Articoli di riviste: "Vafs"

1

Wang, Weirong, Ting Jing, Xiaofeng Yang, Yanhao He, Bo Wang, Yunfang Xiao, Chenxu Shang, Jiye Zhang e Rong Lin. "Hydroxytyrosol regulates the autophagy of vascular adventitial fibroblasts through the SIRT1-mediated signaling pathway". Canadian Journal of Physiology and Pharmacology 96, n. 1 (gennaio 2018): 88–96. http://dx.doi.org/10.1139/cjpp-2016-0676.

Testo completo

Abstract (sommario):

Hydroxytyrosol (HT), a phenolic compound in olive oil, exerts an anti-inflammatory effect in cardiovascular diseases. Recent studies found that autophagy was a therapeutic target of diseases. However, the effect of HT on autophagy in vascular adventitial fibroblasts (VAFs) remains unknown. Thus, in this study, we aimed to determine the effect of HT on cell autophagy and related signaling pathway and whether HT regulates the inflammatory response through autophagy in VAFs. Our results showed that HT promoted cell autophagy by increasing the conversion of LC3 and Beclin1 expression and the autophagic flux in VAFs stimulated with tumor necrosis factor-α (TNF-α). HT also upregulated the expression of the deacetylase sirtuin 1 (SIRT1) protein and mRNA compared with the TNF-α group. The molecular docking studies showed the good compatibility between HT and SIRT1, indicating that HT might act through SIRT1. Further study found that HT regulated autophagy through SIRT1-mediated Akt/mTOR suppression in VAFs. In addition, HT inhibited TNF-α-induced inflammatory response in VAFs through SIRT1. Furthermore, the study showed that HT inhibited the inflammatory response of VAFs through autophagy. These findings indicate that HT regulates the autophagy of VAFs through SIRT1-mediated Akt/mTOR suppression and then inhibits the inflammatory response of VAFs.

Gli stili APA, Harvard, Vancouver, ISO e altri

2

Pasi, Bhaveshkumar N., Subhash K. Mahajan e Santosh B. Rane. "A Method for Performing Forging Operation: A Perspective of Industry 4.0". Recent Patents on Mechanical Engineering 14, n. 3 (9 agosto 2021): 423–35. http://dx.doi.org/10.2174/2212797614666210120110548.

Testo completo

Abstract (sommario):

Background: Cold forging operation is done on small as well as large scale in manufacturing industries. These industries are facing problems such as higher rejection rate of the final product, low productivity, the high number of accidents during production, etc. Objective: The purpose of this research work is to develop a Voice-Assisted Forging System (VAFS) with a lower rejection rate, higher productivity, and lower number of accidents during production. Methods: Based on recently published journals and patents, traditional and automatic forging operations, Industry 4.0, and voice assisted systems are reviewed and VAFS is designed and developed. Then, the trial is taken on VAFS to investigate its performance. Finally, limitations and future research of the VAFS are proposed. Results: It is found that after implementation of the VAFS the average rejection count is reduced by 90.3 percentage, the operational productivity is increased by 71.2 percentage, and process accuracy is increased from 92.75 percentage to 99.30 percentage. Also, the number of accidents is reduced to zero. In comparison with the manual forging operation, the VAFS occupies less space, and it is easy to operate. Conclusion: This system will help the workers as well as the owner of industries to create a better man and machine relationship and to have a human-friendly working environment. VAFS reduces exhaustion and hassle of employees, components rejection, and energy consumptions in the production line.

Gli stili APA, Harvard, Vancouver, ISO e altri

3

Wang, Wei-Rong, Ting-Ting Li, Ting Jing, Yan-Xiang Li, Xiao-Feng Yang, Yan-Hao He, Wei Zhang, Rong Lin e Ji-Ye Zhang. "SIRT1 Regulates the Inflammatory Response of Vascular Adventitial Fibroblasts through Autophagy and Related Signaling Pathway". Cellular Physiology and Biochemistry 41, n. 2 (2017): 569–82. http://dx.doi.org/10.1159/000457878.

Testo completo

Abstract (sommario):

Background/Aims: Autophagy is a lysosomal degradation pathway that is essential for cellular survival, differentiation, and homeostasis. Sirtuin 1 (SIRT1), a NAD+-dependent deacetylase, plays a pivotal role in modulation of autophagy. Recent studies found that autophagy was involved in the regulation of inflammatory response. In this study, we aimed to determine the effect of SIRT1 on autophagy and inflammation, and whether autophagy can regulate the inflammatory response in vascular adventitial fibroblasts (VAFs). Methods: Cell autophagy was evaluated by fluorescence microscope and transmission electron microscopy. The expression of protein and mRNA were determined by Western blot analysis and real time-PCR. The production of cytokine was detected by ELISA. Results: TNF-α induced autophagy and increased SIRT1 expression in VAFs. SIRT1 activator resveratrol enhanced TNF-α-induced VAF autophagy. In contrast, SIRT1 knockdown attenuated VAF autophagy. Both the Akt inhibitor MK2206 and mTOR inhibitor rapamycin further increased TNF-α-induced VAF autophagy. Furthermore, SIRT1 knockdown increased Akt phosphorylation and inhibited the autophagy in VAFs. However, MK2206 attenuated the effect of SIRT1 knockdown on VAF autophagy. In addition, ingenuity pathway analysis showed that there is a relationship between cell autophagy and inflammation. We found that SIRT1 knockdown increased the expression of NLRP3 and interleukin (IL)-6 and promoted the production of IL-1β in VAFs. Further study showed that autophagy activation decreased the expression of NLRP3 and IL-6 and inhibited the production of IL-1β, whereas autophagy inhibition increased the inflammatory response of VAFs. More importantly, our study showed that autophagy was involved in the degradation of NLRP3 through the autophagy-lysosome pathway. Conclusion: SIRT1 not only regulates VAF autophagy through the Akt/mTOR signaling pathway but also suppresses the inflammatory response of VAFs through autophagy.

Gli stili APA, Harvard, Vancouver, ISO e altri

4

Tseng, Benjamin Y., Byron J. Gajewski e Patricia M. Kluding. "Reliability, Responsiveness, and Validity of the Visual Analog Fatigue Scale to Measure Exertion Fatigue in People with Chronic Stroke: A Preliminary Study". Stroke Research and Treatment 2010 (2010): 1–7. http://dx.doi.org/10.4061/2010/412964.

Testo completo

Abstract (sommario):

Background and Purpose. Post-Stroke Fatigue (PSF) is a prevalent yet commonly neglected issue that impacts daily functions and quality of life in people post-stroke. To date no studies have attempted to validate a clinically-feasible and reliable instrument to quantify PSF. We developed the Visual Analog Fatigue Scale (VAFS) to eliminate difficulties and poor data validity in testing people post-stroke. The purpose of this study was to evaluate the reliability, responsiveness, and validity of the VAFS.Methods. Twenty-one people post-stroke (12 males, age =59.5±10.3years; time post-stroke =4.1±3.5years) participated. Subjects underwent a standardized fatigue-inducing exercise; fatigue level was assessed at rest, immediately after exercise, and after recovery. The same protocol was repeated after 14 days.Results. ICC values for the VAFS at rest was 0.851 (CI = 95%,0.673 ∼ 0.936,P<.001), immediately after exercise was 0.846 (CI = 95%,0.663 ∼ 0.934,P<.001), and 15 minutes after exercise was 0.888 (CI = 95%,0.749 ∼ 0.953,P<.001). The ES values for at-rest to post-exercise and for post-exercise to post-recovery were 14.512 and 0.685, respectively. Using paired t-test, significant difference was found between VAFS scores at-rest and post-exercise (P<.001), and between post-exercise and post-recovery (P<.001).Conclusion. Our data suggests good reliability, responsiveness, and validity of the VAFS to assess exertion fatigue in people post-stroke.

Gli stili APA, Harvard, Vancouver, ISO e altri

5

Niwinska, Anna, Aneta Bałabas, Maria Kulecka, Anna Kluska, Magdalena Piątkowska, Agnieszka Paziewska, Kazimiera Pyśniak, Wojciech Olszewski, Michał Mikula e Jerzy Ostrowski. "Limited Practical Utility of Liquid Biopsy in the Treated Patients with Advanced Breast Cancer". Diagnostics 10, n. 8 (28 luglio 2020): 523. http://dx.doi.org/10.3390/diagnostics10080523.

Testo completo

Abstract (sommario):

Recently, liquid biopsy has emerged as a tool to monitor oncologic disease progression and the effects of treatment. In this study we aimed to determine the clinical utility of liquid biopsy relative to conventional oncological post-treatment surveillance. Plasma cell-free (cf) DNA was collected from six healthy women and 37 patients with breast cancer (18 and 19 with stage III and IV tumors, respectively). CfDNA was assessed using the Oncomine Pan-Cancer Cell-Free Assay. In cfDNA samples from patients with BC, 1112 variants were identified, with only a few recurrent or hotspot mutations within specific regions of cancer genes. Of 65 potentially pathogenic variants detected in tumors, only 19 were also discovered in at least one blood sample. The allele frequencies of detected variants (VAFs) were <1% in cfDNA from all controls and patients with stage III BC, and 24/85 (28.2%) variants had VAFs > 1% in only 8 of 25 (32%) patients with stage IV BC. Copy number variations (CNVs) spanning CDK4, MET, FGFR1, FGFR2, ERBB2, MYC, and CCND3 were found in 1 of 12 (8%) and 8 of 25 (32%) patients with stage III and IV tumors, respectively. In healthy controls and patients without BC progression after treatment, VAFs were <1%, while in patients with metastatic disease and/or more advanced genomic alterations, VAFs > 1% and/or CNV were detected in approximately 30%. Therefore, most patients with stage IV BC could not be distinguished from those with stage III disease following therapy, based on liquid biopsy results.

Gli stili APA, Harvard, Vancouver, ISO e altri

6

DeZern, Amy E., Johannes Goll, Travis L. Jensen, Sridhar N. Srivatsan, Nancy K. Gillis, Gregory A. Abel, Eric Padron et al. "Correlation between Peripheral Blood and Bone Marrow Somatic Mutations Among Patients with Suspected or Established Myelodysplastic Syndromes from the National MDS Study". Blood 142, Supplement 1 (28 novembre 2023): 1860. http://dx.doi.org/10.1182/blood-2023-178587.

Testo completo

Abstract (sommario):

INTRODUCTION: Myelodysplastic Syndromes (MDS) are caused by progressive clonal dominance of mutated hematopoietic stem cells. While assessment of mutations in peripheral blood (PB) is an established standard for monitoring patients with some diseases such as chronic myeloid leukemia, the sensitivity and precision of PB screening and monitoring for somatic mutations in patients with MDS and related conditions such as clonal cytopenias of undetermined significance (CCUS) is less certain. Multiple published guidelines require bone marrow (BM) evaluations for the above, an invasive procedure not often performed outside of clinical trials. We compared somatic mutations and variant allele frequencies (VAFs) in paired PB and BM samples to assess the utility of PB results as a surrogate for diagnosis and monitoring. METHODS: The National MDS Natural History Study (National MDS Study) is an observational longitudinal cohort study of cytopenic patients suspected of having a diagnosis of MDS. All patients have PB and BM sampled when entering the study, prior to formal diagnosis. For this study, paired PB and BM baseline DNA samples from 36 patients were assessed for somatic mutations. Only subjects with minimum of one variant detected in their BM were included in this study. DNA was extracted from PB using an automated FlexSTAR (AutoGen) and from BM cell pellets using a QIAamp DNA Mini Kit (QIAGEN). Targeted exon sequencing of 96 genes was performed using a NovaSeq 6000 at a mean coverage of >1,200X and a mean breadth (bases covered at ≥100X) of >99.9%. Reads were aligned against a patched version of the build GRCh38 using BWA-MEM. VarScan2 was used to detect single nucleotide variants and short insertions/deletions with a minimum VAF of 2% and 5%, respectively. Resulting variants from 53 genes were manually reviewed to retain likely disease-causing variants. Correlation analysis between PB and BM VAFs was performed using Pearson correlation and linear regression. To confirm paired samples were sourced from the same subject, the Somalier software using a set of highly polymorphic SNPs across different ancestries was utilized to ensure a high level of relatedness. RESULTS: The 36 patients included 10 (28%) with MDS, 2 (6%) with MDS/MPN, 1 (3%) with AML (<30% blasts), and 23 (64%) with CCUS. The median age was 73 years (Table 1). Five of 36 patients had circulating PB blasts. Among the 191 mutations identified, the most common were TET2 (27%), SRSF2 (13%), DNMT3A (9%), SF3B1 (8%), and ASXL1 (8%). Correlation analysis of mutations (n=180) shared between paired PB and BM samples indicated a linear relationship between VAFs detected in PB and BM (Pearson correlation r=0.95, Figure 1), with a slight increase in variance observed with increasing VAFs. The deviation from the perfect (grey line) to the observed (yellow line) linear fit indicated that PB VAFs underestimated VAFs in BM by approximately 23% overall (Figure 1). For example, a BM VAF of 0.20 translated to a mean PB VAF of 0.16 based on the regression fit. The lower sensitivity was confirmed when looking at the number of total missed variants (present in BM, absent in PB): 9 of 101 (9%). Two mutations were detected in PB, but not BM. These mutations and diagnoses were 1) ETNK1 (VAF 0.026) in a patient with MDS-EB-1; and 2) CBL (VAF 0.021) in a patient with MDS with isolated del5q. Next, we assessed the relationship between percent of detected mutations and minimum VAF that was detected using linear regression and found that the higher the minimum VAF, the lower the percent of missed mutations. For example, for a 0.1, 0.2, and 0.3 minimum VAF, 11%, 9%, and 8% of BM mutations were missed, respectively. There was no difference in concordance between MDS and CCUS. SUMMARY & CONCLUSIONS: PB can be used to reliably identify somatic mutations in patients with suspected or established MDS and related conditions. Linear correlation between PB and BM VAFs showed, unsurprisingly, that BM mutations with higher VAFs are more likely to be detected. If PB is positive, this method of variant detection may be used potentially to diagnose and monitor. However, if negative (or if VAF is less than 0.10), bone marrow genomics are still necessary to exclude detectable clonal mutations. For quantitative predictive tools that use VAFs, PB VAFs would need to be corrected to improve predictive results; our estimated linear regression equation could be used to guide this in a larger prospective study.

Gli stili APA, Harvard, Vancouver, ISO e altri

7

Liu, Lin, Qingzhuo Cui, Junna Song, Yang Yang, Yixin Zhang, Jiapeng Qi e Jingshan Zhao. "Hydroxysafflower Yellow A Inhibits Vascular Adventitial Fibroblast Migration via NLRP3 Inflammasome Inhibition through Autophagy Activation". International Journal of Molecular Sciences 24, n. 1 (22 dicembre 2022): 172. http://dx.doi.org/10.3390/ijms24010172.

Testo completo

Abstract (sommario):

Inflammation is closely associated with progression of vascular remodeling. The NLRP3 inflammasome is the key molecule that promotes vascular remodeling via activation of vascular adventitia fibroblast (VAF) proliferation and differentiation. VAFs have a vital effect on vascular remodeling that could be improved using hydroxysafflower yellow A (HSYA). However, whether HSYA ameliorates vascular remodeling through inhibition of NLRP3 inflammasome activation has not been explored in detail. Here, we cultured primary VAFs and analyzed the migration of VAFs induced by angiotensin II (ANG II) to determine the potential effects and mechanism of HSYA on VAF migration. The results thereof showed that HSYA remarkably inhibited ANG II-induced VAF migration, NLRP3 inflammasome activation, and the TLR4/NF-κB signaling pathway in a dose-dependent manner. In addition, it is worth noting that LPS promoted ANG II-induced VAF migration and NLRP3 inflammasome assembly, which could be significantly reversed using HSYA. Moreover, HSYA could be used to inhibit NLRP3 inflammasome activation by promoting autophagy. In conclusion, HSYA could inhibit ANG II-induced VAF migration through autophagy activation and inhibition of NLRP3 inflammasome activation through the TLR4/NF-κB signaling pathway.

Gli stili APA, Harvard, Vancouver, ISO e altri

8

Fu, Guodong, Ronald S. Chazen, Eric Monteiro, Allan Vescan, Jeremy L. Freeman, Ian J. Witterick e Christina MacMillan. "Facilitation of Definitive Cancer Diagnosis With Quantitative Molecular Assays of BRAF V600E and TERT Promoter Variants in Patients With Thyroid Nodules". JAMA Network Open 6, n. 7 (28 luglio 2023): e2323500. http://dx.doi.org/10.1001/jamanetworkopen.2023.23500.

Testo completo

Abstract (sommario):

ImportanceMolecular testing of the presence of pathogenic genomic variants in a tumor without quantifying the variant allele fraction (VAF) does not differentiate the variation extent among tumors, often resulting in an inconclusive diagnosis because of interpatient variability.ObjectiveTo examine the association between the quantification of VAFs of BRAF V600E and TERT promoter variants and a definitive cancer diagnosis of thyroid tumors.Design, Setting, and ParticipantsThis diagnostic study analyzed a cohort of 378 surgically resected thyroid tumors with a maximum dimension of 1 cm or larger between March 15, 2016, and March 16, 2020, and a separate cohort of 217 residual thyroid fine-needle aspiration (FNA) biopsy specimens obtained from January 22, 2020, to March 2, 2021, at Mount Sinai Hospital, Toronto, Ontario, Canada. Data analysis was conducted between February 1, 2021, and February 1, 2023.ExposuresQuantitative VAF assays of BRAF V600E and TERT promoter variants (C228T and C250T) were performed by digital polymerase chain reaction molecular assays.Main Outcomes and MeasuresThe VAFs of BRAF V600E and TERT promoter variants were correlated with tumor histologic diagnoses and histopathologic features to delineate the association of VAF assays with tumor malignancy. The receiver operating characteristic curve analysis, sensitivity, specificity, positive predictive value, negative predictive value, and logistic regression analysis based on follow-up histopathologic types were used to determine the diagnostic utility of the quantitative molecular assays.ResultsA total of 595 specimens, including 378 surgically resected thyroid tumors and 217 thyroid nodule FNA biopsy specimens, were collected from 580 patients (436 [75.2%] female with a mean [SD] age of 50 [16] years and 144 [24.8%] male with a mean [SD] age of 55 [14] years). Sensitive VAF assays of 378 thyroid tumors revealed the presence of the BRAF V600E variant in 162 tumors (42.9%), with 26 (16.0%) at a low VAF of 1% or less and 136 (84.0%) at a high VAF of greater than 1%, and the presence of TERT promoter variants in 49 tumors (13.0%), including 45 C228T variants (91.8%), 15 (33.3%) of which were quantified as having a low VAF (≤1%) and 30 (66.7%) as having a high VAF (&gt;1%), and 4 C250T variants (8.2%) with VAFs between 40.0% and 47.0%. All tumors detected with BRAF V600E and/or TERT promoter variants, whether at low or high VAFs, received a definitive cancer diagnosis. Further analysis delineated a significant association between high VAFs of either variant individually or different VAF levels for both variants in coexistence and aggressive histopathologic features of tumors. Excluding low VAFs assisted in identifying patients at an intermediate-to-high risk of recurrence (odds ratio, 5.3; 95% CI, 1.9-14.6; P = .001). The VAF assays on the residual FNA biopsy specimens showed a high agreement to those on surgical tissues (κ = 0.793, P &lt; .001) and stratified malignancy in 40 of 183 indeterminate FNA cases (21.9%), with a sensitivity of 93.8% (95% CI, 67.7%-99.7%), specificity of 90.0% (95% CI, 75.4%-96.7%), positive predictive value of 78.9% (95% CI, 53.9%-93.0%), and negative predictive value of 97.3% (95% CI, 84.2%-99.9%).Conclusions and RelevanceThis diagnostic study suggests that sensitive quantitative VAF assays of BRAF V600E and TERT promoter variants can elucidate the interpatient variability in tumors and facilitate a definitive cancer diagnosis of thyroid nodules by differentiating the variation extent of genomic variants, even at low VAFs.

