Articoli di riviste sul tema "Tokyo (Japan). Koiwa Library"

In 1989, the Japan Art Documentation Society (JADS) was born, with inspiration received from members of overseas art library organisations – ARLIS/UK and Ireland, ARLIS/NA, ARLIS/ANZ and others – who attended the 52nd General Conference of the International Federation of Library Associations and Institutions (IFLA) in Tokyo in 1986. However, JADS was very definitely JADS: it did not try to become ARLIS/Japan. What reasoning lay behind the choice of the society’s name? And after its establishment what path did JADS follow: what role did it take on for itself as the framework for joint projects in the art library community in Japan? What were the activities that it aimed to provide to enhance collaboration between museums, libraries and archives? Focussing mainly on the growing interest in Japan in recent years in creating networks between museums, libraries and archives, and on the opening in 2004 of the Art Libraries’ Consortium (ALC), a union catalogue of art libraries based in the Tokyo metropolitan area which has been steadily expanding, this article gives a chronological overview of the developments that have taken place in art libraries and art documentation in Japan from 1986 to 2012.

The National Research Institute for Cultural Properties, Tokyo had its beginnings in the Institute of Art Research, which was the first institution to specialise in research in fine art in Japan. The library at the Institute played a central role from the very start, acquiring and making accessible its large collection of material related to fine art, with an emphasis on books and photographs. In recent years, we have also begun to play a role as an archive and information centre. What were the original aims and objectives behind the establishment of the library, and how have its activities changed? Amidst the many developments in recent years – the role of the internet, now a major information tool, the organisational changes at the Institute itself – it is essential that we continue to do the work for which we have long been recognised in art history research and the preservation and utilisation of cultural properties, and at the same time find ways to collaborate with related institutions.

AbstractThe Japanese government has initiated lifelong learning policies to promote lifelong learning to a super-aging society. It is said that lifelong learning contributes to a richer and more fulfilling life. It is within this context that public libraries have been identified as ideal facilities for promoting lifelong learning. To support lifelong learning successfully, libraries must accurately grasp citizens’ needs, all while working within limited budgets. To understand citizens’ learning needs, this study uses public library circulation data. This study is significant because such data use is often unavailable in Japan. This data was used to clarify citizens’ learning interests. Circulation data was compared from two libraries in Japan: Koto District Library in Tokyo and Tahara City Library in Aichi Prefecture. The data was used to identify general learning needs while also accounting for regional differences. The methodology and results of this research are significant for the development of lifelong learning policy and programming.

AbstractZhongguo guidai tianxiang jilu zongji pressed in 1988 containes ancient Chinese astronomical records including that of meteor, meteorite fall and comet until 1911 from the Standard Histories and local gazetteers existed in China. On the other hand, many local gazetteers lost in China at present have been collected in university and public libraries in Japan. Especially the library of Chinese section in the Research Institute for Humanistic Studies in Kyoto University and the Oriental Library in Tokyo have big collection. This presentation will give a few dozens supplemential ancient records with that big book from local gazetteers in above mentioned libraries.

We report the performance of Wilson and Domainwall Kernels on a new Intel Xeon Phi Knights Landing based machine named Oakforest-PACS, which is co-hosted by University of Tokyo and Tsukuba University and is currently fastest in Japan. This machine uses Intel Omni-Path for the internode network. We compare performance with several types of implementation including that makes use of the Grid library. The code is incorporated with the code set Bridge++.

<p><strong>Abstract.</strong> The Kashiwa Library (KL), The University of Tokyo, holds a collection of old paper maps over the world, about a half of which were originally collected for the International Map Exhibition 1980 in Tokyo. The collection has 3,200 maps published in the 1970s and 1980s, and 1,260 of them were displayed at the exhibition. The map collection is important because it represents the cartography at the emerging era of new technologies and techniques such as satellite remote sensing, computers and GIS for map production (Arikawa et al., 2016). These maps were donated from the Japan Cartographers Association in March 2016, after their collection and storage by the association since the exhibition. In the Japanese fiscal year 2017, the Center for Spatial Information Science (CSIS), The University of Tokyo, and KL started a cooperative research project to produce a digital archive of this map collection, with support from the University of Tokyo Academic Archives Project that facilitates digital archiving of academic materials owned by various units at the university. This presentation explains the procedure of making our digital archive “Kashiwanoha Paper Maps Digital Archive”. “Kashiwanoha” is the address of the Kashiwa Campus of The University of Tokyo where KL and CSIS are located, and it literally means “oak leaf”.</p>

The article considers the Russian printing in the countries of the Asia-Pacific region (China, Japan, Korea, USA, etc.). The author offers the review of literature published in Russian in these countries, basing on the materials of the Russian North-East Asian collection of Hamilton Library of the University of Hawaii (Honolulu, USA), which is one of the best collections in the world on this subject. The article reports on the history of the Russian collection and its creators. The author discusses the terms “Russian book Diaspora” (publishing emigrant activities within the same country — China, Japan, USA, etc.) and “Russian book community” (publishing activities of people from Russia within the same city, such as Harbin, Shanghai, Tokyo; organizations or groups of individuals, etc.). Special attention is paid to the bibliographic description of this collection, which was first published in 2002 in the publishing house of the Russian State Library “Pashkov Dom” (“Russian print in China, Japan and Korea: Catalogue of the collection of Hamilton Library of the University of Hawaii”) and reprinted in the expanded version in 2016 under the title “Russian print in the Asia-Pacific region” (in 4 parts). The article also reports on other foreign collections that contain emigrant publications, including those printed in the countries of the Asia-Pacific region (the libraries of the University of California in Berkeley, the Hoover Institute for war, revolution and peace, and the Museum of Russian culture in San Francisco). The author presents the data on the work of scientific centre of the University of Hawaii for the study of the USSR / Russia “Soviet Union in Pacific Asia Rim”. The article analyses international cooperation of the University of Hawaii library with Russian libraries, in particular, its relations with the libraries of the Russian Far East. The author describes the project of the University of Hawaii Library to create the electronic library catalogue with complete bibliographic and historical information about each edition of the collection and to expand the exchange of literature and information.

COVID-19 has plunged the world into chaos. Global cases increase every day, impacting economic, social and political sectors. Japan is among the impacted countries. How does it deal with the pandemic? The aim of this article is to examine the election in the Tokyo Prefecture area during the pandemic. It is a gubernatorial election that was held on July 5, 2020. The election was held when a seat vacancy occurred as demanded by democratic processes. At the same time, the election was held while the COVID-19 pandemic was spreading across the country, which included Tokyo. Therefore, this article juxtaposes the term democracy against "demo"crazy (you crazy) to show the conflict of norms between the demands of democracy and the madness of holding elections when the situation is considered inappropriate. The term “demo”crazy is a mix of Kelantan Malay words representing you and crazy (madness). The combination of the words translates as "you are crazy." It also reflects that holding elections at the wrong time is considered to be madness. How did the candidates conduct their campaigns and the voting? What was the content of the campaigns during the pandemic? What was the effect of the elections? This study uses the library research methodology to answer these questions. This study found that the demand for democracy was more important than waiting for a possible recovery in the situation. Although holding an election was considered a crazy move, as a supporter of democracy, an election was still considered to be a priority.

Robert Owen’s ideas arrived in the Far East in the late nineteenth century when Japan abandoned its “closed-door” policy. Owen’s views became widely known through numerous translations and publications after the Meiji Restoration in 1868. His ideas have proven influential particularly in the areas of childcare, social welfare, management practice and social movements although his influence on communal life has been limited. Owen has often been viewed negatively as a utopian socialist by Marxists but he has inspired co-operative leaders including Dr Toyohiko Kagawa. Owen has been studied by researchers of social philosophy including Professors Shigeru Goto and Chushichi Tsuzuku. Today, Hitotsubashi University and Meiji University in Tokyo hold the Owen Collection and the Owen Library, respectively. The Robert Owen Association of Japan was set up by concerned researchers and co-operative practitioners in 1958, commemorating the centenary of Owen’s death. It is active in promoting scholarship on Robert Owen and worldwide co-operative history through regular symposia and publications in both English and Japanese. The story of the Rochdale Pioneers remains popular even today and is often revisited by academic essays, books, comics and films while a replica of Rochdale’s Toad Lane Museum was built by Co-op Kobe.

It is important that science is inclusive and communication is prioritised. To make science accessible to all, the gap between highly specific research and people with a general interest in science must be bridged. Effective science communication also helps to engage young people and inspire them to pursue a career in science. In Tokyo, Japan, Dr Kumiko Usuda-Sato, National Astronomical Observatory of Japan (NAOJ), and Dr Lina Canas of the International Astronomical Union (IAU) Office for Astronomy Outreach (OAO), are working to achieve effective communication and full inclusion. The researchers are interested in ensuring that science reaches diverse people, including people with a disability such as blind and visually impaired (BVI) people, as well as promoting diversity and inclusivity within international astronomical research communication. To this end, Usuda-Sato is engaging with the BVI community and tactility experts at the Japan Braille Library. A key focus is on developing resources for helping people to understand the Subaru Telescope, such as 3D printed models, braille and 2D explanations, as well as adapted communication methods. Canas is working to make the research community aware of accessibility issues. A key component of this was the IAU Symposium358, which brought together experts in accessibility and science communication, fostering discussion and promoting international collaboration.

Herzog and de Meuron were 2001 Pulitzer prize winners. Their buildings are famous because of the unique and amazing epidermis. In their representative works, there are two major ways to create and form epidermis. The first one is learning from the surrounding context and environment, and the second is thinking about the features of architectures. This paper, through the investigation of six of their major works: Dominus Winery in California of the US(1998), De Young Museum in San Francisco (2004), the library of Brandenburg Industrial University in Germany, the Tokyo Prada flagship store in Japan, Munich Allianz Stadium in Germany, and Laban Centre for Contemporary Dance in London, summarizes the main methods of H&dM.Architecture surface processing is becoming more and more concerned by the construction industry and the viewers. H&dMs methods of design provide our use for reference. Let us look forward to their next new work.

Japonica in the Archives Left after Bronisław Piłsudski in the Cracow PAU-PAN Academic Library (9). Fujihiko Sekiba’s Mailing (Letter and Book) Sent to Bronisław Piłsudski and its Situational Context The present material constitutes the ninth installment of the series introducing Japanese documents preserved with Bronisław Piłsudski’s archives in the Academic Library of the Polish Academy of Sciences and Lettres (PAU) and Polish Academy of Sciences (PAN) in Cracow and includes photocopies of a letter in German (with its envelope indicating the addressee and the sender in Japanese, its decipherment transcript, and translation into Polish) dated , sent, together with an attached book, to Bronisław residing at that time in Tokyo by Dr. Fujihiko Sekiba, a renowned physician famous all over Japan, long-standing head of the Hokkaido Medical Association and a hospital (both founded by himself), but also medicine historian, anthropologist and one of the pioneers in Japanese ethnomedicine. The book of his own authorship was an extensive monograph on Ainu medicine studied also by Bronisław himself. The paper provides essential data concerning Sekiba’s biography and his legacy (especially, his scientific publications and the hospital still existing and considered one of the leading medical institutions in Hokkaido), and the book in question itself, with an appeal to make every effort possible to trace and find the copy of the book (possibly with some personal dedication) sent, but so far unidentified: Piłsudski, a dedicated collector of “things Ainu”, never easily parted with such items). The letter and the book mailed to Bronisław demonstrate how famous Piłsudski was in Japan as an Ainu researcher as early as 1906 (six years prior to the publication, in Cracow, of Materials for the Study of the Ainu Language and Folklore that secured for him the eternal reference in the annals of academic research worldwide. Mentioned have also been certain related publications on Ainu medicine by Piłsudski.

This article, an elaboration on The Desperate Diplomat (2016), reexamines Japanese Special Envoy Kurusu Saburo’s mission to the United States before Japan attacked Pearl Harbor on 7 December 1941, presenting a new “concurring opinion” in support of his innocence. The u.s. government firmly believed that Kurusu had been informed of the impending attack prior to coming to the United States and thus acted as a smoke screen. And so, the myth of the deceitful ambassador was born. Nevertheless, Kurusu insisted that he had no prior knowledge of Japan’s military action. Misunderstanding of his role in the Pearl Harbor attack and harsh remarks about it upset him. Utilizing Kurusu’s unpublished and previously unused materials in both Japanese and English housed in the National Diet Library in Tokyo, records from the International Military Tribunal for the Far East, and The Desperate Diplomat, based on his original memoir, this article helps Kurusu tell his side of the story to initiate scholarly debate on this insufficiently researched diplomat. This reassessment also presents excerpts from Kurusu’s unpublished personal correspondences with E. Stanley Jones, Bernard M. Baruch, and Joseph C. Grew.

This research discusses the language acquisition of 2-year-old children in terms of phonology and syntax. The purpose of this study is to describe the language acquisition in terms of phonology and syntax of 2-year-old children in Kimono Mom YouTube channel episode 1 to 4. The data source of this research is "Kimono Mom" YouTube channel, episode 1 to episode 4 and the data in the study are utterances expressed by a Japanese child named Sutan who lives with his father and mother in Tokyo, Japan. In his daily life Sutan often communicates with his parents, especially with his mother named Moe. This research is descriptive qualitative research with the method of note taking method and library research. The theory used is the theory of language acquisition in terms of phonology and syntax. The results show that in terms of phonology Sutan can pronounce all vowel sounds except the vowel sound [ɯ]. Sutan can pronounce all consonant sounds perfectly except consonant sounds [ŋ], [ʦ] and [ʣ], as well as consonant sound [ʤ] located at the beginning of the word. In addition, Sutan can pronounce all the special phoneme sounds of Japanese except the double vowel sound (chou boin). In terms of syntax, Sutan can pronounce declarative, imperative, interrogative, and exclamative sentences according to the context even though they are in the form of short sentences and still rarely use particles and the sentence only reaches the verb.

The article examines the relationship between two leading countries – Great Britain and the United States, which had a significant impact on international political situation in the world in 1930s and still have nowadays. As a vector of research, the author takes the factor of the Japanese militaristic regime because of the rather similar current geopolitical situation due to the aggressive actions of Russian Federation. According to this, the author aimed to conduct a comprehensive analysis and his own assessment of the impact of Japan’s behavior in the international arena on the development of British-American relations in various fields. The chronological boundaries of the study are the period from the Mukden incident ‒ the beginning of Japanese invasion in the north-eastern part of China (September, 1931) to the conclusion of Berlin (Tripartite) Pact between Japan, Italy and Germany (September, 1940). Methodology: the article uses a comparative-historical method to compare and analyze the influence of Japan and Germany on the foreign policy of London and Washington, as well as descriptive method ‒ to identify the essence and features of British-American relations during 1931–1940. The use primarily of a wide base of diplomatic documents, archival sources from the F. D. Roosevelt Digital Library, cabinet papers of the British government allowed the author to apply the systematic approach and the principle of objectivity working with only verified facts and their comprehensive assessment. Scientific novelty: for the first time in Ukrainian historiography the author analyzed and rethought the process of how did Japan’s aggressive actions influence on US-British relations on the eve and beginning of World War II regarding the current geopolitical situation. The author concludes that the leadership of the United States and Great Britain did not realize the threat from Japan in time, that their inconsistent actions only contributed to the rapprochement of Tokyo with Nazi Germany and Fascist Italy, culminating in the formation of a tripartite military alliance («axis»). According to the author, the ambiguity of the position of London and Washington caused primarily by the struggle for spheres of influence in the Pacific area and trade conflicts between them in general. In view of this, the article emphasizes the need for modern leading states, especially Great Britain and the USA, to take into account the mistakes of the past in order to prevent a repeat of the Japanese scenario in the international arena in future.

