Articoli di riviste: "Artificial grape"

1

Kosaka, Shinichi, Kazutaka Narita, Kimitoshi Horaguchi, Hirohumi Kugishima, Tadashi Minoshima e Tadaaki Shimazu. "Artificial Lighting for Grape in Winter". JOURNAL OF THE ILLUMINATING ENGINEERING INSTITUTE OF JAPAN 85, n. 3 (2001): 201–3. http://dx.doi.org/10.2150/jieij1980.85.3_201.

Testo completo

Gli stili APA, Harvard, Vancouver, ISO e altri

2

Igounet, Olivier, Charles Baldy, Jean-Pierre Robin, Jean-Claude Boulet, M. Sanon e Benoît Suard. "Effects of artificial soil covers on the internal temperatures of grape berries during the grape maturation". OENO One 29, n. 3 (30 settembre 1995): 131. http://dx.doi.org/10.20870/oeno-one.1995.29.3.1125.

Testo completo

Abstract (sommario):

Air temperature as well as internal and surface temperatures (by infrared radiothermometry) of grape berries of vineyards (var. Syrah) under which we place different soil cover : bare soil, polyethylene and aluminium were monitored during the swelling and the ripening stages at the « Institut National de la Recherche Agronomique » experimental station at Pech Rouge, Gruissan (France). Results showed there were significant differences in the thermal responses of the grapes with respect to the type of soil cover and degree of fruit ripening. High differences in temperatures between grape and air were observed in soil covered with aluminium sheet which reflected most of the incident solar radiation. For this cover, biochemical analysis of berries and must indicate an increase of sugars grade and alcoholic degree. Statistical analysis were carried out to determine the influence of climatic variables on the grape temperatures. Solar radiation, wind and air temperature are the parameters which seem the main factors, nevertheless, their influence evolve during the process of grape maturation.

Gli stili APA, Harvard, Vancouver, ISO e altri

3

Chayjan, R. A., e M. Esna-Ashari. "Effect of moisture content on thermodynamic characteristics of grape: mathematical and artificial neural network modelling". Czech Journal of Food Sciences 29, No. 3 (13 maggio 2011): 250–59. http://dx.doi.org/10.17221/328/2009-cjfs.

Testo completo

Abstract (sommario):

Artificial neural networks (ANNs) and four empirical mathematical models, namely Henderson, GAB, Halsey, and Oswin were used for the estimation of equilibrium moisture content (EMC) of the dried grape (black currant). The results showed that the EMC of the grape were more accurately predicted by ANN models than by the empirical models. The heat and entropy of sorption of the grape have separately been predicted by two mathematical models as a function of EMC with desirable coefficient of determination (R2 ≈ 0.99). At the EMC above 7% (d.b.), the heat and entropy of the grape sorption were smoothly decreased, while they were the highest at the moisture content of about 7% (d.b.). Better equations could be developed for the prediction of the heat of sorption and entropy based on the data from the ANN model.

Gli stili APA, Harvard, Vancouver, ISO e altri

4

Peisley, Rebecca K., Manu E. Saunders e Gary W. Luck. "Providing perches for predatory and aggressive birds appears to reduce the negative impact of frugivorous birds in vineyards". Wildlife Research 44, n. 4 (2017): 334. http://dx.doi.org/10.1071/wr17028.

Testo completo

Abstract (sommario):

Context Birds active in vineyards in south-eastern Australia can reduce or enhance crop yields via their foraging activities (e.g. by consuming grapes or by preying on grape-eating species). Aims We examined the effectiveness of artificial perches in encouraging predatory birds into vineyards to scare frugivorous birds and consequently reduce the damage they cause to grapes. Methods We monitored 12 artificial perches for 4 months during the growing season, spread over six vineyards in north-eastern Victoria, and compared bird damage to grapes at these sites with control sites without perches. Key results We found that raptors did not use the artificial perches. However, the large and aggressive Australian magpie (Cracticus tibicen) commonly used perches and we recorded 38513 perch visits by this species. Grapevines around perch sites suffered >50% less grape damage (4.13% damage per bunch) than control sites (8.57% damage per bunch). Conclusions Our results suggest that providing artificial perches in vineyards can play a role in reducing frugivore damage to grapes. However, the effectiveness of perches can vary under different environmental conditions and certain perch types are not suitable for all predatory or aggressive birds. Implications Future research should focus on the potential role of large-bodied and competitively aggressive species such as the Australian magpie in altering the activity of smaller frugivorous birds in vineyards, and also on the optimum height and location of artificial perches within vineyards to increase visitation by other predatory or aggressive bird species.

