Articoli di riviste: "Beet mild yellowing virus (BMYV)"

1

Hauser, Sébastien, Mark Stevens, Christophe Mougel, Helen G. Smith, Christiane Fritsch, Etienne Herrbach e Olivier Lemaire. "Biological, Serological, and Molecular Variability Suggest Three Distinct Polerovirus Species Infecting Beet or Rape". Phytopathology® 90, n. 5 (maggio 2000): 460–66. http://dx.doi.org/10.1094/phyto.2000.90.5.460.

Testo completo

Abstract (sommario):

Yellowing diseases of sugar beet can be caused by a range of strains classified as Beet mild yellowing virus (BMYV) or Beet western yellows virus (BWYV), both belonging to the genus Polerovirus of the family Luteoviridae. Host range, genomic, and serological studies have shown that isolates of these viruses can be grouped into three distinct species. Within these species, the coat protein amino acid sequences are highly conserved (more than 90% homology), whereas the P0 sequences (open reading frame, ORF 0) are variable (about 30% homology). Based on these results, we propose a new classification of BMYV and BWYV into three distinct species. Two of these species are presented for the first time and are not yet recognized by the International Committee on Taxonomy of Viruses. The first species, BMYV, infects sugar beet and Capsella bursa-pastoris. The second species, Brassica yellowing virus, does not infect beet, but infects a large number of plants belonging to the genus Brassica within the family Brassicaceae. The third species, Beet chlorosis virus, infects beet and Chenopodium capitatum, but not Capsella bursa-pastoris.

Gli stili APA, Harvard, Vancouver, ISO e altri

2

Stephan, Dirk, e Edgar Maiss. "Biological properties of Beet mild yellowing virus derived from a full-length cDNA clone". Journal of General Virology 87, n. 2 (1 febbraio 2006): 445–49. http://dx.doi.org/10.1099/vir.0.81565-0.

Testo completo

Abstract (sommario):

A German isolate of Beet mild yellowing virus (BMYV-IPP) was used for RT-PCR-based construction of the first infectious full-length cDNA clone of the virus (BMYVfl). The complete genomic sequence was determined and displayed high similarity to the French isolate BMYV-2ITB. The host range of BMYVfl was examined by agroinoculation and aphid transmission. Both methods lead to systemic infections in Beta vulgaris, Nicotiana benthamiana, N. clevelandii, N. hesperis, Capsella bursa-pastoris and Lamium purpureum. Immunological investigation by tissue-print immunoassay (TPIA) of agroinoculated plant tissues revealed only local infections restricted to the agroinoculated mesophyll tissues in some plant species. In Nicotiana glutinosa and N. edwardsonii, BMYV was not found in either the agroinoculated tissue or distant tissues by TPIA. So far, BMYVfl agroinoculation did not extend or confine the BMYV host range known from aphid transmission experiments but it did describe new local hosts for BMYV.

Gli stili APA, Harvard, Vancouver, ISO e altri

3

Williams, I. S., A. M. Dewar e A. F. G. Dixon. "The effect of host plant-induced stomach precipitate on the ability of Myzus persicae (Hemiptera: Aphididae) to transmit sugarbeet yellowing viruses". Bulletin of Entomological Research 87, n. 6 (dicembre 1997): 643–47. http://dx.doi.org/10.1017/s0007485300038748.

Testo completo

Abstract (sommario):

AbstractWhen Myzus persicae (Sulzer) feeds on healthy sugarbeet it develops a white precipitate inside its stomach which causes the stomach to enlarge. Infection of sugarbeet plants with beet yellows virus (BYV), but not beet mild yellowing virus (BMYV) results in further increases in stomach size. The influence of the white precipitate on the transmission of BYV and BMYV was investigated by rearing M. persicae on sugarbeet Beta vulgaris, Tetragonia expansa and Capsella bursa-pastoris, which are hosts for both BYV and BMYV, BYV and BMYV respectively, but the latter two hosts do not stimulate the formation of white precipitate in the aphid's stomach. Aphids reared on BYV-infected T. expansa were significantly better vectors of BYV than those reared on BYV-infected sugarbeet, but aphids reared on BMYV-infected C. bursa-pastoris did not transmit BMYV more efficiently than those reared on BMYV-infected sugarbeet. The consequences of these results for the spread of beet yellowing viruses are discussed.

Gli stili APA, Harvard, Vancouver, ISO e altri

4

Beuve, Monique, Mark Stevens, Hsing-Yeh Liu, William M. Wintermantel, Sébastien Hauser e Olivier Lemaire. "Biological and Molecular Characterization of an American Sugar Beet-Infecting Beet western yellows virus Isolate". Plant Disease 92, n. 1 (gennaio 2008): 51–60. http://dx.doi.org/10.1094/pdis-92-1-0051.

Testo completo

Abstract (sommario):

Three aphid-transmitted viruses belonging to the Polerovirus genus, Beet mild yellowing virus (BMYV), Beet chlorosis virus (BChV), and Beet western yellows virus (BWYV), have been described as pathogens of sugar beet. We present the complete biological, serological, and molecular characterization of an American isolate of Beet western yellows virus (BWYV-USA), collected from yellow beet leaves. The biological data suggested that BWYV-USA displayed a host range similar to that of BMYV, but distinct from those of BChV and the lettuce and rape isolates of Turnip yellows virus. The complete genomic RNA sequence of BWYV-USA showed a genetic organization and expression typical of other Polerovirus members. Comparisons of deduced amino acid sequences showed that P0 and the putative replicase complex (P1-P2) of BWYV-USA are more closely related to Cucurbit aphid-borne yellows virus (CABYV) than to BMYV, whereas alignments of P3, P4, and P5 showed the highest homology with BMYV. Intraspecific and interspecific phylogenetic analyses have suggested that the BWYV-USA genome may be the result of recombination events between a CABYV-like ancestor contributing open reading frame (ORF) 0, ORF 1, and ORF 2, and a beet Polerovirus progenitor providing the 3′ ORFs, with a similar mechanism of speciation occurring for BMYV in Europe. Results demonstrate that BWYV-USA is a distinct species in the Polerovirus genus, clarifying the nomenclature of this important group of viruses.

Gli stili APA, Harvard, Vancouver, ISO e altri

5

Bunwaree, Heemee Devi, Elodie Klein, Guillaume Saubeau, Bruno Desprez, Véronique Ziegler-Graff e David Gilmer. "Rapid and Visual Screening of Virus Infection in Sugar Beets Through Polerovirus-Induced Gene Silencing". Viruses 16, n. 12 (23 novembre 2024): 1823. http://dx.doi.org/10.3390/v16121823.

Testo completo

Abstract (sommario):

Since the ban of neonicotinoid insecticides in the European Union, sugar beet production is threatened by outbreaks of virus yellows (VY) disease, caused by several aphid-transmitted viruses, including the polerovirus beet mild yellowing virus (BMYV). As the symptoms induced may vary depending on multiple infections and other stresses, there is an urgent need for fast screening tests to evaluate resistance/tolerance traits in sugar beet accessions. To address this issue, we exploited the virus-induced gene silencing (VIGS) system, by introducing a fragment of a Beta vulgaris gene involved in chlorophyll synthesis in the BMYV genome. This recombinant virus was able to generate early clear vein chlorosis symptoms in infected sugar beets, allowing easy and rapid visual discernment of infected plants across five sugar beet lines. The recombinant virus displayed similar infectivity as the wild-type, and the insert remained stable within the viral progeny. We demonstrated that the percentage of VIGS-symptomatic plants was representative of the infection rate of each evaluated line, and depending on the susceptibility of the line to BMYV infection, VIGS symptoms may last over months. Our work provides a polerovirus-based VIGS system adapted to sugar beet crop allowing visual and rapid large-scale screens for resistance or functional genomic studies.

Gli stili APA, Harvard, Vancouver, ISO e altri

6

Kozlowska-Makulska, Anna, Beata Hasiow-Jaroszewska, Marek S. Szyndel, Etienne Herrbach, Salah Bouzoubaa, Olivier Lemaire e Monique Beuve. "Phylogenetic relationships and the occurrence of interspecific recombination between beet chlorosis virus (BChV) and Beet mild yellowing virus (BMYV)". Archives of Virology 160, n. 2 (5 ottobre 2014): 429–33. http://dx.doi.org/10.1007/s00705-014-2245-6.