Abstract Background: Cancer Genome Profiling (CGP) tests are now widely available in daily practice. However, only a very small fraction of patients have the opportunity for genome-guided therapies. Somatic mutations from cancer specimens are unique to individual patients and hold utility as individual tumor markers in blood. We have developed an original circulating tumor DNA (ctDNA) monitoring system, called OTS (Off-The-Shelf)-Assay, at Iwate Medical University Hospital, Yahaba, Japan. Patients and Methods: Between April 2022 and October 2023, 79 patients who received the OTS-Assay were enrolled in the present analysis. The OTS-Assay includes three steps: (a) OTS-Scan (somatic mutation identification by either tissue or blood), (b) OTS-Select (somatic mutation selection), and (c) OTS-Monitor (periodical somatic mutation quantification as ctDNA). For the OTS-Select, we established an originally developed &gt;90 stepwise selection algorithm. One of the determinants is the availability of appropriate digital PCR (dPCR) probes for individual patients. Here, we search the probes for individual patients from the dPCR probe library, OTS-1000ex, which consists of &gt;1000 probes against frequently reported human somatic mutations (Quantdetect, Tokyo, Japan). Results: All 79 patients were subject to the analysis. The cancer stage of all the patients was advanced. More than 10 tumor types were enrolled, including esophagus (n=42), colorectal (n=12), breast (n=7), lung (n=4), pancreas (n=3), hematological (n=3), and others (n=8). Fifty patients received OTS-Scan, and 29 patients had received a CGP test before the OTS-Assay (i.e., OTS-Scan was not needed). Seventy-five patients received OTS-Select, meaning that four patients had somatic mutations that were designated for ctDNA monitoring. All 79 patients received at least one OTS-monitor. The number of OTS-Monitors received ranged from 1 to 11 during the 19-month period, and the average interval was 3.0 months. The average pretreatment variant allele frequency (VAF) was 4.96% and the majority of the follow-up VAF was less than 1%. More than 90% of the patients had at least one clinical validity defined by: (a) early relapse prediction, (b) treatment efficacy evaluation, or (c) no relapse corroboration. Conclusion: The OTS-Assay system provides stable longitudinal ctDNA monitoring at the range of less than 1% of VAF using the originally developed dPCR probe library. The sensitivity and affordability of the OTS-Assay system allows frequent monitoring, which leads to obtaining important clinical information in the context of advanced cancer therapy. Citation Format: Satoshi S. Nishizuka, Hayato Hiraki, Akiko Yashima-Abo, Takeshi Iwaya. Longitudinal tumor-informed ctDNA monitoring with the originally developed OTS-Assay system [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 3658.

Abstract Background: Many patients undergo a next generation sequencing (NGS)-based cancer genome profiling (CGP) test, but it often does not aid in choosing an optimal therapeutic regimen. Therefore, the genomic information should be used for minimal residual disease (MRD) detection, which directly leads to improved post-treatment cancer patient management. Circulating tumor DNA (ctDNA) is a small fraction of DNA present in blood that carries somatic mutations in cancer patients. Our previous studies demonstrated the clinical validity of ctDNA as a tumor marker for MRD detection. However, the variant allele frequency (VAF; reflecting the fraction of somatic mutations) of ctDNA is less than 1%, at which stable detection is difficult for NGS. Instead of NGS, we have established a highly sensitive ctDNA monitoring system for MRD detection using an originally developed library of &gt;1000 digital PCR (dPCR) probes. Patients and Methods: Using a Clinical Institutional Review Board approval from the Iwate Medical University Hospital, we initiated a dPCR assay system, called off-the-shelf (OTS)-Assay, in April 2022 under a partnership with Quantdetect, Inc (Tokyo, Japan). The OTS-Assay has three main components: OTS-Scan, OTS-Select, and OTS-Monitor. The OTS-Scan can provide an original CGP if a patient comes with no CGP results. The OTS-Select chooses matched somatic mutations from our dPCR probe library. The OTS-Monitor quantifies VAFs of ctDNA periodically in the patient plasma with a sensitivity of 0.05% VAF. There is no strict patient eligibility criteria other than the requirement of previous therapy for treatment of an advanced cancer. Results: Between April and November 2022, 26 patients visited Iwate Medical University Hospital for the OTS-Assay. Twenty-five patients were referred from other Departments of Iwate Medical University Hospital. The primary cancer types include esophagus (n=21), colorectal (n=2), pancreas (n=2), and breast (n=1). Twenty patients had CGP results at their first visit. OTS-Select were used for 13 patients and picked an average of 11.4 mutations per patient. Among those, each of eight patients were immediately able to start ctDNA monitoring with one of the 1000 dPCR probes. As of November 2022, there are four patients who received OTS-Monitor more than one time. Any unexpected VAF increase of ctDNA has not been noted, although a substantial decrease of ctDNA VAF was found in one patient who received one cycle of chemotherapy. Conclusion: The OTS-Assay is a practical introduction of our previous clinical research products based on a core technology, which uses an originally developed library of &gt;1000 dPCR probes. The potential of early and accurate MRD detection will improve post-treatment cancer patient management. Citation Format: Satoshi S. Nishizuka, Hayato Hiraki, Masakazu Abe, Akiko Yashima-Abo, Takeshi Iwaya. An introduction of a highly sensitive circulating tumor DNA monitoring system for minimal residual disease detection using a library of 1000 digital PCR probes. [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2023; Part 1 (Regular and Invited Abstracts); 2023 Apr 14-19; Orlando, FL. Philadelphia (PA): AACR; Cancer Res 2023;83(7_Suppl):Abstract nr 5599.

Japonica in the Archives Left After Bronisław Piłsudski in the Cracow Pau-Pan Academic Library 8. Kimiko Torii’s Letter To Bronisław and Mitsugo Yokoyama’s Letter Written on Board S/S Dakota The present material constitutes the eighth installment of the presentation of Japanese documents preserved with Bronisław Piłsudski’s archives in the Academic Library of the Polish Academy of Sciences and Lettres (PAU) and Polish Academy of Sciences (PAN) in Cracow and includes two letters in facsimile, transliteration, and interpretation in Polish. The first of them has been written in Japanese but in Roman characters (rōmaji) with few insertions in French. Its author, Kimiko Torii was the wife of the renowned Japanese ethnographer and anthropologist Ryūzō Torii who traveled extensively and conducted fieldwork in many places studying numerous cultures, the Ainu, especially the Kuril Ainu, included. Bronisław was personally acquainted with the couple – Ryuzo translated (from German) and published Bronisław’s work “The Aborigines of Sakhalin” (English translation in CWBP 1, 222–235), and Bronisław went to the railway station in Tokyo to see Kimiko off on her way to Mongolia to join her husband there – both conducted research in that country but the primary reason for Kimiko was to go on invitation from a local prince to Harqin (today in Inner Mongolia in China) to replace another Japanese lady in teaching in a school for Mongolian, primarily the prince’s, children – Misako Kawahara. Both ladies left several memoir publications each on their stay and experience accumulated in Mongolia, Kimiko coauthored also some works of academic importance with Ryuzo. Basic data on all the three persons and details concerning some of the publications mentioned have been provided. The letter is personal and, explaining circumstances, constitutes a plea for excuse for failed encounter on a snowy winter evening (beginning of February 1906) at the Toriis’. The other letter has been written by a person from Hiroshima Prefecture named Mitsugo Yokoyama who happened to board S/S Dakota on the way from Japan to the USA as a stowaway. Freezing while in hiding, he was offered a warm blanket from “a Russian” which helped him to survive. The letter does not mention the donor’s name and was probably written as sort of a statement for the captain but also as a letter of the deepest gratitude toward the “Russian”. Finding the moving letter in Cracow allows a supposition that it had been handed over to Piłsudski by its receiver. Kazuhiko Sawada succeeded in tracing the lot of the then lucky beneficiary who survived the journey and his and his family hard times in America (he had six children, five of them allegedly still alive in 2005). Some remarks on the language of the letters and on Bronisław’s nature have also been made. It is the first among all so-far published installments in the Japonica series emerging in co-authorship: Ms. Anna Grądzka prepared the tentative versions of the decipherment of the manuscript originals, and their transliterations and translations within the framework of her MA thesis in Japanese studies at Nicoalus Copernicus University in Toruń.

Abstract:This paper discusses the educational values of Kaizen culture in Japan. The research used to pose a main question of what educational values Kaizen management and culture has in common, based on the theory proposed by Richard T Kinner, Jerry L. Kernes, and Therese M. Dautheribes which declares that universality and education can coexist within the human community because there is a universal moral education written on the human heart. Since this is a library research and that of observational field of studies with qualitative data the researchers analyzed the research observation results conducted in Toyota, Tokyo, Nagoya, Kyoto, and Osaka as the primary sources of this study by using keywords of Kaizen values, Total Management Quality (TQM), and Kaizen Management Quality (KMQ) then the researchers analyzed and described the information about the educational values found in those primary sources. The results indicated that the universal and educational significant values which Kaizen has in general are discipline, good order (organization), honesty, trust, communication, peaceful life and nonviolent value, neatness, equanimity, and habit formation. Those kind of values will result in benevolence and compassion. In the end, Despite the fact that Kaizen seems to be related to the total quality management studies, this research paves the way to learn more about the importance of moral education in raising one's values via the examples rendered by Kaizen of Japan.Abstrak:Artikel ini membahas tentang nilai-nilai pendidikan budaya Kaizen di Jepang. Penelitian ini digunakan untuk mengajukan pertanyaan utama tentang apa kesamaan nilai-nilai pendidikan manajemen dan budaya Kaizen, berdasarkan teori yang dikemukakan oleh Richard T Kinner, Jerry L. Kernes, dan Therese M. Dautheribes yang menyatakan bahwa universalitas dan pendidikan dapat hidup berdampingan dalam komunitas manusia karena ada pendidikan moral universal yang tertulis di hati manusia. Jenis penelitian ini merupakan penelitian Pustaka kualitatif dengan menggunakan hasil observasi penelitian yang dilaksanakan di kota Toyota, Nagoya, Kyoto dan Osaka sebagai sumber utama data penelitian dengan menggunakan kata kunci: nilai-nilai Kaizen, Kualitas Manajemen Total, dan Kualitas Manajemen Kaizen. Hasil penelitian menunjukkan bahwa nilai-nilai penting universal dan pendidikan yang dimiliki Kaizen secara umum adalah disiplin, ketertiban (organisasi), kejujuran, kepercayaan, komunikasi, kehidupan damai dan nilai non-kekerasan, kerapian, keseimbangan batin, dan pembentukan kebiasaan. Nilai-nilai semacam itu akan menghasilkan kebajikan dan kasih sayang. Pada akhirnya, Terlepas dari kenyataan bahwa Kaizen tampaknya terkait dengan studi manajemen kualitas total, penelitian ini membuka jalan untuk mempelajari lebih lanjut tentang pentingnya pendidikan moral dalam meningkatkan nilai-nilai seseorang melalui contoh-contoh yang diberikan oleh Kaizen dari Jepang.

Background Fragility fractures are fractures that result from mechanical forces that would not ordinarily result in fracture. Objectives The objectives were to evaluate the clinical effectiveness, safety and cost-effectiveness of non-bisphosphonates {denosumab [Prolia®; Amgen Inc., Thousand Oaks, CA, USA], raloxifene [Evista®; Daiichi Sankyo Company, Ltd, Tokyo, Japan], romosozumab [Evenity®; Union Chimique Belge (UCB) S.A. (Brussels, Belgium) and Amgen Inc.] and teriparatide [Forsteo®; Eli Lilly and Company, Indianapolis, IN, USA]}, compared with each other, bisphosphonates or no treatment, for the prevention of fragility fracture. Data sources For the clinical effectiveness review, nine electronic databases (including MEDLINE, EMBASE and the World Health Organization International Clinical Trials Registry Platform) were searched up to July 2018. Review methods A systematic review and network meta-analysis of fracture and femoral neck bone mineral density were conducted. A review of published economic analyses was undertaken and a model previously used to evaluate bisphosphonates was adapted. Discrete event simulation was used to estimate lifetime costs and quality-adjusted life-years for a simulated cohort of patients with heterogeneous characteristics. This was done for each non-bisphosphonate treatment, a strategy of no treatment, and the five bisphosphonate treatments previously evaluated. The model was populated with effectiveness evidence from the systematic review and network meta-analysis. All other parameters were estimated from published sources. An NHS and Personal Social Services perspective was taken, and costs and benefits were discounted at 3.5% per annum. Fracture risk was estimated from patient characteristics using the QFracture® (QFracture-2012 open source revision 38, Clinrisk Ltd, Leeds, UK) and FRAX® (web version 3.9, University of Sheffield, Sheffield, UK) tools. The relationship between fracture risk and incremental net monetary benefit was estimated using non-parametric regression. A probabilistic sensitivity analysis and scenario analyses were used to assess uncertainty. Results Fifty-two randomised controlled trials of non-bisphosphonates were included in the clinical effectiveness systematic review and an additional 51 randomised controlled trials of bisphosphonates were included in the network meta-analysis. All treatments had beneficial effects compared with placebo for vertebral, non-vertebral and hip fractures, with hazard ratios varying from 0.23 to 0.94, depending on treatment and fracture type. The effects on vertebral fractures and the percentage change in bone mineral density were statistically significant for all treatments. The rate of serious adverse events varied across trials (0–33%), with most between-group differences not being statistically significant for comparisons with placebo/no active treatment, non-bisphosphonates or bisphosphonates. The incremental cost-effectiveness ratios were > £20,000 per quality-adjusted life-year for all non-bisphosphonate interventions compared with no treatment across the range of QFracture and FRAX scores expected in the population eligible for fracture risk assessment. The incremental cost-effectiveness ratio for denosumab may fall below £30,000 per quality-adjusted life-year at very high levels of risk or for high-risk patients with specific characteristics. Raloxifene was dominated by no treatment (resulted in fewer quality-adjusted life-years) in most risk categories. Limitations The incremental cost-effectiveness ratios are uncertain for very high-risk patients. Conclusions Non-bisphosphonates are effective in preventing fragility fractures, but the incremental cost-effectiveness ratios are generally greater than the commonly applied threshold of £20,000–30,000 per quality-adjusted life-year. Study registration This study is registered as PROSPERO CRD42018107651. Funding This project was funded by the National Institute for Health Research (NIHR) Health Technology Assessment programme and will be published in full in Health Technology Assessment; Vol. 24, No. 29. See the NIHR Journals Library website for further project information.