Gli stili APA, Harvard, Vancouver, ISO e altri

5

Andrushia, A. Diana, e A. Trephena Patricia. "Artificial bee colony optimization (ABC) for grape leaves disease detection". Evolving Systems 11, n. 1 (22 maggio 2019): 105–17. http://dx.doi.org/10.1007/s12530-019-09289-2.

Testo completo

Gli stili APA, Harvard, Vancouver, ISO e altri

6

Chu, Xiaoquan, Yue Li, Dong Tian, Jianying Feng e Weisong Mu. "An optimized hybrid model based on artificial intelligence for grape price forecasting". British Food Journal 121, n. 12 (21 novembre 2019): 3247–65. http://dx.doi.org/10.1108/bfj-06-2019-0390.

Testo completo

Abstract (sommario):

Purpose The purpose of this paper is to propose an optimized hybrid model based on artificial intelligence methods, use the method of time series forecasting, to deal with the price prediction issue of China’s table grape. Design/methodology/approach The approaches follows the framework of “decomposition and ensemble,” using ensemble empirical mode decomposition (EEMD) to optimize the conventional price forecasting methods, and, integrating the multiple linear regression and support vector machine to build a hybrid model which could be applied in solving price series predicting problems. Findings The proposed EEMD-ADD optimized hybrid model is validated to be considered satisfactory in a case of China’ grape price forecasting in terms of its statistical measures and prediction performance. Practical implications This study would resolve the difficulties in grape price forecasting and provides an adaptive strategy for other agricultural economic predicting problems as well. Originality/value The paper fills the vacancy of concerning researches, proposes an optimized hybrid model integrating both classical econometric and artificial intelligence models to forecast price using time series method.

Gli stili APA, Harvard, Vancouver, ISO e altri

7

Xie, Qian, Ana Karina Bedran-Russo e Christine D. Wu. "In vitro remineralization effects of grape seed extract on artificial root caries". Journal of Dentistry 36, n. 11 (novembre 2008): 900–906. http://dx.doi.org/10.1016/j.jdent.2008.07.011.

Testo completo

Gli stili APA, Harvard, Vancouver, ISO e altri

8

Cecotti, Hubert, Agustin Rivera, Majid Farhadloo e Miguel A. Pedroza. "Grape detection with convolutional neural networks". Expert Systems with Applications 159 (novembre 2020): 113588. http://dx.doi.org/10.1016/j.eswa.2020.113588.

Testo completo

Gli stili APA, Harvard, Vancouver, ISO e altri

9

Fermaud, M., P. Pracros, R. Roehrich e J. Stockel. "Evaluation of an Artificial Infestation Technique of Grape with Lobesia botrana (Lepidoptera: Tortricidae)". Journal of Economic Entomology 89, n. 6 (1 dicembre 1996): 1658–62. http://dx.doi.org/10.1093/jee/89.6.1658.

Testo completo

Gli stili APA, Harvard, Vancouver, ISO e altri

10

Xin, Haiping, Jisen Zhang, Wei Zhu, Nian Wang, Peige Fang, Yuepeng Han, Ray Ming e Shaohua Li. "The effects of artificial selection on sugar metabolism and transporter genes in grape". Tree Genetics & Genomes 9, n. 5 (9 giugno 2013): 1343–49. http://dx.doi.org/10.1007/s11295-013-0643-7.