Gli stili APA, Harvard, Vancouver, ISO e altri

9

Cher, Chae Yin, Zi Yi Lim, Daryl Tan, Hae Tha Mya, Wichean Mongkonsritragoon, Min-Han Tan e Yukti Choudhury. "An ultrasensitive amplicon-based sequencing panel for noninvasive molecular testing of hematological malignancies using blood." Journal of Clinical Oncology 38, n. 15_suppl (20 maggio 2020): e19511-e19511. http://dx.doi.org/10.1200/jco.2020.38.15_suppl.e19511.

Testo completo

Abstract (sommario):

e19511 Background: Hematological malignancies, especially acute myeloid leukemia, myeloproliferative neoplasms, and myelodysplastic syndromes (MDS), present with distinct genomic alterations relevant to prognosis. Bone marrow (BM) is the primary sample source for genetic testing, but is obtained by an invasive biopsy procedure which carries risk of infection. An alternative non-invasive sample type to profile disease-relevant genomic alterations at diagnosis and subsequently, is desired for clinical decision making. An ultrasensitive sequencing panel was applied to peripheral blood (PB) as an alternative to BM, to demonstrate its utility for disease profiling and monitoring. Methods: A total of 27 pairs of matched PB and BM samples were obtained from patients with hematological malignancies including leukemia (n = 21), lymphoma (n = 4), multiple myeloma (n = 1) and MDS (n = 1). The sequencing panel covers 45 genes commonly mutated in myeloid and lymphoid malignancies. The panel is based on amplicon-sequencing and includes error correction for variant detection with allele frequency (VAF) as low as 0.1%. Optimized bioinformatics pipeline and in-house sequencing noise removal was used for variant selection and clonal analysis. Results: Complete concordance was seen for mutations detected in 23 of 27 patient-matched BM and PB paired samples. The likely cause of discordance in the other 4 pairs is attributable to mutations with low VAF ( < 0.5%). Overall, 91% of detected variants were concordant between PB and BM with strong correlation of VAFs (R = 0.9617). Serial testing trends correlated with stable disease with limited changes in VAFs (n = 2), and successful treatment response with rapidly falling VAFs (n = 5). In particular, 2 patients with FLT3-ITD and BCR-ABL1, respectively, identified at diagnosis had dramatic decrease in VAFs with respective targeted treatment. Conclusions: We report the utility of an ultrasensitive sequencing assay in PB with excellent concordance of mutations with BM, suggesting PB is a reliable alternative source for testing. In serial samples, the assay demonstrated value in treatment selection and response evaluation.

Gli stili APA, Harvard, Vancouver, ISO e altri

10

Nasko, Dan, Phillip Pham, Stuti Joshi, Kristi Kim, Nairi Pezeshkian, Young Kim, Alexandra Sockell e Jonas Korlach. "Abstract 2432: Improved liquid biopsy assay performance using sequencing by binding (SBB)". Cancer Research 84, n. 6_Supplement (22 marzo 2024): 2432. http://dx.doi.org/10.1158/1538-7445.am2024-2432.

Testo completo

Abstract (sommario):

Abstract Liquid biopsy is revolutionizing the field of early cancer detection research through non-invasive detection of tumor DNA in the blood. However, existing liquid biopsy assays are limited in their sensitivity for ctDNA detection at low variant allele frequencies (VAFs), with most relying on extreme sequencing depth and computational error correction to separate the true ctDNA signal from background errors. This limitation is particularly problematic in the area of early cancer detection, in which expected ctDNA allele frequencies are extremely low. Novel strategies are therefore needed to help improve liquid biopsy assay sensitivity and reduce per-sample sequencing requirements. Here we describe PacBio’s application of the Onso short-read sequencing system to enable detection of ctDNA at low VAFs using the SeraCare Complete ctDNA Mutation Mix reference standard. The Onso system makes use of a novel sequencing by binding (SBB) method to achieve up to 15x greater quality scores, with ≥90% of reads at Q40 or above. We performed targeted capture and sequencing of libraries prepared from the SeraCare reference mix diluted into WT human DNA at the following VAFs: 0.00% (WT), 0.05%, 0.10%, 0.25%, and 0.50%, and compared the sensitivity at each VAF for SBB compared to a competitor method using sequencing by synthesis (SBS) at varying sequencing depths. We observed superior sensitivity for ctDNA detection at low VAFs (0.05%, 0.1%) using SBB at half the sequencing depth compared to SBS, in part due to reduced false positive calling in the WT sample for SBB. Furthermore, SBB was able to achieve comparable sensitivity results to SBS using four-fold less sequencing, and without the use of computational error correction. Finally, combining SBB with computational error-correction methods boosted sensitivity even further, suggesting an additive value for these technologies. Taken together, our results demonstrate the potential of SBB to improve upon existing methods of liquid biopsy and better enable research on early cancer detection. Citation Format: Dan Nasko, Phillip Pham, Stuti Joshi, Kristi Kim, Nairi Pezeshkian, Young Kim, Alexandra Sockell, Jonas Korlach. Improved liquid biopsy assay performance using sequencing by binding (SBB) [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 2432.

Gli stili APA, Harvard, Vancouver, ISO e altri

11

Uy, Geoffrey L., Eric J. Duncavage, Gue Su Chang, Meagan A. Jacoby, Christopher A. Miller, Jin Shao, Sharon Heath et al. "Dynamic Changes in the Clonal Structure of MDS and AML in Response to Epigenetic Therapy". Blood 126, n. 23 (3 dicembre 2015): 610. http://dx.doi.org/10.1182/blood.v126.23.610.610.

Testo completo

Abstract (sommario):

Abstract Hematopoietic cells from patients with myelodysplastic syndromes (MDS) and acute myeloid leukemia (AML) contain gene mutations that are variably distributed between the founding clone and daughter subclone(s). Traditional response criteria in MDS and AML are based on bone marrow morphology and may not accurately reflect antitumor activity and clinical benefit in patients treated with hypomethylating agents. We used digital sequencing of serial bone marrow samples to monitor tumor burden and to characterize the changes in the clonal structure of MDS and AML that occur during treatment with epigenetic therapy. We hypothesized that digital sequencing may provide an alternative measure of antitumor activity and identify the persistence or emergence of resistant clones during treatment which mediate disease relapse. We conducted a phase I/II study in older adults (age ≥ 60) with advanced MDS (IPSS ≥ 1.5) or AML. Subjects received a combination of decitabine 20 mg/m2 on d1-5 with the histone deacetylase inhibitor, panobinostat 10-40 mg po 3x/week every 28 days for up to 12 cycles. Serial bone marrow samples were collected for digital sequencing at baseline, after every 2 cycles of treatment and at the time of relapse. A total of 52 patients, 14 with MDS and 38 with AML were enrolled in this study. For AML patients, 10% achieved a complete remission (CR+CRi) with an additional 18% of patients achieving a morphologic leukemia-free state (mLFS) using IWG response criteria. For patients with MDS, 14% achieved a CR and 21% achieved a marrow CR. We identified 9 MDS and 16 AML patients that had banked, paired bone marrow and skin (as a source of normal DNA) samples and a somatic mutation in at least 1 of 54 recurrently mutated MDS/ AML genes. DNA was enriched for 285 genes commonly mutated in MDS and AML (n=24 patients) or whole exome probes spiked-in with the 285 genes (enhanced exome sequencing; EES) (n=7 patients), and sequenced on a HiSeq2000 instrument with 2x101bp reads. We detected an average of 4.9 SNVs and indels per patient (range 1-15) when only the 285 gene panel was used, compared to 27.4 mutations per patient (range 9-43) using EES. Ten genes were mutated in at least 3 pre-study samples. The presence of a TP53 mutation (N=8) was associated with a trend towards achieving a response (p=0.09). We then analyzed variant allele frequencies (VAF) of mutations in serial samples. We observed five distinct patterns that were associated with different clinical responses, including i) AML patients achieving a CR+CRi (n=2): mutation VAFs were undetectable by cycle 2 using standard sequencing, ii) AML with mLFS (n=2): mutation VAFs remained detectable but decreased to <10%, iii) MDS with CR/cCR+mCR (n=3): mutation VAFs decreased to <10% and were intermittently below the level of detection, iv) MDS with stable disease (n=2): mutation VAFs decreased but some remained >10%, and v) AML with treatment failure (n=5): mutation VAFs were essentially unchanged and remained >30%. We observed responding patients can have persistent measurable clonal hematopoiesis for at least one year without disease progression. Sequencing also revealed selective AML subclone clearance in a patient with treatment failure, nominating a set of mutations that may mark super-responder clones. We observed that the blast percentage decreases prior to mutation VAFs in some patients, suggesting that the differentiation of blasts could falsely underestimate tumor burden. Finally, sequencing revealed that tumor burden can be measured even in patients achieving a CR. Using an ultra-sensitive barcode sequencing approach, we sequenced 1 MDS and 1 AML patient achieving a clinical and molecular CR (based on standard sequencing). We detected extremely rare TP53 mutations months to years prior to disease relapse (VAFs = 0.23% in MDS and 0.05% in AML during a CR - equivalent to a sensitivity of 1 in 2000 heterozygous mutant cells). While patients can live with persistent clonal hematopoiesis in a CR or stable disease, ultimately we find evidence that expansion of a rare subclone drives relapse or progression from MDS to secondary AML. Digital sequencing provides an alternative measure of disease response which may augment traditional clinical response criteria and should be explored in future clinical trials. Disclosures Uy: Novartis: Research Funding. Off Label Use: Panobinostat in MDS/AML. Duncavage:Cofactor Genomics: Consultancy; DI&P Consulting: Consultancy. Jacoby:Sunesis: Research Funding; Novo Nordisk: Consultancy. Abboud:Teva Phamaceutical: Research Funding.

Gli stili APA, Harvard, Vancouver, ISO e altri

12

Duncavage, Eric J., Haley J. Abel, Jason D. Merker, John B. Bodner, Qin Zhao, Karl V. Voelkerding e John D. Pfeifer. "A Model Study of In Silico Proficiency Testing for Clinical Next-Generation Sequencing". Archives of Pathology & Laboratory Medicine 140, n. 10 (7 luglio 2016): 1085–91. http://dx.doi.org/10.5858/arpa.2016-0194-cp.

Testo completo

Abstract (sommario):

Context.—Most current proficiency testing challenges for next-generation sequencing assays are methods-based proficiency testing surveys that use DNA from characterized reference samples to test both the wet-bench and bioinformatics/dry-bench aspects of the tests. Methods-based proficiency testing surveys are limited by the number and types of mutations that either are naturally present or can be introduced into a single DNA sample. Objective.—To address these limitations by exploring a model of in silico proficiency testing in which sequence data from a single well-characterized specimen are manipulated electronically. Design.—DNA from the College of American Pathologists reference genome was enriched using the Illumina TruSeq and Life Technologies AmpliSeq panels and sequenced on the MiSeq and Ion Torrent platforms, respectively. The resulting data were mutagenized in silico and 26 variants, including single-nucleotide variants, deletions, and dinucleotide substitutions, were added at variant allele fractions (VAFs) from 10% to 50%. Participating clinical laboratories downloaded these files and analyzed them using their clinical bioinformatics pipelines. Results.—Laboratories using the AmpliSeq/Ion Torrent and/or the TruSeq/MiSeq participated in the 2 surveys. On average, laboratories identified 24.6 of 26 variants (95%) overall and 21.4 of 22 variants (97%) with VAFs greater than 15%. No false-positive calls were reported. The most frequently missed variants were single-nucleotide variants with VAFs less than 15%. Across both challenges, reported VAF concordance was excellent, with less than 1% median absolute difference between the simulated VAF and mean reported VAF. Conclusions.—The results indicate that in silico proficiency testing is a feasible approach for methods-based proficiency testing, and demonstrate that the sensitivity and specificity of current next-generation sequencing bioinformatics across clinical laboratories are high.

Gli stili APA, Harvard, Vancouver, ISO e altri

13

Yu, Fanyang, Jun Guo, Anahita Fathi Kazerooni, Hamed Akbari, Erik Toorens, Chiharu Sako, Elizabeth Mamourian et al. "NIMG-66. RADIOGENOMICS-BASED HETEROGENEITY ANALYSIS OF GLIOBLASTOMA REVEALS MR IMAGING PHENOTYPICAL CHARACTERIZATION OF EGFR MUTATIONS". Neuro-Oncology 25, Supplement_5 (1 novembre 2023): v201. http://dx.doi.org/10.1093/neuonc/noad179.0762.

Testo completo

Abstract (sommario):

Abstract PURPOSE EGFR is one of the most frequently altered genes in glioblastoma, while also being an attractive therapeutic target for treatment. Having in vivo, imaging-based markers of EGFR mutations, and as well as characterizing molecular heterogeneity, are important for patient management and stratification into trials. Toward this end, we present deep learning models of imaging signatures of EGFR mutations built from MRI. METHODS Our cohort consists of 286 glioblastoma patients with multi-parametric MRI (mpMRI) scans (T1, T1-Gd, T2, T2-FLAIR, DSC, DTI). Radiomics features, including histograms, morphologic and textural descriptors, were first derived. Genomic information was determined from a targeted next generation sequencing (NGS) panel. We jointly trained a variational auto-encoder and a multi-label classifier for predicting 4 key driver genes EGFR, NF1, PTEN, TP53 to learn a latent representation reflecting the molecular heterogeneity in the dataset. The latent representation was analyzed using principal component analysis (PCA). We calculated the Euclidean distance between imaging features of tumors with EGFR plus 1 of the other 3 mutations, from those of tumors having only EGFR mutations. We also analyzed the imaging signatures and variant allele frequencies (VAFs) of individuals with multiple (typically 3-4) resected tissue samples (n=49). RESULTS Co-occurrence of mutations in any of NF1, PTEN, TP53 genes with EGFR mutations resulted into dominance of imaging signatures of these other mutations over that of EGFR mutations. Interestingly, tumors with homogeneously high VAFs in EGFR mutations (n=3) exhibit strong phenotypical difference from the exclusive EGFR mutated group, while individuals with heterogeneous EGFR mutations (n=4) do not show such differences. CONCLUSION Our preliminary findings suggest EGFR imaging characteristics can be dominated by those of other co-occurring mutations. Tumors with homogeneously high VAFs, potentially indicating presence of germline EGFR mutations, lead to relatively distinct imaging phenotypes.

Gli stili APA, Harvard, Vancouver, ISO e altri

14

Stopsack, Konrad H., Irenaeus C. Chan, Evelyn Schmidt, Alex Panchot, Samantha McNulty, Nicole A. Schreiber, Yiwen Zhang et al. "Abstract P011: Clonal hematopoiesis and risk of lethal prostate cancer: a prospective cohort study with long-term follow-up". Cancer Prevention Research 16, n. 1_Supplement (1 gennaio 2023): P011. http://dx.doi.org/10.1158/1940-6215.precprev22-p011.

Testo completo

Abstract (sommario):

Abstract Background: Clonal hematopoiesis (CH), the presence of acquired mutations in leukemia driver genes, promotes systemic inflammation and is common among aging men. Prostate cancer, a subset of which is lethal, also develops in aging men. We hypothesized that CH contributes to development of lethal prostate cancer. Methods: We conducted nested case-cohort studies for metastatic prostate cancer and prostate cancer-specific death (lethal prostate cancer) within the prospective Health Professionals Follow-up Study. First, we followed 1155 men free of prostate cancer and cardiovascular disease at blood draw (1993-1995) for development of lethal prostate cancer over up to 26 years. Second, we followed 532 men with incident non-metastatic prostate cancer for development of lethal prostate cancer. We sequenced blood DNA from 1488 participants for putative CH driver mutations in the 9 most common CH-defining genes with a custom targeted panel (VariantPlex, Invitae, Inc.) at ultra-high depth (mean, 18,000x), employing unique molecular identifiers for error correction. CH variant calling used a novel ensemble calling approach, ArCCH, validated with in-silico tumor dilutions and blinded technical replicates, which had high accuracy for variant allele frequencies (VAFs) as low as 0.1%. We estimated hazard ratios (HRs) with 95% confidence intervals (CIs) in proportional hazards regression with Prentice case-cohort weights. Results: In a random sample of 968 men initially free of prostate cancer and cardiovascular disease (median age at blood draw 60 years, interquartile range 52 to 67), 80% of men had CH at a variant allele frequency (VAF) of >0.1%, 15% had VAFs >2%, and 3% had VAFs >10%; 75% of men had variants in epigenetic modifier genes (DNMT3A, TET2, ASXL1), and 21% had variants in DNA repair genes (PPM1D, TP53, CHEK2). CH burden was strongly age-associated, with approximately one additional CH variant per decade of age at blood draw (mean difference 1.07 variants, 95% CI 0.93 to 1.21). Among men initially free from prostate cancer, after adjusting for age at blood draw, CH clones between 0.1% and 10% VAF were not related to lethal prostate cancer (206 events total; HR 0.93, 95% CI 0.49-1.76 for VAFs 2-10% vs. no variants detected at >0.1% VAF). Results for epigenetic modifiers and DNA repair genes were similar. While inconclusive, data were compatible with positive associations among younger men (< 65 years) or for VAFs >10%. Among men initially diagnosed with non-metastatic prostate cancer, results were similarly null for progression to lethal prostate cancer (164 events). Conclusions: This large prospective study with long-term follow-up suggests that low-level CH is unlikely a major contributor to and not well suited for early detection of lethal prostate cancer. Citation Format: Konrad H. Stopsack, Irenaeus C. Chan, Evelyn Schmidt, Alex Panchot, Samantha McNulty, Nicole A. Schreiber, Yiwen Zhang, Kathryn L. Penney, Michael F. Berger, Luis A. Diaz, Ross L. Levine, Kelly L. Bolton, Lorelei A. Mucci, Philip W. Kantoff. Clonal hematopoiesis and risk of lethal prostate cancer: a prospective cohort study with long-term follow-up. [abstract]. In: Proceedings of the AACR Special Conference: Precision Prevention, Early Detection, and Interception of Cancer; 2022 Nov 17-19; Austin, TX. Philadelphia (PA): AACR; Can Prev Res 2023;16(1 Suppl): Abstract nr P011.

Gli stili APA, Harvard, Vancouver, ISO e altri

15

Bale, Swarna, Chulwoo J. Kim, Joan How, Mohammed Wazir, Lachelle D. Weeks, Maximilian Stahl, Marlise R. Luskin et al. "Mutations in the RNA Splicing Factors U2AF1 and SRSF2 are Context-Dependent in Myeloproliferative Neoplasms". Blood 142, Supplement 1 (28 novembre 2023): 1788. http://dx.doi.org/10.1182/blood-2023-178657.