In 2013, multiple articles reporting the clinical trial of valsartan, an antihypertensive drug of more than US$ 1 billion annual sales from Novartis, were retracted due to data falsification.1,2 These included the Kyoto Heart Study presented by Dr. Hiroaki Matsubara at the European Society of Cardiology 2009 Congress and subsequently published in the European Heart Journal (EHJ).3,4 Aside from retraction of this article by EHJ, the American Heart Association (AHA) also retracted five papers published in three of its journals -- Circulation, Circulation Research, and Hypertension.4 Novartis employees were involved in the conduct and analysis of the Kyoto Heart Study and a second investigator-initiated trial, the Jikei Heart Study,5 although their participation was not acknowledged in publications and presentations of the data, while a Novartis employee who allegedly manipulated statistical data was listed as one of the academic authors, without disclosing the relation with the company.4,6 This scandal has severely damaged scientific integrity in Japan and set the stage for the “Tokyo Declaration on Research Integrity and Ethical Publication in Science and Medicine in the Asia Pacific Region” adopted at the 2013 Convention of the Asia Pacific Association of Medi­cal Journal Editors (APAME) held in Tokyo from 2 to 4 August 2013, and co-published by Journals linked to APAME and listed in the Index Medicus for the South East Asian Region (IMSEAR) and the Western Pacific Region Index Medicus (WPRIM), including the Philippine Journal of Otolaryngology Head and Neck Surgery, with a Special Announcement in this issue.7 At the core of research integrity and ethical publication is responsible and accountable authorship. The ICMJE "Uniform Requirements for Manuscripts Submitted to Biomedical Journals" has been replaced by the “Recommendations for the Conduct, Reporting, Editing, and Publication of Scholarly Work in Medical Journals.”8 An important change under these new guidelines is an additional criterion for authorship, totaling four (4) instead of three (3) criteria. The ICMJE recommends that authorship be based on the following 4 criteria:8 Substantial contributions to the conception or design of the work; or the acquisition, analysis, or interpretation of data for the work; AND Drafting the work or revising it critically for important intellectual content; AND Final approval of the version to be published; AND Agreement to be accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. In addition to being accountable for the parts of the work he or she has done, an author should be able to identify which co-authors are responsible for specific other parts of the work. In addition, authors should have confidence in the integrity of the contributions of their co-authors. One cannot be listed as a co-author for the credit it brings, without being equally accountable in case of discredit. For example, consultant advisers and seniors who would consider adding their names as co-authors of a junior resident, are equally accountable for research misconduct (such as data fabrication, falsification, plagiarism), and cannot lay the blame on one (usually junior) author. While all those designated as authors should meet all four criteria for authorship, and all who meet the four criteria should be identified as authors, those who do not meet all four criteria should be acknowledged. Hence, it is more appropriate for consultant advisers and seniors who do not meet all four criteria for authorship to be acknowledged in this manner. Our journal seeks to maintain the highest standards of biomedical publication, and fully supports the APAME Tokyo Declaration on Research Integrity and Ethical Publication in Science and Medicine in the Asia – Pacific Region as well as the ICMJE Recommendations for the Conduct, Reporting, Editing, and Publication of Scholarly Work in Medical Journals. Multiple accreditations and indexing are testimony to these standards. It was surprising therefore, that a letter from the Commission on Higher Education Journal Accreditation System dated 26 April 2013, which we received 26 May 2013, informed us of our reaccreditation under Category B based on the “recommendation of the panel of evaluators” who “pointed out the need to improve the journal’s refereeing system, regularity of publication/circulation and timeliness.”9 I respectfully responded to these remarks10 stating that: the Philipp J Otolaryngol Head Neck Surg is one of the few consistently compliant journals accredited by the National Journal Selection Committee of the Philippine Council for Health Research and Development, Department of Science and Technology. Our journal has a reputable loco-regional stature evidenced by international contributions from the USA, Japan, Turkey, Malaysia, India and Brunei, and has consistently been recognized as a benchmark journal by the Philippine Association of Medical Journal Editors and Asia Pacific Association of Medical Journal Editors. It functions as the de facto ASEAN Journal in the field of Otolaryngology Head and Neck Surgery. It is always regularly published on time, and indexed in the Health Research and Development Network (HERDIN-NeON) supported by the PCHRD-DOST; Philippine Journals On Line (PhilJOL) and Asia Journals On Line (AsiaJOL) supported by the International Network for the Availability of Scientific Publications (INASP); the Western Pacific Region Index Medicus (WPRIM) of the World Health Organization (WHO), APAMED Central and the Index Copernicus™ Journals Master List. It has always met the accreditation criteria of these services. The journal’s online peer review system is used as an example for other local journals, including in National Medical Writing and Reviewing Workshops organized by the PCHRD (2012 Cebu and Davao, 2013 Baguio and Iloilo), in the Philippine National Health Research System Week (2011 Bacolod, 2012 Manila, 2013 Laoag) as well as for regional journals in Medical Writing and Review Workshops held in Brunei, Singapore, Malaysia, Vietnam and Cambodia. Several local and regional journals have been thus assisted by us in their editing and peer review systems. As a Category A Accredited Research Journal (Batch 1) for 2009 – 2012 per Commission on Higher Education (CHED) Memorandum Order No. 09 s. 2010 and Resolution No. 477-2009, effective December 9, 2009 (signed May 26, 2010), our journal has faithfully complied with all the terms of the JAS, including “acknowledgement in the published journal that the publication thereof was a product of the Journal Accreditation Service project of the Commission on Higher Education” in the inside front cover of every issue. Moreover, we have gone beyond the dissemination requirement by providing a complimentary copy of each issue to every Medical School Library in the Philippines. I ended by reiterating that our journal “has more than complied with the requirements of the Journal Accreditation Service of the Commission on Higher Education for reaccreditation as a Category A Accredited Research Journal, and beg(ged) the honorable review panel to reconsider its recommendation.”10 It turned out that previously-submitted copies of our journal had been inadvertently misplaced, leading to our downgrade from Category A to B. Expecting full reinstatement, I was surprised to receive a response dated 23 July 2013 on 23 August 2013, informing us that: “the Technical Evaluators decided to classify the said journal as ‘conditional category A’ pending submission of enhanced volumes with sober and serious formats to project scientific/scholarly image. While refereed journals often contain many graphs and charts, these do not normally include glossy pages (e.g. advertisements) or exciting pictures (e.g. captoons) which noticeably appeared in the issues that you submitted.”11 I again respectfully responded to these remarks by citing12 the International Committee of Medical Journal Editors Recommendations for the Conduct, Reporting, Editing, and Publication of Scholarly Work in Medical Journals (ICMJE Recommendations) updated August 2013, cited 29 August 2013 available at http://www.icmje.org/urm_main.html8 The recommendations have clear guidelines on advertising, and do not forbid exciting pictures and cartoons. Nowhere do they constrain scholarly medical journals to maintain “sober and serious formats to project scientific/scholarly image.” The Philippine Journal of Otolaryngology Head and Neck Surgery is listed among the Journals Following ICMJE Recommendations http://www.icmje.org/journals.html13 The top-tier journals in medicine (BMJ, JAMA, Lancet and NEJM) as well as Science and Nature all have advertising in glossy pages and exciting pictures and cartoons, even on their covers. The same is true for our major journals in the field of Otolaryngology Head and Neck Surgery. I provided the technical panel with copies of the Instructions to Authors of these journals, as well as photographs of actual caricatures from their covers and inside pages. Finally, I also attached an excerpt from: Bennett HJ. Humor in Medicine. South Med J. 2003;96(12)14 for the perusal of the honourable Technical Panel. As of press time, we have not received a reply from the Technical Panel, but have received advise from the Office of Policy, Planning, Research and Information of the Commission on Higher Education to withhold, in the meantime, our inside front cover acknowledgement that the publication of this issue “was a product of the Journal Accreditation Service project of the Commission on Higher Education.” However, we shall continue to provide a complimentary copy of this issue to every Medical School Library in the Philippines as a valuable service of our Society and Journal as we await the resolution of this situation.

Background Patients with low estimated glomerular filtration rates may be at higher risk of post-contrast acute kidney injury following contrast-enhanced computed tomography imaging. Point-of-care devices allow rapid measurement of estimated glomerular filtration rates for patients referred without a recent estimated glomerular filtration rate result. Objectives To assess the clinical effectiveness and cost-effectiveness of point-of-care creatinine tests for outpatients without a recent estimated glomerular filtration rate measurement who need contrast-enhanced computed tomography imaging. Methods Three systematic reviews of test accuracy, implementation and clinical outcomes, and economic analyses were carried out. Bibliographic databases were searched from inception to November 2018. Studies comparing the accuracy of point-of-care creatinine tests with laboratory reference tests to assess kidney function in adults in a non-emergency setting and studies reporting implementation and clinical outcomes were included. Risk of bias of diagnostic accuracy studies was assessed using a modified version of the Quality Assessment of Diagnostic Accuracy Studies 2 (QUADAS-2) tool. Probabilities of individuals having their estimated glomerular filtration rates correctly classified were estimated within a Bayesian framework and pooled using a fixed-effects model. A de novo probabilistic decision tree cohort model was developed to characterise the decision problem from an NHS and a Personal Social Services perspective. A range of alternative point-of-care testing approaches were considered. Scenario analyses were conducted. Results Fifty-four studies were included in the clinical reviews. Twelve studies reported diagnostic accuracy for estimated glomerular filtration rates; half were rated as being at low risk of bias, but there were applicability concerns for most. i-STAT (Abbott Point of Care, Inc., Princeton, NJ, USA) and ABL (Radiometer Ltd, Crawley, UK) devices had higher probabilities of correctly classifying individuals in the same estimated glomerular filtration rate categories as the reference laboratory test than StatSensor® devices (Nova Biomedical, Runcorn, UK). There was limited evidence for epoc® (Siemens Healthineers AG, Erlangen, Germany) and Piccolo Xpress® (Abaxis, Inc., Union City, CA, USA) devices and no studies of DRI-CHEM NX 500 (Fujifilm Corporation, Tokyo, Japan). The review of implementation and clinical outcomes included six studies showing practice variation in the management decisions when a point-of-care device indicated an abnormal estimated glomerular filtration rate. The review of cost-effectiveness evidence identified no relevant studies. The de novo decision model that was developed included a total of 14 strategies. Owing to limited data, the model included only i-STAT, ABL800 FLEX and StatSensor. In the base-case analysis, the cost-effective strategy appeared to be a three-step testing sequence involving initially screening all individuals for risk factors, point-of-care testing for those individuals with at least one risk factor, and including a final confirmatory laboratory test for individuals with a point-of-care-positive test result. Within this testing approach, the specific point-of-care device with the highest net benefit was i-STAT, although differences in net benefit with StatSensor were very small. Limitations There was insufficient evidence for patients with estimated glomerular filtration rates < 30 ml/minute/1.73 m2, and on the full potential health impact of delayed or rescheduled computed tomography scans or the use of alternative imaging modalities. Conclusions A three-step testing sequence combining a risk factor questionnaire with a point-of-care test and confirmatory laboratory testing appears to be a cost-effective use of NHS resources compared with current practice. The risk of contrast causing acute kidney injury to patients with an estimated glomerular filtration rate of < 30 ml/minute/1.73 m2 is uncertain. Cost-effectiveness of point-of-care testing appears largely driven by the potential of point-of-care tests to minimise delays within the current computed tomography pathway. Future work Studies evaluating the impact of risk-stratifying questionnaires on workflow outcomes in computed tomography patients without recent estimated glomerular filtration rate results are needed. Study registration This study is registered as PROSPERO CRD42018115818. Funding This project was funded by the National Institute for Health Research (NIHR) Health Technology Assessment programme and will be published in full in Health Technology Assessment; Vol. 24, No. 39. See the NIHR Journals Library website for further project information.

Background Hepatocellular carcinoma is the most common type of primary liver cancer. Treatment choice is dependent on underlying liver dysfunction and cancer stage. Treatment options include conventional transarterial therapies for patients with intermediate-stage disease and systemic therapy [e.g. sorafenib (Nexavar®; Bayer plc, Leverkusen, Germany)] for patients with advanced-stage disease. Selective internal radiation therapies deliver radiation to liver tumours via microspheres that are injected into the hepatic artery. There are three selective internal radiation therapies: TheraSphere™ [BTG Ltd, London, UK (now Boston Scientific, Marlborough, MA, USA)], SIR-Spheres® (Sirtex Medical Ltd, Woburn, MA, USA) and QuiremSpheres® (Quirem Medical BV, Deventer, the Netherlands). Objective To assess the clinical effectiveness and cost-effectiveness of selective internal radiation therapies for treating patients with unresectable early-, intermediate- or advanced-stage hepatocellular carcinoma. Methods A search was undertaken to identify clinical effectiveness literature relating to selective internal radiation therapies and relevant comparators for the treatment of hepatocellular carcinoma. Studies were critically appraised and summarised. The network of evidence was mapped to estimate the relative effectiveness of the different selective internal radiation therapies and comparator treatments. An economic analysis evaluated the cost-effectiveness. Results Twenty studies were included in the clinical effectiveness review. Two large randomised controlled trials rated as having a low risk of bias [SARAH: Vilgrain V, Pereira H, Assenat E, Guiu B, Ilonca AD, Pageaux GP, et al. Efficacy and safety of selective internal radiotherapy with yttrium-90 resin microspheres compared with sorafenib in locally advanced and inoperable hepatocellular carcinoma (SARAH): an open-label randomised controlled Phase 3 trial. Lancet Oncol 2017;18:1624–36; and SIRveNIB: Chow PKH, Gandhi M, Tan SB, Khin MW, Khasbazar A, Ong J, et al. SIRveNIB: selective internal radiation therapy versus sorafenib in Asia-Pacific patients with hepatocellular carcinoma. J Clin Oncol 2018;36:1913–21] found no significant difference in overall survival or progression-free survival between SIR-Spheres and sorafenib (systemic therapy) in an advanced population, despite greater tumour response in the SIR-Spheres arm of both trials. There were some concerns regarding generalisability of the SARAH and SIRveNIB trials to UK practice. All other studies of SIR-Spheres, TheraSphere or QuiremSpheres were either rated as being at a high risk of bias or caused some concerns regarding bias. A network meta-analysis was conducted in adults with unresectable hepatocellular carcinoma who had Child–Pugh class A liver cirrhosis and were ineligible for conventional transarterial therapies. The analysis included the SARAH and SIRveNIB trials as well as a trial comparing lenvatinib (Kisplyx®; Eisai Ltd, Tokyo, Japan) (systemic therapy) with sorafenib. There were no meaningful differences in overall survival between any of the treatments. The base-case economic analysis suggested that TheraSphere may be cost-saving relative to both SIR-Spheres and QuiremSpheres. However, incremental cost differences between TheraSphere and SIR-Spheres were small. In a fully incremental analysis, which included confidential Patient Access Scheme discounts, lenvatinib was the most cost-effective treatment and dominated all selective internal radiation therapies. In pairwise comparisons of sorafenib with each selective internal radiation therapy, sorafenib also dominated all selective internal radiation therapies. Limitations The existing evidence cannot provide decision-makers with clear guidance on the comparative effectiveness of treatments in early- and intermediate-stage hepatocellular carcinoma or on the efficacy of TheraSphere or QuiremSpheres. Conclusions In the advanced-stage hepatocellular carcinoma population, two large randomised trials have shown that SIR-Spheres have similar clinical effectiveness to sorafenib. None of the selective internal radiation therapies was cost-effective, being more costly and less effective than lenvatinib, both at list price and with Patient Access Scheme discounts. Future work Future studies may wish to include early- and intermediate-stage hepatocellular carcinoma patients and the low tumour burden/albumin–bilirubin 1 subgroup of advanced-stage patients. Future high-quality studies evaluating alternative selective internal radiation therapies would be beneficial. Study registration This study is registered as PROSPERO CRD42019128383. Funding This project was funded by the National Institute for Health Research (NIHR) Health Technology Assessment programme and will be published in full in Health Technology Assessment; Vol. 24, No. 48. See the NIHR Journals Library website for further project information.