Testo completo

Gli stili APA, Harvard, Vancouver, ISO e altri

11

M, Rubel, Prashant Gm, Naveen Kumar Pg, Sushanth Vh, Mohamed Imranulla, Ipshita Potlia e Swati Mallick. "EFFECT OF GRAPE SEED EXTRACT ON REMINERALIZATION OF ARTIFICIAL CARIES: AN IN-VITRO STUDY". Asian Journal of Pharmaceutical and Clinical Research 9, n. 5 (1 settembre 2016): 174. http://dx.doi.org/10.22159/ajpcr.2016.v9i5.13175.

Testo completo

Abstract (sommario):

ABSTRACTObjective: Grape seeds are gaining more importance because the “Proanthocyanidins” present in them have excellent anticaries, remineralizing, andantibacterial properties. Although many preventive measures have been tried, dental caries remains one of the most prevalent diseases in humans.The ultimate goal of any intervention is the preservation of tooth structure, prevention of lesion progression and inducing remineralization. Thepresent in-vitro study was done to investigate the effect of grape seed extract (GSE) on artificial enamel caries in human teeth.Methods: A total of 50 sound premolars extracted from patients undergoing orthodontic treatment were used in the study. The teeth were cleanedand were immersed in a demineralizing solution for 96 hrs at 37°C and 50% relative humidity to create artificial lesions. The samples were randomlydivided into two groups of 25 each. Half of the samples were immersed in the GSE solution (test) and the other half in saline (control), respectively, for8 days. The samples were measured by microhardness tester to obtain values in Vickers hardness scale. Data were entered into Microsoft Excel andwere analyzed using independent t-test for inter-group comparison and paired t-test for intra-group comparison using SPSS version 21.Results: The mean±SD microhardness values after remineralization for the test and control groups were 357.56±5.53 and 337.60±6.38. GSE groupsignificantly increased the microhardness of the lesions (p≤0.001).Conclusion: GSE is a potential remineralizing agent and can be used to prevent progression of dental caries.Keywords: Grape seed extract, Remineralization, Dental caries.

Gli stili APA, Harvard, Vancouver, ISO e altri

12

ARADHYA, MALLIKARJUNA K., GERALD S. DANGL, BERNARD H. PRINS, JEAN-MICHEL BOURSIQUOT, M. ANDREW WALKER, CAROLE P. MEREDITH e CHARLES J. SIMON. "Genetic structure and differentiation in cultivated grape, Vitis vinifera L." Genetical Research 81, n. 3 (giugno 2003): 179–92. http://dx.doi.org/10.1017/s0016672303006177.

Testo completo

Abstract (sommario):

222 cultivated (Vitis vinifera) and 22 wild (V. vinifera ssp. sylvestris) grape accessions were analysed for genetic diversity and differentiation at eight microsatellite loci. A total of 94 alleles were detected, with extensive polymorphism among the accessions. Multivariate relationships among accessions revealed 16 genetic groups structured into three clusters, supporting the classical eco-geographic grouping of grape cultivars: occidentalis, pontica and orientalis. French cultivars appeared to be distinct and showed close affinity to the wild progenitor, ssp. sylvestris from south-western France (Pyrenees) and Tunisia, probably reflecting the origin and domestication history of many of the old wine cultivars from France. There was appreciable level of differentiation between table and wine grape cultivars, and the Muscat types were somewhat distinct within the wine grapes. Contingency χ2 analysis indicated significant heterogeneity in allele frequencies among groups at all loci. The observed heterozygosities for different groups ranged from 0·625 to 0·9 with an overall average of 0·771. Genetic relationships among groups suggested hierarchical differentiation within cultivated grape. The gene diversity analysis indicated narrow divergence among groups and that most variation was found within groups (∼85%). Partitioning of diversity suggested that the remaining variation is somewhat structured hierarchically at different levels of differentiation. The overall organization of genetic diversity suggests that the germplasm of cultivated grape represents a single complex gene pool and that its structure is determined by strong artificial selection and a vegetative mode of reproduction.