Testo completo

Abstract (sommario):

RNA splicing factor gene mutations are recurrently found in BCR::ABL1 negative myeloproliferative neoplasms (MPN). To understand the interactions between spliceosome gene mutations and MPN phenotypic driver mutations ( JAK2, CALR and MPL), we investigated their patterns of co-occurrence or mutual exclusivity in a cohort of 990 MPN patients with comprehensive molecular profiling and clinical information from the Hematologic Malignancies Data Repository (HMDR). As expected, MPN driver mutations ( JAK2, CALR and MPL) were mutually exclusive (N=658, N=168, N=53 respectively, Log2 OR≤-3.5 and Padj. ≤0.005 using pairwise Fisher's exact tests with Benjamin Hochberg multiple testing correction). Additionally, cases with co-occurring mutations in two RNA splicing factors, SF3B1, U2AF1 and SRSF2 (N=44, N=49, N=44) respectively were uncommon (2/135 splicing factor mutated cases) . We further found that U2AF1 and SRSF2 mutations co-occurred with JAK2 (log2 OR=1.7, Padj.=0.009) and MPL (log2 OR=2.1, Padj.=0.006) respectively, but rarely with CALR mutations (N=2 CALR-U2AF1 log2 OR=-2.3 Padj.=0.025, N=2 CALR-SRSF2 log2 OR=-2.2 Padj.=0.048). In contrast, CALR-SF3B1 mutations occurred at the expected frequency (Padj.=0.11). To explore the molecular settings where these mutations co-occur, we investigated the variant allele frequencies (VAFs) of CALR, U2AF1, SRSF2 and concomitant mutations in the CALR-U2AF1 (N=2) and CALR-SRSF2 (N=2) patients. The VAFs for the mutations detected in the first patient with CALR-U2AF1 co-mutation were: CALR 0.26, U2AF1 0.45, and TET2 0.41. Since CALR and splicing factor mutations are typically heterozygous, this suggests the CALR mutation was sub-clonal to the U2AF1 mutation and that U2AF1 and TET2 mutations were likely present in the same cell. In the second CALR-U2AF1 co-mutant case, VAFs were: CALR 0.31, U2AF1 0.27, and TP53 0.16. It is possible that in this case, the CALR and U2AF1 mutations may have occurred in independent clones or may have occurred in the same cell in the absence of other pathogenic mutations. For the two CALR-SRSF2 patients, data from three samples revealed VAFs of 0.23-0.46 for CALR and 0.21-0.58 for SRSF2 mutations. Considering their typical heterozygous occurrence, we inferred those individual cells harbored both CALR and SRSF2 mutations. Notably, in samples with high VAFs (>0.37) for both CALR and SRSF2 in two separate patients, additional high VAF pathogenic mutations were observed: 0.35 for ASXL1 and 0.46 for RUNX1 respectively. As ASXL1 and RUNX1 mutations also typically occur in a heterozygous manner, we hypothesized that when CALR and SRSF2 mutations are present in the same cell, another pathogenic co-mutation may be required for survival of the clone. To test our hypothesis, we FACS-sorted single lineage negative CD34 positive bone marrow cells from the first CALR- SRSF2 co-mutant case into 96 wells plates containing methylcellulose and hematopoietic growth factors (CFU-GEMM). DNA was harvested from single-cell colonies and genotyped for the following mutations using polymerase chain reaction (PCR) followed by gel electrophoresis and Sanger sequencing: CALR c.1154_1155insTTGTC p.K385fs*, SRSF2 c.284G>T p.P95H, ASXL1 c.1926_1927insG p.G642fs*, EZH2 c.2188_2212delAAAAAACAGCTCTTCGCCAGTCTGG p.F729fs*. Bulk NGS VAFs were 0.46, 0.38, 0.35, and 0.17, respectively. Out of 73 colonies analyzed, 71 colonies had the CALR insertion 5 mutation detected (see figure). Among these 71 CALR-mutated colonies, SRSF2 was found to co-occur in 35 colonies. Interestingly, all 35 colonies were accompanied by an ASXL1 mutation, and 29 of them had an additional EZH2 mutation. These findings support our hypothesis that CALR and SRSF2 mutations may co-occur in the same cell in the presence of another pathogenic mutation. Our findings offer molecular insights into the context-dependent behavior of splicing factor mutations in MPN. While they can co-occur with JAK2 and MPL mutations, U2AF1 and SRSF2 mutations are largely mutually exclusive with CALR mutations. In addition, our findings generate two main biological hypotheses: (i) a synthetic lethal relationship may exist between CALR mutations and SRSF2 or U2AF1 mutations, and (ii) this synthetic lethality may be overcome by the presence of additional pathogenic mutation(s) in the cell. Validation studies are ongoing to address these hypotheses. AM and AEM contributed equally.

Gli stili APA, Harvard, Vancouver, ISO e altri

16

Kaur, Pushpinder, Daniel Campo, Tania B. Porras, Alexander Ring, Janice Lu, Yvonne Chairez, Yunyun Su, Irene Kang e Julie E. Lang. "A Pilot Study for the Feasibility of Exome-Sequencing in Circulating Tumor Cells Versus Single Metastatic Biopsies in Breast Cancer". International Journal of Molecular Sciences 21, n. 14 (8 luglio 2020): 4826. http://dx.doi.org/10.3390/ijms21144826.

Testo completo

Abstract (sommario):

The comparison of the landscape of somatic alterations in circulating tumor cells (CTCs) versus metastases is challenging. Here, we comprehensively characterized the somatic landscape in bulk (amplified and non-amplified), spike-in breast cancer cells, CTCs, and metastases from breast cancer patients using whole-exome sequencing (WES). We determined the level of genomic concordance for somatic nucleotide variants (SNVs), copy number alterations (CNAs), and structural variants (SVs). The variant allele fractions (VAFs) of somatic variants were remarkably similar between amplified and non-amplified cell line samples as technical replicates. In clinical samples, a significant fraction of somatic variants had low VAFs in CTCs compared to metastases. The most frequently recurrent gene mutations in clinical samples were associated with an elevated C > T mutational signature. We found complex rearrangement patterns including intra- and inter-chromosomal rearrangements, singleton, and recurrent gene fusions, and tandem duplications. We observed high molecular discordance for somatic alterations between paired samples consistent with marked heterogeneity of the somatic landscape. The most prevalent copy number calls were focal deletion events in CTCs and metastases. Our results demonstrate the feasibility of an integrated workflow for the identification of a complete repertoire of somatic alterations and highlight the intrapatient genomic differences that occur between CTCs and metastases.

Gli stili APA, Harvard, Vancouver, ISO e altri

17

Cook, Elina K., Richard N. Armstrong, Eshita Sharma, Brooke Snetsinger, Jacqueline Boultwood, Rena Buckstein, Andrea Pellagatti e Michael J. Rauh. "RNA-Seq Analysis of Clonal Hematopoiesis (CHIP) Blood Leukocytes Shows Dysregulation of Neutrophil / Innate Immunity-Related Genes". Blood 132, Supplement 1 (29 novembre 2018): 3843. http://dx.doi.org/10.1182/blood-2018-99-116128.

Testo completo

Abstract (sommario):

Abstract BACKGROUND: Clonal hematopoiesis of indeterminate potential (CHIP) involves the peripheral blood (PB) expansion of progeny of a hematopoietic stem or progenitor cell that is somatically mutated in a hematological cancer-associated gene (most often TET2 or DNMT3A). CHIP associates with comorbid diseases of aging such as cardiovascular disease. Murine knockout (Tet2 or Dnmt3a) and engraftment models of CHIP develop exacerbated cardiovascular disease and their mutated myeloid cells are more reactive to inflammatory stimuli. However, whether blood leukocytes in human CHIP are hyper-inflammatory remains speculative. We recently found people with CHIP have higher serum levels of certain pro-inflammatory cytokines and chemokines than controls (Cook et al, ASH 2017). Thus, we hypothesized that PB effector cells in people with CHIP will be enriched for pro-inflammatory gene expression and pathways. METHODS: The presence of CHIP (variant allele frequency, VAF>0.02) was determined in the whole PB of 30 hematologically healthy adults >65 years old at Baycrest and Sunnybrook Health Sciences Centers (Toronto, Canada) using Ion Proton DNA sequencing targeting 48 commonly mutated genes in myeloid neoplasms. RNA-Seq (HISeq 4000, Illumina, 75bp paired-end sequencing reads with a depth of >50 million/sample) was performed on corresponding ribo-depleted whole PB samples (PAXgene), reads were aligned with HISAT2, gene counts quantified with featureCount, and analyzed with DESeq2. FDR<0.1 was used as a cutoff for differential gene expression analyses. Correlations with clinical and comorbidity data were tested with logistic regressions. RESULTS: People with CHIP ("CHIP+", n: males=8, females=13; TET2=12, DNMT3A=8, SF3B1=1; VAF range=0.03-0.40) compared to those without CHIP ("CHIP-", n: males=3, females=6) had six significantly downregulated genes (e.g. GZMM) and 10 upregulated genes (e.g. DEFA4, LTF, MPO, see Figure 1A). Hierarchical clustering of these top genes yielded two groups, one consisting of most of the CHIP- cases (8/9 cases, in a cluster of 11, see Figure 1A). The three CHIP+ cases that clustered with CHIP- had VAFs lower than 0.15. Of the 16 differentially regulated genes between CHIP+ and CHIP-, nine were recognized by reactome, and most overlapped (≥6 genes) with pathways involving neutrophil degranulation and innate immunity (Figure 1B). DEFA4, LTF, CRISP3, BPI and MPO specifically encode components of neutrophil granules, with various anti-microbial and homeostatic functions. However, mean neutrophil counts (4.6±1.6 vs. 4.4±1.6 10^9/L for CHIP+ vs. CHIP-) and neutrophil to lymphocyte ratios (3.2±1.4 vs. 2.8±2.1 in CHIP+ vs. CHIP-) did not significantly differ between the groups. This suggests that mutations of CHIP may affect neutrophil/immune-related function or phenotype, potentially contributing to comorbid disease. For example, greater expression of alpha-defensins (i.e. DEFA4) in CHIP may involve dysregulated granulocyte maturation and inflammatory function as seen in myelodysplasia (Droin et al, 2010 Blood), suggesting a potential dysregulation of inflammation and immunity. Higher VAFs (>0.15) associated with higher ECOG scores (poorer overall daily functioning: odds ratio=44, 95% CI=4-500, p=0.002), suggesting that larger proportions of mutated cells may have greater effects on gene expression profiles. Accordingly, there were linear correlations between the VAFs of the mutated cell populations and the levels of differentially expressed genes (Figure 1C). CONCLUSIONS: The connection between mutant clones of CHIP and disease remains poorly elucidated. For the first time, to our knowledge, we studied gene expression in CHIP leukocytes. We report that the most prominent gene expression differences between people with CHIP and those without CHIP involve neutrophil degranulation and the innate immune system. Additionally, higher VAFs may have a greater influence on gene expression levels and health than lower VAFs. We plan to validate these candidate genes in a larger cohort. These novel data warrant further investigation of the cellular pathways perturbed by somatic mutations of CHIP. Disclosures Buckstein: Celgene: Honoraria, Membership on an entity's Board of Directors or advisory committees, Research Funding.

Gli stili APA, Harvard, Vancouver, ISO e altri

18

Koebley, Sean, Andrey Mikheikin, Kevin Leslie, Wendy McConnell-Wells, Joshua H. Lehman, Daniel Guest, Taha Al Juhaishi et al. "FLT3 Internal Tandem Duplication Quantitation and Length Analysis By Digital PCR Paired with High-Speed AFM". Blood 136, Supplement 1 (5 novembre 2020): 21–22. http://dx.doi.org/10.1182/blood-2020-137096.

Testo completo

Abstract (sommario):

Introduction DNA length polymorphisms are difficult to diagnose due to their repetitive or variable elements. Within the FLT3 gene, internal tandem duplications (ITDs) range from <30 bp to >200 bp in length and are associated with poor prognosis in acute myeloid leukemia (AML). To address these challenges, we developed digital polymerase chain reaction (dPCR) followed by high-speed atomic force microscopy (HSAFM) as a high-throughput, single-molecule approach for quantifying and sizing length polymorphisms associated with FLT3-ITDs. Methods In the first step of our approach, dPCR (Fig. 1A), a mixed sample is diluted and partitioned into micro-reactions that are individually amplified, mitigating amplification bias and producing homogeneous solutions of either wild-type (WT) or FLT3-ITD variant amplicons. We then used HSAFM to directly image individual amplicons and determine their lengths with nanoscale resolution (Fig. 1B). Length distributions were analyzed by Bayesian inference to identify their most likely character-WT or variant-by determining whether or not the 95% most credible range of mean lengths for each micro-reaction fell within a region of practical equivalence (ROPE) to WT length (Fig. 1C). Variant allele frequency (VAF) was then calculated as the proportion of variant-identified micro-reactions (Fig. 1D). We tested (a) synthetic and cell line DNA ranging from 30 bp to 217 bp, with VAF titrated down to 5%, and (b) clinical FLT3-ITD positive and negative samples, and compared dPCR-HSAFM results to those of a widespread clinical assay (Invivoscribe Leukostrat CDx FLT3 Mutation Assay). Results dPCR-HSAFM successfully returned the VAFs of all spiked-in FLT3-ITD samples across the admixture range of 5%-100%, and WT-only controls yielded VAFs of 0% (Fig. 1C,D). The four tested clinical samples determined as FLT3-ITD positive by the standard assay returned VAFs of 49%, 16%, 26%, and 61% by dPCR-HSAFM, while the two FLT3-ITD negative clinical samples returned VAFs of 6% and <1% (Fig. 1C). Mean variant length of control and clinical samples measured by dPCR-HSAFM agreed with the known lengths as reported by the Leukostrat assay or given by cell line documentation (Fig. 1C, horizontal lines). Conclusions By demonstrating accurate quantification and sizing of FLT3-ITD variants of clinically relevant size and VAF, dPCR-HSAFM supersedes the standard clinical assay, which does not report VAF. Since FLT3-ITD length and VAF are linked to AML outcome and are important for minimal residual disease following therapy, a test that provides both metrics is desirable. Furthermore, the speed, low cost, and flexibility of dPCR-HSAFM to detect long, repetitive insertions make it an attractive alternative to sequencing in the clinical diagnosis of FLT3-ITDs and other length polymorphisms. Figure 1. dCR-HSAFM technique and results. (A) Digital PCR of a mixed sample yields a homogeneous population of WT (blue) or variant FLT3-ITD (red) amplicons in each micro-reaction. (B) HSAFM images of DNA are traced with custom software to yield lengths of individual DNA molecules. (C) Length is used to classify each dPCR reaction as WT or variant, where each vertical line gives the 95% most credible range of mean length for a dPCR reaction and italicized numbers give the number of dPCR reactions for each sample. The four leftmost clinical samples were identified as FLT3-ITD positive by a standard clinical assay, while the two rightmost clinical samples were FLT3-ITD negative. The assay does not report VAF. (D) Spiked-in VAF v. detected VAF is shown for FLT3-ITD samples with 30 bp and 126 bp insertions, with spiked-in VAF ranging from 5%-100%. Vertical bars give the VAFs for ROPEs ± 10% of the initial ROPE width, which conveys the sensitivity of each VAF to the ROPE width. Figure 1 Disclosures No relevant conflicts of interest to declare.

Gli stili APA, Harvard, Vancouver, ISO e altri

19

Li, Wenjun, Shaoheng Liang, Hannah Roberts, Long Dao, Alessandro Pinto, David Zhang e Yalei Wu. "Massively multiplex blocker displacement amplification (BDA) for the detection of measurable residual disease in acute myeloid leukemia." Journal of Clinical Oncology 41, n. 16_suppl (1 giugno 2023): e19045-e19045. http://dx.doi.org/10.1200/jco.2023.41.16_suppl.e19045.

Testo completo

Abstract (sommario):

e19045 Background: Next-generation sequencing (NGS) technologies, used to accomplish high throughput characterization of DNA, have an inherent error rate of between 0.1-1%. However, many important DNA sequences possess variant allele frequencies (VAFs) below this rate, potentially precluding their detection and identification by NGS. The previously published blocker displacement amplification (BDA) research technology has enabled selective amplification of sequences with variants, facilitating detection by NGS of these sequences with low VAFs at low read depths. Methods: Here we present the massively multiplex BDA library preparation method for the NGS-based detection of low VAF sequences. By optimizing our previously published Simulated Annealing Design using Dimer Likelihood Estimation (SADDLE) algorithm, we designed a 4 tube assay, comprising up to ~2400 amplicons in each tube, and ~8300 total amplicons. Tube 1 was designed with the highest likelihood of on-target amplification and the lowest likelihood of dimerization or non-specific amplification. While Tube 1 targeted ~1000 regions covering the most-frequently observed mutations in current public databases of patients with acute myeloid leukemia (AML) across more than 200 genes, Tubes 2-4 were designed for enrichment of the full coding sequence of 63 genes. To highlight the performances of SADDLE, coverage uniformity, primer dimerization, and non-specific amplification of tube 1 were compared to those of a naively designed tube. The panel was further tested with contrived and reference samples to demonstrate its analytical performance. Results: The SADDLE algorithm design decreased the first pass amplicon dropout rate more than 10-fold, from 30% to ~2%, and further improved the overall on-target rate compared to the naively designed panel. Through SADDLE, we were able to achieve an 80% median coverage of 63 genes. The resulting panel has a bulk limit of detection (LoD) of below 0.1% VAF. Conclusions: Massively multiplex BDA enabled the NGS characterization of DNA targets with VAFs suitable for detection of AML measurable residual disease (MRD). This technology represents a 100-fold increase in current plexity for the detection of low VAF alleles over our previously published multiplex BDA technology, demonstrating the ability to perform high throughput sequencing of rare mutations.

Gli stili APA, Harvard, Vancouver, ISO e altri

20

Cho, Yong Gon, Joonhong Park, Ji Yoon Han e Tae Yun Kim. "Evaluation of the Analytical Performance of Oncomine Lung cfDNA Assay for Detection of Plasma EGFR Mutations". Genes 14, n. 6 (2 giugno 2023): 1219. http://dx.doi.org/10.3390/genes14061219.

Testo completo

Abstract (sommario):

Background: The clinical utility of circulating tumor DNA (ctDNA) in the early detection of tumor mutations for targeted therapy and the monitoring of tumor recurrence has been reported. However, the analytical validation of ctDNA assays is required for clinical application. Methods: This study evaluated the analytical performance of the Oncomine Lung cfDNA Assay compared with the cobas® EGFR Mutation Test v2. The analytical specificity and sensitivity were estimated using commercially pre-certified reference materials. The comparative evaluation of the two assays was carried out using reference materials and plasma derived from patients diagnosed with lung cancer. Results: Using 20 ng of input cell-free DNA (cfDNA), the analytical sensitivities for EGFR mutations with variant allele frequencies (VAFs) of 1% and 0.1% were 100% and 100%, respectively. With VAFs of 1.2% and 0.1% using 20 ng of input cfDNA, seven out of nine different mutations in six driver genes were identified in the Oncomine Lung cfDNA Assay. The two assays showed 100% concordance in 16 plasma samples clinically. Furthermore, various PIK3CA and/or TP53 mutations were identified only in the Oncomine Lung cfDNA Assay. Conclusions: The Oncomine Lung cfDNA Assay can be used to identify plasma EGFR mutations in patients with lung cancer, although further large-scale studies are required to evaluate the analytical validity for other types of aberrations and genes using clinical samples.

