal of Environmental Horticulture, 5(3): 105-106.Gashi, B., K. Abdullai, V. Mata and E. Kongjika, 2012. Effect of gibberellic acid and potassium nitrate on seed germination of the resurrection plants Ramonda serbica and Ramonda nathaliae. African Journal of Biotechnology, 11(20): 4537-4542.Hilhorst, H. W., 1990. Dose-response analysis of factors involved in germination and secondary dormancy of seeds of Sisymbrium officinale: Ii. Nitrate. Plant Physiology, 94(3): 1096-1102.Hilton, J. R. and J. A. Thomas, 1986. Regulation of pregerminative rates of respiration in seeds of various weed species by potassium nitrate. Journal of Experimental Botany, 37(10): 1516-1524.Kazemi, M., 2013. Effect of foliar application of humic acid and potassium nitrate on cucumber growth bull. Bulletin of Environment, Pharmacology and Life Sciences, 2(11): 03-06.Marschner, H., 2011. Marschner's mineral nutrition of higher plants. Academic Press.Mavi, K., S. Ermis and I. Demir, 2006. The effect of priming on tomato rootstock seeds in relation to seedling growth. Asian Journal of Plant Sciences, 5(6): 940-947.Nascimento, W. M., 2003. Muskmelon seed germination and seedling development in response to seed priming. Scientia Agricola, 60(1): 71-75.Pipinis, E., E. Milios, M. Georgiou and P. J. F. I. Smiris, 2015. Effects of gibberellic acid and cold stratification on seed germination of two sorbus species. 21(1): 107-114.Ramzan, A., I. Hafiz, T. Ahmad and N. Abbasi, 2010. Effect of priming with potassium nitrate and dehusking on seed germination of gladiolus (Gladiolus alatus). Pakistan Journal of Botany, 42(1): 247-258.Rouhi, H., K. Shakarami and R. Afshari, 2010. Seed treatments to overcome dormancy of waterlily tulip (Tulipa kaufmanniana regel). Australian Journal of Crop Science, 4(9): 718.Sarrwy, S., E. A. Mohamed and H. Hassan, 2010. Effect of foliar sprays with potassium nitrate and mono-potassium phosphate on leaf mineral contents, fruit set, yield and fruit quality of picual olive trees grown under sandy soil conditions. American-Eurasian Journal of Agricultural Environmental Science, 8(4): 420-430.Steel, R. G. and J. H. Torrie, 1980. Principles and procedures of statistics, a biometrical approach. McGraw-Hill Kogakusha, Ltd.Tomlinson, P. B., 1990. The structural biology of palms. Oxford University Press.Var, M., B. Bekci and D. Dinçer, 2010. Effect of stratification treatments on germination of Sorbus torminalis L. Crantz (wild service tree) seeds with different origins. African Journal of Biotechnology, 9(34): 5535-5541.Zarchini, M., D. Hashemabadi, N. Negahdar and S. Zarchini, 2013. Improvement seed germination of wild service tree (Sorbus aucoparia L.) by gibberellic acid. Annals of Biological Research, 4(1): 72-74.

Outside the Russian Arctic, the floristic classification of willow scrub was carried out in Norway (Nordhagen, 1943), Greenland (Daniёls, 1982; Sieg et al., 2006), and Alaska (Cooper, 1986, 1989; Walker et al., 1994; Schickhoff et al., 2002). In the Russian Arctic, willow communities are most fully studied in Chukotka and Wrangel Isl. (Sekretareva, 1990, 1991, 1992, 1995, 2003, 2006; Sinelnikova, 2001); several associations are described in the Siberian Arctic (Zanokha, 2003; Telyatnikov et al., 2014, 2015), on the Kola Peninsula (Koroleva, 2006, 2014), while such studies have just begun in the East European tundras (Neshataev, Lavrinenko, 2020). Many researchers faced a dilemma as to which higher units should be assigned to the syntaxa of communities with shrub willows. They were placed in the Betulo-Adenostyletea Br.-Bl. 1948 (synonym Betulo carpaticae–Alnetea viridis Rejmánek ex Bœuf, Theurillat, Willner, Mucina et Simler in Bœuf et al. 2014), Salicetea purpureae Moor 1958, Scheuchzerio palustris–Caricetea fuscae Tx. 1937 nom. ambiguum (in cases of waterlogging) or Loiseleurio procumbentis–Vaccinietea Eggler ex Schubert 1960 (with a significant abundance of tundra species). Shrub willows are one of the most active plants in the southern and typical tundras of the East European sector of the Arctic. They not only form thickets with an independent high layer (willow scrub), but are also part of tundra and mire communities, in which they are located in one layer (up to 30 cm height) with herbs and dwarf-shrubs. We described 6 associations based on the analysis of 54 relevés made in 12 sites (Fig. 1) of the typical tundra subzone on the Kolguyev, Dolgiy and Vaygach islands and in the tundra near the Pechora River. Some of the described communities with Salix spp. can rightfully be called willow scrub. These are rather high (from 30 cm in height in the northern area of the typical tundra subzone to 160 cm in the southern) and closed (willow cover — 60–95 %) herb- or herb-moss rich thickets mainly from hypoarcto-montane species Salix glauca s. str. and S. lanata s. str. Three new associations are described. Ass. Polemonio acutiflorum–Salicetum lanatae Zanokha ex Lavrinenko et Lavrinenko ass. nov. hoc loco (Table 1, rel. 1–5; Table 5, syntaxon 1; Fig. 2a and b, 3; nomenclature type (lectotypus) — Zanokha, 2003: 35–37, Table 2, rel. 6). Low-growing willow scrub from Salix lanata (30–40 cm height) with herb (Arctagrostis latifolia, Artemisia tilesii, Bistorta vivipara, Cardamine pratensis subsp. angustifolia, Cerastium jenisejense, Equisetum arvense s. l., Myosotis asiatica, Petasites frigidus, Polemonium acutiflorum, Ranunculus propinquus, Saxifraga cernua, S. hirculus, Valeriana capitata)-moss (Brachythecium salebrosum, Bryum pseudotriquetrum, Calliergonella lindbergii, Hylocomium splendens, Plagiomnium ellipticum) cover occupy large areas (up to several hundred square meters) on slightly sloping (1–5 °) sea terraces of Vaygach Isl. in places where sufficient snow accumulates in winter, on terrace bends, in depressions between ridges, on gentle slopes in valleys of small streams (Fig. 2a and b). The soils are cryogenic-ferruginous gley (Fig. 3). The association is also common in typical tundra of the Taimyr Peninsula. Ass. Triseto sibirici–Salicetum glaucae ass. nov. (Table 1, rel. 6–12, nomenclature type (holotypus) — rel. 10 (author’s number — 31_12), Kolguyev Isl., middlestream of the Bugryanka River, 07.08.2012, authors — O. V. Lavrinenko, I. A. Lavrinenko; Table 5, syntaxon 2; Fig. 4a and b, 5). Willow scrub mainly from Salix glauca (70–160 cm height) with herb (Caltha palustris, Carex aquatilis subsp. stans, Comarum palustre, Equisetum arvense s. l., Myosotis palustris, Petasites frigidus, Polemonium