Testo completo

Gli stili APA, Harvard, Vancouver, ISO e altri

7

Reinbold, C., S. Lacombe, V. Ziegler-Graff, D. Scheidecker, L. Wiss, M. Beuve, C. Caranta e V. Brault. "Closely Related Poleroviruses Depend on Distinct Translation Initiation Factors to Infect Arabidopsis thaliana". Molecular Plant-Microbe Interactions® 26, n. 2 (febbraio 2013): 257–65. http://dx.doi.org/10.1094/mpmi-07-12-0174-r.

Testo completo

Abstract (sommario):

In addition to being essential for translation of eukaryotic mRNA, translation initiation factors are also key components of plant–virus interactions. In order to address the involvement of these factors in the infectious cycle of poleroviruses (aphid-transmitted, phloem-limited viruses), the accumulation of three poleroviruses was followed in Arabidopsis thaliana mutant lines impaired in the synthesis of translation initiation factors in the eIF4E and eIF4G families. We found that efficient accumulation of Turnip yellows virus (TuYV) in A. thaliana relies on the presence of eIF (iso)4G1, whereas Beet mild yellowing virus (BMYV) and Beet western yellows virus-USA (BWYV-USA) rely, instead, on eIF4E1. A role for these factors in the infectious processes of TuYV and BMYV was confirmed by direct interaction in yeast between these specific factors and the 5′ viral genome-linked protein of the related virus. Although the underlying molecular mechanism is still unknown, this study reveals a totally unforeseen situation in which closely related viruses belonging to the same genus use different translation initiation factors for efficient infection of A. thaliana.

Gli stili APA, Harvard, Vancouver, ISO e altri

8

Mahillon, Mathieu, Raphaël Groux, Floriane Bussereau, Justine Brodard, Christophe Debonneville, Sonia Demal, Isabelle Kellenberger, Madlaina Peter, Thomas Steinger e Olivier Schumpp. "Virus Yellows and Syndrome “Basses Richesses” in Western Switzerland: A Dramatic 2020 Season Calls for Urgent Control Measures". Pathogens 11, n. 8 (6 agosto 2022): 885. http://dx.doi.org/10.3390/pathogens11080885.

Testo completo

Abstract (sommario):

Massive outbreaks of virus yellows (VY) and syndrome “basses richesses” (SBR) are thought to be responsible for the major loss of sugar beet yields in 2020 in western cantons of Switzerland. Typical yellowing symptoms were visible during field inspections, and control measures were reportedly ineffective or even absent. Both diseases induce yellowing but have distinct etiologies; while VY is caused by aphid-transmitted RNA viruses, SBR is caused by the cixiid-transmitted γ-proteobacterium Candidatus Arsenophonus phytopathogenicus. To clarify the situation, samples from diseased plants across the country were screened for the causal agents of VY and SBR at the end of the season. Beet yellows virus (BYV) and Beet chlorosis virus (BChV) showed high incidence nationwide, and were frequently found together in SBR-infected fields in the West. Beet mild yellowing virus (BMYV) was detected in two sites in the West, while there was no detection of Beet western yellows virus or Beet mosaic virus. The nucleotide diversity of the detected viruses was then investigated using classic and high-throughput sequencing. For both diseases, outbreaks were analyzed in light of monitoring of the respective vectors, and symptoms were reproduced in greenhouse conditions by means of insect-mediated inoculations. Novel quantification tools were designed for BYV, BChV and Ca. A. phytopathogenicus, leading to the identification of specific tissues tropism for these pathogens.

Gli stili APA, Harvard, Vancouver, ISO e altri

9

Kozlowska-Makulska, A., M. S. Szyndel, J. Syller, S. Bouzoubaa, M. Beuve, O. Lemaire e E. Herrbach. "First Report on the Natural Occurrence of Beet chlorosis virus in Poland". Plant Disease 91, n. 3 (marzo 2007): 326. http://dx.doi.org/10.1094/pdis-91-3-0326c.

Testo completo

Abstract (sommario):

Yellowing symptoms on sugar beet (Beta vulgaris L.) are caused by several viruses, especially those belonging to the genus Polerovirus of the family Luteoviridae, including Beet mild yellowing virus (BMYV) and Beet western yellows virus (BWYV), and recently, a new species, Beet chlorosis virus (BChV), was reported (2). To identify Polerovirus species occurring in beet crops in Poland and determine their molecular variability, field surveys were performed in the summer and autumn of 2005. Leaves from symptomatic beet plants were collected at 26 localities in the main commercial sugar-beet-growing areas in Poland that included the Bydgoszcz, Kutno, Lublin, Poznań, Olsztyn, and Warszawa regions. Enzyme-linked immunosorbent assay (ELISA) tests (Loewe Biochemica GmbH, Sauerlach, Germany) detected poleroviruses in 23 of 160 samples (approximately 20 samples from each field). Multiplex reverse-transcription polymerase chain reaction (RT-PCR) (1) (GE Healthcare S.A.-Amersham Velizy, France) confirmed the presence of poleroviruses in 13 of 23 samples. Nine of twenty sugar beet plants gave positive reactions with BChV-specific primers and three with primers specific to the BMYV P0 protein. Two isolates reacted only with primer sets CP+/CP, sequences that are highly conserved for all beet poleroviruses. Leaf samples collected from three plants infected with BChV were used as inoculum sources for Myzus persicae in transmission tests to suitable indicator plants including sugar beet, red beet (Beta vulgaris L. var. conditiva Alef.), and Chenopodium capitatum. All C. capitatum and beet plants were successfully infected with BChV after a 48-h acquisition access period and an inoculation access period of 3 days. Transmission was confirmed by the presence of characteristic symptoms and by ELISA. Amino acid sequences obtained from each of four purified (QIAquick PCR Purification kit, Qiagen S.A., Courtaboeuf, France) RT-PCR products (550 and 750 bp for CP and P0, respectively) were 100% identical with the CP region (GenBank Accession No. AAF89621) and 98% identical with the P0 region (GenBank Accession No. NP114360) of the French isolate of BChV. To our knowledge, this is the first report of BChV in Poland. References: (1) S. Hauser et al. J. Virol. Methods 89:11, 2000. (2) M. Stevens et al. Mol. Plant Pathol. 6:1, 2005.

Gli stili APA, Harvard, Vancouver, ISO e altri

10

JAGGARD, K. W., M. F. ALLISON, C. J. A. CLARK, A. D. TODD e H. G. SMITH. "The effect of nitrogen supply and virus yellows infection on the growth, yield and processing quality of sugarbeet (Beta vulgaris)". Journal of Agricultural Science 139, n. 2 (settembre 2002): 129–38. http://dx.doi.org/10.1017/s002185960200254x.

Testo completo

Abstract (sommario):

The effects of supplying the fertilizer nitrogen (N) as a recommended quantity of ammonium nitrate or as a commonly used dose of poultry manure on yield of sugarbeet infected with Beet mild yellowing virus (BMYV) or Beet yellows virus (BYV) were studied in field experiments at IACR-Broom's Barn in 1990, 1991 and 1992. Three N fertilizer treatments comprising Zero (N0), standard rate of 110 kg N/ha (N1) and poultry manure equivalent to c. 300 kg/ha of available N (N2) were applied to plots which were uninoculated or were subsequently inoculated with either BMYV or BYV. Averaged over virus treatments, N1 increased sugar yields by 23% relative to N0: there was no further increase when N2 was applied. When averaged over N treatments, early virus yellows infection reduced the sugar yields by 23%. Generally there was no significant interaction between N supply and virus infection. There was no evidence that the large N supply could reduce the yield effect of virus yellows infection, as had previously been thought. Crops infected from late July produced similar yields to uninoculated controls. The main effect of virus yellows was to reduce the efficiency of radiation conversion even when account was taken of the light intercepted by yellow foliage. Whilst the N2 treatment helped to maintain a green leaf cover throughout the season on virus yellows infected crops, it had no effect on virus replication. Beet processing quality was impaired by increasing the N supply and by virus infection, but again there were generally no significant interactions between infection and N rate.

Gli stili APA, Harvard, Vancouver, ISO e altri

11

Richter, Johannes, e Gerhard Proeseler. "Zur Identität von beet mild yellowing virus und beet western yellows virus". Archives Of Phytopathology And Plant Protection 25, n. 6 (gennaio 1989): 523–25. http://dx.doi.org/10.1080/03235408909438917.

Testo completo

Gli stili APA, Harvard, Vancouver, ISO e altri

12

Guilley, H., K. E. Richards e G. Jonard. "Nucleotide sequence of beet mild yellowing virus RNA". Archives of Virology 140, n. 6 (giugno 1995): 1109–18. http://dx.doi.org/10.1007/bf01315419.