Gli stili APA, Harvard, Vancouver, ISO e altri

21

Gomez, Felicia, Matthew Matlock, Kilannin Krysiak, Yi-Shan Lee, Eric J. Duncavage, Michelle O'Laughlin, Malachi Griffith, Todd A. Fehniger, Lukas D. Wartman e Obi L. Griffith. "Exome Sequencing of Hodgkin's and Non-Hodgkin Composite Lymphomas Identifies Shared Somatic Mutations Indicative of Common Founding Precursors". Blood 128, n. 22 (2 dicembre 2016): 5285. http://dx.doi.org/10.1182/blood.v128.22.5285.5285.

Testo completo

Abstract (sommario):

Abstract Background: Composite lymphomas (CLs) describe the rare situation when two morphologically distinct lymphomas occur in the same patient. Prior studies have supported a shared origin of CLs based on shared chromosomal translocations and/or the presence of shared immunoglobulin rearrangements. We used exome sequencing to examine somatic events in two cases of CLs. We hypothesized that each lymphoma will have shared and unique mutations, consistent with the presence of a common lymphoma precursor. Further, we postulated that the shared mutations represent potential initiating events in lymphomagenesis. Finally, because each case includes a Hodgkin (HL) and non-Hodgkin lymphoma (NHL), we hypothesize that the somatic mutations found in HL may offer insight into genomic drivers of HL. Clinical Synopsis:Case 1 was a 57-year-old man who presented with abdominal pain associated with a small bowel obstruction (SBO) and lymphadenopathy (LAD). Pathology showed DLBCL (diffuse large B-cell lymphoma, non-germinal center subtype; stage IV). He was treated with 6 cycles of R-CHOP with complete response. Seven months after the completion of R-CHOP, he presented with left neck LAD. An excisional biopsy revealed classical HL (stage II). Hodgkin and Reed-Sternberg (HRS) cells comprised 10% of the sample. He was treated with 3 cycles of ABVD and involved-field radiation therapy. Case 2 was a 66-year-old man with a history of solitary LAD who presented with increasing LAD, night sweats, and a chest wall mass. An excisional biopsy revealed both follicular lymphoma (FL; grade I-II) and classical HL in distinct areas of the lymph node. HRS cells comprised 30% of the sample. FISH studies were positive for t(14;18). He was treated with ABVD for 6 cycles with partial response. Upon progression, a repeat lymph node biopsy showed persistent HL. He was treated with bendamustine and rituximab for 4 cycles with progressive disease. Methods: We performed whole exome sequencing on formalin fixed paraffin embedded tumor samples and matched normal skin samples. We used our standard somatic variant calling pipeline to call somatic variants. SNV (single nucleotide variant) and indel calls were filtered for basic quality metrics and, using in-house software, were processed through a Bayesian classifier to remove false positive somatic events. Filtered variants were manually reviewed to further verify somatic status. Somatic variants were validated using Ampliseq in Case 1. Results: Sequencing resulted in >90% of the target regions with at least 20x in all samples. The mean depth of the NHL and normal samples in Case 1 was >65x. To account for the low malignant tumor cellularity of HL, the HL sample of Case 1 was sequenced to a mean depth of 310x. The mean depth for all samples in Case 2 was >100x (FL = 188x; normal = 104x; HL = 215x). After filtering, we identified 60 and 133 variants in 57 and 101 genes in Case 1 and Case 2, respectively. In Case 1, we identified three sites inTP53, TNFRSF14, and RASAL2 that were shared. We also identified variants in HIST1H2AG, KMT2D, and STAT3 unique to the DLBCL sample, and two mutations in PTPRT unique to the HL sample of Case 1 (Figure 1). In Case 2, we identified shared variants in TNFRSF14 and HIST1H2BF. We also identified two distinct BCL10 mutations in the FL and HL samples of Case 2 (Figure 1). Conclusions: From the shared somatic mutations identified, we infer that a shared lymphoma precursor for each case is likely, and the shared mutations may be early initiating events. In both cases, a shared nonsense mutation was found at TNFRSF14. TNFRSF14 is recurrently mutated in NHL, and recurrent deletions involving TNFRSF14 have been described in HL. Further work is needed to understand how TNFRSF14 alterations drive HL vs. NHL. Finally, it is intriguing that the HL samples contain independent mutations in PTPRT and BCL10. PTPRT is a known cancer gene, and BCL10 has been shown to be associated with the pathogenesis of B-cell NHLs. These data provide new hypotheses for loci involved in HL pathogenesis. Figure 1 Variant allele frequencies (VAFs) in CL samples from Case 1 (A) and Case 2 (B). (A) shows the VAFs of confirmed variants in the DLBCL vs. HL. (B) shows VAFs of FL vs. HL. Variants of note are highlighted in black. The lack of separation of sites in Case 2 may be the result of some admixture of the two lymphomas, which were sequenced from cores taken from the same lymph node. Figure 1. Variant allele frequencies (VAFs) in CL samples from Case 1 (A) and Case 2 (B). (A) shows the VAFs of confirmed variants in the DLBCL vs. HL. (B) shows VAFs of FL vs. HL. Variants of note are highlighted in black. The lack of separation of sites in Case 2 may be the result of some admixture of the two lymphomas, which were sequenced from cores taken from the same lymph node. Disclosures No relevant conflicts of interest to declare.

Gli stili APA, Harvard, Vancouver, ISO e altri

22

Frick, Mareike, Christopher Maximilian Arends, Joel Galan-Sousa, Kaja Hoyer, Willy Chan, Marten Jäger, Kenichi Yoshida et al. "Clonal Hematopoiesis: Cell of Origin, Lineage Repartition and Dynamic Evolution during Chemotherapy". Blood 130, Suppl_1 (7 dicembre 2017): 632. http://dx.doi.org/10.1182/blood.v130.suppl_1.632.632.

Testo completo

Abstract (sommario):

Abstract Background: Clonal hematopoiesis of indeterminate potential (CHIP) is defined by the presence of hematologic cancer associated mutations in the peripheral blood (PB) of at least 10% of elderly people without history of hematologic disorders (Genovese et al ., NEJM, 2014; Jaiswal et al ., NEJM, 2014). At present, caution is needed when predicting clinical consequences from CHIP in healthy people. An essential step towards a better understanding of CHIP requires identification of the cell of origin, clonal expansion patterns within the hematopoietic differentiation tree, and its dynamic behavior under stress scenarios (e.g. chemotherapy). Methods: PB and bone marrow (BM) samples were collected from 437 donors ≥ 55 years without known hematologic disease including a sub-cohort of 72 patients with newly diagnosed non-hematologic cancer requiring chemotherapy. Whole blood DNA was screened for CHIP with a 54 gene panel. A total of 63 PB and 9 BM samples were flow-sorted and variant allele frequencies (VAFs) were quantified in the hematopoietic fractions. In the cancer cohort, 32 clonal mutations were studied at 110 time points to investigate clonal dynamics under chemotherapy. Results: We identified 168 confirmed variants in 121 patients. 34 patients (28.1%) had 2 or more mutations (Fig. 1A). Presence of ≥ 2 mutations was significantly associated with peripheral artery disease (P=.002), diabetes (P=.04), and hyperlipoproteinaemia (P= .047). The most frequent combination was DNMT3A / TET2 (n=10) followed by DNMT3A/DNMT3A and TET2/TET2 in four cases each. TET2 mutations were significantly associated with DNMT3A (P=.015) and ASXL1 (P=.046) (Fig. 1B). Allelic burden of 91 mutations in 63 patients was determined in CD34+ progenitors, monocytes, granulocytes, NK-, B-, and T-cells (median VAFs: 5.1%, 7.1%, 6.3%, 6.0%, 1.9%, and 0.5%). B- and T-cells showed significantly lower VAFs when compared to WB or any other sorted cell fraction (P <.001 for each comparison). NK-cells showed significantly higher VAFs than T- and B-cells (P <.001), reaching comparable VAFs of myeloid cell fractions (Fig. 1C). Next, we compared mutation-specific effects on allelic burden within the cellular subfractions for DNMT3A, TET2, ASXL1, SF3B1, and TP53. No differences were observed except for a higher VAF in T-cells of DNMT3A -mutated individuals compared to other CHIP positive patients (P <.001), indicating an involvement of very early hematopoietic stem cells (HSCs). Next, we tracked individual mutations in flow-sorted stem and precursor cells in the BM of 9 CHIP patients (example in Fig. 1D). In all cases, we were able to identify the mutation in the Lin-CD34+CD38- HSC fraction. Although mutations showed different expansion profiles [expansion ratio (ER)=VAF(monocytes)/VAF(HSCs) or ER=VAF(granulocytes)/VAF(HSCs)], the biggest expansion proportion always occurred in the stem cell compartment indicative for early clonal dominance. In patients with more than one clonal mutation, the repartition of patient specific mutations showed similar patterns in most cases, suggesting that mutations were acquired within one clone. However, in some cases differential outgrowth of mutations was observed, indicating oligoclonality (examples in Fig. 1E). In the cancer cohort, CHIP was significantly associated with chemotherapy dose reduction due to hematotoxicity (P=.028). When following 32 mutations at 110 time points, we observed 3 different patterns of VAF dynamics: 1) increasing, 2) decreasing, and 3) no major changes (example for each in Fig. 1F). We categorized the 3 groups by defining a VAF change of at least +/- 50 % in ≥ 2 time points as cut-off. Only one of the 13 DNMT3A mutations showed VAF dynamics (1/13=7.7%), in the remaining 19 clonal mutations other than DNMT3A, VAF dynamics were observed in 13 clones (68.4% vs. 7.7%; P <.001). When excluding the 7 solely DNMT3A- mutated cases, we observed significantly lower hemoglobin levels prior to cycles 5 and 7 (P=.049 and P=.02) and an elevated red cell transfusion necessity (P=.013). Conclusion: CHIP derives from somatic mutations in Lin-CD34+CD38- HSCs and leads to preferential expansion in myeloid and NK-cell fractions. Clonal dynamics during chemotherapy lead to higher rates of red blood cell transfusions and dose reductions. Larger prospective studies in homogenously treated cancer patients are now warranted to verify the impact of CHIP during chemotherapy applications. Figure 1 Figure 1. Disclosures No relevant conflicts of interest to declare.

Gli stili APA, Harvard, Vancouver, ISO e altri

23

Hecker, Judith S., Luise Hartmann, Maja Rothenberg-Thurley, Jennifer Rivière, Bianka Ksienzyk, Michele C. Buck, Mark Van Der Garde et al. "Characterization of Somatic Mosaicism and Mutational Profiling of Clonal Hematopoiesis Compared to MDS and sAML Depicts Diversities of Clonal Evolution". Blood 138, Supplement 1 (5 novembre 2021): 3278. http://dx.doi.org/10.1182/blood-2021-152187.

Testo completo

Abstract (sommario):

Abstract Background: Clonal hematopoiesis (CH) describes the presence of genetic alterations and expansion of clonal cell populations in the peripheral blood (PB) of individuals without clinical manifestation of a hematologic malignancy. CH is a common, age-related state. However, individuals carrying CH are at greater risk for hematologic cancer. It has been shown that presence of TP53- and other high-risk mutations, variant allele frequency (VAF) >10% or multiple mutations in CH carriers may confer a higher risk of preleukemic development and transformation to myelodysplastic syndrome (MDS) or acute myeloid leukemia (AML). Nevertheless, further insights into the role of CH in clonal evolution towards leukemia and elaborating features that are predictive of leukemic progression are needed. Aims: We have recently shown that CH is common in individuals undergoing hip replacement surgery (Hecker, Hartmann et al., Blood 2021). Here, we compared mutational spectrum in these CH individuals to MDS and secondary AML (sAML) cohorts. Additionally, we analyzed spatial and lineage distribution of CH and longitudinally monitored CH and MDS clones over time. Methods: Samples from individuals without known hematologic disease undergoing hip replacement surgery (n=288 samples from 261 individuals), patients with MDS (n=92) or sAML (n=123) were screened for variants in 68 leukemia-associated genes using a targeted sequencing approach (VAF cut off, 1%). Follow-up (FU) PB samples were available for 21 individuals with CH and 16 untreated low-risk MDS patients, 6-24 months after screening. n=5 CH bone marrow (BM) samples carrying six ASXL1-mutations were sorted for seven different cell fractions. Results: At screening, variants were detected in 127/261 (49%) healthy individuals, 84/92 (91%) MDS and 117/123 (95%) sAML patients, with median VAFs of 2.7% (ranging from 1-44%), 18.8% (1.1-87%) and 37.1% (1-99%), respectively. Individuals with CH had a median number of 1 variant per individual, whereas median detected variants per patient increased with clonal evolution with 3 variants in the MDS and 4 variants per patient in the sAML cohort. CH, MDS and sAML showed entity-specific mutation profiles (Figure 1A). Most variants in CH affected epigenetic modifiers, while mutations in splicing factors, signaling pathways and transcription factors increased with clonal progression. During FU, untreated low-risk MDS patients more frequently gained additional mutations compared to CH individuals (7/16 vs 2/21, respectively; p=0.024). However, we did not observe significant changes in clone sizes over time. In 17 hip replacement individuals both femoral heads were removed simultaneously, allowing paired analysis of two different hematopoietic sites. CH prevalence in this subgroup was 70.6% (12/17). Ten individuals showed identical mutation patterns in BM obtained from the right and left femoral head, with little differences in VAFs (Table 1). In contrast, two other individuals showed significant differences in variant detection comparing one to the other side: ASXL1-mutations were only present in one hip sample, whereas all the other variants were detectable in both sides (p<0.001), indicating possible spatial heterogeneity of CH clones in the BM compartment. To further characterize ASXL1 mosaicism across hematopoietic lineages and differentiation stages, we sorted and sequenced n=5 CH BM samples carrying six ASXL1-mutations for seven different hematopoietic cell fractions. In all cases ASXL1-mutations were identified in CD34 +CD38 -CD90 + hematopoietic stem cells (HSC). VAFs of ASXL1-mutations were differentially distributed (p=0.0049, Kruskal Wallis test): detected VAFs were significantly higher in HSC and common myeloid progenitors (CMP) compared to VAFs in T-cells (p=0.045 and p=0.011, respectively; Dunn´s multiple comparison test; Figure 1B). Conclusions: CH, MDS and sAML show characteristic mutation profiles that remained stable over a 6-24-month period. Gains of additional variants and clonal expansion associated with disease progression. Cellular distribution analysis of ASXL1 CH variants revealed characteristic repartition patterns within the hematopoietic differentiation tree. Additionally, differences in variant detection between cellular BM compartments indicates spatial heterogeneity of CH clones warranting further investigation. J.S.H. and L.H. contributed equally. Figure 1 Figure 1. Disclosures Platzbecker: Geron: Honoraria; Takeda: Honoraria; AbbVie: Honoraria; Celgene/BMS: Honoraria; Janssen: Honoraria; Novartis: Honoraria. Goetze: BMS/Celgene: Other: Advisory Board, Research Funding; Abbvie: Other: Advisory Board.

Gli stili APA, Harvard, Vancouver, ISO e altri

24

Amin, Nisar A., Erlene Kuizon Seymour, Peter Ulintz, Kamlai Saiya-Cork, Brian Parkin, Kerby Shedden e Sami N. Malek. "A Quantitative Analysis of Subclonal and Clonal Gene Mutations Occurring Pre- and Post-Therapy in 53 Cases of Chronic Lymphocytic Leukemia". Blood 126, n. 23 (3 dicembre 2015): 2909. http://dx.doi.org/10.1182/blood.v126.23.2909.2909.

Testo completo

Abstract (sommario):

Abstract Introduction: The landscape of gene mutations in CLL prior to therapy is well-characterized. Comparatively less is known about gene mutations and their frequency in CLL patients that have relapsed after potent chemo-immunotherapy. Further, despite knowledge of subclonal TP53 mutations that enrich and likely drive CLL relapse in a fraction of cases, a comprehensive profile of gene mutations and their variant allele frequencies (VAFs) and clonal dynamics before and after chemo-immunotherapy in CLL is lacking. Methods: We have procured paired pre-treatment and post-treatment samples from 53 CLL cases that had relapsed after chemo-immunotherapy and purified CLL CD19+ cells and CD3+ T-cells to purity with FACS. DNA from relapsed CLL was subjected to exome capture and whole exome sequencing (WES) at a mean coverage of 72-fold (range 52-102) and sequence data analyzed using three variant callers: MuTect v.1.1.4, Strelka v.1.0.13, and VarScan2 v.2.3.7. Somatically acquired gene mutations occurring in 2 or more rCLL cases were confirmed by Sanger sequencing in relapsed CLL samples and also re-sequenced in pre-treatment samples. Genes with mutation frequencies ≥5% in rCLL underwent custom gene panel-based deep coverage re-sequencing in paired pre-treatment and post-treatment samples. Analysis of deep re-sequencing data was done using the Broad GATK HaplotypeCaller v3.3.0 in parallel with VarScan2. Selected low-level variants were measured using droplet digital PCR (ddPCR) that was adapted to detection of VAFs as low as 1/10,000. Results: In CLL relapsed from potent chemo-immunotherapy, we detected mutated TP53, NOTCH1, SF3B1, XPO1, BIRC3, MYD88, NXF1, POT1, CACNA1E, CHD2, EGR2, FAM50A, FAT3, FBXW7, MGA, SAMHD1 and ZMYM3 with frequencies ≥5%. An additional 64 genes were mutated in 2/53 rCLL cases each. We performed ultra-deep panel-based re-sequencing of the 17 genes with frequencies ≥5% in 53 paired diagnosis and relapse samples, complementing selected variants with ddPCR validation to determine VAFs. TP53 mutations constituted the most frequently enriched gene at relapse (7/53=13%) and the VAFs of all TP53 mutations substantially increased at relapse often from very minor subclones at diagnosis. Importantly, none of the clonal TP53 mutations in rCLL appeared directly induced by chemotherapy, but instead all were selected from pre-existing subclones. Similarly, subclonal mutations in SAMHD1 substantially enriched in four cases at relapse (4/53=8%) suggesting a role in resistance to chemotherapy. The majority of NOTCH1 mutations (8/13) were already fully clonal at diagnosis without further enrichment at relapse. Three (3/13) subclonal NOTCH1 mutations substantially enriched at relapse, while two (2/13) clonal NOTCH1 mutations substantially decreased. The VAFs for SF3B1 mutations similarly demonstrated three patterns: i) clonal that remained clonal (4/10), ii) clonal that substantial declined and became subclonal at relapse (4/10), and, iii) subclonal that enriched but remained subclonal (2/10) at relapse. Of the 13 remaining genes, most demonstrated no consistent enrichment or depletion or remained subclonal at relapse. Of biological interest, the genes FBXW7, MYD88, NOTCH1, NXF1, ZMYM3, XPO1, SF3B1 and POT1, were often already fully clonal in the pre-treatment samples, suggesting an early role in CLL pathogenesis rather than a later role in the development of CLL relapse. Conclusion: In this large WES study focused on gene mutations in relapsed CLL paired with analysis of subclone dynamics using deep panel re-sequencing and ddPCR, we identify the genes TP53 and likely SAMHD1 as drivers of CLL relapse in 20% of cases. Multiple other genes previously implicated as CLL drivers did not consistently enrich at relapse. Further, a subset of the mutated genes was often already fully clonal pre-treatment; these genes likely serve an important role early in CLL pathogenesis that is independent of therapy. The majority of relapsed CLL in this cohort were not associated with the recurrent clonal emergence of known CLL driver mutations and based on the gene mutations frequencies reported here, much larger rCLL cohorts would need analysis to confirm possible additional low frequency gene drivers of rCLL. Disclosures Malek: Gilead Sciences: Equity Ownership; Abbvie: Equity Ownership; Janssen Pharmaceuticals: Research Funding.