acutiflorum, Ranunculus propinquus, Rubus chamaemorus, Stellaria calycantha, S. crassifolia, S. palustris s. l., Trisetum sibiricum, Valeriana capitata)-moss (Brachythecium mildeanum, B. reflexum, Calliergon giganteum, Plagiomnium ellipticum, Rhizomnium pseudopunctatum, Sanionia uncinata) cover are described on Kolguyev Isl. The communities are widespread both in the floodplain, where they occupy flat areas in the middle part and near-terrace depressions (in front of the main bank), and on watersheds — in shallow runoff troughs, in saddles between hills and in the lower parts of slopes (Fig. 4a). The soils are cryogenic-ferruginous gley (Fig. 5). Ass. Climacio dendroidis–Salicetum lanatae ass. nov. (Table 2, rel. 1–20, nomenclature type (holotypus) — rel. 8 (author’s number — 63_12), Kolguyev Isl., middlestream of the Bugryanka River, 15.08.2012, authors — O. V. Lavrinenko, I. A. Lavrinenko; Table 5, syntaxa 3–5; Fig. 6a, b and c, 7). Dwarf-shrub–herb–moss willow scrub dominated by low Salix lanata (up to 50 cm height) and mosses (Climacium dendroides, Hylocomium splendens and Sanionia uncinata) are found exclusively on floodplain terraces, at the confluence of streams and on river bends, and are flooded in the strongest floods, which is well demonstrated by layered soils (Fig. 7). They are recognizable due to their well-defined hillock-hollow microrelief, which creates conditions for the growth of different ecology species. The communities are floristically rich (Table 6), especially in herbs (Alchemilla murbeckiana, Astragalus alpinus subsp. arcticus, Bartsia alpina, Carex aquatilis subsp. stans, Equisetum scirpoides, Euphrasia frigida, Festuca ovina, Pachypleurum alpinum, Parnassia palustris, Polemonium acutiflorum, Potentilla crantzii, Rubus chamaemorus, Valeriana capitata, Viola biflora). The presence of dwarf-shrubs (Arctous alpina, Empetrum hermaphroditum, Salix nummularia, S. reticulata, Vaccinium uliginosum subsp. microphyllum) with a relatively high abundance (10–40%) is a characteristic feature of this association. Subassociations were identified based on floristic differences caused by different stages of succession: C. d.–S. l. typicum subass. nov. (Table 2, rel. 1–13; Table 5, syntaxon 3; Fig. 6a and b, 7); C. d.–S. l. inops subass. nov. (Table 2, rel. 14–20, nomenclature type (holotypus) — rel. 18 (author’s number — 68_05), Kolguyev Isl., downstream of the Peschanka River, 04.09.2005, authors — O. V. Lavrinenko, I. A. Lavrinenko; Table 5, syntaxon 4; Fig. 6c). Communities of a subassociation depleted in species were formed on a younger alluvium in comparison with the typical subassociation. These 3 associations are united into a new alliance. All. Polemonio acutiflorum–Salicion glaucae all. nov. Willow scrub predominantly from Salix glauca and S. lanata with herb or herb-moss cover in depressions, runoff troughs, on the slopes of hills on watersheds and on occasionally flooded floodplains in the European part of the Russian Arctic. Nomenclature type of alliance (holotypus) — ass. Triseto sibirici–Salicetum glaucae ass. nov. (Table 1, rel. 6–12; Table 5, syntaxon 2) described in typical tundra on Kolguyev Isl. Diagnostic species of the alliance: Salix glauca and S. lanata (such species of the Salicetalia glauco-lanatae Bœuf et al. Ex Mucina et Daniёls in Mucina et al. 2016 order), herbs — Petasites frigidus, Polemonium acutiflorum, Poa pratensis s. l., Ranunculus propinquus, Valeriana capitata and moss Hylocomium splendens. High-constant species: herbs — Bistorta vivipara, Carex aquatilis subsp. stans, Equisetum arvense s. l., Rubus chamaemorus and mosses — Bryum pseudotriquetrum, Sanionia uncinata. The alliance is placed in the Salicetalia glauco-lanatae order and conditionally, following L. Mucina et al. (2016), into the Betulo carpaticae–Alnetea viridis class. We believe that new syntaxonomic units of the highest level are needed for scrub communities in the Arctic. This is evidenced by floristic differences. So, among the diagnostic species of this class (a total of 47 species, including 17 of the genus Salix), only 5 are found in the East European sector of the Arctic — Alnus fruticosa, Salix hastata, S. phylicifolia, Cortusa matthioli and Viola biflora, which are not in any way significant in willow scrub, in particular, the Polemonio acutiflorum–Salicion glaucae alliance. It is problematic to position another part of the described communities with Salix spp. as willow scrub even with high shrub cover. Willows do not form the highest of the dominant layers, affecting the composition of the lower layers, in which sedges, some mire grasses and mosses are significant. Communities with Salix myrsinites and other hemicalcephilic species were assigned to 2 associations. Ass. Carici redowskianae–Salicetum myrsinitae ass. nov. (Table 3, rel. 1–6, nomenclature type (holotypus) — rel. 4 (author’s number — 123_04), east coast of Dolgiy Isl., 11.07.2004, authors — O. V. Lavrinenko, I. A. Lavrinenko; Table 5, syntaxon 6; Fig. 8). Willow–sedge (Carex aquatilis subsp. stans, C. paralella subsp. redowskiana, C. rariflora)–moss communities dominated by low (up to 15 cm height) Salix myrsinites and green mosses (Aulacomnium turgidum, Hylocomium splendens, Sanionia uncinata, Tomentypnum nitens) are developed on base-rich soils in the terraces deflections and are distributed in the northern part of the typical tundra subzone on Vaygach, Dolgiy and Kolguyev islands. The main dominants in the syntaxon — Salix myrsinites, S. reticulata, Tomentypnum nitens, and accompanying species — Carex paralella subsp. redowskiana, Saxifraga hirculus; Cyrtomnium hymenophyllum, Orthothecium chryseon; Cladonia pocillum are hemicalcephytes. Ass. Equiseto palustris–Salicetum myrsinitae ass. nov. (Table 3, rel. 7–14, nomenclature type (holotypus) — rel. 9 (author’s number — Van17), north-west of the Bolshezemelskaya tundra, Vangureymusyur Upland, Khekheganyakha River in the middlestream, 10.07.2017, authors — O. V. Lavrinenko, I. A. Lavrinenko; Table 5, syntaxon 7; Fig. 9a and b, 10a and b). Willow–herb–moss communities dominated by Salix myrsinites (up to 30 cm height), green and sphagnum mosses are developed on base-rich soils in microdepressions on watersheds, on gentle slopes to lakes. The main dominants in the syntaxon — Salix myrsinites, S. reticulata, Equisetum palustre, Catoscopium nigritum, Sphagnum warnstorfii and Tomentypnum nitens, and accompanying species — Bartsia alpina, Carex paralella subsp. redowskiana, Equisetum variegatum, Pedicularis oederi, Pinguicula alpina, P. vulgaris, Thalictrum alpinum; Campylium stellatum, Cyrtomnium hymenophyllum, Orthothecium chryseon, Sphagnum teres are hemicalcephytes. The area of the association is located in the southern part of the typical tundra subzone. The communities are well recognizable by the dense brushing of the erect shoots of Equisetum palustre, giving them their characteristic appearance and a bright green aspect. In terms of species composition and habitats, the communities of these 2 associations fit into the framework of the Caricion atrofusco-saxatilis Nordhagen 1943 alliance in the Caricetalia davallianae Br.