Testo completo

Gli stili APA, Harvard, Vancouver, ISO e altri

13

Smith, H. G., M. J. C. Asher, G. E. Williams e P. B. Hallsworth. "The effect of fungicides on sugar beet infected with beet mild yellowing virus". Crop Protection 14, n. 8 (dicembre 1995): 665–69. http://dx.doi.org/10.1016/0261-2194(95)00043-7.

Testo completo

Gli stili APA, Harvard, Vancouver, ISO e altri

14

Polák, J., e M. Jokeš. "Localization of the beet mild yellowing virus inSinapis alba L." Biologia Plantarum 28, n. 3 (maggio 1986): 227–29. http://dx.doi.org/10.1007/bf02894601.

Testo completo

Gli stili APA, Harvard, Vancouver, ISO e altri

15

Kühne, Thomas, Gerhard Proeseler, Johannes Richter, Andreas Stanarius e Eckhard Proll. "Mildes Rübenvergilbungs-Virus (beet mild yellowing virus): Vermehrung, Reinigung und Herstellung von Antiseren". Archives Of Phytopathology And Plant Protection 21, n. 1 (gennaio 1985): 3–12. http://dx.doi.org/10.1080/03235408509435900.

Testo completo

Gli stili APA, Harvard, Vancouver, ISO e altri

16

Richter, Kerstin. "Optimiertes Verfahren zum routinemaäßigen Nachweis des Milden Rübenvergilbungs-Virus (beet mild yellowing virus)". Archives Of Phytopathology And Plant Protection 25, n. 3 (gennaio 1989): 243–49. http://dx.doi.org/10.1080/03235408909438866.

Testo completo

Gli stili APA, Harvard, Vancouver, ISO e altri

17

de Koeijer, K. J., e W. van der Werf. "Effects of beet yellows virus and beet mild yellowing virus on leaf area dynamics of sugar beet (Beta vulgaris L.)". Field Crops Research 61, n. 2 (aprile 1999): 163–77. http://dx.doi.org/10.1016/s0378-4290(98)00155-5.

Testo completo

Gli stili APA, Harvard, Vancouver, ISO e altri

18

Wiesner, Kurt, e Marianne Krause. "Zur Lokalisierung des Milden Rübenvergilbungs-Virus (beet mild yellowing virus), des Nekrotischen Rübenvergilbungs-Virus (beet yellows virus) und des Rübenmosaik-Virus (beet mosaic virus) in Zuckerrüben". Archives Of Phytopathology And Plant Protection 26, n. 5 (gennaio 1990): 441–52. http://dx.doi.org/10.1080/03235409009439003.

Testo completo

Gli stili APA, Harvard, Vancouver, ISO e altri

19

SMITH, H. G., M. STEVENS e P. B. HALLSWORTH. "The use of monoclonal antibodies to detect beet mild yellowing virus and beet western yellows virus in aphids". Annals of Applied Biology 119, n. 2 (ottobre 1991): 295–302. http://dx.doi.org/10.1111/j.1744-7348.1991.tb04868.x.

Testo completo

Gli stili APA, Harvard, Vancouver, ISO e altri

20

Grimmer, M. K., K. M. R. Bean, M. C. Luterbacher, M. Stevens e M. J. C. Asher. "Beet mild yellowing virus resistance derived from wild and cultivated Beta germplasm". Plant Breeding 127, n. 3 (giugno 2008): 315–18. http://dx.doi.org/10.1111/j.1439-0523.2007.01457.x.

Testo completo

Gli stili APA, Harvard, Vancouver, ISO e altri

21

Mayo, Mike, Eugene Ryabov, Gillian Fraser e Michael Taliansky. "Mechanical transmission of Potato leafroll virus". Journal of General Virology 81, n. 11 (1 novembre 2000): 2791–95. http://dx.doi.org/10.1099/0022-1317-81-11-2791.

Testo completo

Abstract (sommario):

Like typical luteoviruses, Potato leafroll virus (PLRV) cannot be transmitted mechanically by rubbing plants with solutions containing virus particles. However, PLRV was found to be mechanically transmissible from extracts of plants that had been inoculated by viruliferous aphids and then post-inoculated with Pea enation mosaic virus-2 (PEMV-2). Unlike the asymptomatic infections induced by either virus alone, double infections in Nicotiana benthamiana induced necrotic symptoms with some line patterning and vein yellowing. Infective PLRV was recovered from a purified virus preparation by inoculating plants mechanically with purified virus particles mixed with PEMV-2. Similarly, Beet mild yellowing virus was readily transmitted mechanically from mixtures containing PEMV-2. PLRV was also transmissible from mixtures made with extracts of plants infected with Groundnut rosette virus, although less efficiently than from mixtures containing PEMV-2. This novel means of transmitting PLRV, and perhaps other poleroviruses, should prove very useful in a number of fields of luteovirus research.

Gli stili APA, Harvard, Vancouver, ISO e altri

22

Jones, T. D., K. W. Buck e R. T. Plumb. "The detection of beet western yellows virus and beet mild yellowing virus in crop plants using the polymerase chain reaction". Journal of Virological Methods 35, n. 3 (dicembre 1991): 287–96. http://dx.doi.org/10.1016/0166-0934(91)90070-g.

Testo completo

Gli stili APA, Harvard, Vancouver, ISO e altri

23

Wiesner, Kurt, e Marianne Krause. "Die Verteilung des Milden Rübenvergilbungs-Virus (beet mild yellowing virus) und des Nekrotischen Rübenvergilbungs-Virus (beet yellows virus) in Zuckerrüben im Verlauf der Vegetationsperiode". Archives Of Phytopathology And Plant Protection 27, n. 2 (gennaio 1991): 109–16. http://dx.doi.org/10.1080/03235409109439054.

Testo completo

Gli stili APA, Harvard, Vancouver, ISO e altri

24

STEVENS, MARK, PHILIPPA B. HALLSWORTH e HELEN G. SMITH. "The effects of Beet mild yellowing virus and Beet chlorosis virus on the yield of UK field-grown sugar beet in 1997,1999 and 2000". Annals of Applied Biology 144, n. 1 (febbraio 2004): 113–19. http://dx.doi.org/10.1111/j.1744-7348.2004.tb00323.x.

Testo completo

Gli stili APA, Harvard, Vancouver, ISO e altri

25

STEVENS, M., H. G. SMITH e P. B. HALLSWORTH. "Detection of the luteoviruses, beet mild yellowing virus and beet western yellows virus, in aphids caught in sugar-beet and oilseed rape crops, 1990–1993". Annals of Applied Biology 127, n. 2 (ottobre 1995): 309–20. http://dx.doi.org/10.1111/j.1744-7348.1995.tb06675.x.

Testo completo

Gli stili APA, Harvard, Vancouver, ISO e altri

26

Proeseler, Gerhard, Kerstin Richter, Ilona Kalinina e Thomas Kühne. "Weitere Ergebnisse bei der Anwendung des ELISA zum Nachweis des Milden Rübenvergilbungs-Virus (beet mild yellowing virus)". Archives Of Phytopathology And Plant Protection 21, n. 6 (gennaio 1985): 437–43. http://dx.doi.org/10.1080/03235408509435978.

Testo completo

Gli stili APA, Harvard, Vancouver, ISO e altri

27

Kastirr, Rainer, Dieter Keichenbächer e Detlef Haase. "ELISA-Nachweis des Milden Rübenvergilbnngs-Virus (beet mild yellowing virus) und des Gerstengelbverzwergungs-Virus (barley yellow dwarf virus) im Vektor: (Kurze Mitteilung)". Archives Of Phytopathology And Plant Protection 21, n. 4 (gennaio 1985): 331–33. http://dx.doi.org/10.1080/03235408509435956.

Testo completo

Gli stili APA, Harvard, Vancouver, ISO e altri

28

GOVIER, D. A. "Purification and partial characterisation of beet mild yellowing virus and its serological detection in plants and aphids". Annals of Applied Biology 107, n. 3 (dicembre 1985): 439–47. http://dx.doi.org/10.1111/j.1744-7348.1985.tb03160.x.

Testo completo

Gli stili APA, Harvard, Vancouver, ISO e altri

29

Robles-Hernandez, L., A. C. Gonzalez-Franco, E. M. Gill-Langarica, C. Sago, O. V. Nikolaeva e A. V. Karasev. "First Report of Beet severe curly top virus in Jalapeño Pepper in Chihuahua, Mexico". Plant Disease 95, n. 6 (giugno 2011): 778. http://dx.doi.org/10.1094/pdis-02-11-0138.