Gli stili APA, Harvard, Vancouver, ISO e altri

25

Kuziora, Michael, Brandon W. Higgs, Philip Z. Brohawn, Rajiv Raja, Carlos Bais e Koustubh Ranade. "Association of early reduction in circulating tumor DNA (ctDNA) with improved progression-free survival (PFS) and overall survival (OS) of patients (pts) with urothelial bladder cancer (UBC) treated with durvalumab (D)." Journal of Clinical Oncology 35, n. 15_suppl (20 maggio 2017): 11538. http://dx.doi.org/10.1200/jco.2017.35.15_suppl.11538.

Testo completo

Abstract (sommario):

11538 Background: Mutation variant allele frequencies (VAFs) in ctDNA indicate the frequency of cancer clones harboring the specific variant in the primary lesion and metastases, thus providing a surrogate for tumor burden. We previously reported that early reduction in VAF in ctDNA was associated with improved survival on durvalumab in NSCLC subjects. Here we replicated this association in UBC pts treated with durvalumab. Methods: CP1108/NCT01693562 was a nonrandomized phase 1/2 trial evaluating D in pts with advanced UBC or other solid tumors. By 24OCT2016, 103 UBC pts received 10 mg/kg Q2W of D with median 8.4 mos follow up. A panel of 70 genes was assayed for DNA variants using the Guardant360 cancer panel in plasma ctDNA from 33 UBC pts pre-treatment and 29 pts pre and 6 wks on-treatment. The mean VAF pre or on treatment of patient single nucleotide variants (SNVs) and insertion/deletions was correlated with clinical outcomes. Objective response rate (ORR) was calculated according to RECIST v1.1 and a Cox proportional hazard ratio (HR) was calculated adjusting for baseline ECOG, sex, age, and smoking status. Results: Complete and partial responders (CR/PRs) showed a significant decrease (Δ = -2.4%, p = 0.02) in ctDNA mean VAF post-treatment with D (i.e. reduction in tumor burden) compared to an increase in mean VAF (i.e. increase in tumor burden) in progressive disease (PD) pts (Δ = +2.7%, p = 0.31). This correlation was also observed in total mutation count in CR/PR (Δ = -4.6, p = 0.003) compared to PD pts (Δ = +2.8, p = 0.44). Pts with a decrease in ctDNA VAF at week 6 had longer median PFS (9.3 mos, 95%CI = [3.0, not reached(NR)] and OS (median NR, 95% CI = [20.3,NR]) compared to those with an increase in VAF (median PFS = 1.4 mos, 95%CI = [1.3,NR];HR = 0.29; p = 0.05 and median OS = 8.2 mos, 95% CI = [2.3,NR]; HR = 0.12; adjusted p = 0.04). DCR was 85%/14% for pts with a decrease/increase in VAF (p = 0.002). Conclusions: CtDNA VAFs were reduced in responders but not non-responders after six wks of D. A decrease in VAFs 6 wks following treatment with D correlated with longer PFS and OS, suggesting utility as an early indicator of clinical benefit. Clinical trial information: NCT01693562.

Gli stili APA, Harvard, Vancouver, ISO e altri

26

Zilberg, Catherine, Matthew Weicai Lee, Spiridoula Kraitsek, Bruce Ashford, Marie Ranson, Kerwin Shannon, N. Gopalakrishna Iyer et al. "Is high-risk cutaneous squamous cell carcinoma of the head and neck a suitable candidate for current targeted therapies?" Journal of Clinical Pathology 73, n. 1 (12 luglio 2019): 17–22. http://dx.doi.org/10.1136/jclinpath-2019-206038.

Testo completo

Abstract (sommario):

ObjectiveCutaneous squamous cell carcinoma (cSCC) is the second most common malignancy, most frequently affecting the head and neck. Treatment often requires surgery and can have significant functional morbidity. Research into disease pathogenesis and second line medical management of cSCC is limited. We assess genetic mutations in high-risk, primary head and neck cutaneous squamous cell carcinomas (HNcSCC) that may hinder or be beneficial for use of targeted therapy in disease management.MethodsGenetic alterations and variant allele frequencies (VAFs) were analysed using a clinically relevant 48 gene panel in 10 primary high-risk non-metastatic treatment-naïve HNcSCC to evaluate applicability of targeted therapeutics. Variants present at all VAFs were evaluated for pathogenicity. Somatic mutation patterns of individual tumours were analysed.ResultsHigh-risk HNcSCC showed a high proportion (82%) of C to T transitions in keeping with ultraviolet-mediated damage. There was significant intratumour genetic heterogeneity in this cohort (MATH scores 20–89) with the two patients <45 years of age showing highest intratumour heterogeneity. TP53 was altered at VAF >22% in all cases, and mutations with highest VAF were observed in tumour suppressor genes in 80%. 70% of cases demonstrated at least one mutation associated with treatment resistance (KIT S821F, KIT T670I, RAS mutations at codons 12 and 13).ConclusionWe demonstrate high proportion tumour suppressor loss of function mutations, high intratumour genetic heterogeneity, and presence of well recognised resistance mutations in treatment naïve primary HNcSCC. These factors pose challenges for successful utilisation of targeted therapies.

Gli stili APA, Harvard, Vancouver, ISO e altri

27

Gallì, Anna, Gabriele Todisco, Eulalia Catamo, Cinzia Sala, Chiara Elena, Sara Pozzi, Elisa Bono et al. "Relationship between clone metrics and clinical outcome in clonal cytopenia". Blood 138, n. 11 (13 luglio 2021): 965–76. http://dx.doi.org/10.1182/blood.2021011323.

Testo completo

Abstract (sommario):

Abstract Clonal cytopenia of undetermined significance (CCUS) is associated with an increased risk of developing a myeloid neoplasm with myelodysplasia (MN). To identify the features of the mutant clone(s) that is associated with clinical phenotype and progression, we studied the following cohorts of individuals: 311 patients with idiopathic cytopenia of undetermined significance (ICUS), 532 community-dwelling individuals without hematologic phenotype (n = 355) or with unexplained anemia (n = 177), and 592 patients with overt MN. Ninety-two of 311 (30%) patients with ICUS carried a somatic genetic lesion that signaled CCUS. Clonal hematopoiesis (CH) was detected in 19.7% and 27.7% of nonanemic and anemic community-dwelling individuals, respectively. Different mutation patterns and variant allele frequencies (VAFs) (clone metrics parameters) were observed in the conditions studied. Recurrent mutation patterns exhibited different VAFs associated with marrow dysplasia (0.17-0.48), indicating variable clinical expressivity of mutant clones. Unsupervised clustering analysis based on mutation profiles identified 2 major clusters, characterized by isolated DNMT3A mutations (CH-like cluster) or combinatorial mutation patterns (MN-like cluster), and showing different overall survival (HR, 1.8). In patients with CCUS, the 2 clusters had different risk of progression to MN (HR, 2.7). Within the MN-like cluster, distinct subsets with different risk of progression to MN were identified based on clone metrics. These findings unveil marked variability in the clinical expressivity of myeloid driver genes and underline the limitations of morphologic dysplasia for clinical staging of mutant hematopoietic clones. Clone metrics appears to be critical for informing clinical decision-making in patients with clonal cytopenia.

Gli stili APA, Harvard, Vancouver, ISO e altri

28

Mata, Douglas A., Mina L. Xu, Vignesh Shanmugam, Hanna Tukachinsky, Alexa Betzig Schrock, Jeffrey S. Ross, Erik Abraham Williams et al. "Liquid biopsy (LB)-based comprehensive genomic profiling (CGP) of circulating tumor DNA (ctDNA) for the evaluation of patients with myeloid neoplasms." Journal of Clinical Oncology 40, n. 16_suppl (1 giugno 2022): e19064-e19064. http://dx.doi.org/10.1200/jco.2022.40.16_suppl.e19064.

Testo completo

Abstract (sommario):

e19064 Background: LB-based CGP of ctDNA can facilitate the diagnosis, molecular profiling, and monitoring of patients with myeloid neoplasia, particularly when standard CGP is not feasible due to a lack of circulating disease or insufficient tumor in the marrow or tissue. Methods: Retrospective study of LB samples from patients reported to have histiocytic neoplasms (HNs), myelodysplastic syndrome (MDS), myeloproliferative neoplasms (MPN), or acute myeloid leukemia (AML) tested using hybrid-capture next-generation sequencing using the FoundationOne Liquid CDx (targeting 324 genes), FoundationOne Liquid (70 genes), or FoundationACT (62 genes) assays during routine clinical care between 5/2016 and 9/2021. Results: Among 48,459 unique patient samples submitted for CGP, 83 were from myeloid neoplasia: 34 HN, 23 MDS, 15 MPN, and 11 AML. The median cell-free DNA yield was 74.9 ng (interquartile range [IQR]: 52.0-167.4), well above the minimum needed for analysis. Reportable pathogenic alterations were detected in 62.7% (52/83) of cases. The median maximum somatic allele frequency (MSAF) was 17.0% (IQR: 1.7-49.0%), with AML (45.7%), MDS (25.9%), and MPN (43.8%) having higher median MSAFs than HNs (3.2%), not unexpected given that the former naturally circulate. In all, 147 pathogenic short variants and 6 pathogenic rearrangements were detected (median variant allele frequency [VAF]: 2.1%, IQR: 0.3-20.5%, range: 0.11-99.8%). Sixty-one had VAFs < 1.0%, indicating excellent sensitivity. HNs exhibited activating RAS-RAF-MEK pathway alterations in BRAF (31.3% of cases in which pathogenic alterations were identified), NF1 (12.5%), MAP2K1 (6.3%), and NRAS (6.3%), detected at VAFs as low as 0.21%, 0.13%, 0.11%, and 4.0%, respectively. AML cases exhibited pathogenic alterations in TP53 (57.1%), FLT3 (28.6%), IDH2 (28.6%), NPM1 (28.6%), KRAS (14.3%), and NRAS (14.3%), among others. Subclonal heterogeneity was identified, including an AML case with KRAS G12A and G13R and NRAS G12A mutations detected at VAFs of 0.24%, 0.19%, and 0.2%, respectively. Altered genes in patients undergoing workup for MDS or MPN included TP53 (41.4%), JAK2 (37.9%), DNMT3A (13.8%), CHEK2 (10.3%), PTPN11 (10.3%), SF3B1 (10.3%), TET2 (10.3%), ASXL1 (6.9%), MPL (3.5%), and U2AF1 (3.5%), among others. Last, among 48,243 patients with a LB for a solid tumor diagnosis, 3,487 JAK2 V617F, 366 CALR C-terminal truncation, and 343 MPL W515X mutations were detected, potentially indicating a concurrent or occult MPN. Conclusions: LB identified clinically relevant genomic alterations in myeloid neoplasia, offering a powerful tool that may be used pre- or post-treatment when CGP of the buffy coat, marrow, or tissue is infeasible. Given its low limit of detection, LB can also identify low-level emerging or persistent subclones, which may facilitate monitoring and minimal residual disease testing.

Gli stili APA, Harvard, Vancouver, ISO e altri

29

Kelley, Todd William, Ana-Luisa Silva, Rebecca Palmer, Ryan Evans, Iyelola Turner, Christina Xyrafaki, Justyna Mordaka et al. "Analytical performance assessment of ASPYRE-Lung: A new assay for rapid detection of actionable variants from tissue and plasma in NSCLC patients." Journal of Clinical Oncology 41, n. 16_suppl (1 giugno 2023): e15038-e15038. http://dx.doi.org/10.1200/jco.2023.41.16_suppl.e15038.

Testo completo

Abstract (sommario):

e15038 Background: We developed ASPYRE technology to make detection of genomic variants in oncology patients more accessible. Although ASPYRE is not traditional PCR, it can be performed using standard qPCR instruments on nucleic acid extracted from FFPE tissue or plasma and is therefore easily adoptable by clinical laboratories. Using ASPYRE, we designed a targeted panel called ASPYRE-LungTM consisting of 114 variants in 11 genes ( ALK, BRAF, EGFR, ERBB2, KRAS, RET, ROS1, MET & NTRK1/2/3) to inform the clinical management of patients with NSCLC. We have previously published general assay descriptions of ASPYRE-Lung (Silva et al., 2021, Scientific Reports and Gray et al., 2022, BMC Medical Genomics). Here we extend our prior studies with a detailed analytic performance assessment across all variants using precisely controlled synthetic samples. We determined assay-wide performance using samples with low variant allele fractions (VAFs) near the limit of detection (LoD) of the assay and compared results across 2 separate laboratory settings. Methods: Nine independent batches of reagents were split between 2 laboratories. Contrived test samples were prepared with known VAFs (DNA variants) or copy numbers (RNA variants). Each sample contained a single variant with VAFs of 0.1-0.5% for DNA variants, and 6-150 copies for RNA variants. Multiple replicates were performed at both testing sites using 20ng DNA/6ng RNA. Data was processed using an internally designed algorithm and analyzed using a machine learning classifier which determined the presence or absence of each individual variant. Results: Study data resulted in a total of 133,083 variant calls from 2,319 samples. For each variant at each VAF or copy number, the detection rate was calculated, and the results for each variant were used to calculate an LoD95 using probit regression. Target assay specifications and the assay-wide analytical performance data are shown in the table below. Conclusions: The data show that ASPYRE-Lung meets or exceeds target specifications for the detection of single nucleotide variants (SNVs), insertions/deletions (indels), and gene fusions. Estimates of LoD for key variants fall within target specifications, and assay-wide performance demonstrates highly sensitive detection of each class of variant. Performance was similar at the two laboratory sites further supporting the clinical potential of the assay. Moreover, the assay only requires 20ng DNA and as little as 6ng RNA, depending on sample type, so it is highly suitable for use with typical NSCLC patient samples such as needle core biopsies or plasma where available nucleic acid may be limited. This data supports further clinical development of ASPYRE-Lung. [Table: see text]

Gli stili APA, Harvard, Vancouver, ISO e altri

30

Wheeler, Rebecca, Catherine Terhaar e Mark Kruzel. "Observed germline BRCA1/2 and TP53 tumor genomic profiling allele frequencies." Journal of Clinical Oncology 42, n. 16_suppl (1 giugno 2024): e22533-e22533. http://dx.doi.org/10.1200/jco.2024.42.16_suppl.e22533.

Testo completo

Abstract (sommario):

e22533 Background: Tumor genomic profiling (TGP) is increasingly used to assist with cancer treatment planning. While these tests are not intended to find germline variants, they are a possible incidental outcome. Currently there are no clear guidelines on when to suspect if a somatic variant identified on TGP may need confirmatory germline genetic testing. Variant allele frequency (VAF) is one tool commonly used to assess if a variant may be germline. While some studies have demonstrated germline VAF ranges on TGP, the data is limited. The purpose of this study was to review VAF ranges of BRCA1/2 and TP53 variants at a large reference laboratory to better understand VAF ranges of confirmed germline variants. Methods: A retrospective review of test results from 184 patients who underwent TGP and hereditary cancer germline testing at a large reference laboratory was performed. Patients were included in the study if they had both TGP and germline testing performed, regardless of the order of testing. Results were analyzed to determine variants identified and VAF. Analysis of BRCA1/2 and TP53 variants included patients who had variants identified on TGP and had germline testing that would have confirmed the variants if present in the germline. The VAFs were obtained, and simple statistics were used to describe the findings. Results: Twenty-one patients were found to have 23 BRCA1/2 variants identified on TGP (2 patients had 2 BRCA1/2 TGP variants). Of these TGP variants, 16 were confirmed on germline testing (69.6%). The TGP VAF for these patients ranged from 38.2% to 85.1%. The mean was 61.0% and the median was 61.8%. The remaining 7 TGP variants that were not confirmed on germline testing ranged from 7.2% to 63.4%. The mean was 31.1% and the median was 28%. Thirty-eight patients were found to have 41 TP53 variants identified on TGP (3 patients had 2 TP53 TGP variants). Of these patients, 1 had a TP53 variant confirmed on germline testing with a VAF of 44.7%. The 40 remaining variants in this dataset were not confirmed on germline testing. The VAF for these 40 variants ranged from 1.3% to 95.3%. The mean was 38.4% and the median was 34.5%. Conclusions: In this study, 69.6% of BRCA1/2 TGP variants were confirmed on germline testing compared to 2.4% of TP53 TGP variants. Confirmed germline variants identified on TGP had VAFs that were > 38%. It’s important to note that TP53 variants may have very high VAFs (up to 95.3% in this study) and not be.

Gli stili APA, Harvard, Vancouver, ISO e altri

31

Kerlin, Meeta Prasad, William E. Trick, Deverick J. Anderson, Hilary M. Babcock, Ebbing Lautenbach, Renaud Gueret e Michael Klompas. "Interrater Reliability of Surveillance for Ventilator-Associated Events and Pneumonia". Infection Control & Hospital Epidemiology 38, n. 2 (8 novembre 2016): 172–78. http://dx.doi.org/10.1017/ice.2016.262.

Testo completo

Abstract (sommario):

OBJECTIVETo compare interrater reliabilities for ventilator-associated event (VAE) surveillance, traditional ventilator-associated pneumonia (VAP) surveillance, and clinical diagnosis of VAP by intensivists.DESIGNA retrospective study nested within a prospective multicenter quality improvement study.SETTINGIntensive care units (ICUs) within 5 hospitals of the Centers for Disease Control and Prevention Epicenters.PATIENTSPatients who underwent mechanical ventilation.METHODSWe selected 150 charts for review, including all VAEs and traditionally defined VAPs identified during the primary study and randomly selected charts of patients without VAEs or VAPs. Each chart was independently reviewed by 2 research assistants (RAs) for VAEs, 2 hospital infection preventionists (IPs) for traditionally defined VAP, and 2 intensivists for any episodes of pulmonary deterioration. We calculated interrater agreement using κ estimates.RESULTSThe 150 selected episodes spanned 2,500 ventilator days. In total, 93–96 VAEs were identified by RAs; 31–49 VAPs were identified by IPs, and 29–35 VAPs were diagnosed by intensivists. Interrater reliability between RAs for VAEs was high (κ, 0.71; 95% CI, 0.59–0.81). Agreement between IPs using traditional VAP criteria was slight (κ, 0.12; 95% CI, −0.05–0.29). Agreement between intensivists was slight regarding episodes of pulmonary deterioration (κ 0.22; 95% CI, 0.05–0.39) and was fair regarding whether episodes of deterioration were attributable to clinically defined VAP (κ, 0.34; 95% CI, 0.17–0.51). The clinical correlation between VAE surveillance and intensivists’ clinical assessments was poor.CONCLUSIONSProspective surveillance using VAE criteria is more reliable than traditional VAP surveillance and clinical VAP diagnosis; the correlation between VAEs and clinically recognized pulmonary deterioration is poor.Infect Control Hosp Epidemiol 2017;38:172–178

Gli stili APA, Harvard, Vancouver, ISO e altri

32

Kuzminskaitė, Vilma, Justina Kaklauskaitė e Justė Petkevičiūtė. "Incidence and features of preoperative anxiety in patients undergoing elective non-cardiac surgery". Acta medica Lituanica 26, n. 1 (7 maggio 2019): 93–100. http://dx.doi.org/10.6001/actamedica.v26i1.3961.