-Bl. 1950 order in the mire vegetation Scheuchzerio palustris–Caricetea fuscae class. The description of such communities in the East European tundras and, especially on the eastern macroslope of the Polar Urals (Lapshina et al., 2021), significantly pushes the boundaries of alliance area to the east. Ass. Andromedo pumilae–Salicetum reptantis ass. nov. (Table 4, rel. 1–8, nomenclature type (holotypus) — rel. 3 (author’s number — T134a), Malozemelskaya tundra, Kolokolkova Bay, Tobseda village vicinity, 10.07.2011, authors — O. V. Lavrinenko, I. A. Lavrinenko; Table 5, syntaxon 10). Willow (Salix reptans)–herb–dwarf-shrub–moss communities are distributed along the edges of wet low sea terraces in the Malozemelskaya tundra. The presence of dwarf-shrubs (Andromeda polifolia subsp. pumila, Empetrum hermaphroditum, Vaccinium uliginosum subsp. microphyllum) with a fairly high coverage, and grasses — Carex rariflora, Pedicularis sudetica subsp. arctoeuropaea, Rubus chamaemorus is a characteristic feature of the association. 2 variants are described: typica (Table 4, rel. 1–5; Table 5, syntaxon 8; Fig. 11a and 12a) — in the mainland and var. Sphagnum fimbriatum (Table 4, rel. 6–8; Table 5, syntaxon 9; Fig. 11b and 12b) — to the south, on Lovetskiy Isl. in the Pechora Bay. Aulacomnium palustre most often forms the basis of the ground cover; in var. Sphagnum fimbriatum is codominated by sphagnum (Sphagnum fimbriatum, S. girgensohnii, S. squarrosum) and Hylocomium splendens. In depressions between hillocks, if any, a cover of hygrophilic mosses — Kiaeria glacialis, Polytrichum jensenii, Warnstorfia exannulata, W. sarmentosa is formed. This and previously described (Lavrinenko et al., 2016; Lavrinenko, Lavrinenko, 2018b) associations — Carici rariflorae–Salicetum glaucae Lavrinenko et Lavrinenko 2018, Carici stantis–Aulacomnietum palustris Lavrinenko, Matveyeva et Lavrinenko 2016 and Parnasio palustris–Salicetum reptantis Matveyeva et Lavrinenko ex Lavrinenko et Lavrinenko 2018 (Table 4; Table 5, syntaxa 11–15; Fig. 13–15) united in a new Aulacomnio palustris–Caricion rariflorae alliance in Caricetalia fuscae Koch 1926 nom. ambiguum order and Scheuchzerio palustris–Caricetea fuscae class. All. Aulacomnio palustris–Caricion rariflorae all. nov. Willow–sedge–moss communities with low shrub willows (Salix glauca, S. lanata, S. reptans) occupying extensive wet coastal lowlands, including the rear parts of marshes and the transition stripe from marshes to tundras in the East European sector of the Arctic. Nomenclature type of the alliance (holotypus) — ass. Andromedo pumilae–Salicetum reptantis ass. nov. (Table 4, rel. 1–8; Table 5, syntaxon 10). Diagnostic species of the alliance defined within the Scheuchzerio palustris–Caricetea fuscae class: Empetrum hermaphroditum, Carex rariflora, Luzula wahlenbergii, Pedicularis sudetica subsp. arctoeuropaea and Aulacomnium palustre. Constant species: shrubs Salix glauca and S. reptans and moss Sanionia uncinata. The alliance was proposed on the basis of the structural, physiognomic characteristics of wetland communities and the group significance of the diagnostic species (see Westhoff, Maarel, 1978: 333).

ABSTRACT This study aims to investigate and analyze e the effect of Operating Expenses Operating Income (BOPO), capital adequacy ratio (CAR), financial slack, sustainability officer, and sustainability committee on green banking disclosure in Islamic banks registered with the Financial Services Authority (OJK) during the period 2017-2021. In this study, panel data regression data analysis techniques were used with the help of Eviews 10 software. The results of this study show that partially the variables Operating costs in operating income (BOPO), capital adequacy ratio (CAR), financial slack, and sustainability officer have no effect on green banking disclosure. While the variable Sustainability Committee has a positive and significant effect on Green Banking disclosure. At the same time, the variables BOPO, CAR, Financial Slack, Sustainability Officer, and Sustainability Committee have a significant effect on Green Banking disclosure. The implication of this research for science is to contribute to the literature related to the factors that influence green banking disclosure. In addition, this research is also expected to help banks in improving their governance, and for the government is expected to help in making policies related to green banking disclosure. Keywords: Operating Expenses on Operating Income, Capital Adequacy Ratio, Financial Slack, Green Banking, Sustainability ABSTRAK Penelitian ini bertujuan untuk mengkaji dan menganalisis pengaruh dari Biaya Operasional Pendapatan Operasional (BOPO), Rasio Kecukupan Modal (CAR), Financial Slack, Sustainability Officer, dan Sustainability committee terhadap pengungkapan green banking pada bank syariah yang terdaftar di OJK selama periode 2017-2021. Teknik sampling yang digunakan adalah Purposive Sampling dengan kriteria tertentu, sehingga sampel didapat sebanyak 45 data dari 9 Bank syariah yang sesuai kriteria. Dan menggunakan teknik analisis data regresi data panel dengan bantuan software Eviews 10. Hasilnya menunjukkan bahwa secara parsial variabel BOPO, Capital Adequacy Ratio (CAR), Financial Slack dan Sustainability Officer tidak berpengaruh terhadap pengungkapan Green banking. Sedangkan variabel Sustainability Committee berpengaruh positif dan signifikan terhadap pengungkapan Green Banking. Secara simultan variabel BOPO, CAR, Financial Slack, Sustainability officer dan Sustainability Committee memiliki pengaruh dan signifikan terhadap pengungkapan Green banking Kata Kunci: Biaya Operasi pada Pendapatan Operasional, Capital Adequacy Ratio, Financial Slack, Green Banking, Sustainability REFERENCES Ahlström, J., & Ficekova, M. (2017). The relationship between current financial slack