Testo completo

Abstract (sommario):

Curly top is a serious problem in many irrigated crops in the semiarid areas in the western United States. The disease is caused by a complex of leafhopper-transmitted curtoviruses, one of which, Beet mild curly top virus (BMCTV), was previously found in chili pepper in Zacatecas and Aguascalientes, Mexico (3). During the past few years, sporadic symptoms similar to curly top disease were observed in jalapeño pepper in the south-central area of Chihuahua State. Symptomatic plants were scattered in otherwise healthy looking pepper stands and displayed stunting and yellowing. Affected leaves were brittle, showed upward curling, and a distinct green vein pattern with interveinal yellowing. In June and August of 2010, field surveys were conducted in Cordillera-Escuadra, Meoqui-Estacion Consuelo, Meoqui-Lomas del Consuelo, and Delicias-Presa Francisco I Madero. Ninety-four leaf samples were collected from symptomatic jalapeño pepper plants and subjected to ELISA and PCR testing for curly top. Of the 94 samples, 11 were found to be positive by triple-antibody sandwich-ELISA with polyclonal antibodies against curly top (2). To confirm the identification of curly top and type the specific curtovirus identified, four ELISA-positive samples were subjected to a PCR analysis using a virus-specific primer set for curtovirus typing designed by Chen et al. (1). All four samples tested produced a single 720-bp band with primers BSCTVv2688 and BGc396 (1) characteristic of the Beet severe curly top virus (BSCTV). These curly top-specific PCR amplicons were sequenced and found to be 99% similar to the BSCTV nucleotide sequence in the C1 gene region (GenBank Accession No. X97203); corresponding sequences were deposited in GenBank under Accession Nos. JF437870 to JF437873. To our knowledge, this is the first report of the curly top virus in the State of Chihuahua, demonstrating that curly top is established and common in jalapeño pepper here and will need surveillance in other vegetable crops under irrigation. References: (1) L. F. Chen et al. Plant Dis. 94:99, 2010. (2) J. Durrin et al. Plant Dis. 94:972, 2010. (3) R. Velásquez-Valle et al. Plant Dis. 92:650, 2008.

Gli stili APA, Harvard, Vancouver, ISO e altri

30

Cun, Zihui. "Identification of New Chickpea Virus and Control of Chickpea Virus Disease". Evidence-Based Complementary and Alternative Medicine 2022 (28 maggio 2022): 1–8. http://dx.doi.org/10.1155/2022/6465505.

Testo completo

Abstract (sommario):

Objective. The objective of the study was to discuss the classification, virus characteristics, detection methods, and control measures of chickpea virus, with an aim to provide a theoretical basis for identification of new chickpea virus and control of chickpea virus disease. Methods. The domestic and foreign studies were reviewed, and the virus coat protein or nucleic acid sequence was identified by immunological and molecular diagnostic techniques. Results. There were 14 main types of chickpea viruses attacking, and seven Luteoviridae viruses were reported, namely, chickpea chlorotic stunt virus (CpCSV), bean leafroll virus (BLRV), beet western yellows virus (BWYV), soybean dwarf virus (SbDV), cotton leafroll dwarf virus (CLRDV), cucurbit aphid-borne yellows virus (CABYV), and phasey bean mild yellows virus (PhBMYV). The family Geminiviridae includes chickpea chlorotic dwarf virus (CpCDV), chickpea chlorosis virus (CpCV), chickpea redleaf virus (CpRLV), chickpea yellows virus (CpYV), and mastrevirus. The family Nanoviridae is dominated by the faba bean necrotic yellows virus (FBNYV). The family Bromoviridae includes cucumber mosaic virus (CMV) and alfalfa mosaic virus (AMV). Conclusion. At present, there are mainly 12 types of viruses infecting chickpeas, which are transmitted by leafhoppers or aphids and are associated with symptoms such as yellowing, chlorosis, and stunted pod development, resulting in serious yield loss. Correct use of various molecular diagnostic tools to detect and identify chickpea virus can accurately assess chickpea virus infection and provide a basis for the prevention and treatment of chickpea virus disease.

Gli stili APA, Harvard, Vancouver, ISO e altri

31

Velasquez-Valle, R., J. Mena-Covarrubias, L. R. Reveles-Torres, G. R. Argüello-Astorga, M. A. Salas-Luevano e J. A. Mauricio-Castillo. "First Report of Beet mild curly top virus in Dry Bean in Zacatecas, Mexico". Plant Disease 96, n. 5 (maggio 2012): 771. http://dx.doi.org/10.1094/pdis-02-12-0122-pdn.

Testo completo

Abstract (sommario):

In August 2009, yellowing, upward curling of leaves, and stunted growth were observed on 15 to 40% of dry bean (Phaseolus vulgaris cv. Aluvori) plants in each of several experimental fields in Zacatecas, Mexico. Symptoms and presence of the beet leafhopper (Circulifer tenellus) in affected fields suggested an infection by curtoviruses (Geminiviridae). Total DNA extracts from 18 plant samples exhibiting symptoms were obtained by a modified Dellaporta method (2) and subjected to PCR analysis using two pairs of new, degenerate primers specific for curtoviruses: RepQEW-for (CCRAARTAAGMATCRGCCCAYTCTTG) in combination with CP450-rev (GTCCTCGAGTAGACGGCATAGCCTGACC) and V2Gen910-for (ATGTCGACGAAGCATTTGAAGTTTGATATGGC) with Rep2GQ-rev (GAAGATCTGCWCGMGGAGGYCARCAGACGGCT). This double set of primers was used to amplify two overlapping DNA segments encompassing the complete curtovirus genome. All samples produced amplicons of the expected size (1.75 and 1.8 kb, respectively) that were cloned into pGEM-T Easy Vector (Promega, Madison, WI). Restriction fragment length polymorphism analysis of PCR clones with EcoRI and HinfI endonucleases suggested the presence of a single curtovirus species because only one restriction fragment pattern was observed in all cases. Viral amplicons from three plants were sequenced, and the overlapping DNA fragments were subsequently assembled into a complete genome sequence. Comparison of the virus sequence (Accession No. HQ634913) with sequences of all curtovirus isolates available in GenBank showed that it shared the highest nucleotide identity (98%) with Beet mild curly top virus-Mexico SLP1 from pepper (BMCTV-MX [SLP1]; Accession No. EU586260). Amino acid sequence identity of the seven predicted proteins (Rep, TrAP, REn, C4, V1, V2, and V3) encoded by the virus isolated from bean plants shared 98.0, 97.3, 98.5, 98.8, 100, 99.2, and 97.8% sequence identity, respectively, with the homologous proteins of BMCTV-MX [SLP1]. A BMCTV isolate from pepper collected in Zacatecas in 2007 (Accession No. EU586260) with 96% nucleotide sequence identity to the curtovirus identified in bean induced symptoms in P. vulgaris cv. Topcrop similar to those observed in bean in Zacatecas (1). To determine the presence of curtoviruses in the local populations of insect vectors, beet leafhoppers were collected in one of the sampled dry bean fields and total DNA was isolated from a pool of approximately 20 insects. Amplification of viral DNA with the degenerate primers RepQEW-for and CP450-rev and further sequencing of the PCR products confirmed the presence of a curtovirus DNA sharing almost identical nucleotide identity (99%) with the DNA isolated from bean plants. In 2011, symptoms similar to those observed in bean in 2009 occurred in approximately 30% of dry bean plants, suggesting that BMCTV is endemic in the Zacatecas Region. To our knowledge, this is the first report of BMCTV in legumes in Mexico. References: (1) L. F. Chen et al. Arch. Virol. 156:547, 2011. (2) S. L. Dellaporta et al. Plant Mol. Biol. Rep. 1:19, 1983.

Gli stili APA, Harvard, Vancouver, ISO e altri

32

Velásquez-Valle, R., M. M. Medina-Aguilar e R. Creamer. "First Report of Beet mild curly top virus Infection of Chile Pepper in North-Central Mexico". Plant Disease 92, n. 4 (aprile 2008): 650. http://dx.doi.org/10.1094/pdis-92-4-0650a.