Abstract Background: Traditional prognostic classification of myelodysplastic syndromes (MDS) is based on scoring systems such as IPSS, WPSS, and IPSS-R. The scoring system lacks several important pieces of information in the patient's condition, especially age, gender, and performance status（PS).Therefore, prognosis prediction by scoring system is not accurate enough because it does not reflect the actual patient situation such as age and PS. Now, we demonstrate the use of a more accurate and intelligent machine learning-based model, and it is desirable to construct a more comprehensive prognostic system suitable for actual real worlds data in clinical practice. Methods: We analyzed clinical data set of 333 patients with MDS diagnosed at the University of Tokyo Hospital from April 1996 to March 2020 using machine learning. Now, we created two novel prediction models for MDS using machine learning. 1) A novel prognostic prediction system was constructed by machine learning of the patient information including age, gender, PS, white blood counts, neutrophil, hemoglobin level, platelet counts, blast counts in bone marrow and peripheral blood, chromosomal abnormalities and treatment. 70% of the patient information in the dataset was analyzed as training data, and the remaining 30% was evaluated as test data. The cases were randomly assigned to the training test datasets. First, we used the training dataset to build a prediction system to link clinical information with subsequent leukemogenesis and mortality. Next, we evaluated the performance including the AUC and accuracy of the system on the test data. 2) To assess the benefit of drugs administered for the treatment of MDS, the effectiveness of drugs must be compared among patients with a similar level of risk. To this end, we devised a leukemogenesis index, in which we classified MDS patients into two groups: low risk (index &lt;0.5) and high risk (index&gt;0.5). We compared the mortality of these leukemogenesis risk-matched subgroups between the therapeutic agent and non-therapeutic agent. The outcome of patients in the leukemogenesis risk-matched subgroups demonstrated the real-world effectiveness of the therapeutic agents. Results: We first attempted to find the optimal algorithm for machine learning out of 15 candidate algorithms by using the PyCaret, a machine learning library. It was determined that CatBoost performed the best in terms of an AUC (Area Under the Curve) and accuracy. Using CatBoost algorithm, the prediction performances of our algorithm for mortality with MDS patients yielded an AUC score of 0.73 and an accuracy score of 0.75. The AUC of this novel system with machine learning was 0.75, which showed an improvement of 16% in performance compared to the AUC of 0.59 for the traditional IPSS system. The prediction performances for leukemogenesis yielded an AUC score of 0.73 and an accuracy score of 0.76. To assess the effectiveness of administered therapeutic agents, it is necessary to examine the effects of agents among MDS patients in subgroups of uniform predicted risk at the time of presentation when drug treatment is considered. To this end, we devised an evaluation method for leukemogenesis risk-matched analysis using the risk index. We compared the mortality rates of these leukemogenesis risk-matched subgroups between the treatment groups of Aza (azacytidine) and the other-treatment groups in non-transplantable patients. In the low-risk group, the Kaplan-Meier estimates of mortality by 1 year were 85 % in the Aza treatment group and same as 85 % in the other treatment group. In the high-risk group, the Kaplan-Meier estimates of mortality by 1 year were 64 % in the Aza treatment group and 42 % in the other treatment group. Due to the 60 cases in high-risk group, the difference did not reach significance. Conclusion: In summary, we have developed novel comprehensive prediction models of leukemogenesis and prognosis for MDS patients with high accuracy using machine learning. We also developed a novel system, "leukemogenesis risk-matched analysis," to infer the real-world effectiveness of Aza stratifying MDS patients based on leukemogenesis risk as assessed by machine learning according to the patient information at the time of initial diagnosis. In addition, the leukemogenesis risk index can be used to distinguish between high-risk and low-risk patients, which is useful in supporting the management of treatment. Disclosures Honda: Takeda Pharmaceutical: Other: Lecture fee; Otsuka Pharmaceutical: Other: Lecture fee; Chugai Pharmaceutical: Other: Lecture fee; Ono Pharmaceutical: Other: Lecture fee; Jansen Pharmaceutical: Other: Lecture fee; Nippon Shinyaku: Other: Lecture fee. Kurokawa: AbbVie GK: Research Funding, Speakers Bureau; Daiichi Sankyo Company.: Research Funding, Speakers Bureau; Nippon Shinyaku Co., Ltd.: Research Funding, Speakers Bureau; Kyowa Hakko Kirin Co., Ltd.: Research Funding, Speakers Bureau; Sumitomo Dainippon Pharma Co., Ltd.: Research Funding, Speakers Bureau; Chugai Pharmaceutical Company: Research Funding, Speakers Bureau; Takeda Pharmaceutical Company Limited.: Research Funding, Speakers Bureau; ONO PHARMACEUTICAL CO., LTD.: Research Funding, Speakers Bureau; Otsuka Pharmaceutical Co., Ltd.: Research Funding, Speakers Bureau; Eisai Co., Ltd.: Research Funding, Speakers Bureau; MSD K.K.: Research Funding, Speakers Bureau; Astellas Pharma Inc.: Research Funding, Speakers Bureau; Pfizer Japan Inc.: Research Funding, Speakers Bureau; Teijin Limited: Research Funding, Speakers Bureau.

Background Levetiracetam (Keppra®, UCB Pharma Ltd, Slough, UK) and zonisamide (Zonegran®, Eisai Co. Ltd, Tokyo, Japan) are licensed as monotherapy for focal epilepsy, and levetiracetam is increasingly used as a first-line treatment for generalised epilepsy, particularly for women of childbearing age. However, there is uncertainty as to whether or not they should be recommended as first-line treatments owing to a lack of evidence of clinical effectiveness and cost-effectiveness. Objectives To compare the clinical effectiveness and cost-effectiveness of lamotrigine (Lamictal®, GlaxoSmithKline plc, Brentford, UK) (standard treatment) with levetiracetam and zonisamide (new treatments) for focal epilepsy, and to compare valproate (Epilim®, Sanofi SA, Paris, France) (standard treatment) with levetiracetam (new treatment) for generalised and unclassified epilepsy. Design Two pragmatic randomised unblinded non-inferiority trials run in parallel. Setting Outpatient services in NHS hospitals throughout the UK. Participants Those aged ≥ 5 years with two or more spontaneous seizures that require anti-seizure medication. Interventions Participants with focal epilepsy were randomised to receive lamotrigine, levetiracetam or zonisamide. Participants with generalised or unclassifiable epilepsy were randomised to receive valproate or levetiracetam. The randomisation method was minimisation using a web-based program. Main outcome measures The primary outcome was time to 12-month remission from seizures. For this outcome, and all other time-to-event outcomes, we report hazard ratios for the standard treatment compared with the new treatment. For the focal epilepsy trial, the non-inferiority limit (lamotrigine vs. new treatments) was 1.329. For the generalised and unclassified epilepsy trial, the non-inferiority limit (valproate vs. new treatments) was 1.314. Secondary outcomes included time to treatment failure, time to first seizure, time to 24-month remission, adverse reactions, quality of life and cost-effectiveness. Results Focal epilepsy. A total of 990 participants were recruited, of whom 330 were randomised to receive lamotrigine, 332 were randomised to receive levetiracetam and 328 were randomised to receive zonisamide. Levetiracetam did not meet the criteria for non-inferiority (hazard ratio 1.329) in the primary intention-to-treat analysis of time to 12-month remission (hazard ratio vs. lamotrigine 1.18, 97.5% confidence interval 0.95 to 1.47), but zonisamide did meet the criteria (hazard ratio vs. lamotrigine 1.03, 97.5% confidence interval 0.83 to 1.28). In the per-protocol analysis, lamotrigine was superior to both levetiracetam (hazard ratio 1.32, 95% confidence interval 1.05 to 1.66) and zonisamide (hazard ratio 1.37, 95% confidence interval 1.08 to 1.73). For time to treatment failure, lamotrigine was superior to levetiracetam (hazard ratio 0.60, 95% confidence interval 0.46 to 0.77) and zonisamide (hazard ratio 0.46, 95% confidence interval 0.36 to 0.60). Adverse reactions were reported by 33% of participants starting lamotrigine, 44% starting levetiracetam and 45% starting zonisamide. In the economic analysis, both levetiracetam and zonisamide were more costly and less effective than lamotrigine and were therefore dominated. Generalised and unclassifiable epilepsy. Of 520 patients recruited, 260 were randomised to receive valproate and 260 were randomised to receive to levetiracetam. A total of 397 patients had generalised epilepsy and 123 had unclassified epilepsy. Levetiracetam did not meet the criteria for non-inferiority in the primary intention-to-treat analysis of time to 12-month remission (hazard ratio 1.19, 95% confidence interval 0.96 to 1.47; non-inferiority margin 1.314). In the per-protocol analysis of time to 12-month remission, valproate was superior to levetiracetam (hazard ratio 1.68, 95% confidence interval 1.30 to 2.15). Valproate was superior to levetiracetam for time to treatment failure (hazard ratio 0.65, 95% confidence interval 0.50 to 0.83). Adverse reactions were reported by 37.4% of participants receiving valproate and 41.5% of those receiving levetiracetam. Levetiracetam was both more costly (incremental cost of £104, 95% central range –£587 to £1234) and less effective (incremental quality-adjusted life-year of –0.035, 95% central range –0.137 to 0.032) than valproate, and was therefore dominated. At a cost-effectiveness threshold of £20,000 per quality-adjusted life-year, levetiracetam was associated with a probability of 0.17 of being cost-effective. Limitations The SANAD II trial was unblinded, which could have biased results by influencing decisions about dosing, treatment failure and the attribution of adverse reactions. Future work SANAD II data could now be included in an individual participant meta-analysis of similar trials, and future similar trials are required to assess the clinical effectiveness and cost-effectiveness of other new treatments, including lacosamide and perampanel. Conclusions Focal epilepsy – The SANAD II findings do not support the use of levetiracetam or zonisamide as first-line treatments in focal epilepsy. Generalised and unclassifiable epilepsy – The SANAD II findings do not support the use of levetiracetam as a first-line treatment for newly diagnosed generalised epilepsy. For women of childbearing potential, these results inform discussions about the benefit (lower teratogenicity) and harm (worse seizure outcomes and higher treatment failure rate) of levetiracetam compared with valproate. Trial registration Current Controlled Trials ISRCTN30294119 and EudraCT 2012-001884-64. Funding This project was funded by the National Institute for Health Research (NIHR) Health Technology Assessment programme and will be published in full in Health Technology Assessment; Vol. 25, No. 75. See the NIHR Journals Library website for further project information.

Abstract Introduction The identification of genetic defects in hemophilia A is essential to understanding the features of a patient's hemophilia. At present, 3 methods are generally applied in the standard analysis of the F8 gene in order to identify genetic defects: 1) direct sequencing is performed after the PCR amplification of the exons and the flanking intronic sequence to detect small defects; 2) long-range PCR amplification is performed to detect inversions; and 3) a multiplex ligation-probe amplification analysis (MLPA) is performed to detect gross rearrangements. However, a causative mutation cannot be found in approximately 2% of patients. Recently, several studies have reported the existence of a causative variant located deep inside an intron. We aimed to develop a whole F8 genetic analysis method using Next-Generation Sequencing (NGS) to investigate deep inside introns. Material & Methods Genomic DNA was extracted from patient peripheral blood cells, and the complete F8 locus was amplified in 14 overlapping regions (5-23 kb) by long-range PCR. In total, approximately 201kb (including the upstream and downstream regions of the F8) was amplified. The PCR fragments were purified using an illustraTM GFXTM PCR DNA and a Gel Band Purification Kit (GE Healthcare UK Ltd.), and were equimolarly mixed. The DNA library was prepared by fragmentation using a Nextera XT DNA sample preparation kit (Illumina Inc.). The paired-end adapter-ligated fragments of the pooled libraries were attached to the flow cell and sequenced using the amplicon sequencing application of the MiSeq software program (Illumina). The nucleotide sequences that were obtained were aligned to the GRCh37/hg19 coordinates of an F8 reference sequence using the Burrows-Wheeler Aligner (BWA). The variants were detected using the Genome Analysis Toolkit (GATK) and were annotated by the VariantStudio software program (Illumina). The Combined Annotation Dependent Depletion (CADD) score, which predicts the deleteriousness of single nucleotide variants as well as insertion/deletions variants in the human genome, was obtained from the CADD (ver. 1.3) website (http://cadd.gs.washington.edu/home). The study was approved by the Ethics Committee of Tokyo Medical University. Written informed consent was obtained from all patients, and studies were carried out in accordance with the principles of the Declaration of Helsinki. Results Forty-seven male hemophilia A patients were investigated, including 32 who had been analyzed previously. Of these, no causative mutation had previously been identified in two patients by standard analysis. Sequencing coverage was sufficiently high (>20 reads) to confirm the sequence, though it varied widely by region and analysis. However, a small part of intron 22, which differed in size (~1-2 kb) according to sample and analysis, showed very low coverage (0-20 reads). Our NGS analysis therefore allowed the identification of genetic variants in about 99% of F8. On average, 140 variants were detected in each patient. In the analysis of samples which had a previously identified causative mutation, single nucleotide variants (such as point mutations) were detected with high levels of accuracy. In contrast, structural variants (such as inversions and large duplications) could not be detected under present conditions. To identify rare and disease causative variants located deep within introns, we ruled out those variants registered in dbSNP, 1000 Genomes, COSMIC, and ClinVar databases. This left a total of 30 variants from 47 patients. The C-score of these variants obtained by CADD analysis ranged from 0.005 to 14.97. One of the two patients with unknown causative mutations carried a variant, c.144-10810T>C, in intron 1 with a C-score of 13.56. This score was sufficiently high and was suggested as the possible etiology of the patient's hemophilia A. Conclusion We established a comprehensive F8 analysis method using NGS. This technique was shown to be very effective for the detection of single nucleotide variants, though improvement was necessary for the detection of structural variants. Our study suggested that the existence of rare variants, which are likely to cause a hemophilia, deep inside the intron of F8, is not uncommon. Disclosures Inaba: Biogen: Honoraria; Bayer: Honoraria. Shinozawa:Pfizer: Honoraria; Bayer: Honoraria; Baxalta: Honoraria, Other: Endowed chair. Amano:Kaketsuken: Honoraria; Bayer: Honoraria, Membership on an entity's Board of Directors or advisory committees; Baxalta: Honoraria, Membership on an entity's Board of Directors or advisory committees; ViiV: Honoraria; Biogen: Honoraria; Novo: Honoraria, Membership on an entity's Board of Directors or advisory committees; Janssen: Honoraria. Fukutake:EPS: Research Funding; Siemens: Speakers Bureau; simic: Research Funding; Sekisui Medical: Consultancy, Honoraria, Speakers Bureau; Roche Diagnostics: Honoraria, Speakers Bureau; Biogen: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Speakers Bureau; Abbott: Honoraria, Speakers Bureau; Kaketsuken: Honoraria; Japan Blood Products Organization: Honoraria, Research Funding; Torii: Speakers Bureau; Bayer: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Speakers Bureau; LSI Medience: Consultancy; SRL Inc: Consultancy; Pfizer: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Speakers Bureau; Baxalta: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Research Funding, Speakers Bureau; Novo Nordisk: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Research Funding, Speakers Bureau; CSL Behring: Honoraria.

Internationally, there are well-known school library models including the U.S. model, with its strong groups of professionals, the British model, dependent on school library services in the community, and the Australian model, which can be described as either a successor to or a middle way between these two models. However, no independent school library model has been established in Asia. In Japan, the Library and Information Professions and Educations Renewal (LIPER) project was established in 2003 to study reforms to and the reorganization of library and information science education, with the members of the Japan Society of Library and Information Science. The School Library Initiatives for Asia & Pacific (SLAP) Forum, an international meeting for school library practitioners, was held in Tokyo in January 2013, and even before then an initiative was conducted as part of the studies spun off from the LIPER’s third stage. This paper reports on these topics.

A survey of teachers' perceptions of school libraries was conducted in 1998 in Ohta-ku in Tokyo, Japan and in the Honolulu District in Hawaii, USA. The results were compared to find similarities and differences and to examine possible influences on the development of school libraries in these locations. Most survey respondents in Ohta-ku and Honolulu acknowledged the importance of the pedagogical role of school libraries and school librarians. Teachers in Honolulu had higher expectations of service from school librarians than did teachers in Ohta-ku. This result was probably due to differences in policy and in the availability of trained school library personnel. There were some other interesting differences between the survey responses of teachers from Ohta-ku and Honolulu, probably because of major differences in the nature of school library development in the two areas.