resources and future CSR Performance. A quantitative study of public companies in the Nordic Markets. Master Thesis, Umea School of Business and Economics. Alim, M., & Sina, D. I. (2020). Pengaruh capital adequacy ratio, non performing financing dan laba bersih terhadap financial sustainability ratio (Pada perusahaan perbankan syariah yang ada di Indonesia periode 2014-2018). Balance Vocation Accounting Journal, 4(1), 28–42. doi: 10.31000/bvaj.v4i.2701 Amidjaya, P. G., & Widagdo, A. K. (2020). Sustainability reporting in Indonesian listed banks: Do Corporate governance, ownership structure and digital banking matter? Journal of Applied Accounting Research, 21(2), 231–247. doi:10.1108/JAAR-09-2018-0149 Anggraeni, D. Y., & Djakman, C. D. (2017). Slack resources, feminisme dewan, dan kualitas pengungkapan tanggung jawab sosial perusahaan. Jurnal Akuntansi dan Keuangan Indonesia, 14(1), 94–118. doi:10.21002/jaki.2017.06 Ashwin, A. S., Krishnan, R. T., & George, R. (2015). Board characteristics, financial slack and R&D investments: An empirical analysis of the indian pharmaceutical industry. International Studies of Management and Organization, 46(1), 8–23. doi:10.1080/00208825.2015.1007007 Astuti, R. P. (2022). Pengaruh CAR, FDR, NPF, dan BOPO terhadap profitabilitas perbankan syariah. Jurnal Ilmiah Ekonomi Islam, 8(3), 3213–3223. doi:10.29040/jiei.v8i3.6100 Barney, J. B. (1986). Organizational culture : Can it be a source of sustained competitive advantage ? The Academy of Management Review, 11(3), 656–665. doi:10.2307/258317 Bose, S., Khan, H. Z., Rashid, A., & Islam, S. (2017). What drives green banking disclosure? An institutional and corporate governance perspective. Asia Pacific Journal of Management, 35(2), 501–527. doi:10.1007/s10490-017-9528-x Bourgeois, L. J. (1981). The measurement of organizational slack. The Academy of Management Review, 6(1), 29–39. doi:10.2307/257138 Bradley, S. W., Shepherd, D. A., & Wiklund, J. (2011). The importance of slack for new organizations facing “Tough” environments. Journal of Management Studies, 48(5), 1071–1097. doi:10.1111/j.1467-6486.2009.00906.x Burke, J. J., Hoitash, R., & Hoitash, U. (2017). The heterogeneity of board-level sustainability committees and corporate social performance. Journal of Business Ethics, 154(4), 1161–1186. doi:10.1007/s10551-017-3453-2 Calıyurt, K. T. (2020). Introduction: Why do we need to talk about climate change risk as accountants and auditors urgently? In Accounting, Finance, Sustainability, Governance and Fraud: Vol. I (pp 3-10). Singapore: Springer Campbell, D., Craven, B., & Shrives, P. (2003). Voluntary social reporting in three FTSE sectors: A comment on perception and legitimacy. Accounting, Auditing & Accountability Journal, 16(4), 558–581. doi:10.1108/09513570310492308 Deegan, C. (2002). The legitimising effect of social and environmental disclosures – a theoretical foundation. Accounting, Auditing & Accountability Journal, 15(3), 282-311. doi.org/10.1108/09513570210435852 Dendawijaya, L. (2005). Manajemen perbankan (2nd Edition). Bogor: Penerbit Ghalia Indonesia. Donaldson, T., & Preston, L. (1995). The stakeholder theory of the corporation: Concepts, evidence, and implications. The Academy of Management Review, 20(1), 65–91. doi:10.2307/258887 Dowling, J., & Pfeffer, J. (1975). Organizational legitimacy: Social values and organizational behavior. University of California Press, 18(1), 122–136. doi:10.2307/1388226 Freeman, R. E., & McVea, J. (1984). A stakeholder approach to strategic management. Darden Graduate School of Business Administration: University of Virginia. Fu, R., Tang, Y., & Chen, G. (2020). Chief sustainability officers and corporate social (Ir) responsibility. Strategic Management Journal, 41(4), 656–680. doi:10.1002/smj.3113 Ghozali, I., & Chariri, A. (2007). Teori akuntansi. Semarang: Badan Penerbit Universitas Diponegoro. Hikmah, I. L., & Majid, M. S. A. (2019). Faktor keuangan internal yang memengaruhi pertumbuhan Qardhul Hasan sebagai wujud pelaksanaan CSR pada perbankan syariah Indonesia. Jurnal Ilmiah Mahasiswa Ekonomi Islam, 1(1), 1–18. Hörisch, J., Freeman, R. E., & Schaltegger, S. (2014). Applying stakeholder theory in sustainability management: Links, similarities, dissimilarities, and a conceptual framework. Organization and Environment, 27(4), 328–346. doi:10.1177/1086026614535786 Horisch, J., Schaltegger, S., & Freeman, R. E. (2020). Integrating stakeholder theory and sustainability accounting : A conceptual synthesis. Journal of Cleaner Production, 275(1). doi:10.1016/j.jclepro.2020.124097 Ivada, E., & Fauzi, H. (2019). Sustainability officer in Indonesia’s palm oil companies. New Approaches to CSR, Sustainability and Accountability, 81–102. doi: 10.1007/978-981-32-9588-9_6 Kanashiro, P., & Rivera, J. (2019). Do chief sustainability officers make companies greener? The moderating role of regulatory pressures. Journal of Business Ethics, 155(3), 687–701. doi:10.1007/s10551-017-3461-2 Khamilia, N., & Nor, W. (2022). Faktor-faktor dalam meningkatkan pengungkapan green banking. Jurnal Riset Akuntansi (JUARA), 12(1), 1–23. doi:10.36733/juara.v12i1.3144 Kim, S. I., Shin, H., Shin, H., & Park, S. (2019). Organizational slack, corporate social responsibility, sustainability, and integrated reporting: Evidence from Korea. Sustainability, 11(16), 2–17. doi:10.3390/su11164445 Laskowska, A. (2018). Green banking as the prospective dimension of banking in Poland. Ecological Questions Online, 29(1), 129–135. doi:10.12775/EQ.2018.011 Lewis, T. C. (2013). A Review and Analysis of the Effects of Financial Slack on Firm Innovation. August, 1–58. Dessertation of doctor of philosophy in management science, The University of Wisconsin-Milwaukee Liana, S. (2019). Pengaruh profitabilitas, leverage , ukuran perusahaan dan dewan komisaris independen terhadap pengungkapan sustainability report. Jesya: Jurnal Ekonomi & Ekonomi Syariah, 2(2), 199–208. doi:10.36778/jesya.v2i2.69 Lymperopoulos, C., Chaniotakis, I. E., & Soureli, M. (2012). A model of green bank marketing. Journal of Financial Services Marketing, 17(2), 177–186. doi:10.1057/fsm.2012.10 Malinton, D., & Kampo, K. (2019). Pengaruh moderasi green banking dalam hubungan antara Corporate Social Responsibility dan Going Concern. Dinamika Akuntansi, Keuangan Dan Perbankan, 8(2), 117–133. Masrurroh, D. A., & Mulazid, A. S. (2017). Analisis pengaruh size perusahaan, Capital Adequacy Ratio (CAR), Return On Asset (ROA), Financing Deposit Ratio (FDR) terhadap pengungkapan