Testo completo

Abstract (sommario):

During the 2005 growing season, widespread virus-like symptoms were observed in pepper (Capsicum annuum) fields in north-central Mexico. Early in the season, plants were chlorotic and stunted with thickened, elongated leaves. From mid to late season, the affected plants showed severe yellowing, upwardly rolled, small leaves, and a few deformed fruits. Symptoms were similar to those described for curtoviruses in pepper (1). The leafhopper vector of curtoviruses, Circulifer tenellus, was first reported in the area in 1953 (3) (its presence was confirmed again in January 2008). Pepper fields were sampled in the states of Aguascalientes and Zacatecas, and five symptomatic plants from Zacatecas tested positive for the presence of curtoviruses by PCR using primers to the coat protein (CP) coding region (2). PCR amplicons from three samples of Ancho and Mirasol pepper types from Zacatecas, which also tested positive by PCR using the rep coding region (2), were sequenced and compared with reported curtoviruses. The samples showed 91% identity with the CP coding region and 93% identity with the rep coding region of Beet mild curly top virus (formerly the Worland strain). A survey of pepper fields from Aguascalientes and Zacatecas based on symptomatic plants was conducted from July to August of 2005. Forty-three fields of different types of pepper, including those growing under mulch and drip irrigation, were surveyed. Twenty-five plants in each of five contiguous rows were inspected for the symptoms described above. Disease symptoms were noted in Mirasol, Ancho, Pasilla, and Guajillo pepper types, and the average disease incidence was 9.87% (range: 1.6 to 48%), 15.2% (range: 6.4 to 25.6%), 7.85% (range: 2.4 to 15.2%), and 20.8% (range: 8 to 33.6%), respectively. To our knowledge, this is the first report of curtovirus infection of chile pepper in this region of Mexico. The moderate level of curtovirus infection found here suggests the need to initiate management strategies for this disease. References: (1) L. L. Black et al. Page 98 in: Pepper Diseases. A Field Guide. AVRDC, Taiwan, 1991. (2) R. Creamer et al. Plant Dis. 89:480, 2005. (3) D. A. Young and N. W. Frazier. Hilgardia 23:25, 1954.

Gli stili APA, Harvard, Vancouver, ISO e altri

33

Mukoye, Benard, Collins Mangeni, Jones Sue, Anthony Mabele e Hassan Were. "Next generation sequencing as a tool in modern pest risk analysis: a case study of groundnuts (Arachis hypogaea) as a potential host of new viruses in western Kenya". African Phytosanitary Journal 2, n. 1 (1 novembre 2020): 51–62. http://dx.doi.org/10.52855/qgpx3332.

Testo completo

Abstract (sommario):

Groundnut (Arachis hypogaea, L.) is grown in diverse environments throughout the semi-arid and sub-tropical regions of the world. Poor yields of 500-800kg/ha are attributed to poor agronomic practices, pests and diseases. The major disease reported in Kenya is Groundnut rosette disease (GRD). But recent observations in the field showed that the crop has varied and severe symptoms in addition to those caused by GRD. This required deeper analysis to establish the causal agents. Groundnut samples with virus-like symptoms were collected from western Kenya in 2016. Total RNA was extracted using All Prep RNA Mini Kit. Five mRNA libraries were prepared using the Illumina TrueSeq stranded mRNA library Prep Kit and pooled for multiplexed sequencing using an Illumina HiSeq 2500 to generate paired end reads (FastQ Sanger). The reads were analysed in the Galaxy project platform (customized). Quality reads were first mapped onto plant genome Refseq and unmapped reads isolated and mapped onto virus Refseq using Bowtie 2 (v2.2.3). Groundnut rosette virus satellite RNA, Groundnut rosette virus, Groundnut rosette assistor virus, Ethiopian tobacco bushy top virus, Cowpea polerovirus 2, Chickpea chlorotic stunt virus, Melon aphid-borne yellow virus, Phasey bean mild yellow virus, Beet mild yellowing virus, White clover mottle virus and Cotton leafroll dwarf virus were identified in four libraries. Other viruses (with less than 100 reads) including Bean common mosaic virus, Bean common mosaic necrosis virus, Cowpea chlorotic mottle virus RNA 3, Broad bean mottle virus RNA 3, Passion fruit woodiness virus among others were also mapped. Some of the viruses common in western Kenya were confirmed by PCR. The presence of at least three viruses in groundnuts in Western Kenya highlights the importance of starting a germplasm clean-up program of the plant material used as seed in this crop. Key words: Groundnuts, NGS, RefSeq, Viruses.

Gli stili APA, Harvard, Vancouver, ISO e altri

34

Fritzsche, Rolf, Ewald Karl, Rainer Kastirr, Wolfram Lehmann e Susanne Thiele. "Epidemiologische Untersuchungen zur Ausbreitung des Milden Rübenvergilbungs-Virus (beet mild yellowing virus) im Zuckerrübenstand unter besonderer Berücksichtigung der Wanderung radioaktiv markierter Vektoren sowie der Samenübertragbarkeit". Archives Of Phytopathology And Plant Protection 22, n. 5 (gennaio 1986): 389–94. http://dx.doi.org/10.1080/03235408609436030.

Testo completo

Gli stili APA, Harvard, Vancouver, ISO e altri

35

Stevens, Mark, e Felicita Viganó. "Production of a full-length infectious GFP-tagged cDNA clone of Beet mild yellowing virus for the study of plant–polerovirus interactions". Virus Genes 34, n. 2 (2 dicembre 2006): 215–21. http://dx.doi.org/10.1007/s11262-006-0046-z.

Testo completo

Gli stili APA, Harvard, Vancouver, ISO e altri

36

Vučurović, A., A. Bulajić, I. Stanković, D. Ristić, J. Berenji, J. Jović e B. Krstić. "First Report of the Occurrence of Cucurbit aphid-borne yellows virus on Oilseed Pumpkin in Serbia". Plant Disease 95, n. 8 (agosto 2011): 1035. http://dx.doi.org/10.1094/pdis-02-11-0147.

Testo completo

Abstract (sommario):

In July 2008, field-grown oilseed pumpkins (Cucurbita pepo L. ‘Olinka’) showing severe yellowing and thickening of older leaves were observed in the Kisač locality of Vojvodina Province, Serbia. Symptomatic plants were found only near the borders of the field. Leaf samples collected from 15 symptomatic plants were tested for the presence of four viruses causing the cucurbit yellowing disorder. Total RNAs were extracted from deep frozen plant materials with an RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) and reverse transcription (RT)-PCR was conducted with the OneStep RT-PCR Kit (Qiagen) following the manufacturer's instructions. RNA extracted from healthy C. pepo and molecular-grade water were included as negative controls in each PCR reaction. Species-specific primers (1,2) failed to detect the presence of three viruses causing the cucurbit yellowing disorder, Cucumber vein yellowing virus, Cucumber yellow stunting disorder virus, and Beet pseudo-yellows virus, in symptomatic samples. When two different sets of CABYV-specific primer pairs, CABYVup/CABYVdown (2) and CE9/CE10 (3), for a 484-bp and a 600-bp fragment of the CP gene of Cucurbit aphid-borne yellows virus (CABYV), respectively, were used for amplification, the former amplified fragments of the expected size from all symptomatic samples, whereas the latter successfully amplified a 600-bp fragment from only 7 of 15 samples. The 600-bp amplified product derived from isolate 145-08 was purified (QIAquick PCR Purification Kit, Qiagen), sequenced in both directions, deposited in GenBank (Accession No. HQ202745), and subjected to sequence analysis by MEGA4 software. Sequence comparisons revealed a high nucleotide identity of 99.8% (100 and 99.5% amino acid identities for the CP and the overlapping MP genes, respectively) with Czech CABYV isolates from C. pepo ‘Ovifera’ (HM771271-73). A neighbor-joining tree obtained on a 545-bp CP fragment of CABYV isolates available in GenBank database revealed that Serbian CABYV isolate 145-08 was clustered with isolates from Spain, Italy, France, and Tunisia in the Mediterranean subgroup denoted previously (4). In a persistent type transmission test, which was carried out using Aphis gossypii Glover, the aphids were allowed to feed on leaves of the collected sample (145-08) for an acquisition access period of 2 days and then 10 aphids were transferred to each of 20 C. pepo ‘Olinka’ plants for a 5 day inoculation access period. Transmission was successful in 6 of 20 plants as assessed by the development of a mild yellowing symptom 2 weeks after transmission and confirmed by RT-PCR with the CABYVup/CABYVdown primers. To our knowledge, this is the first record of the occurrence of CABYV in Serbia. The discovery of CABYV on oilseed pumpkin should prompt more detailed surveys and subsequent testing of other cucurbits cultivated in Serbia to establish the distribution and incidence of CABYV in Serbia. References: (1) K. Bananej et al. Plant Dis. 90:1113, 2006. (2) I. N. Boubourakas et al. Plant Pathol. 55:276, 2006. (3) M. Juarez et al. Plant Dis. 88:907, 2004. (4) Q. X. Shang et al. Virus Res. 145:341, 2009.