Amy Icke, recipient of UKeiG’s Early Career award, reports on the IASL (International Association of School Librarians) Conference 2016, held in Tokyo, 21st - 26th August 2016. The theme of the event was “A school library built for the digital age” and Amy outlines and discusses key conference themes illustrated with examples delivered by librarians working in a range of countries including Japan, Australia, Sweden and Canada. Key messages for our readers in all sectors includes: The importance of context: knowing your organisation and your audience and tailoring your message to them;Meaningful collaboration and relationship building: how to forge successful working relationships between staff and libraries;The diversity of the LIS work role;The importance of teaching digital literacies and getting students “work ready”.

AbstractWe developed a 0.01-degree gridded precipitation dataset of Japan based on historical observation datasets covering 1926 to 2020. Historical observations conducted by the Japan Meteorological Agency and other Japanese bureaucratic agencies were spatially interpolated using the inverse distance weighting method at daily and hourly temporal resolutions. Optimal parameterization for our interpolation process was selected by comparing interpolated results of various parameter combinations with precipitation observation conducted by the University of Tokyo Forests. We conducted cross-validation for over 1,000 stations with sufficient data throughout our data period and verified our product can reproduce the temporal variability of local precipitation. The strong points of our precipitation dataset are its high spatiotemporal resolution and the abundance of point precipitation source data. We expect our dataset to be highly relevant to various future studies as it can serve multiple purposes such as forcing data for hydrological models or a database for analyzing the characteristics of historical rainfall events.

AbstractWe describe a collaborative analysis study involving numerical models and observation data for the Tokyo metropolitan area called the ULTra-sIte for Measuring Atmosphere of Tokyo Metropolitan Environment (ULTIMATE) project. It evaluates cloud microphysics schemes of numerical models using extensive observation data for the Tokyo area. We have access to various remote sensing and in situ data for the Tokyo area for operational and research purposes, particularly by enhancing observations for ground validation of the EarthCARE satellite, which is set to launch in 2023. This study focuses on using the dual-polarization Doppler weather radar, operated by the Japan Meteorological Agency. In terms of numerical models, we use and compare multi-models with single-moment (SM) and double-moment (DM) cloud microphysics schemes; the global non-hydrostatic model, Non-hydrostatic ICosahedral Atmospheric Model (NICAM) and the two regional models with A System based on a Unified Concept for Atmosphere (ASUCA) and Scalable Computing for Advanced Library and Environment (SCALE) are used. In particular, because NICAM can be used as both a global and a regional model, we can immediately test the improved scheme on a global scale for its effect on climatology and the evaluation of climate sensitivity. This paper introduces the methodology for evaluating numerical models by the dual-polarization radar using the observation simulator and compares numerical model results with observations. In particular, we evaluate the simulated rain in the lower level near the ground and the large ice particles just above the melting level. The simulation with NICAM-DM reproduces the comparable polarimetric radar characteristics of rain as the observation. However, the simulations with NICAM-SM and ASUCA-SM show larger raindrop sizes in stronger rain areas compared to the observation. For the larger ice particles just above the melting level around 4 km, NICAM-DM and ASUCA-SM overestimate particle sizes of graupel or snow, while NICAM-SM has a similar size of the ice particles. In future studies, we will use the present results to improve the cloud microphysics scheme, which will be tested on a global model.

Chenopodium quinoa mitovirus 1 (CqMV1), a member of Mitovirus in the family Mitoviridae, is the first identified plant mitovirus (Nerva et al., 2019), which has been reported to be capable of infecting different cultivars of Chenopodium quinoa including Cherry vanilla quinoa, GQU-7356 campesino Quinoa, and Wild (Nerva et al., 2019). Cultivation of C. quinoa has increased notably in China, with good agricultural and industrial results due to its nutritional value (Vega-Gálvez et al., 2010). In September 2019, leaf mottling and plant stunting were observed on C. quinoa (cv. Longli 1) plants (Fig. S1) in a field of about 0.9 acre in Qingyuan County, Zhejiang Province, China. About 33.3% (401/1200) of C. quinoa showed leaf mottling and plant stunting symptoms. To identify viral agents potentially associated with this disease, a sRNA library from a symptomatic leaf sample was generated and sequenced. Total RNA was extracted using RNAiso Plus (TaKaRa, Tokyo, Japan) and the library was constructed using the Truseq Small RNA Library preparation kit (Illumina, CA, USA). Approximately 14 million raw reads were obtained from the Illumina MiSeq platform. The clean reads were obtained and assembled using the VirusDetect pipeline v1.6 (Zheng et al., 2017) for virus identification. A total of 22 assembled contigs, with sizes ranging from 42 to 306 nt, could be aligned to the genome of CqMV1 isolate Che1 (accession no. MF375475) with nucleotide identities of 96.3% to 99.1% and a cumulative alignment coverage of the CqMV1 genome of 84.0%. Except for CqMV1, no other viruses or viroids were found in the sample. Based on the assembled contigs and the reference CqMV1 genome, we designed two primer pairs (P1F: 5′- TCCGAATCTCATTTTCGGAGTGGGTAGA -3′ and P1R: 5′- CAGACTTTAGATCAAATGAATACACATGT -3′; P2F: 5′- TCCAGTATACCTGTGGATAGTACTTTCA -3′and P2R: 5′- CGATCTCTGCTACCAAATACTCGTGAGCC -3′) to obtain the genome sequence of CqMV1 isolate Zhejiang (CqMV1-ZJ). Total RNA from the CqMV1-infected C. quinoa plant was subject to reverse transcription (RT) using AMV reverse transcriptase (TaKaRa, Tokyo, Japan) with random primers N6 (TaKaRa, Tokyo, Japan). The cDNA was then used as the template to amplify two regions in the genome, which together covered the entire genome of CqMV1-ZJ, using high-fidelity DNA polymerase KOD-Plus-Neo (Toyobo, Osaka, Japan). The PCR products were cloned into the pLB vector (Tiangen, Beijing, China) and Sanger sequenced (YouKang Co., Ltd, China). The obtained sequences were assembled into a 2,730-nt contig, representing the complete genome of CqMV1-ZJ (GenBank accession no. MT089917). Pairwise sequence comparison using the Sequence Demarcation Tool v.1.2 (Muhire et al., 2014) revealed that CqMV1-ZJ shared a sequence identity of 96.9% with the sole CqMV1 sequence available in GenBank (MF375475), thus confirming the identity of the virus as CqMV1. Furthermore, we performed RT- PCR detection on 10 collected samples using the primer pair P1F and P1R. All seven symptomatic plants tested positive for CqMV1 infection, whereas three asymptomatic plants were CqMV1-free (Fig. S1), suggesting a possible association between the virus and the symptoms observed. However, in the study by Nerva et al, two CqMV1 infected accessions (cv. Regalona and IPSP1) were found asymptomatic (Nerva et al., 2019), we therefore speculated that the symptom caused by CqMV1 varies between different C. quinoa varieties or its growth environment. To the best of our knowledge, this is the first report of CqMV1 infecting C. quinoa in China. Its ability to be transmitted through seeds (Nerva et al., 2019) and the possible pathogenicity in C. quinoa raises a serious concern for the local C. quinoa industry. The findings reported here will assist further investigations on the epidemiology and biological characteristics of CqMV1 in Zhejiang, China.

Originally published in Tokyo in 1903, Hanakatsura (literally “garland of flowers”) features a biographical sketch of the activist and author Kishida Toshiko (Baroness Nakajima) plus four short stories by Japanese women writers of the Meiji era: Akebonozome: A Cloth Dyed in Rainbow Colors, by Kaho Miyake Ōtsugomori: The Last Day of the Year, by Ichiyo Higuchi Onisenbiki: The Thousand Devils, by Usurai Kitada (Mrs. Kajita) Shinobine, by Otsuka Kusuo Compiled and translated by Tei Fujiu, four memorable and affecting stories depict women experiencing the frustrations of traditional family roles within an emergent commercial society at the turn of the century. The men seem preoccupied with buying and selling votes, fighting foreign wars, ignoring their families, or going out on the town; and they are fully capable of rejecting a bride for her looks or just letting a new wife walk away. Meanwhile, young female characters cope with overall shabbiness, lost samurai dignity, orphanhood, servitude, poverty, indebtedness, jealous sisters, stepmothers, and mothers-in-law, and the combined challenges of being blind, ugly, alone, and empathetic.

Tomato yellow mottle-associated virus (TYMaV), is a member of the genus Cytorhabdovirus in the family Rhabdoviridae, which has been reported to infect tomato (Lycopersicon esculentum) (Xu et al. 2017), Solanum nigrum (Li et al., 2022) and Nicotiana benthamiana (Zhou et al. 2019). In July 2021, virus-like symptoms of chlorosis, mosaic, and ring spots were observed in pepper, tomato, and eggplant during a survey of viral symptoms in Huzhou City, Zhejiang Province, China. To identify viral agents potentially associated with these diseases, an Oxford Nanopore cDNA library from the mixed samples was generated and sequenced. Briefly, total RNA from 10 leaf tissue samples (3 pepper plants, 4 tomato plants, and 3 eggplant plants) was extracted using RNAiso Plus (TaKaRa, Tokyo, Japan) and pooled in equal amounts (100 ng/l each). The library was constructed using a PCR-cDNA sequencing kit (SQK-PCS109; Oxford Nanopore Technologies, Oxford, UK) in accordance with the manufacturer's instructions. Approximately 8.6 million reads were obtained from the Oxford MinION platform. After removing adapters and low-quality reads using iVar v1.3.1 (Grubaugh et al., 2019), the clean reads were subjected to BLASTn search in the GenBank database. We identified sequences derived from potato virus X (PVX), potato virus Y (PVY), cucumber mosaic virus (CMV), pepper mottle virus (PepMoV), and TYMaV. Of these reads, 339 with lengths ranging from 375 to 8651 nt were mapped to the genome of TYMaV (GeneBank Accession No. KY075646.1) at a 98.2% query coverage. To identify TYMaV-infected plants in the pooled samples, all 10 samples were analyzed by two-step RT-PCR using AMV reverse transcriptase (Takara, Tokyo, Japan) combined with random primers N6 (Takara, Dalian, China) and high-fidelity DNA polymerase KOD-Plus-Neo (Toyobo, Osaka, Japan) with primer pairs: N-F 5′- CAGGGAGAGAATGTACAAGTTGATC′/N-R 5′- GACCTTGCTCATCTGATGCAAC -3′, amplifying 420 bp of the 3′end of nucleoprotein (N) gene. A pepper sample showing chlorosis symptom was positive for the TYMaV infection, but negative for PVX, PVY, CMV or PepMoV infection when tested using the primers listed in table S1. To confirm the genome sequence of TYMaV Zhejiang isolate (TYMaV-ZJ), we carried out two-step RT-PCR with seven primer pairs (Table S1) designed based on the reference TYMaV genome (GeneBank accession number KY075646.1). PCR products were cloned into pLB vector (Tiangen, Beijing, China) and Sanger sequenced in both directions. At least five independent clones of each fragment were sequenced to avoid possible mutations introduced by PCT. The sequences were assembled into a nearlyfull-length genome of TYMaV –ZJ which was composed of 13344nt (GeneBank accession number OP296980). Pairwise sequence comparison revealed that TYMaV -ZJ genome shared 91.50% and 85.59% nt sequence identity with that of the TYMaV tomato isolate (KY075646.1) and the Solanum nigrum isolate (MW527091.1), which is higher than the species demarcation threshold of 75% for the genus Cytorhabdovirus (Walker et al., 2022). To the best of our knowledge, this is the first report of TYMaV infecting pepper.

Tribal Textiles and the Mingei Circle in Japan: Muneyoshi Yanagi’s View on Carpet Yumiko Kamada, Keio University, Tokyo Follow Date of this Version 2020 Citation Published in Hidden Stories/Human Lives: Proceedings of the Textile Society of America 17th Biennial Symposium, October 15-17, 2020. https://digitalcommons.unl.edu/tsaconf/ doi: 10.32873/unl.dc.tsasp.013 Comments Copyright © 2020 Yumiko Kamada Abstract Tribal carpets and textiles have been enthusiastically collected by connoisseurs and ordinary people in Europe and the United States for years. Along with a number of publications on tribal carpets and textiles, several recent exhibitions such as Portable Storage: Tribal Weavings from the Collection of William and Inger Ginsberg at the Metropolitan Museum of Art indicate a keen academic interest in the West. In contrast, tribal carpets and textiles did not gain the attention of the majority of Japanese. However, some Japanese, especially Yanagi Muneyoshi and his friends in the Mingei circle, notably Hamada Shoji, Serizawa Keisuke, and Tonomura Kichinosuke, have been collecting tribal carpets and textiles since the mid-twentieth century. This paper focuses on this little-known fact and explores how and in what circumstances these textiles were collected. As discussed elsewhere by the author, Indian and Persian carpets were brought to Edo-period Japan by the Dutch East India Company and used for special occasions such as festivals. Then, from the early twentieth century, a privileged few, such as aristocrats, scholars, and businessmen, had the chance to visit Europe and the United States and became exposed to carpets as daily furnishings. Some took tribal carpets and textiles back to Japan. While several Japanese handbooks on the use of carpet as interior decoration were published in the 1920s, most Japanese were unfamiliar with carpets. It was in this context that Yanagi Muneyoshi found beauty in carpet designs and came to regard carpets and tribal textiles as idealized artifacts. In the 1950s, Yanagi actually used a saddle bag made by a Persian nomad as a cushion in his library. Using his work as source material, this paper examines why carpets and tribal textiles were highly valued by the Mingei circle and compares their view with William Morris’s attitude toward Oriental carpets.

Abstract Background The investigation into sudden unexpected and unnatural deaths supports criminal justice, aids in litigation, and provides important information for public health including surveillance, epidemiology, and prevention programs. The use of mortality data to convey trends can inform policy development and resource allocations. Hence, data practices/management systems in Forensic Medicine are critical. This study scoped literature and described the body of knowledge on data management and practice systems in Forensic Medicine. Methods Five steps of the methodological framework of Arksey and O’Malley guided this scoping review. A combination of keywords, Boolean terms, and Medical Subject Headings was used to search PubMed, EBSCOhost (CINAHL with full text and Health Sources), Cochrane Library, Scopus, Web of Science, Science Direct, WorldCat, and Google Scholar from the 18th to 24th of June 2020 and updated in November 2021 for peer review papers. This study included articles involving unnatural deaths, focused on data practice or data management systems, relating to Forensic Medicine, all study designs, and published in English. Screening and selection and data extraction were conducted by two reviews. Thematic analysis was conducted, and the results were reported using both quantitatively and qualitatively. Results Of the 23,059 articles, 16 met this study’s inclusion criteria. The included articles were published between 2008 and 2019. Eight of the 16 articles were published between 2017 and 2019. Most of the included studies were conducted in the USA (5) and Australia/New Zealand (4). Only two publications were from lower- and middle-income countries (Nigeria, Mexico), and the remaining 14 were from high-income countries (Italy, Denmark, USA, Australia, and New Zealand, Japan, Switzerland, Canada). The data management systems found in this study were as follows: Virtopsy, Canadian Coroner and Medical Examiner Database, Infant Injury Database, Fatal injury surveillance system, Medical Examiners and Coroners Alert System, National Violent Deaths Reporting System, AM/PM Database, Tokyo CDISC/ODM, and National Coronial Information System. Conclusions This study’s results revealed limited articles relating to data management and practice systems in Forensic Medicine, particularly in LMICs through literature indicating there is a prevalence of unnatural deaths in LMICs. This study, therefore, recommends research on data management and practice systems relating to forensic medicine in LMICs to inform policy decisions.