Corporate Social Responsibility (CSR) bank umum syariah di Indonesia periode 2012-2015. Human Falah, 4(1), 1–18. Mattingly, J. E., & Olsen, L. (2018). Performance outcomes of investing slack resources in corporate social responsibility. Journal of Leadership and Organizational Studies, 25(4), 481–498. doi:10.1177/1548051818762336 Miller, K. P., & Serafeim, G. (2014). Chief sustainability officers: Who are they and what do they do? SSRN Electronic Journal, 24(11), 1–22. doi:10.2139/ssrn.2411976 Otoritas Jasa Keuangan/OJK. (2016). Peraturan Otoritas Jasa Keuangan nomor 4/POJK.03/2016 tentang penilaian tingkat kesehatan bank umum. Retrieved from https://www.ojk.go.id/id/kanal/perbankan/regulasi/peraturan-ojk/Documents/Pages/pojk-tentang-penilaian-tingkat-kesehatan-bank-umum/SALINAN-POJK%204%20Penilaian.pdf Otoritas Jasa Keuangan/OJK. (2017). POJK No. 51 /POJK.03/2017 tentang penerapan keuangan berkelanjutan bagi lembaga jasa keuangan, emiten, dan perusahaan publik. Retrieved from https://ojk.go.id/id/regulasi/Pages/Penerapan-Keuangan-Berkelanjutan-bagi-Lembaga-Jasa-Keuangan,-Emiten,-dan-Perusahaan-Publik.aspx Patten, D. M. (2019). Seeking legitimacy. Sustainability Accounting, Management and Policy Journal, 11(6), 1009–1021. doi: 10.1108/SAMPJ-12-2018-0332. Peters, G. F., & Romi, A. M. (2014). Does the voluntary adoption of corporate governance mechanisms improve environmental risk disclosures? Evidence from greenhouse gas emission accounting. Journal of Business Ethics, 125(4), 637–666. doi:10.1007/s10551-013-1886-9 Pinasti, W. F., & Mustikawati, R. I. (2018). Pengaruh CAR, BOPO, NPL, NIM dan LDR terhadap profitabilitas bank umum periode 2011-2015. Nominal: Barometer Riset Akuntansi dan Manajemen, 7(1), 126-142. doi:/10.21831/nominal.v7i1.19365 Rahmayati, R., Mujiatun, S., & Sari, M. (2022). Islamic green banking at Bank Pembangunan Daerah in Indonesia. Indonesian Interdisciplinary Journal of Sharia Economics (IIJSE), 5(1), 74–93. doi:10.31538/iijse.v5i1.1850 Risk Check. (2019). 5 reasons every company needs a sustainability committee. Retrieved from https://riskcheckinc.com/5-reasons-every-company-needs-a-sustainability-committee/ Romli, R., & Zaputra, A. R. R. (2021). Pengaruh implementasi Green Banking, Corporate Social Responsibility terhadap nilai perusahaan pada perusahaan perbankan yang terdaftar di BEI. Portofolio: Jurnal Ekonomi, Bisnis, Manajemen, dan Akuntansi, 18(2), 136–159. https://doi.org/10.54783/portofolio.v18i2.214 Rossi, A. (2017). The association between sustainability governance characteristics and the assurance of corporate sustainability reports. Social and Environmental Accountability Journal, 37(1), 79–80. doi:10.1080/0969160X.2016.1273453 Agoes, S., & Ardana, I.C. (2017). Etika bisnis dan profesi : Tantangan membangun manusia seutuhnya. Jakarta: Salemba Empat. Safitri, M., & Saifudin. (2019). Implikasi karakteristik perusahaan dan Good Corporate Governance terhadap pengungkapan Sustainability Report. Jurnal Bingkai Ekonomi, 4(1), 13–25. Sahetapy, R., Pattinasarany, W., R. Siahaan, F., Gunawan, M., Pramudya, P., & Anita. (2018). Indeks investasi hijau sektor industri berbasis lahan. Jakarta: International NGO Forum on Indonesian Development (INFID) dan Indonesian Working Group on Forest Finance (IWGFF). Saputra, S. E. (2016). Pengaruh leverage, profitabilitasddan size terhadap pengungkapan corporate social responsibility pada perusahaan di Bursa Efek Indonesia. Economica: Journal of Economic and Economic Education, 5(1), 69–81. doi:10.22202/economica.2016.v5.i1.817 Sekarlangit, L. D., & Wardhani, R. (2021). The effect of the characteristics and activities of the board of directors on Sustainable Development Goal (SDG) disclosures: Empirical evidence from Southeast Asia. MDPI: Sustainability, 13(14), 1–17. doi:10.3390/su13148007 Selly, S. P. S., Sunarmi, & Mulyono, A. (2023). Implementasi capital adequacy ratio dan human resource slack dalam mengoptimalkan penerapan sustainable finance. Jurnal Riset Mahasiswa Akuntansi, 11(1), 129–136. doi:10.21067/jrma.v11i1.8344 Solekah, N. A. (2019). The effect of green banking product and green corporate image on green customer loyalty mediated by green customers satisfaction in syariah banking mediation. Management and Economics Journal (MEC-J), 3(1), 81-94. doi:10.18860/mec-j.v0i2.5837 Sugiarti, R. (2020). Pengaruh firm maturity dan slack resources terhadap pengungkapan corporate social responsibility. Journal of Applied Business and Economic: JABE, 7(1), 48–64. doi:10.30998/jabe.v7i1.5373 Tarigan, J., & Semuel, H. (2015). Pengungkapan sustainability report dan kinerja keuangan. Jurnal Akuntansi dan Keuangan, 16(2), 88–101. doi:10.9744/jak.16.2.88-101 TUK Indonesia. (2019). Tinjauan atas reformasi keuangan berkelanjutan di Indonesia. Retrieved from https://www.tuk.or.id/2019/12/keuangan-berkelanjutan-indonesia/. Utomo, A. S., Maharani, N. K., & Octavio, D. Q. (2015). Financial determinants of Qardhul Hasan financing growth: Evidence from islamic banks in Indonesia. Global Review of Islamic Economics and Business, 3(1), 38–45. doi:10.14421/grieb.2015.031-03 Van Der Laan, S. (2009). The role of theory in explaining motivation for corporate social disclosure: Voluntary disclosures vs solicited. The Australasian Accounting Business & Finance Journal, 3(4), 15–29. Vanacker, T., Collewaert, V., & Paeleman, I. (2013). The relationship between slack resources and the performance of entrepreneurial firms : The role of venture capital and angel investors. Journal of Management Studies, 50(6), 1070–1096. doi:10.1111/joms.12026 Velte, P., & Stawinoga, M. (2020). Do chief sustainability officers and CSR committees influence CSR-Related outcomes? A structured literature review based on empirical-quantitative research findings. Journal of Management Control, 31(4), 333-377. doi:10.1007/s00187-020-00308-x Wernerfelt, B. (1984). A resource-based view of the firm. Strategic Management Journal, 5(2), 171–180. Zhang, Y., Li, J., Jiang, W., Zhang, H., Hu, Y., & Liu, M. (2018). Organizational structure, slack resources and sustainable corporate socially responsible performance. Corporate Social Responsibility and Environmental Management, 25(6), 1099–1107. doi:10.1002/csr.1524