Gli stili APA, Harvard, Vancouver, ISO e altri

13

Benjamin, Shiny, Roshni LNU, Sabeena Susan Thomas e Mohan Thomas Nainan. "Grape Seed Extract as a Potential Remineralizing Agent: A Comparative in vitro Study". Journal of Contemporary Dental Practice 13, n. 4 (2012): 425–30. http://dx.doi.org/10.5005/jp-journals-10024-1162.

Testo completo

Abstract (sommario):

ABSTRACT Objective Remineralization is an effective treatment that may stop or reverse early tooth decay. Grape seed extract (GSE) is the potential remineralizing agent under investigation. Materials and methods Sound human tooth sections were obtained from the cervical portion of the root and stored in demineralizing solution at 37°C for 96 hours to induce artificial root caries lesions. The sections were divided into four treatment groups including 6.5% grape seed extract, sodium monofluorophosphate (220 ppm) with 0.05% calcium glycerophosphate, 0.5% calcium glycerophosphate and control (no treatment). An in vitro pH cycling model was used to cycle the demineralized specimens through treatment solutions, acidic buffer and neutral buffer for 8 days at 6 cycles per day. Subsequently, they were evaluated using confocal laser scanning microscope. Data were analyzed using analysis of variance (p < 0.05). Results GSE revealed less demineralization and more remineralization compared with other groups. Conclusion GSE promotes remineralization of artificial root caries lesions. Clinical significance The search for the perfect remineralizing agent continues to this day. GSE could be a welcome addition to the remineralization armamentarium. Abbreviations and acronyms GSE: Grape seed extract; ppm: Parts per million; CaGP: Calcium glycerophosphate; CLSM: Confocal laser scanning microscope; ANOVA: Analysis of variance; PA: Proanthocyanidin; CEJ: Cementoenamel junction; mM: Millimole; CaCl2.2H2O: Calcium chloride dihydrate; KH2PO4: Potassium dehydrate phosphate; K2HPO4: Dipotassium phosphate; dH2O: Deionized water; w/v: Weight by volume; ROD: Relative optical density; nm: Nanometer; SD: Standard deviation. How to cite this article Benjamin S, Roshni, Thomas SS, Nainan MT. Grape Seed Extract as a Potential Remineralizing Agent: A Comparative in vitro Study. J Contemp Dent Pract 2012;13(4):425-430.

Gli stili APA, Harvard, Vancouver, ISO e altri

14

Furuse, Adilson Yoshio, Constantino Fernandes Neto, Genine Moreira de Freitas Guimarães, Bianca Rodrigues Terrabuio, Fabio Antonio Piola Rizzante e Linda Wang. "Color evaluation of white spot lesions treated with resin infiltration after water or grape juice storage". Brazilian Journal of Oral Sciences 19 (9 marzo 2020): e201674. http://dx.doi.org/10.20396/bjos.v19i0.8658336.

Testo completo

Abstract (sommario):

Aim: To evaluate the color stability of bovine enamel with artificial white spot lesions treated with resin infiltration (ICON) or remineralization with fluoride using two storage methods. Methods: Sixty incisors were submitted to artificial white spot lesion induced by demineralization-remineralization (DE-RE) cycling. Initial color was evaluated with CIE-Lab to measure ΔEab. Demineralized teeth were divided according to the treatment of the white spot lesion (n = 20): 1) Remineralization with 2% neutral fluoride gel for 4min (control); 2) ICON application following manufacturer’s recommendations; and 3) ICON with decreased drying time after the application of ethanol. After 24h, color was evaluated and samples were subdivided (n = 10) according to storage: 1) distilled water for 1 month; 2) grape juice for 10min daily. After storage, color was evaluated. L*, a* and b* data were analyzed by one-way ANOVA and ∆Eab data by two-way ANOVA followed by Tukey’s HSD (α = 0.05). Results: L* was affected by juice storage, and decreased when ICON was applied with decreased drying time after the ethanol application. The same behavior occurred with a* (increase with reduced drying time), while b* was not affected. For ∆Eab significant differences were observed between groups (p = 0.0219) and storage methods (p = 0.0007). There was no interaction effect (p = 0.1118). Remineralization with fluoride presented the lowest color changes after storage in water. Conclusion: Treatment of artificial carious lesions with resin infiltration presented greater color changes than fluoride remineralization after storage in both solutions in vitro.