Gli stili APA, Harvard, Vancouver, ISO e altri

37

Fritzsche, Rolf, Werner Wrazidlo e Susanne Thiele. "Einfluß der Mangan-Versorgung des Bodens und der Pflanze auf die Intensität der Symptomausbildung bei Zuckerrüben durch Infektion mit dem Milden Rübenvergilbungs-Virus (beet mild yellowing virus)". Archives Of Phytopathology And Plant Protection 24, n. 3 (gennaio 1988): 189–94. http://dx.doi.org/10.1080/03235408809437809.

Testo completo

Gli stili APA, Harvard, Vancouver, ISO e altri

38

Orfanidou, C., V. I. Maliogka e N. I. Katis. "First Report of Cucurbit chlorotic yellows virus in Cucumber, Melon, and Watermelon in Greece". Plant Disease 98, n. 10 (ottobre 2014): 1446. http://dx.doi.org/10.1094/pdis-03-14-0311-pdn.

Testo completo

Abstract (sommario):

In 2011, an outbreak of a yellowing disease causing chlorosis and Interveinal chlorotic spots on lower leaves was observed in cucumber (Cucumis sativus) and melon (C. melo) plants in two greenhouses on the island of Rhodes, Greece. Similar symptoms were observed in 2012 in open field watermelon (Citrullus lanatus) plants in Rhodes and in November 2013 in a cucumber greenhouse in Tympaki, Crete. Disease incidence ranged from 10 to 40%. The observed symptoms were similar to those caused by whitefly transmitted criniviruses (family Closteroviridae) Cucurbit yellow stunting disorder virus (CYSDV) and Beet pseudo-yellows virus (BPYV), as well as Cucurbit chlorotic yellows virus (CCYV), a recently described crinivirus that infects cucurbits in Japan (4) and by the aphid transmitted polerovirus (family Luteoviridae) Cucurbit aphid-borne yellows virus (CABYV). Dense populations of whiteflies were present in all the affected crops. Leaf samples from cucumber (10 from Rhodes and 10 from Crete), melon (10), and watermelon (10) were collected and tested for the presence of the above viruses. Total RNA was extracted from the samples (2) and detection of BPYV, CYSDV, and CABYV was done as previously described (1,3) whereas detection of CCYV was conducted by herein developed two-step RT-PCR assays. Two new pairs of primers, ‘CC-HSP-up’ (5′-GAAGAGATGGGTTGGTGTAGATAAA-3′)/‘CC-HSP-do’ (5′-CACACCGATTTCATAAACATCCTTT-3′) and ‘CC-RdRp-up’ (5′-CCTAATATTGGAGCTTATGAGTACA-3′)/‘CC-RdRp-do’ (5′-CATACACTTTAAACACAACCCC-3′) were designed based on GenBank deposited sequences of CCYV for the amplification of two regions partially covering the heat shock protein 70 homologue (HSP70h) (226 bp) and the RNA dependent RNA polymerase (RdRp) genes (709 bp). Interestingly, CCYV was detected in all samples tested, while CYSDV was detected in 18 cucumbers (10 from Rhodes and 8 from Crete), 1 melon, and 3 watermelon plants. Neither BPYV nor CABYV were detected. In order to verify the presence of CCYV, the partial HSP70h and RdRp regions of a cucumber isolate from Crete were directly sequenced using the primers ‘CC-HSP-up’/‘CC-HSP-do’ and ‘CC-RdRp-up’/‘CC-RdRp-do’. BLAST analysis of the obtained sequences (HG939521 and 22) showed 99% and 100% identities with the HSP70h and RdRp of cucumber CCYV isolates from Lebanon, respectively (KC990511 and 22). Also, the partial HSP70h sequence of a watermelon CCYV isolate from Rhodes showed 99% identity with the cucumber isolate from Crete. Whitefly transmission of CCYV was also carried out by using an infected cucumber from Crete as virus source. Four groups of 30 whitefly adults of Bemisia tabaci biotype Q were given an acquisition and inoculation access time of 48 and 72 h, respectively. Each whitefly group was transferred to a healthy cucumber plant (hybrid Galeon). Two weeks post inoculation, the plants, which have already been showing mild interveinal chlorosis, were tested for virus presence by RT-PCR. CCYV was successfully transmitted in three of four inoculated cucumbers, which was further confirmed by sequencing. In Greece, cucurbit yellowing disease has occurred since the 1990s, with CYSDV, BPYV, and CABYV as causal agents. To our knowledge, this is the first report of CCYV infecting cucurbits in Greece; therefore, our finding supports the notion that the virus is spreading in the Mediterranean basin and is an important pathogen in cucurbit crops. References: (1) I. N. Boubourakas et al. Plant Pathol. 55:276, 2006. (2) E. Chatzinasiou et al. J. Virol. Methods 169:305, 2010. (3) L. Lotos et al. J. Virol. Methods 198:1, 2014. (4) M. Okuda et al. Phytopathology 100:560, 2010.

Gli stili APA, Harvard, Vancouver, ISO e altri

39

Kaya, Rza, e Nazl Dide Kutluk Ylmaz. "Distribution of some aphid-borne viruses infecting sugar beet in Turkey". Sugar Industry, 2016, 747–52. http://dx.doi.org/10.36961/si17977.

Testo completo

Abstract (sommario):

Surveys were conducted in sugar beet (Beta vulgaris L.) growing areas, which cover 52% of Turkey’s sugar beet production. Sugar beet leaves showing virus-like symptoms such as chlorosis, mosaic and chlorotic spots, were collected from 291 different fields located in ten different provinces in northern and central parts of Turkey in 2011. Beet leaf samples were tested by ELISA for Beet yellowing virus (BYV), Beet mosaic virus (BtMV) and beet-related Poleroviruses [Beet mild yellowing virus (BMYV) and Beet chlorosis virus (BChV)]. Based on the ELISA tests, 58.4% of the samples collected from sugar beet fields gave positive reactions for the viruses tested. None of the samples were found to be infected in Kastamonu and Krkkale provinces. Beet-related Poleroviruses (BMYV and BChV) were the most common viruses obtained from 38.5% of the samples followed by BYV and BtMV with 29.6% and 12.7% respectively. The incidences of single virus infection were 11.3% for BYV and 5.5% for BtMV. Mixed virus infections occurred in 20.3% of the sugar beet samples. Out of four groups of symptoms, chlorosis was the most common symptom (72.9%) followed by mosaic (15.3%), chlorosis+mosaic (7.1%) and chlorotic spots (4.7%) in the surveyed areas.

Gli stili APA, Harvard, Vancouver, ISO e altri

40

Borgolte, Simon, Mark Varrelmann e Roxana Hossain. "Time point of virus yellows infection is crucial for yield losses in sugar beet, and co‐infection with beet mosaic virus is negligible under field conditions". Plant Pathology, 10 giugno 2024. http://dx.doi.org/10.1111/ppa.13954.

Testo completo

Abstract (sommario):

AbstractBeet chlorosis virus (BChV), beet mild yellowing virus (BMYV) and beet yellows virus (BYV) transmitted by Myzus persicae cause virus yellows (VY) disease in sugar beet. M. persicae also transmits beet mosaic virus (BtMV), which is often associated with VY. So far, field trials to determine the effect of infection time point on yield have used 100% inoculation density and little is known about the yield effect of BtMV in mixed infections with VY species under field conditions. Therefore, we conducted sugar beet field trials using a new inoculation protocol with densities of 3%–10% in combination with different infection time points; we also tested the effect of BtMV/VY species mixed infections on white sugar yield (WSY). We observed a wide range of WSY losses for BChV (3.6%–26.8%), BMYV (1.7%–22.0%) and BYV (3.7%–37.0%) depending on infection time point, with no further significant losses after BBCH Stages 18/19, 35 and 39, respectively. Both the time of infection and area under disease progress curve showed excellent correlation with WSY losses for all VY species. BtMV had no significant effect on WSY losses either as a single infection or in mixed infections with BChV or BYV compared to control or single infections of these viruses. However, BMYV/BtMV mixed infection showed significantly increased WSY loss (+13.6%) compared to single BMYV infection. Our results can be used to predict yield losses in practical fields and to develop economic control thresholds for decision support systems.