In the current study, methanolic and selective extracts from different parts of Gymnocarpos decander were screened for total phenolic, flavonoid, flavonol and condensed tannin contents. The antioxidant activity of extracts was also determined. The highest values of total contents of phenolics (156.097 ± 2.312 mg GAE/g DM), flavonoids (14.878 ± 0.275 mg CE/g DM), condensed tannins (39.388 ± 1.599 mg CE/g DM) and flavonols (6.506 ± 1.021 mg QE/g DM) were found in flowers. The most powerful antioxidant was found in the methanolic extract of flowers (32.27 ± 2.400 mg AAE/g DM). Tannins extracted from flowers showed an interesting antioxidant activity to trap the 1,1-Diphenyl- 2-picrylhydrazyl (DPPH) free radical (0.063 ± 0.000 mg/mL) and to reduce iron absorption (0.083 ± 0.004 mg/mL). The highest activity in the β-carotene test was found in the butanolic fraction of flowers (0.314 ± 0.008 mg/mL). A high performance liquid chromatography (HPLC) analysis allowed the detection of quercetin, -coumaric acid and naringenin in the ethyl acetate and butanolic fractions of flowers, and also vanillic acid in the ethyl acetate fraction of flowers. REFERENCES: Abu Zarin, M.H., Isha A., & Armania,N. (2016). Antioxidant, antimicrobial and cytotoxicpotential of condensed tannins from Leucaena leucocephala hybrid-Rendang. Foodscience and humain wellness, 5, 65–75. https://doi.org/10.1016/j.fshw.2016.02.001Ahmed, S., Hasan, M.M., & Mahmood, Z.A. (2016). Antiurolithiatic plants in differentcountries and cultures. Journal of Pharmacognosy and Phytochemistry, 5,102–115.https://www.phytojournal.com/archives/2016/vol5issue1/PartB/4-4-45.pdf.Ashraful, A., Subhan, N., Mahbubur, R, Reza, H., & Sarker, S. (2014). Effect of CitrusFlavonoids, Naringin and Naringenin, on Metabolic Syndrome and Their Mechanismsof Action. Advanced Nutrients, 5, 404–417. doi: 10.3945/an.113.005603.Baba Aïssa, F. (1999). Encyclopédie des plantes utiles. Ed : Librairie Moderne Rouïba.Alger, pp 368.Bate-Smith, E. (1962). The phenolic constituents of plants and their taxonomic significance.Botanical Journal of the Linnean Society, 58: 95–173. https://doi.org/10.1111/j.1095-8339.1962.tb00890.xBechlem, H., Mencherini, T., Bouheroum, M., Benayache, S, Cotugno, R., Braca, A., & DeTommasi, N. (2017). New Constituents from Gymnocarpos decander .Planta Medica,83,1200–1206. DOI: 10.1055/s-0043-111599 Beddou, F., Bekhechi, C., Ksouri, R., Chabane Sari, D., & Atik Bekkara, F. (2014). Potentialassessment of Rumex vesicarius L. as a source of natural antioxidants and bioactivecompounds. Journal of Food Science and Technology, 52, 3549–3560.doi: 10.1007/s13197-014-1420-9Bekkara, F., Jay, M., Viricel, M.R., & Rome, S. (1998). Distribution of phenolic compoundswithin seed and seedlings of two Vicia faba cvs differing in their seed tannin content,and study of their seed and root phenolic exudations. Plant Soil, 203, 27–36.https://doi.org/10.1023/A:1004365913726Belyagoubi‑Benhammou, N., Belyagoubi, L., El Zerey‑Belaskri, A., Zitouni, A.,Ghembaza, N., Benhassaini, H., & Atik‑Bekkara, F., Piras, A., Falconieri, D., Rosa,A. (2018). Fatty acid composition and antioxidant activity of Pistacia lentiscus L. fruitfatty oil from Algeria. Journal of Food Measurement and Characterisation, 12 ,1408–1412. https://doi.org/10.1007/s11694-018-9755-yBenhammou, N., Atik-Bekkara, F., & Kadifkova-Panovska, T. (2009). Antioxidant activityof methanolic extracts and some bioactive compounds of Atriplex halimus. ComptesRendus Chimie, 12, 1259–1266. Doi : 10.1016/j.crci.2009.02.004Bouaziz, M., Dhouib, A., Loukil, S., Boukhris, M., & Sayadi, S. (2009). Polyphenols content,antioxidant and antimicrobial activities of extracts of some wild plants collected fromthe south of Tunisia. African Journal of Biotechnology, 8, 7017–7027.doi:10.4314/ajb.v8i24.68789Bouchelta, A., Boughdad, A., & Blenzar, A. (2005). Effets biocides des alcaloïdes, dessaponines et des flavonoïdes extraits de Capsicum frutescens L. (Solanaceae) surBemisia tabaci (Gennadius) (Homoptera :Aleyrodidae). Biotechnologie, AgronomieSociété et Environnnement, 9, 259–269. https://popups.uliege.be/1780-4507/text/v9n4/259.pdfGhembaza, N., Belyagoubi-Benhammou, N., Zitouni, A., Toul, F., Michalet, S., & AtikBekkara, F. (2021). Rapid identification analysis of chemical constituents of Sedumvillosum L. (Orpin.) by UHPLC-DAD-HRSM. Journal of Natural Products Researchand Applications, 1, 15–23.https://ojs.univ-tlemcen.dz/index.php/JNPRA/article/view/967/852Hasbal, G., Yilmaz-Ozden, T., & Can, A. (2014). Antioxidant and antiacetylcholinesteraseactivities of Sorbus torminalis (L.) Crantz (wild service tree) fruits. Journal of food anddrug analysis, 23, 57–62. doi: 10.1016/j.jfda.2014.06.006.Hertog, M.G., Hollman, P.C.H., & Venema, D.P. (1992). Optimization of a quantitativeHPLC determination of potentially anticarcinogenic flavonoids in vegetables and fruits.Journal of Agricultural and Food Chemistry, 40, 1591–1598.https://doi.org/10.1021/jf00021a023Javidnia, K., Miri, R., Jamalian A., Sarkarzadeh, H., & Nasiri, A. (2008). Composition ofEssential Oil of Gymnocarpos decander Forrssk. from Iran. Journal of Essential OilResearch, 20, 477–478. https://doi.org/10.1080/10412905.2008.9700062 Julkunen-Titto, R. (1985). Phenolic constituents in the leaves of northern Willows methodsfor the analysis of certain phenolics. Journal of Agricultural and Food Chemistry, 33,213–217. https://doi.org/10.1021/jf00062a013Kaiser, J., Yassin, M., Prakash, S., Safi, N., Agami, M., Lauw, S., Ostrozhenkova ,E., Bacher,A., Rohdich, F., Eisenreich, W., Safi, J., & Galan-Goldhirsh, A.(2007). Anti-malarialdrug targets: screening for inhibitors of 2C-methyl-D-erythritol 4- phosphate synthase(IspC protein) in Mediterranean plants. Phytomedicine, 14, 242–249. doi:10.1016/j.phymed.2006.12.018.Khan, N., Akhtar, M.S., Khan, B.A., Braga, V., & Reich, A . (2015). Antiobesity,hypolipidemic, antioxidant and hepatoprotective effects of Achyranthes aspera seedsaponins in high cholesterol fed albino rats. Archives of medicale science, 11, 1261–1271. doi: 10.5114/aoms.2015.56353Kumaran, A., & Karunakaran, R.J. (2007). In vitro antioxidant activities of methanol extractsof five Phyllanthus species from India. LWT Lebensmittel-Wissenschaft & Technologie,40, 344–352. https://doi.org/10.1016/j.lwt.2005.09.011Kumaran, S.P., Kutty, B.C., Chatterji, A., Subrayan, P.P., & Mishra, K.P. (2007).Radioprotection against DNA damage by an extract of Indian green mussel. Pernaviridis (L). Journal of environmental pathology, toxicology and oncology, 26, 263–272.doi: 10.1615/jenvironpatholtoxicoloncol.v26.i4.30.Mabry, T. (1980). Betalains. In: Bell E, Charwood B, eds. Encyclopedia of plant physiology,secondary plant products. Berlin, Germany: Springer Verlag, pp 