Gli stili APA, Harvard, Vancouver, ISO e altri

15

Tasin, Marco, Anna-Carin Bäckman, Marie Bengtsson, Nélia Varela, Claudio Ioriatti e Peter Witzgall. "Wind tunnel attraction of grapevine moth females, Lobesia Botrana, to natural and artificial grape odour". Chemoecology 16, n. 2 (7 marzo 2006): 87–92. http://dx.doi.org/10.1007/s00049-005-0332-6.

Testo completo

Gli stili APA, Harvard, Vancouver, ISO e altri

16

Yang, Hai Qing, Wei Qiang Luo e Wen Jing Wang. "Nondestructive Discrimination of Grape Seed Varieties Using UV-VIS-NIR Spectroscopy and Chemometrics". Applied Mechanics and Materials 236-237 (novembre 2012): 89–94. http://dx.doi.org/10.4028/www.scientific.net/amm.236-237.89.

Testo completo

Abstract (sommario):

Classification of grape seed species is a useful tool to obtain seeds with desired quality traits. This study aimed at rapidly and nondestructively discriminating four varieties of grape seeds using ultra violet, visible and near infrared (UV-VIS-NIR) spectroscopy with wavelength range of 2101100 nm. A hundred twenty grape seed samples were divided for calibration (n=80) and validation (n=40). The spectra were subjected to a principal component analysis (PCA) with the leading 10 principal components (PCs) used to build calibration models. The obtained PCs were treated by linear discriminant analysis (LDA), artificial neural network (ANN) and support vector machine (SVM) to build various discrimination models. Validation results showed that the PC-LDA model developed for the full range of UV-VIS-NIR achieved better performance than those developed for partial wavelengths, i.e. UV, VIS, NIR, UV-VIS, and VIS-NIR. The PC-LDA model with 8 PCs achieved best performance with 100% discrimination accuracy. This experiment suggests that the UV-VIS-NIR spectroscopy coupled with PC-LDA calibration method is promising for the nondestructive discrimination of grape seed varieties.

Gli stili APA, Harvard, Vancouver, ISO e altri

17

Nikoghosyan, Maria, Maria Schmidt, Kristina Margaryan, Henry Loeffler-Wirth, Arsen Arakelyan e Hans Binder. "SOMmelier—Intuitive Visualization of the Topology of Grapevine Genome Landscapes Using Artificial Neural Networks". Genes 11, n. 7 (17 luglio 2020): 817. http://dx.doi.org/10.3390/genes11070817.

Testo completo

Abstract (sommario):

Background: Whole-genome studies of vine cultivars have brought novel knowledge about the diversity, geographical relatedness, historical origin and dissemination, phenotype associations and genetic markers. Method: We applied SOM (self-organizing maps) portrayal, a neural network-based machine learning method, to re-analyze the genome-wide Single Nucleotide Polymorphism (SNP) data of nearly eight hundred grapevine cultivars. The method generates genome-specific data landscapes. Their topology reflects the geographical distribution of cultivars, indicates paths of cultivar dissemination in history and genome-phenotype associations about grape utilization. Results: The landscape of vine genomes resembles the geographic map of the Mediterranean world, reflecting two major dissemination paths from South Caucasus along a northern route via Balkan towards Western Europe and along a southern route via Palestine and Maghreb towards Iberian Peninsula. The Mediterranean and Black Sea, as well as the Pyrenees, constitute barriers for genetic exchange. On the coarsest level of stratification, cultivars divide into three major groups: Western Europe and Italian grapes, Iberian grapes and vine cultivars from Near East and Maghreb regions. Genetic landmarks were associated with agronomic traits, referring to their utilization as table and wine grapes. Pseudotime analysis describes the dissemination of grapevines in an East to West direction in different waves of cultivation. Conclusion: In analogy to the tasks of the wine waiter in gastronomy, the sommelier, our ‘SOMmelier’-approach supports understanding the diversity of grapevine genomes in the context of their geographic and historical background, using SOM portrayal. It offers an option to supplement vine cultivar passports by genome fingerprint portraits.