Gli stili APA, Harvard, Vancouver, ISO e altri

41

Hossain, Roxana, e Mark Varrelmann. "Virus Yellows in sugar beet – possibilities to achieve virus resistance". Sugar Industry, 29 novembre 2021, 696–701. http://dx.doi.org/10.36961/si28160.

Testo completo

Abstract (sommario):

Virus yellows in sugar beet is caused by different virus species. Monitoring has shown that Beet yellows virus (BYV), Beet mild yellowing virus (BMYV), Beet chlorosis virus (BChV) are common and widespread, while Beet mosaic virus (BtMV) is less prevalent. The green peach aphid (Myzus persicae) is considered the main vector of these viruses. Sugar beet varieties with resistance or tolerance traits are currently not available to practical growers, therefore it is imperative to support breeding efforts with improved strategies to achieve virus resistance. For this purpose, a field test was established in which yield differences between susceptible and tolerant varieties can be generated by a 3% inoculation with BMYV-carrying aphids. A greenhouse bioassay has also been developed to distinguish susceptible and tolerant genotypes following BYV infection. Both assays pave the way for future use of natural resources such as wild forms and other breeding material to screen for virus resistance. In addition, molecular biology approaches are used to identify plant susceptibility factors of the plant-virus interaction, which will be knocked out via modern precision breeding methods to generate recessive virus resistance. Consequently, genotypes with naturally occurring mutations in the appropriate factors can be used for crossbreeding processes into elite breeding material.

Gli stili APA, Harvard, Vancouver, ISO e altri

42

Rollwage, Lukas, Hilde Van Houtte, Roxana Hossain, Niels Wynant, Glenda Willems e Mark Varrelmann. "Recessive resistance against beet chlorosis virus is conferred by the eukaryotic translation initiation factor (iso)4E in Beta vulgaris". Plant Biotechnology Journal, 15 marzo 2024. http://dx.doi.org/10.1111/pbi.14333.

Testo completo

Abstract (sommario):

SummaryEukaryotic translation initiation factors (eIFs) are important for mRNA translation but also pivotal for plant‐virus interaction. Most of these plant‐virus interactions were found between plant eIFs and the viral protein genome‐linked (VPg) of potyviruses. In case of lost interaction due to mutation or deletion of eIFs, the viral translation and subsequent replication within its host is negatively affected, resulting in a recessive resistance. Here we report the identification of the Beta vulgaris Bv‐eIF(iso)4E as a susceptibility factor towards the VPg‐carrying beet chlorosis virus (genus Polerovirus). Using yeast two‐hybrid and bimolecular fluorescence complementation assays, the physical interaction between Bv‐eIF(iso)4E and the putative BChV‐VPg was detected, while the VPg of the closely related beet mild yellowing virus (BMYV) was found to interact with the two isoforms Bv‐eIF4E and Bv‐eIF(iso)4E. These VPg‐eIF interactions within the polerovirus‐beet pathosystem were demonstrated to be highly specific, as single mutations within the predicted cap‐binding pocket of Bv‐eIF(iso)4E resulted in a loss of interaction. To investigate the suitability of eIFs as a resistance resource against beet infecting poleroviruses, B. vulgaris plants were genome edited by CRISPR/Cas9 resulting in knockouts of different eIFs. A simultaneous knockout of the identified BMYV‐interaction partners Bv‐eIF4E and Bv‐eIF(iso)4E was not achieved, but Bv‐eIF(iso)4EKO plants showed a significantly lowered BChV accumulation and decrease in infection rate from 100% to 28.86%, while no influence on BMYV accumulation was observed. Still, these observations support that eIFs are promising candidate genes for polerovirus resistance breeding in sugar beet.

Gli stili APA, Harvard, Vancouver, ISO e altri

43

Stanković, Ivana, Katarina Zečević, Živko Ćurčić e Branka Krstic. "First Report of Beet Yellows Virus Causing Virus Yellows in Sugar Beet in Serbia". Plant Disease, 9 giugno 2023. http://dx.doi.org/10.1094/pdis-04-23-0660-pdn.

Testo completo

Abstract (sommario):

Several viruses have been described to infect sugar beet (Beta vulgaris var. saccharifera L.), but virus yellows disease is one of the most important diseases in many sugar beet growing areas. It is caused by four viruses either in single or mixed infection, including the poleroviruses beet western yellows virus (BWYV), beet mild yellowing virus (BMYV), and beet chlorosis virus (BChV), and a closterovirus beet yellows virus (BYV) (Stevens et al. 2005; Hossain et al. 2021). In August 2019, five samples of sugar beet plants showing yellowing on interveinal leaf tissue were collected in a sugar beet crop in the Novi Sad locality (Vojvodina Province, Serbia). Double-antibody sandwich (DAS)-ELISA commercial antisera (DSMZ, Braunschweig, Germany) were used to test the collected samples for the presence of the most common sugar beet viruses: beet necrotic yellow vein virus (BNYVV), BWYV, BMYV, BChV, and BYV. Commercial positive and negative controls were included in each ELISA test. BYV was serologically detected in all sugar beet samples, but no other viruses tested were found. The presence of BYV in sugar beet plants was further confirmed by conventional reverse transcription (RT)-PCR. Total RNAs were extracted using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany), according to the manufacturer's instructions, and used as template in the RT-PCR. Total RNAs extracted from healthy sugar beet leaves and molecular-grade water were included as negative controls in the RT-PCR analysis. RT-PCR confirmed the presence of BYV in all naturally infected plants using four sets of specific primers (Kundu and Ryšánek 2004), whereas no amplification products were obtained in the negative controls. The RT-PCR products derived from isolate 209-19 were purified and directly sequenced in both directions using the same primer pairs as in RT-PCR (accession numbers OQ686792 to OQ686794). Multiple sequence alignment of the L-Pro and N-terminal part of the MET genes showed that the Serbian BYV isolate had the highest nucleotide identity (99.01% and 100%, respectively) with several BYV isolates in GenBank originating from different parts of the world. Sequence analysis of the HSP70 gene showed the highest similarity (99.79%) with the BYV-Cro-L isolate found in Croatia. In a semi-persistent type of transmission test, aphids (Myzus persicae Sulzer) were allowed to feed on BYV-infected leaves of an ELISA-positive sample (209-19) for 48 hours, and then the aphids were transferred to five plants each of Spinacia oleracea cv. Matador and B. vulgaris ssp. vulgaris cv. Eduarda for a three-day inoculation access period. All test plants were successfully infected and exhibited symptoms in the form of interveinal yellowing up to three weeks postinoculation. RT-PCR confirmed the presence of BYV in all inoculated plants. A study by Nikolić (1951) suggested a possible presence of BYV based on symptoms observed on sugar beet plants in fields, but to our knowledge this is the first report of BYV in sugar beet in Serbia. As sugar beet is one of the most important industrial crops in Serbia, the presence of BYV could lead to significant losses, considering that aphid vectors are widespread under Serbian environmental conditions. The discovery of BYV on sugar beet should prompt a more detailed survey and subsequent testing of susceptible hosts to determine the distribution and incidence of BYV in Serbia.

Gli stili APA, Harvard, Vancouver, ISO e altri

44

Okole, Nathan, Facundo R. Ispizua Yamati, Roxana Hossain, Mark Varrelmann, Anne‐Katrin Mahlein e Rene H. J. Heim. "Aerial low‐altitude remote sensing and deep learning for in‐field disease incidence scoring of virus yellows in sugar beet". Plant Pathology, 14 luglio 2024. http://dx.doi.org/10.1111/ppa.13973.

Testo completo

Abstract (sommario):

AbstractThis study investigates the potential of high‐resolution (<0.5 cm/pixel) aerial imagery and convolutional neural networks (CNNs) for disease incidence scoring in sugar beet, focusing on two important aphid‐transmitted viruses, beet mild yellowing virus (BMYV) and beet chlorosis virus (BChV). The development of tolerant sugar beet cultivars is imperative in the context of increased disease management concerns due to the ban on neonicotinoids in the European Union. However, traditional methods of disease phenotyping, which rely on visual assessment by human experts, are both time‐consuming and subjective. Therefore, this study assessed whether aerial multispectral and RGB images could be harnessed to perform automated disease ratings comparable to those performed by trained experts. To this end, two variety trials were conducted in 2021 and 2022. The 2021 dataset was used to train and validate a CNN model on five cultivars, while the 2022 dataset was used to test the model on two cultivars different from those used in 2021. Additionally, this study tests the use of transformed features instead of raw spectral bands to improve the generalization of CNN models. The results showed that the best CNN model was the one trained for BMYV on RGB images using transformed features instead of conventional raw bands. This model achieved a root mean square error score of 11.45% between the model and expert scores. These results indicate that while high‐resolution aerial imagery and CNNs hold great promise, a complete replacement of human expertise is not yet possible. This research contributes to an innovative approach to disease phenotyping, driving advances in sustainable agriculture and crop breeding.