513–533.Maiza, K., Hammiche, V., & Maiza-benabdesselam, F. (2011). Traditional medicine in northSahara: the “Deffi”. Life Sciences Leaflets, 16, 551–560.Manyou, Y., Gouvinhas, I., Rocha, J. , Ana I. R. N., & Barros, A. (2021). Phytochemicaland antioxidant analysis of medicinal and food plants towards bioactive food andpharmaceutical resources. Scientific reports, 11, 10041. https://doi.org/10.1038/s41598-021-89437-4Moure, A., Franco, D., Sineiro, J., Dominguez, H., Nunez, M.J., & Lem, J.M. (2000).Evaluation of extracts from Gevuina avellana hulls as antioxidants. Journal ofAgricultural and Food Chemistry, 48, 3890–3897. doi: 10.1021/jf000048w.Oyaizu, M. (1986). Studies on products of browning reaction prepared from glucose amine.Japan Journal of Nutrition, 44, 307–315.http://dx.doi.org/10.5264/eiyogakuzashi.44.307Prieto, P., Pineda, M., & Aguilar, M. (1999). Spectrophotometric quantitation of antioxidantcapacity through the formation of a phosphomolybdenum complex: specific applicationto the determination of vitamin E. Analytical Biochemistry, 269, 337–341. doi:10.1006/abio.1999.4019.Razali, N., Razab, R., Mat Junit, S., & Abdul Aziz, A. (2008). Radical scavenging andreducing properties of extracts of cashew shoots (Anacardium occidentale). FoodChemistry, 111, 38–44. DOI:10.1016/j.foodchem.2008.03.024 Sadeghi, Z., Valizadeh, J., Shermeh, O., & Akaberi, M. (2015). Antioxidant activity and totalphenolic content of Boerhavia elegans(choisy) grown in Baluchestan, Iran. Americanjournal of psychiatry, 5, 1–9.Sanchez-Moreno, C., Larrauri, J.A., & Saura-Calixto, F. (1998). A procedure to measure theantiradical efficiency of polyphenols. Journal of the Science of food and Agriculture,76, 270–276.https://doi.org/10.1002/(SICI)1097-0010(199802)76:2<270::AID-JSFA945>3.0.CO;2-9Shaik, Y.B., Castellani, M.L., Perrella, A., Conti, F., Salini, V., Tete, S., Madhappan,B., Vecchiet, J., De Lutiis, M.A., Caraffa, A., & Cerulli, G. (2006). Role of quercetin(a natural herbal compound) in allergy and inflammation. Journal of BiologicalRegulators and Homeostatic Agents. 20, 47–52.Singleton, V.L., & Rossi, J.A. (1965). Colorimetry of total phenolics with phosphomolybdicphosphotungstic acid reagents. American Journal of Enology and Viticulture, 16,144–158.Sikder, K., Das, N., Kesh, SB., & Dey, S. (2014). Quercetin and B-sitosterol prevents highfat diet induced dyslipidemia and hepatotoxicity in swiss albino mice. Indian Journal ofExperimental Biology, 52, 60–66.Subburaman, S., Ganesan K., & Ramachandran M. (2014). Protective role of naringeninagainst doxorubicin-induced cardiotoxicity in a rat model: histopathology and mRNAexpression profile studies. Journal of Environnemental Patholology, Toxicology andOncology, 33, 363–376. doi: 10.1615/jenvironpatholtoxicoloncol.2014010625.Tanaka, Y., Sasaki, N., & Ohmiya, A. (2008). Biosynthesis of plant pigments: anthocyanins,betalains and carotenoids. The Plant Journal, 54, 733–749. doi: 10.1111/j.1365-313X.2008.03447.x.Tarhouni, M., Ben Salem, F., Ouled Belgacem, A., & Neffati, M. (2010). Acceptability ofplant species along grazing gradients around watering points in Tunisian arid zone.Flora, 205, 454-461. DOI:10.1016/j.flora.2009.12.020Toul, F., Belyagoubi-Benhammou, N., Zitouni, A., & Atik-Bekkara, F. (2016). Antioxidant https://doi.org/10.1080/14786419.2016.1217205 Zhang, S.Y., Zheng, C.G., Yan, X.Y., & Tian, W.X. (2008). Low concentration of condensedtannins from catechu significantly inhibits fatty acid synthase and growth of MCF-7cells. Biochemical Biophysical Research Communications, 371, 654–658. doi:10.1016/j.bbrc.2008.04.062Zhishen, J., Mengcheng, T., & Jianming, W. (1999). The determination of flavonoid contentsin mulberry and their scavenging effects on superoxide radicals. Food Chemistry, 64,555–559. https://doi.org/10.1016/S0308-8146(98)00102-2

The impact of agricultural intensification on soil degradation now is occurring in tropical countries. The objective of this study was to determine the effect of long-term tillage and N fertilization on soil properties and crop yields in corn-soybean rotation. This long-term study which initiated since 1987 was carried out on a Typic Fragiudult soil at Politeknik Negeri Lampung, Sumatra (105o13’45.5"-105o13’48.0"E, 05o21’19.6"-05o21’19.7"S) in 2010 and 2011. A factorial experiment was arranged in a randomized block design with four replications. The first factor was tillage system namely intensive tillage (IT) and conservation tillage (CT) which consist of minimum tillage (MT) and no-tillage (NT); while the second factor was N fertilization with rates of 0, 100 and 200 kg N ha-1 applied for corn, and 0, 25, and 50 kg N ha-1 for soybean. The results showed that bulk density and soil strength at upper layer after 24 years of cropping were similar among treatments, but the soil strength under IT at 50-60 cm depth was 28.2% higher (p<0.05) than NT. Soil moisture and temperature under CT at 0-5 cm depth were respectively 38.1% and 4.5% higher (p<0.05) than IT. High N rate decreased soil pH at 0-20 cm depth as much as 10%, but increased total soil N at 0-5 cm depth as much as 19% (p<0.05). At 0-10 cm depth, MT with no N had highest exchangeable K, while IT with medium N rate had the lowest (p<0.05). At 0-5 cm depth, MT with no N had highest exchangeable Ca, but it had the lowest (p<0.05) if combined with higher N rate. Microbial biomass C throughout the growing season for NT was consistently highest and it was 14.4% higher (p<0.05) than IT. Compared to IT, Ap horizon of CT after 24 years of cropping was deeper, with larger soil structure and more abundance macro pores. Soybean and corn yields for long-term CT were 64.3% and 31.8% higher (p<0.05) than IT, respectively. Corn yield for long-term N with rate of 100 kg N ha-1 was 36.4% higher (p<0.05) than with no N.Keywords: Conservation tillage, crop yields, N fertilization, soil properties[How to Cite: Utomo M, IS Banuwa, H Buchari, Y Anggraini and Berthiria. 2013.Long-term Tillage and Nitrogen Fertilization Effects on Soil Properties and Crop Yields. J Trop Soils 18 (2): 131-139. Doi: 10.5400/jts.2013.18.2.131][Permalink/DOI: www.dx.doi.org/10.5400/jts.2013.18.2.131] REFERENCESAl-Kaisi and X Yin. 2005. Tillage and crop residue effects on soil carbon dioxide emission in corn- soybean rotation. J Environ Qual 34: 437-445. Pub Med. Barak P, BO Jobe, AR Krueger, LA Peterson and DA Laird. 1997. Effects of long-term soilacidification due to nitrogen inputs in Wisconsin. Plant Soil 197: 61-69.Blake GR and KH Hartge. 