Tomato leaf curl New Delhi virus (ToLCNDV), a member of the genus Begomovirus in the family Geminiviridae is naturally transmitted by the whitefly Bemisia tabaci (order Hemiptera, family Aleyrodidae) in a circulative and persistent manner (Moriones et al. 2017). ToLCNDV has occurred in Bangladesh, India, Indonesia, Iran, Italy, Malaysia, Pakistan, Sri Lanka, Spain, Thailand and Tunisia (Moriones et al. 2017). To date, The primary cultivated host of ToLCNDV has been identified as tomato (Lycopersicon esculentum), but the virus is also known to infect 43 other plant species from a range of families including Cucurbitaceae, Euphorbiaceae, Solanaceae, Malvaceae and Fabaceae (Zaidi et al. 2017). In August 2021, virus-like symptoms including leaf deformation and curing were observed on tomato (Lycopersicon esculentum) in a greenhouse of about 0.5 hectares in Zhejiang Province, China. To identify viral agents potentially associated with this disease, an Oxford Nanopore cDNA library from a symptomatic sample was generated and sequenced. Total RNA was extracted using RNAiso Plus (TaKaRa, Tokyo, Japan). Libraries were constructed using Oxford Nanopore PCR-cDNA Sequencing Kit (SQK-PCS109; Oxford Nanopore Technologies, Oxford, UK), as recommended. Approximately 8.7 million reads were obtained from the Oxford MinION platform. After removing the adapters and low-quality reads, the clean reads were subjected to BLASTn analysis against the nt database. Approximately 797 and 168 reads produced high nt identities to the genome of ToLCNDV DNA-A (GeneBank Accession No. U15015.2) and ToLCNDV DNA-B (GeneBank Accession No. U15017.2) respectively. We designed 6 primer pairs (Table S1) to obtain the sequence of ToLCNDV Zhejiang (ToLCNDV-ZJ) isolate DNA-A and DNA-B. Briefly, total DNA from ToLCNDV-infected tomato was extracted using standard cetyl trimethylammonium bromide method. Segments of ToLCNDV DNA-A and DNA-B were amplified using high-fidelity DNA polymerase KOD-Plus-Neo (Toyobo, Osaka, Japan). PCR products were cloned into the pLB vector (Tiangen, Beijing, China) and Sanger sequenced. The obtained sequences were assembled into complete sequences of ToLCNDV-ZJ DNA-A (2,739 nt, GeneBank Accession No. OP356207) and DNA-B (2,693 nt, GeneBank Accession No. OP356208). Pairwise sequence comparison revealed that the ToLCNDV -ZJ shared the highest nt sequence identities of 98.7% and 98.4% with the genome segments of New Delhi isolate (genome A: HM159454) and India:Delhi:Cucumis:2012 isolate (genome B: KC545813) respectively. Furthermore, we performed PCR detection on 10 collected samples using the primer pair P1F and P1R. All eight symptomatic plants showing upward leaf curling and leaf distortion tested positive for ToLCNDV infection, whereas two asymptomatic plants were ToLCNDV free. To our knowledge, this is the first report of ToLCNDV infecting tomato in China, and with the widespread presence of B. tabaci in green houses, ToLCNDV may be a potential threat to the cultivation of tomato in China. In addition, ToLCNDV is an exceptional Old World bipartite begomovirus. In China, monopartite DNA satellite-associated begomoviruses with mostly narrow geographical ranges predominate, and are widespread (Li et al., 2022). The occurrence of ToLCNDV in China, which indicates that the success of this virus would become an emerging threat to vegetable and fiber crops.