Testo completo

Abstract (sommario):

The study was conducted at the Centre of Anaesthesiology, Intensive Care and Pain Management of Vilnius University Hospital Santaros Klinikos. Background. Due to its implications on postoperative outcomes and patient satisfaction, anxiety evaluation should be incorporated in the preoperative assessment of the patients. Materials and methods. A series of consecutive patients undergoing elective surgery were included in the study. Preoperative anxiety was evaluated using the Hospital Anxiety and Depression Scale (HADS), the Amsterdam Preoperative Anxiety and Information Scale (APAIS), and the Visual Analogue (Face) Scale (VAFS). Qualitative and quantitative analyses were used to describe features of anxiety. Results. 149 patients were included in the study, of whom 40.9% were scheduled for low, 47.7% for intermediate, and 11.4% for highrisk procedures. Based on HADS, 19 patients (12.6%) were positive for anxiety. VAFS revealed that 10.3% of patients experience medium/high intensity of anxiety. Patients were mostly concerned about the success (29.3%) and complications (11.4%) of the surgery APAIS score analysis revealed significantly higher anxiety (p < 0.01) and a need of information (p < 0.01) about surgery compared to anaesthesia. In contrast to age, education, or previous surgery, anxiety was associated with female sex (p < 0.01), surgical risk (p = 0.02), and subjective health evaluation (p < 0.01). Patients tended to choose a conversation with the doctor (45.6%) or a relative (44.8%) as a measure to relieve anxiety, and 18.4% would choose medication. Praying, music therapy, massage, or even sexual intercourse were among the measures suggested by patients. Conclusions. A significant part of patients experience anxiety before surgery, predominantly about the success of the surgery. According to the patients, conversation is the best option to reduce anxiety.

Gli stili APA, Harvard, Vancouver, ISO e altri

33

Buhimschi, Irina A., Catalin S. Buhimschi, Carl P. Weiner, Tatsuji Kimura, Benjamin D. Hamar, Anna K. Sfakianaki, Errol R. Norwitz, Edmund F. Funai e Elena Ratner. "Proteomic but Not Enzyme-Linked Immunosorbent Assay Technology Detects Amniotic Fluid Monomeric Calgranulins from Their Complexed Calprotectin Form". Clinical Diagnostic Laboratory Immunology 12, n. 7 (luglio 2005): 837–44. http://dx.doi.org/10.1128/cdli.12.7.837-844.2005.

Testo completo

Abstract (sommario):

ABSTRACT Four proteomic biomarkers (human neutrophil peptide 1 [HNP1], HNP2 [defensins], calgranulin C [Cal-C], and Cal-A) characterize the fingerprint of intra-amniotic inflammation (IAI). We compared proteomic technology using surfaced-enhanced laser desorption-ionization-time of flight (SELDI-TOF) mass spectrometry to enzyme-linked immunosorbent assay (ELISA) for detection of these biomarkers. Amniocentesis was performed on 48 women enrolled in two groups: those with intact membranes (n = 27; gestational age [GA], 26.0 ± 0.8 weeks) and those with preterm premature rupture of the membranes (PPROM; n = 21; GA, 28.4 ± 0.9 weeks). Paired abdominal amniotic fluids (aAFs)-vaginal AFs (vAFs) were analyzed in PPROM women. Quantitative aspects of HNP1-3, Cal-C, Cal-A, and calprotectin (a complex of Cal-A with Cal-B) were assessed by ELISA. SELDI-TOF mass spectrometry tracings from 16/48 (33.3%) aAFs and 13/17 (88.2%) vAFs were consistent with IAI (three or four biomarkers present). IAI (by SELDI-TOF mass spectrometry) was associated with increased HNP1-3 and Cal-C measured by ELISA. However, immunoassays detected Cal-A in only 4 of the AFs even though its specific SELDI-TOF mass spectrometry peak was identified in 19/48 AFs. Calprotectin immunoreactivity was decreased in AFs retrieved from women with IAI (P = 0.01). In conclusion, IAI is associated with increased HNP1-3 levels. In the absence of isoform-specific ELISAs, mass spectrometry remains the only way to discriminate the HNP biomarker isoforms. Monomeric Cal-A is not reliably estimated by specific ELISA as it binds to Cal-B to form the calprotectin complex. Cal-C was reliably measured by SELDI-TOF mass spectrometry or specific ELISA.

Gli stili APA, Harvard, Vancouver, ISO e altri

34

Muñoz-González, Javier I., Iván Álvarez-Twose, María Jara-Acevedo, Ana Henriques, Esther Viñas, Carlos Prieto, Laura Sánchez-Muñoz et al. "Frequency and prognostic impact of KIT and other genetic variants in indolent systemic mastocytosis". Blood 134, n. 5 (1 agosto 2019): 456–68. http://dx.doi.org/10.1182/blood.2018886507.

Testo completo

Abstract (sommario):

Abstract Indolent systemic mastocytosis (ISM) patients have a normal life expectancy, except in the 5% to 10% of cases that progress to more advanced SM (advSM), which has a significantly poorer outcome. Mutations in genes other than KIT frequently found in myeloid neoplasms have been associated with a poorer outcome among advSM, whereas limited information exists about their frequency and prognostic impact in ISM. We investigated the frequency and prognostic impact of variants in 18 genes, found to be altered in advSM, in 322 ISM patients (median follow-up, 5.7 years) divided into discovery (n = 200) and validation (n = 122) cohorts. Overall, 71 genetic variants were detected in 55 of 322 (17%) patients. Mutated ISM cases, particularly those carrying ASXL1, RUNX1, and/or DNMT3A (A/R/D) pathogenic variant allele frequencies (VAFs) ≥ 30%, exhibited significantly shortened (P < .001) progression-free survival (PFS) and overall survival (OS). Multivariate analysis showed that serum β2-microglobulin (sβ2M) levels > 2.5 µg/mL (hazard ratio [HR], 9.8; P = .001), together with a KIT D816V VAF ≥ 1% in bone marrow (BM) (HR, 10.1; P = .02) and pathogenic variants of A/R/D VAFs ≥ 30% (HR, 4.2; P = .02), were the best combination of independent predictors for PFS. In turn, A/R/D gene pathogenic VAF ≥ 30% was the only independent predictor for OS (HR, 51.8; P < .001). Based on these variables, 2 scoring systems were constructed for risk stratification of ISM at diagnosis with significantly different 10-year PFS (100%, 91%, 0% for scores of 0, 1, ≥2, respectively) and OS (100% and 50% for scores of 0 and 1) rates.

Gli stili APA, Harvard, Vancouver, ISO e altri

35

Tbeileh, Noura, Luika Timmerman, Aras N. Mattis, Kan Toriguchi, Yosuke Kasai, Carlos Corvera, Eric Nakakura et al. "Metastatic colorectal adenocarcinoma tumor purity assessment from whole exome sequencing data". PLOS ONE 18, n. 4 (6 aprile 2023): e0271354. http://dx.doi.org/10.1371/journal.pone.0271354.

Testo completo

Abstract (sommario):

Tumors rich in stroma are associated with advanced stage and poor prognosis in colorectal adenocarcinoma (CRC). Abundance of stromal cells also has implications for genomic analysis of patient tumors as it may prevent detection of somatic mutations. As part of our efforts to interrogate stroma-cancer cell interactions and to identify actionable therapeutic targets in metastatic CRC, we aimed to determine the proportion of stroma embedded in hepatic CRC metastases by performing computational tumor purity analysis based on whole exome sequencing data (WES). Unlike previous studies focusing on histopathologically prescreened samples, we used an unbiased in-house collection of tumor specimens. WES from CRC liver metastasis samples were utilized to evaluate stromal content and to assess the performance of three in silico tumor purity tools, ABSOLUTE, Sequenza and PureCN. Matching tumor derived organoids were analyzed as a high purity control as they are enriched in cancer cells. Computational purity estimates were compared to those from a histopathological assessment conducted by a board-certified pathologist. According to all computational methods, metastatic specimens had a median tumor purity of 30% whereas the organoids were enriched for cancer cells with a median purity estimate of 94%. In line with this, variant allele frequencies (VAFs) of oncogenes and tumor suppressor genes were undetectable or low in most patient tumors, but higher in matching organoid cultures. Positive correlation was observed between VAFs and in silico tumor purity estimates. Sequenza and PureCN produced concordant results whereas ABSOLUTE yielded lower purity estimates for all samples. Our data shows that unbiased sample selection combined with molecular, computational, and histopathological tumor purity assessment is critical to determine the level of stroma embedded in metastatic colorectal adenocarcinoma.

Gli stili APA, Harvard, Vancouver, ISO e altri

36

Kleman, Ariel, Arun K. Singavi, Lauren Pommert, Michael T. Zimmerman, Wendy Demos, Angela Mathison, Sridhar Rao, Karen-Sue Carlson e Parameswaran Hari. "Secondary Hematologic Malignancies after Autologous Stem Cell Transplantation for Multiple Myeloma Are Associated with a Distinct Mutational Profile". Blood 136, Supplement 1 (5 novembre 2020): 28. http://dx.doi.org/10.1182/blood-2020-142410.

Testo completo

Abstract (sommario):

Background: Patients (pts) diagnosed with multiple myeloma (MM) are at risk for developing secondary hematologic malignancies (SHM). The etiology of SHM-associated genetic alterations (GAs) is unclear. We hypothesized that the GAs present in MM-associated SHMs would have a distinct profile compared to de novo or other therapy related hematologic malignancies. Aims: For MM pts who develop SHM, compare GAs at Autologous Stem Cell Transplant (ASCT) and at diagnosis of SHM. Assess for presence of previously reported deleterious myeloid GAs and determine if there is clonal evolution from the autograft. Methods: We retrospectively identified 9 MM pts with SHM post-ASCT. Autograft (auto) cells and SHM Fresh Frozen Plasma Extraction (FFPE) samples underwent whole exome sequencing. GAs with known clinical significance, variant allele frequency (VAF) ≥0.05 or ≤0.9, and high or moderate impact on the gene-encoded protein were included for analysis. From literature review, we identified 89 reported GAs (kmGAs) in myeloid malignancies. Targeted deep sequencing for these mutations was performed to obtain the VAF in both the auto and SHM FFPE samples. Results: 9 adult pts (age 56-71) with MDS, AML, or ALL were included. 8 auto samples and 9 SHM samples were available. All pts received induction therapy prior to ASCT (44% and 55% with lenalidomide/thalidomide or bortezomib containing regimens, respectively). Lenalidomide maintenance was utilized in 60% of pts. Whole exome sequencing revealed 118,614 GAs in all samples. 2074 GAs were included. Average mutational burden was similar between the auto and SHM samples. For paired samples (matched auto and SHM samples for each pt), 1173 GAs with kmGAs of GATA2, SETBP1, and ATM were present. GATA2 and SETBP1 were present in 3 and 5 auto samples, and 4 and 6 SHM samples, respectively. SETBP1 and GATA2 were present in paired samples for 3 and 1 pt, respectively. Targeted deep sequencing revealed significant mutations in SHM samples, but not auto samples, for ABCA12, ASXL1, BCOR, BRAF, EXH2, KDM5A, KMT2A, KMT2D, NOTCH1, PRPF8, TET2, and TP53. The most highly represented mutation was TP53 which was present in 6 pts, followed by KMT2A in 3 pts, KMT2D in 3 pts, PRPF8 in 2 pts, and TET2 in 2 pts. The patient who carried the most significant mutations carried the diagnosis of ALL, harboring 11 genetic mutations in the SHM sample only. For paired samples, KDM5A, KMT2D, FLT3, SETBP1, ZRSR2, PRPF8, TET2, and TP53 showed mutations in both auto and SHM samples, showing stable or decreased VAFs. GATA2 showed two moderate impact missense mutations, one in a pt with a VAF of 0.58 in the auto sample and 0.40 in the SHM. The other GATA2 variant appeared as a novel mutation in one pt's SHM sample and was also present in two other pts with VAFs of 0.5 and 0.49 in the auto sample increasing to 0.81 and 0.70 in the SHM sample, respectively. TP53 showed the highest number of variants. Analysis showed 6 high impact variants with VAFs ranging from 0.05-0.80 and 3 moderate impact variants with VAFs ranging from 0.08-0.89. These mutations were represented in both the auto and SHM samples included. There were several TP53 alterations with the most frequent being structural interaction variants, missense variants, and frameshift variants. Conclusion: This limited cohort demonstrates that mutational profile for pts with SHM is distinct from de-novo myeloid malignancies, and the average mutational burden did not change from pre-transplant to the development of SHM. In this population, TP53, KMT2A, GATA2, and KMT2D represented the most frequent SHM mutations. Targeted deep sequencing revealed that most significant variants were present only in SHM samples suggesting a novel mutation rather than clonal evolution from the auto sample. Disclosures Hari: Incyte Corporation: Consultancy; Takeda: Consultancy; BMS: Consultancy; Amgen: Consultancy; GSK: Consultancy; Janssen: Consultancy.

Gli stili APA, Harvard, Vancouver, ISO e altri

37

Lowe, Dana Ruminski, Benedicta Forson, Matthew G. Butler, Yves Konigshofer, Catherine Huang, Omoshile Clement, Russell K. Garlick e Bharathi Anekella. "Abstract 2219: Reference materials for ctDNA-based measurable residual disease (MRD) assay development and validation". Cancer Research 82, n. 12_Supplement (15 giugno 2022): 2219. http://dx.doi.org/10.1158/1538-7445.am2022-2219.

Testo completo

Abstract (sommario):

Abstract Monitoring measurable residual disease (MRD) via liquid biopsy is a promising method for catching early stage cancer and disease relapse long before traditional diagnostics, which generally require significant disease progression for detection. Assays in development include those that target patient-specific variants and fixed panels for all patients. Regardless, detection of variant allele frequencies at extremely low levels, well below the limit of detection of typical circulating tumor DNA (ctDNA) assays, presents a challenge that can be surmounted with well-designed reference materials that allow for assessment of sensitivity and specificity. We developed the Seraseq® ctDNA MRD Panel kit composed of 4 tumor fractions at decreasing levels to meet validation needs of both patient-specific and fixed panel targeted cfDNA NGS MRD assays. Genomic DNA from tumor and their SNP-matched normal cell lines, characterized by whole exome sequencing (WES), was fragmented to approximate the size of circulating cell free DNA (ccfDNA). This DNA was blended at tumor fractions (TF) of 0.5%, 0.05%, and 0.005% and biosynthetic DNA fragments containing more common and clinically relevant variants were spiked in at similar TF levels. A normal (0% tumor) ctDNA reference material was produced for comparison and identification of background variants. The VAFs for the biosynthetic variants were determined by digital PCR (BioRad QX200) and targeted cfDNA NGS assay (ArcherDx LiquidPlex) in the 0.5% TF mix. Somatic variants from the tumor DNA were assessed using a custom Agilent SureSelect XT HS2 assay targeting ~100 variants in the MRD panel mix using 50 ng as input. Variants were called at 1 observation. All biosynthetic variants were detectable in the TF 0.5% mix at anticipated VAFs (dPCR: 0.43% ± 0.12% and NGS: 0.33% ± 0.15%). Somatic VAFs of the ctDNA MRD panel mixes were measured at expected levels although not all variants were detected below 0.05% due to sampling. Agilent SureSelect XT HS2 libraries had ~25% incorporation efficiency and ~ 72% on-target. The 0.5% and 0.05% mixes showed evidence of more of the somatic variants at 1 or more copies than the other samples. The 0.005% mix showed evidence of more of the somatic variants than the 0% mix. The Seraseq ctDNA MRD Panel Mixes have been designed to provide a broad range of DNA mutations from tumor-normal matched cell lines and spike-in variants to aid sensitivity and specificity when applied to MRD evaluation of patient-specific and fixed panel cfDNA NGS MRD assays. Citation Format: Dana Ruminski Lowe, Benedicta Forson, Matthew G. Butler, Yves Konigshofer, Catherine Huang, Omoshile Clement, Russell K. Garlick, Bharathi Anekella. Reference materials for ctDNA-based measurable residual disease (MRD) assay development and validation [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2022; 2022 Apr 8-13. Philadelphia (PA): AACR; Cancer Res 2022;82(12_Suppl):Abstract nr 2219.

Gli stili APA, Harvard, Vancouver, ISO e altri

38

Appin, Christina, Abigail K. Suwala, Stephanie Hilz, Radhika Mathur, Ivan Smirnov, Chibo Hong, Nicholas Stevers et al. "PATH-28. RE-DEFINING CLONALITY OF THE TERT PROMOTER MUTATION WITH DEEP SEQUENCING AND MAXIMAL SAMPLING OF NEWLY DIAGNOSED AND RECURRENT GBM AND OLIGODENDROGLIOMA". Neuro-Oncology 23, Supplement_6 (2 novembre 2021): vi121. http://dx.doi.org/10.1093/neuonc/noab196.480.

Testo completo

Abstract (sommario):

Abstract TERT promoter mutation (TPM), found in over 80% of IDH-wildtype glioblastomas (GBMs) and oligodendrogliomas, leads to reactivation of telomerase and consequently tumor cell immortalization, which is potentially reversible. TERT could therefore serve as an effective target in treating tumors with TPM, if TPM is present throughout the tumor. Previous studies using a single sample or minimal sampling per tumor have shown potentially conflicting results, suggesting TPM is clonal in some cases and subclonal in others. Here we use spatially mapped tumor samples representing maximal tumor sampling to address this critical issue. Sanger sequencing was performed on 311 newly diagnosed and recurrent tumor samples from 19 IDH-wildtype GBMs and 10 oligodendrogliomas. To validate Sanger sequencing and resolve potentially ambiguous samples, deep amplicon sequencing was performed on 164 samples. To determine tumor purity and TERT expression levels, whole exome sequencing (164 samples) and RNA-Seq (129 samples) data sets were analyzed computationally. Sanger and amplicon sequencing showed that TPM was present in 305 of 311 samples (98.1%). TPM was not detected in 6 samples which had tumor purity estimates too low to be accurately determined by FACETS and lacked evidence of any driver mutation. Variant allele frequencies (VAFs) of TPM showed high positive correlation with those of clonal alterations in GBMs (r(90) = .93, p < .0001) and oligodendrogliomas (r(48) = .96, p < .0001). TPM VAFs also showed high positive correlation with tumor purity in both GBMs (r(112) = .92, p < .0001) and oligodendrogliomas (r(48) = .89, p < .0001). TPM VAF showed a moderate positive correlation with TERT expression in GBMs (r(78) = .40, p < .001) and oligodendrogliomas (r(47) = .49, p < .001). Therefore, TPM is a tumor-wide, clonal mutation in both newly diagnosed and recurrent GBMs and oligodendrogliomas. TPM VAF is moderately correlated with TERT expression.

Gli stili APA, Harvard, Vancouver, ISO e altri

39

Abe, Masakazu, Hayato Hiraki, Takashi Tsuyukubo, Sadahide Ono, Shigekatsu Maekawa, Daichi Tamura, Daiki Ikarashi et al. "Abstract 3326: The clinical validity of urinary pellet DNA monitoring of recurrent bladder cancer". Cancer Research 83, n. 7_Supplement (4 aprile 2023): 3326. http://dx.doi.org/10.1158/1538-7445.am2023-3326.