Gli stili APA, Harvard, Vancouver, ISO e altri

18

Behroozi Khazaei, Nasser, Teymour Tavakoli, Hassan Ghassemian, Mohammad Hadi Khoshtaghaza e Ahmad Banakar. "Applied machine vision and artificial neural network for modeling and controlling of the grape drying process". Computers and Electronics in Agriculture 98 (ottobre 2013): 205–13. http://dx.doi.org/10.1016/j.compag.2013.08.010.

Testo completo

Gli stili APA, Harvard, Vancouver, ISO e altri

19

Khiavi, H., Haji Shikhlinski, A. Ahari e Asgar Heydari. "Evaluation of Different Grape Varieties for Resistance to Powdery Mildew Caused by Uncinula Necator". Journal of Plant Protection Research 49, n. 4 (1 dicembre 2009): 434–39. http://dx.doi.org/10.2478/v10045-009-0069-2.

Testo completo

Abstract (sommario):

Evaluation of Different Grape Varieties for Resistance to Powdery Mildew Caused byUncinula NecatorPowdery mildew is one of the most serious and destructive diseases of grapes around the world including Iran. Although the application of chemical pesticides is the most common control method, the use of resistant varieties may be the most effective and environmentally sound strategy for managing the disease. Fourteen grape varieties were evaluated for testing powdery mildew (Uncinula necator) resistance under natural infection conditions and artificial inoculation methods were used during 2007-2008 in Ardabil province of Iran. Disease severity on leaves and fruit (cluster) were evaluated using Voytovich (1987) procedure. Results of the experiments showed that Shahani, Yagothi and Tabrizkishmishi cultivars were immune, Sahibi cultivar was highly resistant, Agshilig and Tokoulgan were resistant, Kishmishi, Khalili and Tabarzeh cultivars were tolerant, Aldarag and Koupakbogan were susceptible and Garashilig, Seyrakpousteh and Rasmi cultivars were highly susceptible to the disease. In general, results of this study were promising and some immune, highly resistant and resistant cultivars toU. necatorwere identified and they may be used as a resistance genetic source for management of the disease in national and international programs.

Gli stili APA, Harvard, Vancouver, ISO e altri

20

Ghiglieno, Isabella, Fulvio Mattivi, Gabriele Cola, Davide Trionfini, Daniele Perenzoni, Anna Simonetto, Gianni Gilioli e Leonardo Valenti. "The effects of leaf removal and artificial shading on the composition of Chardonnay and Pinot noir grapes". OENO One 54, n. 4 (22 ottobre 2020): 761–77. http://dx.doi.org/10.20870/oeno-one.2020.54.4.2556.

Testo completo

Abstract (sommario):

Aims: The aim of this study was to assess the effects of leaf removal and bunch shading on the analytical composition of Pinot noir and Chardonnay (Vitis vinifera L.) grapes suitable for making premium sparkling wine.Method and results: Total bunch defoliation (TD) and different treatments using shading nets (TD1L, TD2L and ND1L) were evaluated in comparison with a test with no defoliation and shading (ND) over three seasons in the southern part of Franciacorta, one of the most famous Italian sparkling wine regions. Micrometeorological variables, yield components, musts and grapes chemical composition were evaluated. Shading practices lead to a delay in ripening and they improve the acidic content of must, thus resulting in a potential improvement in the quality of juice suitable for producing sparkling wines. Furthermore, this particular type of vine canopy management leads to changes in the phenolic content of grapes.Conclusions: From the results obtained it was possible to underline the positive effect - delaying ripening, preserving acid concentration and reducing flavonol content - of shading on the composition of Pinot noir and Chardonnay grapes suitable for making premium sparkling wine.Significance of the study: This study shows the importance of shading, because it delays grape ripening and thereby preserves the acidic content of musts and, specifically, deals with the problem of early ripening related to the climate change now underway.