Introduction The sensational appearance of kawaii fashion in Tokyo’s Harajuku neighborhood—full of freedom, fun, and frills— has captivated hearts and imaginations worldwide. A key motivational concept for this group is “kawaii” which is commonly translated as “cute” and can also be used to describe things that are “beautiful”, “funny”, “pretty”, “wonderful”, “great”, “interesting”, and “kind” (Yamane 228; Yomota 73; Dale 320). Representations in media such as the styling of Harajuku street model and J-pop star Kyary Pamyu Pamyu, directed by Sebastian Masuda, have helped bring this fashion to a wider audience. Of this vibrant community, decora fashion is perhaps best known with its image well documented in in street-fashion magazines such as Shoichi Aoki’s FRUiTS (1997–2017), Websites such as Tokyo Fashion (2000–present), and in magazines like KERA (1998–2017). In particular, decora fashion captures the “do-it-yourself” approach for which Harajuku is best known for (Yagi 17). In this essay we draw on New Materialism to explore the ways in which decora fashion practitioners form kawaii affective assemblages with the objects they collect and transform into fashion items. We were motivated to pursue this research to build on other qualitative studies that aimed to include the voices of practitioners in accounts of their lifestyles (e.g. Nguyen; Monden; Younker) and respond to claims that kawaii fashion is a form of infantile regression. We—an Australian sociologist and kawaii fashion practitioner, a Japanese decora fashion practitioner and Harajuku street model, and a Japanese former owner of a tearoom in Harajuku—have used an action-led participatory research method to pool our expertise. In this essay we draw on both a New Materialist analysis of our own fashion practices, a 10-year longitudinal study of Harajuku (2012–2022), as well as interviews with twelve decora fashion practitioners in 2020. What Is Decora Fashion? Decora is an abbreviation of “decoration”, which reflects the key aesthetic commitment of the group to adorn their bodies with layers of objects, accessories, and stickers. Decora fashion uses bright clothing from thrift stores, layers of handmade and store-bought accessories, and chunky platform shoes or sneakers. Practitioners enjoy crafting accessories from old toys, kandi and perler beads, weaving, braiding, crocheting novelty yarn and ribbon, and designing and printing their own textiles. In addition to this act of making, decora practitioners also incorporate purchases from specialty brands like 6%DOKI DOKI, Nile Perch, ACDC Rag, YOSUKE USA, and minacute. According to our interviewees, whom we consulted in 2020, excess is key; as Momo told us: “if it’s too plain, it’s not decora”. Decora uses clashing, vibrant, electric colours, and a wild variety of kawaii versions of monsters, characters, and food which appear as motifs on their clothing (Groom 193; Yagi 17). Clashing textures and items—such as a sweat jackets, gauzy tutus, and plastic toy tiaras—are also a key concept (Koga 81). Colour is extended to practitioners’ hair through colourful hair dyes, and the application of stickers, bandaids, and jewels across their cheeks and nose (Rose, Kurebayashi and Saionji). These principles are illustrated in fig. 1, a street snap from 2015 of our co-author, Kurebayashi. Working with the contrasting primary colours across her hair, clothes, and accessories, she incorporates both her own handmade garments and found accessories to form a balanced outfit. Her Lisa Frank cat purse, made from a psychedelic vibrant pink faux fur, acts as a salient point to draw in our eyes to a cacophony of colour throughout her ensemble. The purse is a prized item from her own collection that was a rare find on Mercari, an online Japanese auction Website, 15 years ago. Her sweater dress is handmade, with a textile print she designed herself. The stickers on the print feature smiley faces, rainbows, ducks, and candy—all cheap and cheerful offerings from a discount store. Through intense layering and repetition, Kurebayashi has created a collage that is reminiscent of the clips and bracelets that decorate her hair and wrists. This collage also represents the colour, fun, and whimsy that she immerses herself in everyday. Her platform shoes are by Buffalo London, another rare find for her collection. Her hair braids are handmade by Midoroya, an online artist, which she incorporates to create variety in the textures in her outfit from head to toe. Peeking beneath her sweater is a short colourful tutu that floats and bounces with each step. Together the items converge and sing, visually loud and popping against the urban landscape. Fig. 1: Kurebayashi’s street snap in an decora fashion outfit of her own styling and making, 2015. Given the street-level nature of decora fashion, stories of its origins draw on oral histories of practitioners, alongside writings from designers and stores that cater to this group (Ash). Its emergence was relatively organic in the early 1990s, with groups enjoying mixing and combining found objects and mis-matching clothing items. Initially, decorative styles documented in street photography used a dark colour palette with layers of handmade accessories, clips, and decorations, and a Visual-kei influence. Designers such as Sebastian Masuda, who entered the scene in 1995, also played a key role by introducing accessories and clothes inspired by vintage American toys, Showa era (1926-1989) packaging, and American West Club dance culture (Sekikawa and Kumagi 22–23). Pop idols such as Tomoe Shinohara and Kyary Pamyu Pamyu are also key figures that have contributed to the pop aesthetic of decora. While decora was already practiced prior to the release of Shinohara’s 1995 single Chaimu, her styling resonated with practitioners and motivated them to pursue a more “pop” aesthetic with an emphasis on bright colours, round shapes, and handmade colourful accessories. Shinohara herself encouraged fans to take on a rebelliously playful outlook and presentation of self (Nakao 15–16; Kondō). This history resonates with more recent pop idol Kyary Pamyu Pamyu’s costuming and set design, which was directed by Sebastian Masuda. Kyary’s kawaii fashion preceded her career, as she regularly participated in the Harajuku scene and agreed to street snaps. While the costuming and set design for her music videos, such as Pon Pon Pon, resonate with the Harajuku aesthetic, her playful persona diverges. Her performance uses humour, absurdity, and imperfection to convey cuteness and provide entertainment (Iseri 158), but practitioners in Harajuku do not try to replicate this performance; Shinohara and Kyary’s stage persona promotes ‘immaturity’ and ‘imperfection’ as part of their youthful teenage rebellion (Iseri 159), while kawaii fashion practitioners prefer not to be seen in this light. When considering the toys, stickers, and accessories incorporated into decora fashion, and the performances of Shinohara and Kyary, it is understandable that some outsiders may interpret the fashion as a desire to return to childhood. Some studies of kawaii fashion more broadly have interpreted the wearing of clothing like this as a resistance to adulthood and infantile regression (e.g., Kinsella 221–222; Winge; Lunning). These studies suggest that practitioners desire to remain immature in order to “undermin[e] current ideologies of gender and power” (Hasegawa 140). In particular, Kinsella in her 1995 chapter “in Japan” asserts that fashion like this is an attempt to act “vulnerable in order to emphasize … immaturity and inability to carry out social responsibilities” (241), and suggests that this regression is “self-mutilation [which denies] the existence of a wealth of insights, feelings and humour that maturity brings with it” (235). This view has spread widely in writing about kawaii fashion, and Steele, Mears, Kawamura, and Narumi observe for instance that “prolonging childhood is compelling” as an attractive component of Harajuku culture (48). While we recognise that this literature uses the concept of “childishness” to acknowledge the rebellious nature of Harajuku fashion, our participants would like to discourage this interpretation of their practice. In particular, participants highlighted their commitment to studies, paying bills, caring for family members, and other markers they felt indicated maturity and responsibility. They also found this belief that they wanted to deny themselves adult “insights, feelings and humour” deeply offensive as it disregards their lived experience and practice. From a Sociological perspective, this infantilising interpretation is concerning as it reproduces Orientalist framings of Japanese women who enjoy kawaii culture as dependent and submissive, rather than savvy consumers (Bow 66–73; Kalnay 95). Furthermore, this commentary on youth cultures globally, which points to an infantilisation of adulthood (Hayward 230), has also been interrogated by scholars as an oversimplistic reading that doesn’t recognise the rich experiences of adults who engage in these spaces while meeting milestones and responsibilities (Woodman and Wyn; Hodkinson and Bennett; Bennett). Through our lived experience and work with the decora fashion community, we offer in this essay an alternative account of what kawaii means to these practitioners. We believe that agency, energy, and vibrancy is central to the practice of decora fashion. Rather than intending to be immature, practitioners are looking for vibrant ways to exist. A New Materialist lens offers a framework with which we can consider this experience. For example, our informant Momota, in rejecting the view that her fashion was about returning to childhood, explained that decora fashion was “rejuvenating” because it gave them “energy and power”. Elizabeth Groscz in her essay on freedom in New Materialism encourages us to consider new ways of living, not as an expression of “freedom from” social norms, but rather “freedom to” new ways of being, as expression of their “capacity for action” (140). In other words, rather than seeking freedom from adult responsibilities and regressing into a state where one is unable to care for oneself, decora fashion is a celebration of what practitioners are “capable of doing” (Groscz 140–141) by finding pleasure in collecting and making. Through encounters with kawaii objects, and the act of creating through these materials, decora fashion practitioners’ agential capacities are increased through experiences of elation, excitement and pleasure. Colourful Treasures, Fluttering Hearts: The Pleasures of Collecting kawaii Matter Christine Yano describes kawaii as having the potential to “transform the mundane material world into one occupied everywhere by the sensate and the sociable” (“Reach Out”, 23). We believe that this conceptualisation of kawaii has strong links to New Materialist theory. New Materialism highlights the ways in which human subjects are “are unstable and emergent knowing, sensing, embodied, affective assemblages of matter, thought, and language, part of and inseparable from more-than human worlds” (Lupton). Matter in this context is a social actor in its own right, energising and compelling practitioners to incorporate them into their everyday lives. For example, kawaii matter can move us to be more playful, creative, and caring (Aiwaza and Ohno; Nishimura; Yano, Pink Globalization), or help us relax and feel calm when experiencing high levels of stress (Stevens; Allison; Yano, “Reach Out”). Studies in the behavioral sciences have shown how kawaii objects pique our interest, make us feel happy and excited, and through sharing our excitement for kawaii things become kinder and more thoughtful towards each other (Nittono; Ihara and Nittono; Kanai and Nittono). Decora fashion practitioners are sensitive to this sensate and sociable aspect of kawaii; specific things redolent with “thing-power” (Bennett) shine and twinkle amongst the cultural landscape and compel practitioners to gather them up and create unique outfits. Decora fashion relies on an ongoing hunt for objects to upcycle into fashion accessories, thrifting second-hand goods in vintage stores, dollar stores, and craft shops such as DAISO, Omocha Spiral, and ACDC Rag. Practitioners select plastic goods with smooth forms and shapes, and soft, breathable, and light clothing, all with highly saturated colours. Balancing the contrast of colours, practitioners create a rainbow of matter from which they assemble their outfits. The concept of the rainbow is significant to practitioners as the synergy of contrasting colours expresses its own kawaii vitality. As our interviewee, Kanepi, described, “price too can be kawaii” (Yano, Pink Globalization 71); affordable products such as capsule toys and accessories allow practitioners to amass large collections of glistening and twinkling objects. Rare items are also prized, such as vintage toys and goods imported from America, resonating with their own “uniqueness”, and providing a point of difference to the Japanese kawaii cultural landscape. In addition to the key principles of colour, rarity, and affordability, there is also a personalised aspect to decora fashion. Amongst the mundane racks of clothing, toys, and stationary, specific matter twinkles at practitioners like treasures, triggering a moment of thrilling encounter. Our interviewee Pajorina described this moment as having a “fateful energy to it”. All practitioners described this experience as “tokimeki” (literally, a fluttering heart beat), which is used to refer to an experience of excitement in anticipation of something, or the elating feeling of infatuation (Occhi). Our interviewees sought to differentiate this experience of kawaii from feelings of care towards an animal or children through writing systems. While the kanji for “kawaii” was used to refer to children and small animals, the majority of participants wrote “kawaii” to express the vivid and energetic qualities of their fashion. We found each practitioner had a tokimeki response to certain items that and informed their collecting work. While some items fit a more mainstream interpretation of kawaii, such as characters like Hello Kitty, ribbons, and glitter, other practitioners were drawn to non-typical forms they believed were kawaii, such as frogs, snails, aliens, and monsters. As our interviewee Harukyu described: “I think people’s sense of kawaii comes from different sensibilities and perspectives. It’s a matter of feelings. If you think it is kawaii, then it is”. Guided by individual experiences of objects on the shop shelves, practitioners select things that resonate with their own inner beliefs, interests, and fantasies of what kawaii is. In this regard, kawaii matter is not “structured” or “fixed” but rather “emergent through relations” that unfold between the practitioner and the items that catch their eye in a given moment (Thorpe 12). This offers not only an affirming experience through the act of creating, but a playful outlet as well. By choosing unconventional kawaii motifs to include in their collection, and using more standard kawaii beads, jewels, and ribbons to enhance the objects’ cuteness, decora fashion practitioners are transforming, warping, and shifting kawaii aesthetic boundaries in new and experimental ways (Iseri 148; Miller 24–25). As such, this act of collecting is a joyous and elating experience of gathering and accumulating. Making, Meaning, and Memory: Creating kawaii Assemblages Once kawaii items are amassed through the process of collecting, their cuteness is intensified through hand-making items and assembling outfits. One of our interviewees, Momo, explained to us that this expressive act was key to the personalisation of their clothes as it allows them to “put together the things you like” and “incorporate your own feelings”. For example, the bracelets in fig. 2 are an assemblage made by our co-author Kurebayashi, using precious items she has collected for 10 years. Each charm has its own meaning in its aesthetics, memories it evokes, and the places in which it was found. Three yellow rubber duck charms bob along strands of twinkling pink and blue bubble-like beads. These ducks, found in a bead shop wholesaler while travelling in Hong Kong, evoke for Kurebayashi an experience of a bubble bath, where one can relax and luxuriate in self care. Their contrast with the pink and blue—forming the trifecta of primary colours—enhances the vibrant intensity of the bracelet. A large blue bear charm, contrasting in scale and colour, swings at her wrist, its round forms evoking Lorenz’s Kindchenschema. This bear charm is another rare find from America, a crowning jewel in Kurebayashi’s collection. It represents Kurebayashi’s interest in fun and colourful animals as characters, and as potential kawaii friends. Its translucent plastic form catches the light as it glistens. To balance the colour scheme of her creation, Kurebayashi added a large strawberry charm, found for just 50 Yen in a discount store in Japan. Together these objects resonate with key decora principles: personal significance, rarity, affordability, and bright contrasting colours. While the bear and duck reference childhood toys, they do not signify to Kurebayashi a desire to return to childhood. Rather, their rounded forms evoke a playful outlook on life informed by self care and creativity (Ngai 841; Rose). Through bringing the collection of items together in making these bracelets, the accessories form an entanglement of kawaii matter that carries both aesthetic and personal meaning, charged with memories, traces of past travels, and a shining shimmering vitality of colour and light. Fig. 2: Handmade decora fashion bracelet by Kurebayashi, 2022. The creation of decora outfits is the final act of expression and freedom. In this moment, decora fashion practitioners experience elation as they gleefully mix and match items from their collection to create their fashion style. This entanglement of practitioner and kawaii matter evokes what Gorscz would describe as “free acts … generated through the encounter of life with matter” (151). If we return to fig. 1, we can see how Kurebayashi and her fashion mutually energise each other as an expression of colourful freedom. While the objects themselves are found through encounters and given new life by Kurebayashi as fashion items, they also provide Kurebayashi with tools of expression that “expand the variety of activities” afforded to adults (Gorscz 154). She feels elated, full of feeling, insight, and humour in these clothes, celebrating all the things she loves that are bright, colourful, and fun. Conclusion In this essay, we have used New Materialist theory to illustrate some of the ways in which kawaii matter energises decora fashion practitioners, as an expression of what Gorscz would describe as “capacity for action” and a “freedom towards” new modes of expression. Practitioners are sensitive to kawaii’s affective potential, motivating them to search for and collect items that elate and excite them, triggering moments of thrilling encounters amongst the mundanity of the stores they search through. Through the act of making and assembling these items, practitioners form an entanglement of matter charged with their feelings, memories, and the vitality and vibrancy of their collections. Like shining rainbows in the streets, they shimmer and shine with kawaii life, vibrancy, and vitality. Acknowledgements This article was produced with the support of a Vitalities Lab Scholarship, UNSW Sydney, a National Library of Australia Asia Studies scholarship, as well as in-kind support from the University of Tokyo and the Japan Foundation Sydney. We also thank Deborah Lupton, Melanie White, Vera Mackie, Joshua Paul Dale, Masafumi Monden, Sharon Elkind, Emerald King, Jason Karlin, Elicia O’Reily, Gwyn McLelland, Erica Kanesaka, Sophia Saite, Lucy Fraser, Caroline Lennette, and Alisa Freedman for their kind input and support in helping bring this community project to life. Finally, we thank our decora fashion practitioners, our bright shining stars, who in the face of such unkind treatment from outsiders continue to create and dream of a more colourful world. We would not be here without your expertise. References Aizawa, Marie, and Minoru, Ohno. “Kawaii Bunka no Haikei [The Background of Kawaii Culture].” Shōkei gakuin daigaku kiyō [Shōkei Gakuin University Bulletin] 59 (2010): 23–34. Allison, Anne. “Cuteness as Japan’s Millennial Product.” Pikachu's Global Adventure: The Rise and Fall of Pokémon. Ed. Joseph Tobin. Durham: Duke UP, 2004. 34–49. Aoki, Shoichi. FRUiTS. Renzu Kabushikigaisha. 1997–2017. Ash. “The History of: Decora.” The Comm, 31 May. 2022. <https://the-comm.online/blog/the-history-of-decora/>. Bennett, Andy. Music, Style and Aging: Growing Old Disgracefully? Philadelphia: Temple UP, 2013. Bennett, Jane. Vibrant Matter: A Political Ecology of Things. London: Duke UP, 2010. Bow, Leslie. Racist Love: Asian Abstraction and the Pleasures of Fantasy. Durham: Duke UP, 2022. Dale, Joshua. “Cuteness Studies and Japan.” The Routledge Companion to Gender and Japanese Culture. Eds. Jennifer Coates, Lucy Fraser, and Mark Pendleton. New York: Routledge, 2020. 320–30. Groom, Amelia. “Power Play and Performance in Harajuku.” New Voices in Japanese Studies 4 (2011): 188–214. Groscz, Elizabeth. “Feminism, Materialism, and Freedom.” New Materialisms: Ontology, Agency, and Politics. Eds. Diana Coole and Samantha Frost. Durham: Duke UP, 2007. Hasegawa, Yuko. “Post-Identity Kawaii: Commerce, Gender, and Contemporary Japanese Art.” Consuming Bodies: Sex and Contemporary Japanese Art. Ed. Fran Loyd. London: Reaktion Books, 2002. 127–41. Hayward, Keith. “Life Stage Dissolution’ in Anglo-American Advertising and Popular Culture: Kidults, Lil’ Britneys and Middle Youths.” The Sociological Review 61.3 (2013): 525–48. Hodkinson, Paul, and Andy Bennett. Ageing and Youth Cultures: Music, Style and Identity. London: Berg, 2013. Ihara, Namiha, and Hiroshi Nittono. “Osanasa no Teido ni Yoru ‘Kawaii’ no Kategori Bunrui [Categorization of “Kawaii” by Levels of Infantility].” Studies in Human Sciences 6.13 (2011): 13–18. Iseri, Makiko. “Flexible Femininities? Queering kawaii in Japanese Girls’ Culture.” Twenty-First Century Feminism: Forming and Performing Femininity. Eds. Claire Nally and Angela Smith. London: Palgrave Macmillian, 2015. Kanai, Yoshihiro, and Hiroshi Nittono. “Kyōkansei to Shinwa Dōki ni Yoru ‘Kawaii’ Kanjō no Yosoku Moderu Kōchiku [Building a Predictive Model of ‘Cute’ Emotions Using Empathy and Affinity Motivation].” Sonariti kenkyū 23.3 (2015): 131–41. Kalnay, Erica Kanesaka. “Yellow Peril, Oriental Plaything: Asian Exclusion and the 1927 U.S.-Japan Doll Exchange.” Journal of Asian American Studies 23.1 (2020): 93–124. KERA. JInternational. 1998–2017. Kinsella, Sharon. “Cuties in Japan.” Women, Media, and Consumption in Japan. Eds. Brian Moeran and Lisa Skov. Richmond: Curzon Press, 1995. 220–54. Koga, Reiko. ‘Kawaii’ no Teikoku: Mōdo to Media to Onna-no-Ko Tachi [Empire of Kawaii: Mode, Media and Girls]. Tokyo: Seidosha, 2009. Kondō, Masataka. “Shinohara tomoe 40-sai ni shinorābūmu kara no henbō-buri kyōretsu kyara wa engidatta no ka [Shinohara Tomoe, 40 years Old, Changed from the Shinohara Boom: Was Her Strong Character a Performance?”].” Bunshun Online 3 Sep. 2019. <https://bunshun.jp/articles/-/11297>. Lorenz, Konrad. “Die angeborenen Formen möglicher Erfahrung [The Innate Condition of the Possibility of Experience].” Zeitschrift für Tierpsychologie 5.2 (1943): 245–409. Lunning, Frenchy.“Under the Ruffles: Shōjo and the Morphology of Power.” Mechademia 6 (2011): 63–19. Lupton, Deborah. “Toward a More-than-Human Analysis of Digital Health: Inspirations from Feminist New Materialism.” Qualitative Health Research 29.14 (2019): 1999–2009. Monden, Masafumi. Japanese Fashion Cultures: Dress and Gender in Contemporary Japan. Sydney: Bloomsbury, 2015. Miller, Laura. “Cute Masquerade and the Pimping of Japan.” International Journal of Japan 20.1 (2011): 18-29. Nakano, Atsumi. 2015. "The Formation and Commodification of Harajuku’s Image in Japan." Ritsumeikan Journal of Asia Pacific Studies. 34 (2016): 10–19. Ngai, Sianne. Our Aesthetic Categories: Zany, Cute, Interesting. Cambridge: Harvard UP, 2012. Nguyen, An. “Eternal Maidens: Kawaii Aesthetics and Otome Sensibility in Lolita Fashion.” Asian Journal of Popular Culture 2.1 (2016): 15–31. Nishimura, Mika. “Kawaii-ron Shiron II: Kawaii-ron no Shatei [Essay about Kawaii, II: The Limits of Kawaii Theory].” Dezain riron 73 (2019): 43–52. Nittono, Hiroshi. “Kawaiisa to Osanasa: Bebīsukīma o Meguru Hihan-teki Kōsatsu [Cuteness and Childhood: Critical Reflections of the Baby Schema].” VISION 25.2 (2013): 100–04. Nittono, Hiroshi. “The Two-Layer Model of ‘Kawaii’: A Behavioral Science Framework for Understanding Kawaii and Cuteness.” East Asian Journal of Popular Culture 2.1 (2016): 79–95. Occhi, Debra. “How to Have a HEART in Japanese.” Culture, Body, and Language: Conceptualizations of Internal Body Organs across Cultures and Languages. Eds. Farzad Sharifan, René Dirven, Ning Yu, and Susanne Niemeier. Berlin: De Gruyter Mouton, 2008. Rose, Megan Catherine. “Child’s Play? Exploring the Significance of Kawaii for Decora and Fairy-kei Fashion Practitioners in Harajuku through a Case-Focused Analysis.” New Voices in Japanese Studies 12 (2020): 80–102. Rose, Megan Catherine, Haruka Kurebayashi, and Rei Saionji. “Makeup in Decora Fashion, Harajuku, Tokyo.” Girls Museum, 2021. <https://www.girlmuseum.org/project/more-than-pretty/>. Sekikawa, Matoko, and Minori Kumagi. 6% DOKIDOKI Perfect Book. Tokyo: Takarajimasha, 2013. Steele, Valerie, Patricia Mears, Yuniya Kawamura, and Hiroshi Narumi, eds. Japan Fashion Now. New Haven: Yale UP, 2010. Stevens, Carolyn. “Cute But Relaxed: Ten Years of Rilakkuma in Precarious Japan.” M/C Journal 17.20 (2014): 1–10. Thorpe, Holly, Julie Brice, and Marianne Clark. Feminist New Materialisms, Sport and Fitness: A Lively Entanglement. London: Palgrave MacMillan, 2020. Tokyo Fashion. Tokyo Fashion. 23 Dec. 2021. <https://www.tokyofashion.com>. Winge, Theresa. “Undressing and Dressing Loli: A Search for the Identity of Japanese Lolita.” Mechademia 3 (2008): 347–63. Woodman, Dan, and Johanna Wyn. Youth and Generation. California: SAGE, 2015. Yagi, Yoko. Tokyo Street Style. New York: Abrams, 2018. Yamane, Kazuma. Hentai shōjo moji no kenkyū [Research on Girls’ Strange Handwriting]. Tokyo: Kōdansha, 1989. Yano, Christine. Pink Globalization: Hello Kitty's Trek across the Pacific. Durham: Duke UP, 2015. ———. “Reach Out and Touch Someone: Thinking through Sanrio’s Social Communication Empire.” Japanese Studies, 31.1 (2011): 23–36. Yomota, Inuhiko. Kawaii-ron [Theory of Cuteness]. Tokyo: Chikuma Shobo, 2006. Younker, Therese. “Japanese Lolita: Dreaming, Despairing, Defying.” Stanford Journal of East Asian Affairs, 11.1 (2012): 97–110.