Testo completo

Abstract (sommario):

Abstract Introduction: Approximately half of high-risk non-muscle-invasive bladder cancers (NMIBCs) recur after transurethral resection of the bladder tumor (TURBT), whereas conventional urological testing for bladder cancer (BC) patients has been considered invasive and with low sensitivity. Our previous reports have shown that circulating tumor DNA (ctDNA) monitored by digital PCR (dPCR) can predict relapse and evaluate treatment efficacy in digestive tract cancers. In BC patients, tumor-derived genetic mutations detected in urinary DNA are expected to be a diagnostic biomarker. This study evaluates the clinical validity of monitoring tumor-specific gene mutations in ctDNA and urine pellet DNA (upDNA) using dPCR as a biomarker for early relapse prediction and determination of treatment efficacy. Materials and Methods: Thirty-two previously treated and untreated BC patients were enrolled. Tumor DNA was extracted from archived TURBT tissues, and gene mutation analysis by Next Generation Sequencing (NGS) of tumors was performed to select patient-unique somatic mutations for both ctDNA and upDNA monitoring by dPCR. Longitudinal variant allele frequencies (VAFs) of ctDNA and upDNA were monitored by dPCR for up to two years. While dPCR is rapid and has a high sensitivity of less than 0.1% VAF, a mutation-specific primer/probe set is required. Therefore, we established over 1,000 primer/probe sets for frequent mutations in human cancer. This large-scale dPCR primer/probe library allow us to select patient specific mutations for immediate ctDNA monitoring. Clinical recurrence (Crec) based on imaging and urinary cell findings are compared with VAF dynamics of ctDNA and upDNA. Results: The median observation period was 516 days (30-733), and a total of 230 urine samples were collected. The selection of monitoring mutations based on NGS analysis was performed in 93.8% (30/32) cases, with 2.3 (range: 1-6) mutations monitored per case. The primer/probe sets covered 87.5% (28/32) of cases and 87.5% (42/48) of mutations. The VAFs of the upDNA of cases started showing constantly increasing trends 3-12 months earlier than the diagnosis of Crec in 71.4% (5/7) of the cases. The other two Crec cases, which did not show an elevated upVAF, were both pyuria cases. After local treatment, the upDNA VAFs remained high in the Crec cases. Conventional Crec did not seem to be fully reflected by ctDNA alone. Conclusion: Frequent VAF monitoring using upDNA by dPCR enables the prediction of local relapse and the evaluation of treatment efficacy in the management of BC patients. Citation Format: Masakazu Abe, Hayato Hiraki, Takashi Tsuyukubo, Sadahide Ono, Shigekatsu Maekawa, Daichi Tamura, Daiki Ikarashi, Renpei Kato, Tomohiko Matsuura, Mitsugu Kanehira, Ryo Takata, Hiromitsu Fujisawa, Takeshi Iwaya, Masashi Idogawa, Wataru Obara, Satoshi S. Nishizuka. The clinical validity of urinary pellet DNA monitoring of recurrent bladder cancer [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2023; Part 1 (Regular and Invited Abstracts); 2023 Apr 14-19; Orlando, FL. Philadelphia (PA): AACR; Cancer Res 2023;83(7_Suppl):Abstract nr 3326.

Gli stili APA, Harvard, Vancouver, ISO e altri

40

Joudinaud, Romane, Augustin Boudry, Laurène Fenwarth, Sandrine Geffroy, Mikaël Salson, Herve Dombret, Céline Berthon et al. "Clonal Dynamics of FLT3-ITD Positive Acute Myeloid Leukemia Patients with Relapsed/Refractory Disease Following Intensive Chemotherapy +/- Midostaurin". Blood 142, Supplement 1 (28 novembre 2023): 976. http://dx.doi.org/10.1182/blood-2023-182018.

Testo completo

Abstract (sommario):

Introduction: Despite the wider use of midostaurin (MIDO) in combination with intensive chemotherapy (ICT) as the 1st-line treatment for FLT3-mutated acute myeloid leukemia (AML), complete remission (CR) rates are close to 60%, and relapses occur in over 40% of cases, demonstrating the ability of leukemic cells to resist and evade therapy ( Stone et al., NEJM 2017). Conventional fragment-length analyses of paired diagnosis/relapse samples have shown that FLT3-internal tandem duplications (ITDs) are retained in 80% and 50% of cases following ICT alone and MIDO+ICT respectively ( Schmalbrock et al., Blood 2021). Only limited data are available on the dynamics of FLT3-ITDs or other co-mutations in refractory patients (pts). Here, we conducted a retrospective study involving 115 pts with relapsed/refractory AML harboring FLT3-ITD at diagnosis. Materials and methods: Clonal evolution was examined in paired diagnosis/progression blood or bone marrow samples from 115 pts with FLT3-ITD+ AML treated with MIDO+ICT (n=33) or ICT alone (n=82). Among them, 21 pts had primary refractory disease (MIDO+ICT, n=8; ICT, n=13) and 94 pts relapsed after achieving CR (MIDO+ICT, n=25; ICT, n=69). FLT3-ITDs and co-mutations were screened on genomic DNA by high-throughput sequencing at both timepoints using a custom-designed panel. For accurate annotation and quantification of FLT3-ITDs from sequencing data, we used the recentlypublished FiLT3r algorithm ( Boudry et al., BMC Bioinformatics 2022). For each ITD detected, FiLT3r allelic ratio (AR) was assessed by the ratio between the mutated allele and the wild-type allele. Results: A total of 226 FLT3-ITDs were detected in 115 pts at AML diagnosis, among which 120 (53%) ITDs were found with an AR below 0.05 ( Figure 1). Among pts who achieved CR and experienced relapse (n=94), 48 had multiple FLT3-ITDs at diagnosis and 46 had a single FLT3-ITD at diagnosis. Overall, we observed a simplification of the FLT3-ITD repertoire upon relapse with the persistence of at least one initial clone in 8/12 [67%] and 24/36 [67%] pts with multiple ITDs receiving MIDO+ICT and ICT alone respectively. In relapsed pts who initially had a single FLT3-ITD clone at diagnosis, the addition of MIDO to ICT was associated with a higher rate of FLT3-ITD negativity compared to pts receiving ICT alone (6/13 [46%] vs 5/33 [15%]; P = 0.05) ( Figure 2). Interestingly, among 21 pts with primary refractory AML, we observed that FLT3-ITD mutation status became negative in 5/8 pts (62%) and 2/13 pts (15%) after induction with MIDO+ICT and ICT alone respectively. We then compared the initial characteristics between retained and lost FLT3-ITDs at AML relapse. Lost FLT3-ITDs had significantly lower AR than retained clones in both treatment groups. In order to limit the impact of sample dilution on the allele burden, we defined adjusted variant allele frequencies (VAFs) as the VAFs of FLT3-ITDs normalized to the VAFs of NPM1 mutations, whenever applicable. In so doing, we observed that adjusted VAFs of retained FLT3-ITDs increased at relapse, regardless of the treatment group (adjusted VAF, diagnosis vs relapse: 0.28 vs 0.86 and 0.88 vs 1.6 in the MIDO+ICT group and ICT alone group; P = 2.3e-03 and P = 2.4e-04). Importantly, an adjusted VAF higher than 1 was strongly suggestive of a homozygous state of FLT3-ITD. Such situation was found to be more prevalent at relapse in both treatment groups. Besides the selection of a dominant FLT3-ITD clone, other relapse-related changes including the acquisition of additional mutations will be presented. Conclusion: Our study of the clonal dynamics of AML with FLT3-ITD mutations provides insights into the mechanisms underlying therapy escape. Our data suggest that clonal interference characterized by multiple FLT3-ITD clones is associated with a greater ability to select a FLT3-ITD-positive clone at relapse in pts receiving MIDO+ICT. Although the addition of MIDO to ICT increases the probability of eradicating a single FLT3-ITD clone, FLT3-ITD+ relapses remain common following this combination, often with the selection of homozygous FLT3-ITD clones and/or the emergence of new mutations. Finally, our data in refractory situation emphasize the need to reassess mutational status at each stage of progression before implementing targeted therapy.

Gli stili APA, Harvard, Vancouver, ISO e altri

41

Yokoyama, Akira, Tomonori Hirano, Koichi Watanabe, Masashi Tamaoki, Kenshiro Hirohashi, Yoshihiro Ishida, Yoshikage Inoue et al. "Abstract 1075: Buccal mucosal remodeling predicts esophageal cancer risk". Cancer Research 84, n. 6_Supplement (22 marzo 2024): 1075. http://dx.doi.org/10.1158/1538-7445.am2024-1075.

Testo completo

Abstract (sommario):

Abstract Lifestyle habits, including alcohol consumption, tobacco smoking, and germline variants of ALDH2 and ADH1B, increase the risk of developing esophageal squamous cell carcinoma (ESCC). However, current prediction methods that rely on self-reported lifestyle information lack accuracy. We previously demonstrated that driver-mutated clones remodel the esophageal epithelium with age and that this remodeling is accelerated in heavy drinkers and smokers. Nonetheless, predicting cancer from clonal expansion in normal tissues remains challenging, due to limited sample availability beyond the blood. The squamous epithelium continuously covers the esophagus, throat, and oral cavity. Therefore, we evaluated buccal mucosal remodeling by mutant clones and its potential as a predictive biomarker of ESCC. A total of 387 buccal mucosa samples were collected from 110 subjects, including 62 with ESCC and 48 without, using swabs of three different sizes, followed by error-corrected sequencing targeting 26 driver genes that showed positive selection in samples from ESCC and physiologically normal esophageal tissues, as well as ALDH2 and ADH1B. Somatic mutations were detected in all samples (median, 27 (1-134)). In total, 13,235 mutations, including 12,085 nonsynonymous and 1,150 synonymous mutations, with VAFs ranging from 0.0016-0.12 (median, 0.0025), were detected. Ten of the 26 genes, TP53, CHEK2, NOTCH1, CDKN2A, NOTCH2, FAT1, AJUBA, PPM1D, ARID1A, and ZNF750 showed positive selection (dN/dS >1, q<0.1). Correlation analysis demonstrated that driver mutations in TP53, FAT1, and PPM1D were positively correlated with not only germline risk variants of ALDH2 but also alcohol consumption. The impact of alcohol consumption on the number and sum of VAFs of mutations in each of the three genes was analyzed and stratified by the presence or absence of the germline risk variant of ALDH2, and positive correlations were observed only among subjects with risk variants. Compared to subjects without ESCC, patients with early-stage or advanced ESCC displayed significantly higher numbers and sums of VAFs of driver mutations (p<0.05). These results indicated that buccal mucosal remodeling driven by positively selected mutations is associated with lifestyle and germline risk factors for ESCC, thus motivating the establishment of a predictive model for ESCC using genetic swab data. The prediction model for ESCC using sequencing data outperformed a model using self-reported lifestyle and alcohol flushing reaction and a model using lifestyle and germline risk variants (AUC of 0.94, 0.72, and 0.88, respectively). In conclusion, this is the first study to use clonal expansion in normal tissues to predict the presence of solid organ cancer, and our study successfully established a prediction model for ESCC based on buccal mucosal remodeling and germline variants. Citation Format: Akira Yokoyama, Tomonori Hirano, Koichi Watanabe, Masashi Tamaoki, Kenshiro Hirohashi, Yoshihiro Ishida, Yoshikage Inoue, Yasuhide Takeuch, Yo Kishimoto, Soo Ki Kim, Chikatoshi Katada, Yasuhito Nanya, Hiroshi Seno, Seishi Ogawa, Manabu Muto, Nobuyuki Kakiuchi. Buccal mucosal remodeling predicts esophageal cancer risk [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 1075.

Gli stili APA, Harvard, Vancouver, ISO e altri

42

Rodriguez-Blanco, Cleofas, Carlos Bernal-Utrera, Ernesto Anarte-Lazo, Juan Jose Gonzalez-Gerez e Manuel Saavedra-Hernandez. "A 14-Day Therapeutic Exercise Telerehabilitation Protocol of Physiotherapy Is Effective in Non-Hospitalized Post-COVID-19 Conditions: A Randomized Controlled Trial". Journal of Clinical Medicine 12, n. 3 (18 gennaio 2023): 776. http://dx.doi.org/10.3390/jcm12030776.

Testo completo

Abstract (sommario):

The emergence of COVID-19 has led to serious public health problems. Now that the acute phase of the pandemic has passed, new challenges have arisen in relation to this disease. The post-COVID-19 conditions are a priority for intervention, as months after the onset of the disease, they continue to present symptoms, especially physical and respiratory symptoms. Our aim is to test the efficacy of a fourteen-day telerehabilitation program of respiratory and strength exercises in people with post-COVID-19 conditions. For this purpose, a randomized controlled trial was generated in which data from 48 patients were analyzed using the BS, 30STSTST, MD12, VAFS, and 6MWT tests. The obtained results showed the benefit of the intervention in generating great results with respect to the control group.

Gli stili APA, Harvard, Vancouver, ISO e altri

43

Hutter, Stephan, Niroshan Nadarajah, Manja Meggendorfer, Wolfgang Kern, Torsten Haferlach e Claudia Haferlach. "Whole Genome Sequencing in Routine Hematologic Samples: How to Proceed Analyses Best When Germline Controls Are Missing?" Blood 132, Supplement 1 (29 novembre 2018): 5275. http://dx.doi.org/10.1182/blood-2018-99-113294.

Testo completo

Abstract (sommario):

Abstract Background: The human genome is very heterogeneous on the individual level which challenges interpretation of whole genome sequencing (WGS) data. In order to reduce complexity in tumor genetics WGS of a tumor is performed together with WGS of "normal" tissue from the respective patient (i.e. fingernails, skin biopsy, hair, buccal swaps) which is used as the germline sequence (tumor/matched normal approach, TMNA). This approach allows the extraction of somatic mutations acquired in the tumor through sophisticated algorithms. In routine diagnostics, especially in hematological neoplasms, "normal" tissue representing the germline sequence is usually not available, which prohibits the standard use of somatic tumor/normal variant calling tools. Aims: On the road to implement WGS into routine diagnostics we tested a TMNA in comparison to a tumor/unmatched normal approach (TUNA), where pooled genomic DNA (Promega, Fitchburg, WI) was used instead of a matched normal. Cohorts and Methods: 9 samples from patients with hematological neoplasms (7 AML, 2 ALL) were sequenced at diagnosis on Illumina HiSeqX machines (Illumina, San Diego, CA), along with complete remission samples to serve as matched normals for the TMNA. For comparison, a mixture of genomic DNA from multiple anonymous donors was used as "normal" for the TUNA. Read mapping and somatic variant calling was performed using the tools Isaac3 and Strelka2, respectively. Statistical differences between groups were assessed by two-sided Mann-Whitney tests. Results: The TMNA produced a median of 17,700 somatic variant calls, while the TUNA produced 419,000. This 24-fold disparity is mainly due to residual germline variants missed by the TUNA. A large fraction of TMNA variants (57%) was located in regions of known low confidence variant calling (as defined by the Genome in a Bottle Consortium) and likely contain mostly artifacts. After removing these regions from analysis a median of 7,700 and 331,000 variants remained in the TMNA and TUNA datasets, respectively. In order to eliminate germline variants, the gnomAD population database was queried and any present variants were discarded. As expected, this removed over 95% of all variants from the TUNA dataset, but also 41% from the TMNA dataset. The latter might be attributed to common germline variants falsely being called as somatic by the TMNA and/or somatic mutations occurring at polymorphic sites. After this filtering step a median of 3,770 and 15,500 variants remained in the TMNA and TUNA datasets, respectively. This 4-fold disparity in variant number is most likely caused by rare germline variation remaining in the TUNA dataset. Of the remaining TMNA variants only 65% could be found within the larger TUNA dataset. A major factor governing this observation was variant allele frequency (VAF). Variants that overlapped between both datasets had on average higher VAFs than those unique to the TMNA (p < 2.2x10-16). Further inspection of the VAF distribution among samples revealed a bimodal or nearly bimodal distribution for all samples. All distributions shared a sharp peak centered on a VAF of 10%, which was unexpected given the estimated tumor fractions of the samples predict VAFs of 25% and higher. Variants in this lower part of the distribution (arbitrarily defined as VAFs < 20%) constitute on average 50% of all variants in a TMNA sample, with extremes reaching 95% in 2 samples. These low frequency variants show distinctly lower mapping qualities than variants with VAFs ≥ 20% (p < 2.2x10-16), i.e. they reside in regions of elevated mapping ambiguity which potentially leads to the creation of artefacts. Analyzing the overlap of only the higher VAF variants we find that 97.4% of all TMNA variants can also be found in the TUNA dataset. Conclusions: Comparing tumor samples to matched normal material from the respective patient is the preferred approach for somatic variant calling in WGS data, however even with modern algorithms false positives due to technical artifacts seem to be highly abundant. A deeper understanding of the nature of these artifacts is crucial for developing appropriate filtering schemes and improving variant calling algorithms. In the absence of a matched normal using a TUNA can uncover the vast majority (97.4%) of high-quality variants found in a TMNA, however distinguishing true somatic variants from residual rare germline variation in a TUNA remains a major challenge. Disclosures Hutter: MLL Munich Leukemia Laboratory: Employment. Nadarajah:MLL Munich Leukemia Laboratory: Employment. Meggendorfer:MLL Munich Leukemia Laboratory: Employment. Kern:MLL Munich Leukemia Laboratory: Employment, Equity Ownership. Haferlach:MLL Munich Leukemia Laboratory: Employment, Equity Ownership. Haferlach:MLL Munich Leukemia Laboratory: Employment, Equity Ownership.

Gli stili APA, Harvard, Vancouver, ISO e altri

44

Nishida, Yuki, Rafael Heinz Montoya, Kiyomi Morita, Tomoyuki Tanaka, Feng Wang, Koichi Takahashi, Jo Ishizawa et al. "Clonal Expansion of Mutant p53 Clones By MDM2 Inhibition in Acute Myeloid Leukemias". Blood 136, Supplement 1 (5 novembre 2020): 27–28. http://dx.doi.org/10.1182/blood-2020-142794.