1986. Bulk density. In: A Klute (ed). Methods of Soil Analysis. ASA and SSSA. Madison, Wisconsin, USA, pp. 363-375.Blanco-Canqui H and R Lal. 2008. No-till and soil-profile carbon sequestration: an on farm assessment. Soil Sci Soc Am J 72: 693-701. Blanco-Canqui H, LR Stone and PW Stahlman. 2010. Soil response to long-term cropping systems on an Argiustoll in the Central Great Plains. Soil Sci Soc Am J 74: 602-611.Blevins RL, MS Smith, GW Thomas and WW Frye. 1983. Influence of conservation tillage on soil properties. J Soil Water Conserv 38: 301-305.Blevins RL, GW Thomas and PL Cornelius. 1977 Influence of no-tillage and nitrogen fertilization on certain soil properties after 5 years of continuous corn. Agron J 69: 383-386.Blevins, RL and WF Frye, 1993. Conservation tillage: an ecological approach to soil management. Adv Agron 51: 34-77.Brady NC and RR Weil. 2008. The nature and properties of soils. Pearson Prentice Hall. Fourteenth Edition. New Jersey, 965 p.Brito-Vega, H, D Espinosa-Victoria, C Fragoso, D Mendoza, N De la Cruz Landaro and A Aldares-Chavez. 2009. Soil organic particle and presence of earthworm under different tillage systems. J Biol Sci 9: 180-183.Derpch, R 1998. Historical review of no-tilage cultivation of crops. JIRCAS Working Rep. JAPAN Int Res Ctr for Agric Sciences, Ibaraki, Japan 13: 1-18. Diaz-Zorita, M., JH Grove, L Murdock, J Herbeck and E Perfect. 2004. Soil structural disturbance effects on crop yields and soil properties in a no-till production system. Agron J 96: 1651-1659.Dickey EC, PJ Jasa and RD Grisso. 1994. Long-term tillage effect on grain yield and soil properties in a soybean/grain sorghum Rotation. J Prod Agric 7: 465 - 470.Edwards WM, LD, Norton, CE, Redmond. 1988. Characterizing macro pores that affect infiltration into non tilled soil. Soil Sci Soc Am J 52: 483-487.Fernandez RO, PG Fernandez, JVG Cervera and FP Torres. 2007 Soil properties and crop yields after 21 years of direct drilling trials in southern Spain. Soil Till Res 94: 47-54.Fengyun Z, W Pute, Z Xining and C Xuefeng. 2011. The effects of no-tillage practice on soil physical properties. Afr J Biotech 10: 17645-17650. Havlin, JL, JD Beaton, SM Tisdale and WL Nelson. 2005. Soil Fertility and Fertilizer: an Introduction to Nutrient Management. Pearson Prantice Hall. Sevent Edition. Upper Saddle River, New Jersey, 515 p.Karlen DL, NC Wollenhaupt, DC Erbach, EC Berry, JB Swan, NS Eash and JL Jordahl. 1994. Crop residue effects on soil quality following 10-years of no-till corn. Soil Till Res 31: 149-167.Kumar A and DS Yadav. 2005. Effect of zero and minimum tillage in conjunction with nitrogen management in wheat (Triticum aestivum ) after rice (Oryza sativa.). Indian J Agron 50 (1): 54-57.Lal R. 1989. Conservation tillage for sustainable agriculture: tropics versus temper­ate environment. Adv Agron 42: 85-197.Lal R. 1997. Residue management, conservation tillage and soil restoration for mitigating greenhouse effect by CO2 enrichment. Soil Till Res 43: 81-107.Lal R. 2007. Soil science in a changing climate. CSA New 52: 1-9.Mallory J J, RH Mohtar, GC Heathman, DG Schulze and E Braudeau. 2011. Evaluating the effect of tillage on soil structural properties using the pedostructure concept. Geoderma 163: 141-149. doi:10.1016/ j.geoderma. 2011.01.018. 9p.Paustian K, HP Collins and EA Paul. 1997. Management control on soil carbon. In: EA Paul, ET Elliot, K Paustian and CV Cole (eds). Soil Organic Matter in Temperate Agro-ecosystems: Long-term Experiment in North America. CRC Press, pp. 15-50.Rasmussen, KJ. 1999. Impact of ploughless soil tillage on yield and soil quality: A Scandinavian review. Soil Till Res 53: 3-14.Quintero M. 2009. Effects of conservation tillage in soil carbon sequestration and net revenues of potato-based rotations in the Colombian Andes. [Thesis], University of Florida, USA. SAS [Statistical Analysis System] Institute. 2003. The SAS system for windows. Release 9.1. SASInst Inc, Cary, NC.Singh A and J Kaur. 2012. Impact of conservation tillage on soil properties in rice-wheat cropping system. Agric Sci Res J 2: 30-41.Six, J, SD Frey, RK Thiet and KM Batten. 2006. Bacterial and fungal contributions to carbon sequestration in agroecosystems. Soil Sci Soc Am J 70: 555-569.Smith JL and HP Collins. 2007. Management of organisms and their processes in soils. In: EA Paul (ed). Soil Microbiology, Ecology and Biochemistry. Third Edition. Academic Press, Burlington, USA, 532 p.Stockfisch N, T Forstreuter, W Ehlers. 1999. Ploughing effects on soil organic matter after twenty years of conservation tillage in Lower Saxony, Germany. Soil Till Res 52: 91-101.Tarkalson, DD, GW Hergertb and KG Cassmanc. 2006. Long-term effects of tillage on soil chemical properties and grain yields of a dryland winter wheat-sorghum/corn-fallow rotation in the great plains. Agron J 26: 26-33. Thomas GA, RC Dalal, J Standley. 2007. No-till effect on organic matter, pH, cation exchange capacity and nutrient distribution in a Luvisol in the semi-arid subtropics. Soil Till Res 94: 295-304.Utomo M, H Suprapto and Sunyoto. 1989. Influence of tillage and nitrogen fertilization on soil nitrogen, decomposition of alang-alang (Imperata cylindrica) and corn production of alang-alang land. In: J van der Heide (ed.). Nutrient management for food crop production in tropical farming systems. Institute for Soil Fertility (IB), pp. 367-373.Utomo M. 2004. Olah tanah konservasi untuk budidaya jagung berkelanjutan. Prosiding Seminar Nasional IX Budidaya Pertanian Olah Tanah Konservasi. Gorontalo, 6-7 Oktober, 2004, pp. 18-35 (in Indonesian).Utomo M, A Niswati, Dermiyati, M R Wati, AF Raguan and S Syarif. 2010. Earthworm and soil carbon sequestration after twenty one years of continuous no-tillage corn-legume rotation in Indonesia. JIFS 7: 51-58.Utomo M, H Buchari, IS Banuwa, LK Fernando and R Saleh. 2012. Carbon storage and carbon dioxide emission as influenced by long-term conservation tillage and nitrogen fertilization in corn-soybean rotation. J Trop Soil 17: 75-84.Wang W, RC Dalal and PW Moody. 2001. Evaluation of the microwave irradiation method for measuring soil microbial biomass. Soil Sci Soc Am J 65: 1696-1703.Wright AL and FM Hons. 2004. Soil aggregation and carbon and nitrogen storage under soybean cropping sequences. Soil Sci Soc Am J 68: 507-513. Zibilske LM, JM Bradford and JR Smart. 2002. Conservation tillage induced change in organic carbon, total nitrogen and available phosphorus in a semi-arid alkaline subtropical soil. Soil Till Res 66: 153-163.