The curtain rose. The howling of desert wind filled the performance hall in the Shanghai Grand Theatre. Into the center stage, where a scenic construction of a mountain cliff and a desert landscape was dimly lit, entered the character of the Daoist priest Wang Yuanlu (1849–1931), performed by Chen Yizong. Dressed in a worn and dusty outfit of dark blue cotton, characteristic of Daoist priests, Wang began to sweep the floor. After a few moments, he discovered a hidden chambre sealed inside one of the rock sanctuaries carved into the cliff.Signaled by the quick, crystalline, stirring wave of sound from the chimes, a melodious Chinese ocarina solo joined in slowly from the background. Astonished by thousands of Buddhist sūtra scrolls, wall paintings, and sculptures he had just accidentally discovered in the caves, Priest Wang set his broom aside and began to examine these treasures. Dawn had not yet arrived, and the desert sky was pitch-black. Priest Wang held his oil lamp high, strode rhythmically in excitement, sat crossed-legged in a meditative pose, and unfolded a scroll. The sound of the ocarina became fuller and richer and the texture of the music more complex, as several other instruments joined in.Below is the opening scene of the award-winning, theatrical dance-drama Dunhuang, My Dreamland, created by China’s state-sponsored Lanzhou Song and Dance Theatre in 2000. Figure 1a: Poster Side A of Dunhuang, My Dreamland Figure 1b: Poster Side B of Dunhuang, My DreamlandThe scene locates the dance-drama in the rock sanctuaries that today are known as the Dunhuang Mogao Caves, housing Buddhist art accumulated over a period of a thousand years, one of the best well-known UNESCO heritages on the Silk Road. Historically a frontier metropolis, Dunhuang was a strategic site along the Silk Road in northwestern China, a crossroads of trade, and a locus for religious, cultural, and intellectual influences since the Han dynasty (206 B.C.E.–220 C.E.). Travellers, especially Buddhist monks from India and central Asia, passing through Dunhuang on their way to Chang’an (present day Xi’an), China’s ancient capital, would stop to meditate in the Mogao Caves and consult manuscripts in the monastery's library. At the same time, Chinese pilgrims would travel by foot from China through central Asia to Pakistan, India, Nepal, Bangladesh, and Sri Lanka, playing a key role in the exchanges between ancient China and the outside world. Travellers from China would stop to acquire provisions at Dunhuang before crossing the Gobi Desert to continue on their long journey abroad. Figure 2: Dunhuang Mogao CavesThis article approaches the idea of “abroad” by examining the present-day imagination of journeys along the Silk Road—specifically, staged performances of the various Silk Road journey-themed dance-dramas sponsored by the Chinese state for enhancing its cultural and foreign policies since the 1970s (Kuang).As ethnomusicologists have demonstrated, musicians, choreographers, and playwrights often utilise historical materials in their performances to construct connections between the past and the present (Bohlman; Herzfeld; Lam; Rees; Shelemay; Tuohy; Wade; Yung: Rawski; Watson). The ancient Silk Road, which linked the Mediterranean coast with central China and beyond, via oasis towns such as Samarkand, has long been associated with the concept of “journeying abroad.” Journeys to distant, foreign lands and encounters of unknown, mysterious cultures along the Silk Road have been documented in historical records, such as A Record of Buddhist Kingdoms (Faxian) and The Great Tang Records on the Western Regions (Xuanzang), and illustrated in classical literature, such as The Travels of Marco Polo (Polo) and the 16th century Chinese novel Journey to the West (Wu). These journeys—coming and going from multiple directions and to different destinations—have inspired contemporary staged performance for audiences around the globe.Home and Abroad: Dunhuang and the Silk RoadDunhuang, My Dreamland (2000), the contemporary dance-drama, staged the journey of a young pilgrim painter travelling from Chang’an to a land of the unfamiliar and beyond borders, in search for the arts that have inspired him. Figure 3: A scene from Dunhuang, My Dreamland showing the young pilgrim painter in the Gobi Desert on the ancient Silk RoadFar from his home, he ended his journey in Dunhuang, historically considered the northwestern periphery of China, well beyond Yangguan and Yumenguan, the bordering passes that separate China and foreign lands. Later scenes in Dunhuang, My Dreamland, portrayed through multiethnic music and dances, the dynamic interactions among merchants, cultural and religious envoys, warriors, and politicians that were making their own journey from abroad to China. The theatrical dance-drama presents a historically inspired, re-imagined vision of both “home” and “abroad” to its audiences as they watch the young painter travel along the Silk Road, across the Gobi Desert, arriving at his own ideal, artistic “homeland”, the Dunhuang Mogao Caves. Since his journey is ultimately a spiritual one, the conceptualisation of travelling “abroad” could also be perceived as “a journey home.”Staged more than four hundred times since it premiered in Beijing in April 2000, Dunhuang, My Dreamland is one of the top ten titles in China’s National Stage Project and one of the most successful theatrical dance-dramas ever produced in China. With revenue of more than thirty million renminbi (RMB), it ranks as the most profitable theatrical dance-drama ever produced in China, with a preproduction cost of six million RMB. The production team receives financial support from China’s Ministry of Culture for its “distinctive ethnic features,” and its “aim to promote traditional Chinese culture,” according to Xu Rong, an official in the Cultural Industry Department of the Ministry. Labeled an outstanding dance-drama of the Chinese nation, it aims to present domestic and international audiences with a vision of China as a historically multifaceted and cosmopolitan nation that has been in close contact with the outside world through the ancient Silk Road. Its production company has been on tour in selected cities throughout China and in countries abroad, including Austria, Spain, and France, literarily making the young pilgrim painter’s “journey along the Silk Road” a new journey abroad, off stage and in reality.Dunhuang, My Dreamland was not the first, nor is it the last, staged performances that portrays the Chinese re-imagination of “journeying abroad” along the ancient Silk Road. It was created as one of many versions of Dunhuang bihua yuewu, a genre of music, dance, and dramatic performances created in the early twentieth century and based primarily on artifacts excavated from the Mogao Caves (Kuang). “The Mogao Caves are the greatest repository of early Chinese art,” states Mimi Gates, who works to increase public awareness of the UNESCO site and raise funds toward its conservation. “Located on the Chinese end of the Silk Road, it also is the place where many cultures of the world intersected with one another, so you have Greek and Roman, Persian and Middle Eastern, Indian and Chinese cultures, all interacting. Given the nature of our world today, it is all very relevant” (Pollack). As an expressive art form, this genre has been thriving since the late 1970s contributing to the global imagination of China’s “Silk Road journeys abroad” long before Dunhuang, My Dreamland achieved its domestic and international fame. For instance, in 2004, The Thousand-Handed and Thousand-Eyed Avalokiteśvara—one of the most representative (and well-known) Dunhuang bihua yuewu programs—was staged as a part of the cultural program during the Paralympic Games in Athens, Greece. This performance, as well as other Dunhuang bihua yuewu dance programs was the perfect embodiment of a foreign religion that arrived in China from abroad and became Sinicized (Kuang). Figure 4: Mural from Dunhuang Mogao Cave No. 45A Brief History of Staging the Silk Road JourneysThe staging of the Silk Road journeys abroad began in the late 1970s. Historically, the Silk Road signifies a multiethnic, cosmopolitan frontier, which underwent incessant conflicts between Chinese sovereigns and nomadic peoples (as well as between other groups), but was strongly imbued with the customs and institutions of central China (Duan, Mair, Shi, Sima). In the twentieth century, when China was no longer an empire, but had become what the early 20th-century reformer Liang Qichao (1873–1929) called “a nation among nations,” the long history of the Silk Road and the colourful, legendary journeys abroad became instrumental in the formation of a modern Chinese nation of unified diversity rooted in an ancient cosmopolitan past. The staged Silk Road theme dance-dramas thus participate in this formation of the Chinese imagination of “nation” and “abroad,” as they aestheticise Chinese history and geography. History and geography—aspects commonly considered constituents of a nation as well as our conceptualisations of “abroad”—are “invariably aestheticized to a certain degree” (Bakhtin 208). Diverse historical and cultural elements from along the Silk Road come together in this performance genre, which can be considered the most representative of various possible stagings of the history and culture of the Silk Road journeys.In 1979, the Chinese state officials in Gansu Province commissioned the benchmark dance-drama Rain of Flowers along the Silk Road, a spectacular theatrical dance-drama praising the pure and noble friendship which existed between the peoples of China and other countries in the Tang dynasty (618-907 C.E.). While its plot also revolves around the Dunhuang Caves and the life of a painter, staged at one of the most critical turning points in modern Chinese history, the work as a whole aims to present the state’s intention of re-establishing diplomatic ties with the outside world after the Cultural Revolution. Unlike Dunhuang, My Dreamland, it presents a nation’s journey abroad and home. To accomplish this goal, Rain of Flowers along the Silk Road introduces the fictional character Yunus, a wealthy Persian merchant who provides the audiences a vision of the historical figure of Peroz III, the last Sassanian prince, who after the Arab conquest of Iran in 651 C.E., found refuge in China. By incorporating scenes of ethnic and folk dances, the drama then stages the journey of painter Zhang’s daughter Yingniang to Persia (present-day Iran) and later, Yunus’s journey abroad to the Tang dynasty imperial court as the Persian Empire’s envoy.Rain of Flowers along the Silk Road, since its debut at Beijing’s Great Hall of the People on the first of October 1979 and shortly after at the Theatre La Scala in Milan, has been staged in more than twenty countries and districts, including France, Italy, Japan, Thailand, Russia, Latvia, Hong Kong, Macao, Taiwan, and recently, in 2013, at the Lincoln Center for the Performing Arts in New York.“The Road”: Staging the Journey TodayWithin the contemporary context of global interdependencies, performing arts have been used as strategic devices for social mobilisation and as a means to represent and perform modern national histories and foreign policies (Davis, Rees, Tian, Tuohy, Wong, David Y. H. Wu). The Silk Road has been chosen as the basis for these state-sponsored, extravagantly produced, and internationally staged contemporary dance programs. In 2008, the welcoming ceremony and artistic presentation at the Olympic Games in Beijing featured twenty apsara dancers and a Dunhuang bihua yuewu dancer with long ribbons, whose body was suspended in mid-air on a rectangular LED extension held by hundreds of performers; on the giant LED screen was a depiction of the ancient Silk Road.In March 2013, Chinese president Xi Jinping introduced the initiatives “Silk Road Economic Belt” and “21st Century Maritime Silk Road” during his journeys abroad in Kazakhstan and Indonesia. These initiatives are now referred to as “One Belt, One Road.” The State Council lists in details the policies and implementation plans for this initiative on its official web page, www.gov.cn. In April 2013, the China Institute in New York launched a yearlong celebration, starting with "Dunhuang: Buddhist Art and the Gateway of the Silk Road" with a re-creation of one of the caves and a selection of artifacts from the site. In March 2015, the National Development and Reform Commission (NDRC), China’s top economic planning agency, released a new action plan outlining key details of the “One Belt, One Road” initiative. Xi Jinping has made the program a centrepiece of both his foreign and domestic economic policies. One of the central economic strategies is to promote cultural industry that could enhance trades along the Silk Road.Encouraged by the “One Belt, One Road” policies, in March 2016, The Silk Princess premiered in Xi’an and was staged at the National Centre for the Performing Arts in Beijing the following July. While Dunhuang, My Dreamland and Rain of Flowers along the Silk Road were inspired by the Buddhist art found in Dunhuang, The Silk Princess, based on a story about a princess bringing silk and silkworm-breeding skills to the western regions of China in the Tang Dynasty (618-907) has a different historical origin. The princess's story was portrayed in a woodblock from the Tang Dynasty discovered by Sir Marc Aurel Stein, a British archaeologist during his expedition to Xinjiang (now Xinjiang Uygur autonomous region) in the early 19th century, and in a temple mural discovered during a 2002 Chinese-Japanese expedition in the Dandanwulike region. Figure 5: Poster of The Silk PrincessIn January 2016, the Shannxi Provincial Song and Dance Troupe staged The Silk Road, a new theatrical dance-drama. Unlike Dunhuang, My Dreamland, the newly staged dance-drama “centers around the ‘road’ and the deepening relationship merchants and travellers developed with it as they traveled along its course,” said Director Yang Wei during an interview with the author. According to her, the show uses seven archetypes—a traveler, a guard, a messenger, and so on—to present the stories that took place along this historic route. Unbounded by specific space or time, each of these archetypes embodies the foreign-travel experience of a different group of individuals, in a manner that may well be related to the social actors of globalised culture and of transnationalism today. Figure 6: Poster of The Silk RoadConclusionAs seen in Rain of Flowers along the Silk Road and Dunhuang, My Dreamland, staging the processes of Silk Road journeys has become a way of connecting the Chinese imagination of “home” with the Chinese imagination of “abroad.” Staging a nation’s heritage abroad on contemporary stages invites a new imagination of homeland, borders, and transnationalism. Once aestheticised through staged performances, such as that of the Dunhuang bihua yuewu, the historical and topological landscape of Dunhuang becomes a performed narrative, embodying the national heritage.The staging of Silk Road journeys continues, and is being developed into various forms, from theatrical dance-drama to digital exhibitions such as the Smithsonian’s Pure Land: Inside the Mogao Grottes at Dunhuang (Stromberg) and the Getty’s Cave Temples of Dunhuang: Buddhist Art on China's Silk Road (Sivak and Hood). They are sociocultural phenomena that emerge through interactions and negotiations among multiple actors and institutions to envision and enact a Chinese imagination of “journeying abroad” from and to the country.ReferencesBakhtin, M.M. The Dialogic Imagination: Four Essays. Austin, Texas: University of Texas Press, 1982.Bohlman, Philip V. “World Music at the ‘End of History’.” Ethnomusicology 46 (2002): 1–32.Davis, Sara L.M. Song and Silence: Ethnic Revival on China’s Southwest Borders. New York: Columbia University Press, 2005.Duan, Wenjie. “The History of Conservation of Mogao Grottoes.” International Symposium on the Conservation and Restoration of Cultural Property: The Conservation of Dunhuang Mogao Grottoes and the Related Studies. Eds. Kuchitsu and Nobuaki. Tokyo: Tokyo National Research Institute of Cultural Properties, 1997. 1–8.Faxian. A Record of Buddhistic Kingdoms. Translated by James Legge. New York: Dover Publications, 1991.Herzfeld, Michael. Ours Once More: Folklore, Ideology, and the Making of Modern Greece. Austin: University of Texas Press, 1985.Kuang, Lanlan. Dunhuang bi hua yue wu: "Zhongguo jing guan" zai guo ji yu jing zhong de jian gou, chuan bo yu yi yi (Dunhuang Performing Arts: The Construction and Transmission of “China-scape” in the Global Context). Beijing: She hui ke xue wen xian chu ban she, 2016.Lam, Joseph S.C. State Sacrifice and Music in Ming China: Orthodoxy, Creativity and Expressiveness. New York: State University of New York Press, 1998.Mair, Victor. T’ang Transformation Texts: A Study of the Buddhist Contribution to the Rise of Vernacular Fiction and Drama in China. Cambridge, Mass.: Council on East Asian Studies, 1989.Pollack, Barbara. “China’s Desert Treasure.” ARTnews, December 2013. Sep. 2016 <http://www.artnews.com/2013/12/24/chinas-desert-treasure/>.Polo, Marco. The Travels of Marco Polo. Translated by Ronald Latham. Penguin Classics, 1958.Rees, Helen. Echoes of History: Naxi Music in Modern China. Oxford: Oxford University Press, 2000.Shelemay, Kay Kaufman. “‘Historical Ethnomusicology’: Reconstructing Falasha Liturgical History.” Ethnomusicology 24 (1980): 233–258.Shi, Weixiang. Dunhuang lishi yu mogaoku yishu yanjiu (Dunhuang History and Research on Mogao Grotto Art). Lanzhou: Gansu jiaoyu chubanshe, 2002.Sima, Guang 司马光 (1019–1086) et al., comps. Zizhi tongjian 资治通鉴 (Comprehensive Mirror for the Aid of Government). Beijing: Guji chubanshe, 1957.Sima, Qian 司马迁 (145-86? B.C.E.) et al., comps. Shiji: Dayuan liezhuan 史记: 大宛列传 (Record of the Grand Historian: The Collective Biographies of Dayuan). Beijing: Zhonghua shuju, 1959.Sivak, Alexandria and Amy Hood. “The Getty to Present: Cave Temples of Dunhuang: Buddhist Art on China’s Silk Road Organised in Collaboration with the Dunhuang Academy and the Dunhuang Foundation.” Getty Press Release. Sep. 2016 <http://news.getty.edu/press-materials/press-releases/cave-temples-dunhuang-buddhist-art-chinas-silk-road>.Stromberg, Joseph. “Video: Take a Virtual 3D Journey to Visit China's Caves of the Thousand Buddhas.” Smithsonian, December 2012. Sep. 2016 <http://www.smithsonianmag.com/smithsonian-institution/video-take-a-virtual-3d-journey-to-visit-chinas-caves-of-the-thousand-buddhas-150897910/?no-ist>.Tian, Qing. “Recent Trends in Buddhist Music Research in China.” British Journal of Ethnomusicology 3 (1994): 63–72.Tuohy, Sue M.C. “Imagining the Chinese Tradition: The Case of Hua’er Songs, Festivals, and Scholarship.” Ph.D. Dissertation. Indiana University, Bloomington, 1988.Wade, Bonnie C. Imaging Sound: An Ethnomusicological Study of Music, Art, and Culture in Mughal India. Chicago: University of Chicago Press, 1998.Wong, Isabel K.F. “From Reaction to Synthesis: Chinese Musicology in the Twentieth Century.” Comparative Musicology and Anthropology of Music: Essays on the History of Ethnomusicology. Eds. Bruno Nettl and Philip V. Bohlman. Chicago: University of Chicago Press, 1991. 37–55.Wu, Chengen. Journey to the West. Tranlsated by W.J.F. Jenner. Beijing: Foreign Languages Press, 2003.Wu, David Y.H. “Chinese National Dance and the Discourse of Nationalization in Chinese Anthropology.” The Making of Anthropology in East and Southeast Asia. Eds. Shinji Yamashita, Joseph Bosco, and J.S. Eades. New York: Berghahn, 2004. 198–207.Xuanzang. The Great Tang Dynasty Record of the Western Regions. Hamburg: Numata Center for Buddhist Translation & Research, 1997.Yung, Bell, Evelyn S. Rawski, and Rubie S. Watson, eds. Harmony and Counterpoint: Ritual Music in Chinese Context. Stanford: Stanford University Press, 1996.