Testo completo

Abstract (sommario):

MDM2 inhibition by small molecules as a means of restoring p53 function has shown clinical activity against acute myeloid leukemia (AML) (Andreeff, Clin Cancer Res 2015). However, we and others have found increased variant allele frequencies (VAFs) of TP53 mutations in AML cells after treatment with MDM2 inhibitors, either as monotherapy or in combination with other agents (Daver ASH 2019), which suggests that MDM2 inhibition selects preexisting clones or generates de novo clones with TP53 mutations. We performed a long-term culture of AML cells (MOLM-13, an AML cell line with wild-type p53 and FLT3-ITD) treated with increasing concentrations of an MDM2 inhibitor idasanutlin (up to 320 nM, less than 10% concentration of Cmax) (Selleck). We obtained MDM2 inhibitor-resistant (R) AML cells after 96 days of the drug exposure and found that the resistant cells harbor hotspot TP53 p.R248W (R248W) mutation. We next isolated single cell clones from MOLM-13 R cells by limiting dilution, and obtained twelve subclones (subclones #1-12 in order of development). All clones carried the same R248W mutation. To determine clonal patterns of these cells, we performed single cell DNA sequencing (scDNAseq) of MOLM-13 parental, R and subclone #1 and #2 (SC1 and SC2) cells using the MissionBio Tapestry system covering 125 amplicons of 19 genes frequently mutated in AML. scDNAseq identified FLT3-ITD mutations in all cells analyzed, as expected. In the parental cells we identified only 0.02% cells (1/ 5,240) with the identical R248W mutation found in MOLM-13 R cells. MOLM-13 R cells had only 0.6% of wild-type TP53 cells, 51% carrying R248W only, and 43% R248W/R213* mutation (R248W/R213*). SC1 and SC2 cells had 1% and 99% of R248W and R248W/R213* clones, respectively (Fig.1). Seven other mutations were detected by scDNAseq. Results suggest that MDM2 inhibition can accelerate the selection of TP53-mutant AML cells in vitro. Of note, the parental cells had remained mostly p53 wild-type, where the subclone with mutant R248W did not have a growth advantage over other cells. Next we analyzed patient samples enrolled in the phase 1 clinical trial (NCT02319369) for the MDM2 inhibitor milademetan (DS-3032b; Daiichi-Sankyo) in relapsed/refractory AML or high-risk MDS patients. Fifty seven patients were treated with single agent milademetan in the study. All but one patient had wild-type TP53 as determined by NGS at baseline. One patient (1.8%) had a TP53 p.R213* mutation at baseline with VAF of 91%. Four patients (7%) developed different TP53 mutations (R248Q, R248W, P250fs, V122fs and V274L), with increasing VAFs that were not detected at baseline to 19% average, ranging from 11% to 28% post treatment, One patient (anonymized ID 1001-1005) developed both, R248Q and R248W mutations, detected at cycle 2 day1 (C2D1, day 29). The pre-existing R213* mutation detected in one patient persisted with increased VAF after treatment (91% to 100%). To detect p53 mutations with higher sensitivity than NGS, we performed droplet digital PCR (ddPCR) for R248W/Q and R273H in samples from two patients. ddPCR detected 0.46% and 0.62% of R248Q and R248W mutations, respectively, at baseline, which were not detected by NGS, with increased VAFs of 18.2 and 27.6% at C2D1, respectively. ddPCR detected additional R273H mutations with VAFs of 0.08% and 0.18% at baseline, and 2.2% and 2.6% in these patients at C2D1, respectively. Conclusion: Data suggest that MDM2 inhibition selects rare AML subpopulations with TP53 mutations and careful monitoring of patients treated with MDM2 inhibitors with sensitive methods to detect TP53 mutant clones is warranted. This finding also points to the need to develop strategies to prevent/suppress these clones early on. Disclosures Kumar: Daiichi-Sankyo Inc.: Current Employment. Patel:Daiichi-Sankyo Inc.: Current Employment. Dos Santos:Daiichi Sankyo, Inc.: Current Employment. DiNardo:Daiichi Sankyo: Consultancy, Honoraria, Research Funding; Novartis: Consultancy; ImmuneOnc: Honoraria; Calithera: Research Funding; Celgene: Consultancy, Honoraria, Research Funding; Notable Labs: Membership on an entity's Board of Directors or advisory committees; AbbVie: Consultancy, Honoraria, Research Funding; MedImmune: Honoraria; Jazz: Honoraria; Agios: Consultancy, Honoraria, Research Funding; Takeda: Honoraria; Syros: Honoraria. Andreeff:Daiichi-Sankyo; Jazz Pharmaceuticals; Celgene; Amgen; AstraZeneca; 6 Dimensions Capital: Consultancy; Daiichi-Sankyo; Breast Cancer Research Foundation; CPRIT; NIH/NCI; Amgen; AstraZeneca: Research Funding; Centre for Drug Research & Development; Cancer UK; NCI-CTEP; German Research Council; Leukemia Lymphoma Foundation (LLS); NCI-RDCRN (Rare Disease Clin Network); CLL Founcdation; BioLineRx; SentiBio; Aptose Biosciences, Inc: Membership on an entity's Board of Directors or advisory committees; Amgen: Research Funding.

Gli stili APA, Harvard, Vancouver, ISO e altri

45

Zhu, Shichao, Lin Cai, Chunhua Ma, Hongmei Zeng, Hua Guo, Xiaoqing Mao, Chenghui Zeng et al. "The Clinical Impact of Ventilator-Associated Events: A Prospective Multi-Center Surveillance Study". Infection Control & Hospital Epidemiology 36, n. 12 (27 agosto 2015): 1388–95. http://dx.doi.org/10.1017/ice.2015.200.

Testo completo

Abstract (sommario):

OBJECTIVEThe Centers for Disease Control and Prevention (CDC) has developed an approach to ventilator-associated events (VAE) surveillance. Using these methods, this study was performed to investigate VAE incidences and to test whether VAEs are associated with poorer outcomes in China.DESIGNA 4-month, prospective multicenter surveillance study between April and July 2013.SETTINGOur study included 15 adult intensive care units (ICUs) of 15 hospitals in China.PATIENTSPatients admitted to ICUs during the study periodMETHODSPatients on mechanical ventilation (MV) were monitored for VAEs: ventilator-associated conditions (VACs), infection-related ventilator-associated complications (IVACs), and possible or probable ventilator-associated pneumonia (VAP). Patients with and without VACs were compared with regard to duration of MV, ICU length of stay (LOS), overall hospital LOS, and mortality rate.RESULTSDuring the study period, 2,356 of the 5,256 patients admitted to ICUs received MV for 8,438 ventilator days. Of these patients, 636 were on MV >2 days. VACs were identified in 94 cases (4.0%; 11.1 cases per 1,000 ventilator days), including 31 patients with IVACs and 16 with possible VAP but none with probable VAP. Compared with patients without VACs, patients with VACs had longer ICU LOS (by 6.2 days), longer duration on MV (by 7.7 days), and higher hospital mortality rate (50.0% vs 27.3%). The mortality rate attributable to VACs was 11.7%. Compared with those with VACs alone, patients with IVACs had longer duration on MV and increased ICU LOS but no higher mortality rates.CONCLUSIONSIn China, surveillance of VACs and IVACs is able to identify MV patients with poorer outcomes. However, surveillance of possible and probable VAP can be problematic.Infect. Control Hosp. Epidemiol. 2015;36(12):1388–1395

Gli stili APA, Harvard, Vancouver, ISO e altri

46

Garg, M. "Exploring use of Real World Evidence (RWE) in us Value Assessment Frameworks (VAFS)". Value in Health 21 (maggio 2018): S106. http://dx.doi.org/10.1016/j.jval.2018.04.723.

Testo completo

Gli stili APA, Harvard, Vancouver, ISO e altri

47

Duan, Yi Tong, Fang Jing Liu, Lu Wang e Yong Feng Li. "Analysis of Acidic End Products and Molecular Characterization of Biohydrogenbacterium R3 sp.nov". Advanced Materials Research 183-185 (gennaio 2011): 27–30. http://dx.doi.org/10.4028/www.scientific.net/amr.183-185.27.

Testo completo

Abstract (sommario):

Biohydrogenbacterium R3 sp.nov, as a typical strains of hydrogen production bacteria, was isolated from the activated sludge in the biohydrogen production reaction by using culture media of HPB-LR which was designed particularly for isolating anaerobic fermentation bacteria and an improved Hungate rolling tubes technique and a plate method of culture bottle (PMCB) which were used for counting and isolating the anaerobes by our lab. Two representative strains of hydrogen production bacteria, namely RL20, RL37, and a strain of no hydrogen production bacterium, namely RL16 were used as contrast analysis. Experiment results indicated that the distributed proportion of ethanol and acetic acid was 95%-99% in the total amount of VAFs (Volatile Fatty Acid) of R3 which were typical ethanol-type fermentation, and the total amount of ethanol and acetic acid was commensurate with that of propionic acid.

Gli stili APA, Harvard, Vancouver, ISO e altri

48

Wong, Wing Hing, Kevin Elliot, Iskra Pusic, John F. DiPersio e Todd E. Druley. "Investigating the Effects of Clonal Hematopoiesis in Healthy Marrow and Blood Donors on the Outcomes of Recipients Following Hematopoietic Stem Cell Transplantation". Blood 132, Supplement 1 (29 novembre 2018): 2180. http://dx.doi.org/10.1182/blood-2018-99-115427.

Testo completo

Abstract (sommario):

Abstract Background: Using error-corrected sequencing with a detection limit of 0.0001, Young et al. (2016) found that 95% of healthy individuals harbor somatic mutations in blood cells in genes associated with leukemia. In addition to increasing the risk of AML (Jaiswal et al. 2014), these clones have recently been associated with cardiac dysfunction (Fuster et al. 2017; Jaiswal et al. 2017). This prompted us to consider the impact of clonal hematopoiesis from healthy donors on outcomes in recipients of allogeneic hematopoietic stem cell transplantation (HSCT). Indeed, donor-derived hematological complications have been anecdotally documented where rare donor clones harboring pathogenic mutations expanded in the recipients following HSCT. As a result, hematopoietic progenitors harboring mutations conferring self-renewal or growth advantages that facilitate preferential engraftment could be unknowingly transferred from donor to recipient (Gibson et al. 2017). Several retrospective studies of secondary hematopoietic malignancies post-HSCT have shown that donor clones harboring mutations in JAK2 and DNMT3A with low variant frequency (VAF) have undergone clonal expansion in the recipients (Yasuda et al. 2014). To date, there has not been a systematic and quantitative study to assess how donor clonal hematopoiesis engrafts and potentially affects the clinical outcome of recipients. In this study, we aim to quantify the spectrum of donor clones that engraft the recipient by longitudinally tracking clonal dynamics in the recipients at three time points post-HSCT. We also aim to compare individual patient outcomes with clonal engraftment. Methods: Error-corrected sequencing (ECS) on 80 genes frequently mutated in AML was performed on 133 isolated peripheral blood leukocytes from 27 allogeneic HSCT recipients at Washington University and the Siteman Cancer Center. Five samples were obtained for each patient which include the matched donor sample from the CIBMTR (n=25) along with pre-transplant, day 30 post-HSCT (D30), day 100 post-HSCT (D100) and one year post-HSCT (D360) for all patients. Independent biological replicates were sequenced for each sample and only the somatic events found in both replicates will be considered true positives using published and validated computational pipelines and thresholds. Results and Conclusions: All D30 and D100 samples harbor clonal mutations (mean 5.67 variants in D30 samples; 5.52 variants in D100 samples) with VAFs ranging from 0.0005 - 0.11. A total of 126 variants are only observed in D30 samples while 122 variants are only observed in D100. Twelve patients have 27 filtered mutations observed in both time points with general increase in VAFs in the later time point. Interestingly, we found SRCAP to be most recurrently mutated in both D30 and D100 samples (48.1% and 33.3%, respectively). This gene has recently been implicated in therapy-related clonal hematopoiesis following cytotoxic treatment (Wong et al. 2018). SRCAP is not frequently observed in clonal hematopoiesis in individuals without preceding hematological disorders or cytotoxic treatments. Therefore, these observed SRCAP variants could either: 1) be present in donors in very low VAFs or 2) arise after transplantation. Analysis of donor sequencing data would provide insight into this. Overall, we find that ECS is a specific and sensitive method for quantitatively characterizing the dynamics of clonal engraftment and proliferation in allogeneic HSCT recipients. In addition, we have found that mutated SRCAP appears to promote clonal engraftment and expansion after conditioning therapy, similar to recent results post-chemotherapy. Future work: Computational analysis of donor and recipient pre-transplant samples along with D360 samples is underway and nearly complete. Correlating ECS results with clinical and demographic (e.g. age and gender of donor and recipient) data is also underway. Disclosures No relevant conflicts of interest to declare.

Gli stili APA, Harvard, Vancouver, ISO e altri

49

Garcia-Gisbert, Nieves, Lierni Fernández-Ibarrondo, Concepción Fernández-Rodríguez, Laura Camacho, Anna Angona, Joan Gibert, Xavier Calvo et al. "Molecular Characterization of Ph-Negative Myeloproliferative Neoplasms in Tumor Circulating Nucleic Acids". Blood 134, Supplement_1 (13 novembre 2019): 2953. http://dx.doi.org/10.1182/blood-2019-123003.

Testo completo

Abstract (sommario):

Introduction. Genetic studies in patients with Ph-negative myeloproliferative neoplasms (MPNs) are essential to establish a correct diagnosis and to optimize their management. Recently, it has been demonstrated that it is possible to detect molecular alterations present in solid tumors and hematologic neoplasms by the analysis of circulating tumor DNA in plasma samples, which is known as liquid biopsy. It has been reported that most of the circulating cell-free DNA (cfDNA) has its origin in immature hematopoietic and bone marrow cells; however, there is limited information about liquid biopsy applications in MPNs. Objective. To analyze the molecular profile of circulating tumor DNA in patients with MPNs. Patients and methods. Peripheral blood samples from 75 patients with MPNs were collected at the time of diagnosis: 21 polycythemia vera (PV), 42 essential thrombocythemia (ET), 10 primary myelofibrosis (PMF) and two non-classifiable MPNs. Cellular DNA was extracted from the granulocytic fraction isolated by density gradient centrifugation and cfDNA was obtained from 1-3ml of plasma (MagMAX Cell-Free DNA Isolation Kit, Thermo Fisher Scientific). cfDNA purity was ascertained by capillary electrophoresis (4200 TapeStation system, Agilent). Molecular characterization was performed in paired samples of granulocytes DNA and cfDNA by next generation sequencing (NGS). Libraries were prepared using a custom panel that covered the whole codifying region of 25 myeloid-associated genes (QIAseq Custom DNA Panels, Qiagen) and sequenced using Illumina technology (Miseq, Nextseq) with a 3000x minimum coverage. Results. The amount of total cfDNA/mL in plasma was significantly higher in PMF (mean 97 ng/ml) than in PV and ET (mean 18 and 23g/ml, respectively) (p = 0.003, Kruskal-Wallis). Overall, 144 mutations in driver (JAK2, CALR, MPL) and non-driver genes were detected in the granulocytic fraction with similar frequencies to what has been described for PV, ET and PMF. The most frequently mutated non-driver genes where ASXL1 (18.7%), TET2 (17.3%), DNMT3A (6.7%), SRSF2 (6.7%) and IDH2 (5.3%). Sequencing of cfDNA showed a total of 146 mutations. All mutations detected in the granulocytic fraction were also detected in the paired cfDNA sample (100% concordance); two additional mutations in MPL and ASXL1 were detected in plasma in one case. The median variant allele frequency (VAF) present in cfDNA was 29% (range 0.86 - 91.73%), which is far superior to what has been described in solid neoplasms or lymphomas (median 0.41%, range 0.03% - 97.6%). A strong correlation was observed between the VAFs of granulocytic DNA and cfDNA (r = 0.875, p < 0.001, Spearman) (Figure 1). The mutation VAFs detected in cfDNA were significantly higher than VAFs detected in granulocytes (p < 0.001, Wilcoxon). In particular, MPL mutations presented 2.5 higher VAF in cfDNA than in granulocytes (p = 0.018, Wilcoxon). This finding was confirmed and quantified by digital PCR. Interestingly, in one PMF patient the p.W515L MPL driver mutation was originally only detectable by NGS in cfDNA, but not in granulocytes. This mutation was identified by ultra-sensitive digital PCR in both cfDNA (VAF 2.30%) and granulocytes (VAF 0.16%). Conclusions. The analysis of circulating tumor DNA allows the characterization of the molecular abnormalities of patients with Ph negative myeloproliferative neoplasms. The sensitivity for mutation detection in driver and non-driver genes was equal or even superior to that obtained when studying the isolated granulocytic population. Disclosures Salar: Roche: Research Funding, Speakers Bureau; Janssen Pharmaceuticals: Consultancy, Speakers Bureau; Gilead: Consultancy, Speakers Bureau; Celgene: Consultancy. Besses:Gilead: Research Funding. Bellosillo:TermoFisher Scientific: Consultancy, Speakers Bureau; Qiagen: Consultancy, Speakers Bureau.

Gli stili APA, Harvard, Vancouver, ISO e altri

50

Schmidt, Elizabeth, Devon M. Fitzgerald, Camila Zanette, Gavin D. Meredith, Mark A. McElwain, Raul Burciaga, Kevin C. Vavra, Thomas H. Smith, Jesse J. Salk e Jake Higgins. "Abstract LB254: Accurate detection of low frequency AML-associated mutations in vitro using Duplex Sequencing with enzymatic fragmentation". Cancer Research 83, n. 8_Supplement (14 aprile 2023): LB254. http://dx.doi.org/10.1158/1538-7445.am2023-lb254.

Testo completo

Abstract (sommario):

Abstract Sensitive and specific detection of low frequency mutations in acute myeloid leukemia (AML) is critical in research of minimal residual disease (MRD). At variant allele frequencies (VAF) below approximately 1%, PCR and sequencing errors result in prohibitive signal-to-noise ratios with next generation sequencing (NGS). Duplex Sequencing (DS) relates the original top and bottom DNA strands to make double stranded consensus sequences to greatly reduce errors. In two experiments we show further improvement of DS of AML-related genes by the use of enzymatic fragmentation (EF) and an updated gene panel that incorporates 2022 European LeukemiaNet (ELN) recommendations. In the first DS study, 29 AML-related genes (59 kb) were targeted in hybrid capture. Mutant cell line DNA was mixed into DNA from a healthy young donor to simulate MRD. Expected VAFs in mixtures were 1.0-0.003%. Samples comprised a mix of 4 insertions and deletions (indel), a mix of 15 single nucleotide variants (SNV), and 4 serial dilutions of a FLT3 ITD plus an NPM1 insertion. Pure diluent DNA was used as a negative control. Each sample was prepared in quadruplicate with mechanical fragmentation (MF) vs EF. DNA input mass was 1,500 ng per replicate, except for 50-250 ng for the FLT3/NPM1 mixes with expected VAF of 1% and 0.1%, respectively. Input masses were set to ensure >95% probability of detection of all mutations in the combined data. All targeted variants down to 0.003% VAF were detected in spike-in mixtures, with expected vs observed VAF highly correlated whether using MF or EF (R2 >0.98 for all mixtures). Duplex molecular depth was 1.2-2.0x higher with EF vs MF across input masses. Panel-wide mean duplex depth per 1,500 ng replicate was 30,376x for MF and 48,036x for EF, for combined mean depths of 121,508x for MF and 192,144x for EF. In the negative control, background mutational calls at spike-in positions were 4/2,993,429 duplex bases using MF and 0/4,780,491 duplex bases with EF, reflecting increased specificity with EF. Next, a revised panel targeting 36 AML-related genes (80 kb) was used for DS with EF. Here differing mutant cell line DNA was mixed into the same diluent from above (the negative control). This mixture harbors 27 variants with expected VAFs of 0.125-0.006% (4 indels, 21 SNVs, a FLT3 ITD and an NPM1 insertion), 17 of which (2 indels, 14 SNVs and the NPM1 insertion) span VAFs of 0.011-0.009% to establish a limit of detection of 0.01%. With 2,000 ng (+/- 10%) input, for 14 samples, panel-wide mean duplex depth was 56,528x. For variants with expected VAF ≥ 0.009%, the assay had >98% sensitivity, >96% specificity, and >98% accuracy at genomic positions of known true positive variants. In summary, DS with EF yields more data per nanogram of DNA than MF, maximizing the use of precious samples. This method exhibits extremely low background mutation signal and a low limit of detection across targets that are valuable in AML MRD research. Citation Format: Elizabeth Schmidt, Devon M. Fitzgerald, Camila Zanette, Gavin D. Meredith, Mark A. McElwain, Raul Burciaga, Kevin C. Vavra, Thomas H. Smith, Jesse J. Salk, Jake Higgins. Accurate detection of low frequency AML-associated mutations in vitro using Duplex Sequencing with enzymatic fragmentation [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2023; Part 2 (Clinical Trials and Late-Breaking Research); 2023 Apr 14-19; Orlando, FL. Philadelphia (PA): AACR; Cancer Res 2023;83(8_Suppl):Abstract nr LB254.

Gli stili APA, Harvard, Vancouver, ISO e altri

Articoli di riviste sul tema "Vafs"

Cita una fonte nei formati APA, MLA, Chicago, Harvard e in molti altri stili