Gli stili APA, Harvard, Vancouver, ISO e altri

45

Hossain, Roxana, Wulf Menzel e Mark Varrelmann. "Viröse Vergilbung in Zuckerrübe – Biologie und Befallsrisiko". Sugar Industry, 1 ottobre 2019, 665–72. http://dx.doi.org/10.36961/si23793.

Testo completo

Abstract (sommario):

Seit der Entdeckung, dass Zucker aus dem Wurzelkörper von Rüben extrahiert werden kann, ist die Zuckerrübe bis heute zur wichtigsten Zuckerpflanze der gemäßigten Breiten geworden. Die Zuckererträge werden jedoch erheblich durch Krankheiten und Schädlinge beeinflusst. Zu den wirtschaftlich relevantesten Erkrankungen zählen u. a. Viruserkrankungen, die über Bodenorganismen und sehr häufig auch von an den Blättern saugenden Insekten, wie Blattläusen und Zikaden, auf die Pflanzen übertragen werden. Die viröse Vergilbung, verursacht durch einen Komplex aus unterschiedlichen Virusspezies, wird hauptsächlich durch die Blattlausart Myzus persicae übertragen und kann zu Ertragsverlusten bis zu 50 % führen. In Deutschland treten das Beet yellows virus (BYV), das Beet mild yellowing virus (BMYV), das Beet chlorosis virus (BChV) vermehrt und das Beet mosaic virus (BtMV) seltener auf. Das Beet western yellows virus (BWYV) konnte bisher nur in den USA und Asien nachgewiesen werden. Die Symptome sind sehr variabel. Es können sich Chlorosen, Nekrosen und im Falle des BtMV mosaikartige Aufhellungen an den älteren Blättern ausprägen. Die Schwere des Befalls im Bestand unterliegt natürlichen Schwankungen der Blattlauspopulationen und hängt zudem mit dem Infektionszeitpunkt sowie klimatischen Bedingungen, vor allem in den Wintermonaten, zusammen. So bricht die Erkrankung zunächst nesterweise aus, bis sie sich im gesamten Bestand ausbreitet. Bisher ist in der Gattung Beta keine vollständige Resistenz gegenüber Vertretern des Vergilbungsvirus-Komplexes bekannt. Resistente Sorten sind also bisher nicht verfügbar. Die Vergilbungsviren konnten viele Jahre mithilfe von Saatgutbeizmitteln aus der Wirkstoffgruppe der Neonicotinoide zur Bekämpfung von Virusvektoren sehr gut kontrolliert werden. Für diese gibt es seit 2019 nun ein Einsatzverbot in Deutschland. Die einseitige Nutzung der verbliebenen Insektizide erhöht jedoch den Selektionsdruck auf die Blattlauspopulationen und wird zukünftig vermehrt zu Resistenzproblemen führen. Eine dauerhafte Kontrolle der Virusvektoren und indirekt der Virusspezies ist daher nur über Resistenzzüchtung möglich, die durch die veränderten Rahmenbedingungen bezüglich des Pflanzenschutzmittel-einsatzes im Zuckerrübenanbau zeitnah und mit entsprechender Intensivität durchgeführt werden muss.

Gli stili APA, Harvard, Vancouver, ISO e altri

46

"Beet mild yellowing virus (beet mild yellowing)". CABI Compendium CABI Compendium (7 gennaio 2022). http://dx.doi.org/10.1079/cabicompendium.9421.

Testo completo

Abstract (sommario):

This datasheet on Beet mild yellowing virus covers Identity, Overview, Distribution, Hosts/Species Affected, Vectors & Intermediate Hosts, Diagnosis, Biology & Ecology, Seedborne Aspects, Impacts, Prevention/Control, Further Information.

Gli stili APA, Harvard, Vancouver, ISO e altri

47

"Beet mild yellowing virus (beet mild yellowing)". PlantwisePlus Knowledge Bank Species Pages (7 gennaio 2022). http://dx.doi.org/10.1079/pwkb.species.9421.

Testo completo

Gli stili APA, Harvard, Vancouver, ISO e altri

48

Schop, Sharella, Floor van den Ham, Ellen van Oorschot, Sander R. Grapendaal, Elma Raaijmakers e Rene A. A. van der Vlugt. "Development of a one‐step multiplex reverse transcription‐polymerase chain reaction and Luminex xTAG assay for the simultaneous detection of yellowing viruses infecting sugar beet". Plant Pathology, 26 aprile 2024. http://dx.doi.org/10.1111/ppa.13911.

Testo completo

Abstract (sommario):

AbstractYellowing viruses are an increasing threat to sugar beet cultivation, due to limitations on insecticide usage and climate change. Virus detection, monitoring and resistance breeding are key to secure high sugar beet yields in the future. For this research, a one‐step multiplex reverse transcription (mRT)‐PCR method was designed to detect simultaneously beet mild yellowing virus, beet chlorosis virus, beet yellows virus (BYV), beet mosaic virus and turnip yellows virus. The addition of Luminex xTAG array technology was used as a follow‐up method to increase assay specificity. The one‐step mRT‐PCR was evaluated on 22 field samples with single and mixed virus infections. The xTAG assay works as expected both in a simplex and multiplex setting, except that BYV detection needs optimization in the multiplex setting. In the future, the Luminex xTAG assay would be an excellent method for the detection of beet yellowing viruses due to its high specificity and the potential to increase the number of targets.

Gli stili APA, Harvard, Vancouver, ISO e altri

49

Puthanveed, Vinitha, Khushwant Singh, Efstratia Poimenopoulou, Josefin Pettersson, Abu Bakar Siddique e Anders Kvarnheden. "Milder autumns may increase risk for infection of crops with turnip yellows virus". Phytopathology®, 20 febbraio 2023. http://dx.doi.org/10.1094/phyto-11-22-0446-v.

Testo completo

Abstract (sommario):

Climate change has increased the risk for infection of crops with insect-transmitted viruses. Mild autumns provide prolonged active periods to insects, which may spread viruses to winter crops. In autumn 2018, green peach aphids (Myzus persicae) were found in suction traps in southern Sweden that presented infection risk for winter oilseed rape (OSR; Brassica napus) with turnip yellows virus (TuYV). A survey was carried out in spring 2019 with random leaf samples from 46 OSR fields in southern and central Sweden using DAS-ELISA resulting in TuYV being detected in all fields except one. In the counties of Skåne, Kalmar and Östergötland, the average incidence of TuYV-infected plants was 75% and the incidence reached 100% for nine fields. Sequence analyses of the coat protein gene revealed a close relationship between TuYV isolates from Sweden and other parts of the world. High-throughput sequencing for one of the OSR samples confirmed the presence of TuYV and revealed co-infection with TuYV-associated RNAs. Molecular analyses of seven sugar beet (Beta vulgaris) plants with yellowing, collected in 2019, revealed that two of them were infected by TuYV together with two other poleroviruses: beet mild yellowing virus and beet chlorosis virus. The presence of TuYV in sugar beet suggests a spillover from other hosts. Poleroviruses are prone to recombination, and mixed infection with three poleroviruses in the same plant poses a risk for the emergence of new polerovirus genotypes.

Gli stili APA, Harvard, Vancouver, ISO e altri

50

Hossain, Roxana, Wulf Menzel, Celin Lachmann e Mark Varrelmann. "New insights into virus yellows distribution in Europe and effects of beet yellows virus, beet mild yellowing virus, and beet chlorosis virus on sugar beet yield following field inoculation". Plant Pathology, 17 novembre 2020. http://dx.doi.org/10.1111/ppa.13306.

Testo completo

Gli stili APA, Harvard, Vancouver, ISO e altri

Articoli di riviste sul tema "Beet mild yellowing virus (BMYV)"

Cita una fonte nei formati APA, MLA, Chicago, Harvard e in molti altri stili