Gli stili APA, Harvard, Vancouver, ISO e altri

21

Wang, Junfang, Yuxia Sun, Hengzhen Wang, Xueqiang Guan e Lijun Wang. "Resveratrol Synthesis under Natural Conditions and after Ultraviolet-C Irradiation in Grape Leaves at Different Leaf Developmental Stages". HortScience 51, n. 6 (giugno 2016): 727–31. http://dx.doi.org/10.21273/hortsci.51.6.727.

Testo completo

Abstract (sommario):

The biosynthesis and accumulation of resveratrol in grape may be regulated by genetic and environmental factors [i.e., ultraviolet-C (UV-C) irradiation]. However, there is a lack of research on the biosynthesis and accumulation of resveratrol in grape leaves responding to UV-C irradiation at sequential developmental stages. In this study, leaf resveratrol concentration during different developmental stages of three grape cultivars, Jingxiu, Beifeng, and MRH3, under natural conditions, and of ‘Beifeng’ leaves exposed to UV-C irradiation was investigated. Results showed that resveratrol synthesis was related to the developmental stages under natural conditions. In young leaves, resveratrol concentration was low, but it increased continuously during leaf development, mainly as piceid forms. UV-C irradiation greatly stimulated resveratrol synthesis in ‘Beifeng’ leaves, and young leaves at 20 days were most sensitive to the irradiation. The total resveratrol in the skin of UV-C irradiated berries is about 19 times higher than that of the control, mainly in the forms of trans-resveratrol (trans-res)/cis-resveratrol (cis-res). These results provide a basis for increasing resveratrol concentration by artificial means.

Gli stili APA, Harvard, Vancouver, ISO e altri

22

SUGINO, Atsushi, Kanji TSURU, Satoshi HAYAKAWA, Yuki SHIROSAKI, Chikara OHTSUKI e Akiyoshi OSAKA. "0932 GRAPE^[○!R] Technology : Novel technique for providing titaniumu-based artificial joint with osteoconductivity by spatial design". Proceedings of the Bioengineering Conference Annual Meeting of BED/JSME 2009.22 (2010): 344. http://dx.doi.org/10.1299/jsmebio.2009.22.344.

Testo completo

Gli stili APA, Harvard, Vancouver, ISO e altri

23

Luo, Lufeng, Hanjin Wen, Qinghua Lu, Haojie Huang, Weilin Chen, Xiangjun Zou e Chenglin Wang. "Collision-Free Path-Planning for Six-DOF Serial Harvesting Robot Based on Energy Optimal and Artificial Potential Field". Complexity 2018 (1 novembre 2018): 1–12. http://dx.doi.org/10.1155/2018/3563846.

Testo completo

Abstract (sommario):

Collision-free autonomous path planning under a dynamic and uncertainty vineyard environment is the most important issue which needs to be resolved firstly in the process of improving robotic harvesting manipulator intelligence. We present and apply energy optimal and artificial potential field to develop a path planning method for six degree of freedom (DOF) serial harvesting robot under dynamic uncertain environment. Firstly, the kinematical model of Six-DOF serial manipulator was constructed by using the Denavit-Hartenberg (D-H) method. The model of obstacles was defined by axis-aligned bounding box, and then the configuration space of harvesting robot was described by combining the obstacles and arm space of robot. Secondly, the harvesting sequence in path planning was computed by energy optimal method, and the anticollision path points were automatically generated based on the artificial potential field and sampling searching method. Finally, to verify and test the proposed path planning algorithm, a virtual test system based on virtual reality was developed. After obtaining the space coordinates of grape picking point and anticollision bounding volume, the path points were drew out by the proposed method. 10 times picking tests for grape anticollision path planning were implemented on the developed simulation system, and the success rate was up to 90%. The results showed that the proposed path planning method can be used to the harvesting robot.

Gli stili APA, Harvard, Vancouver, ISO e altri

24

Mwamahonje, Andekelile, Deusdedit Kilambo, Leon Mrosso e Tileye Feyissa. "Screening for resistance of grape varieties to powdery mildew (Erysiphenecator) disease". JOURNAL OF ADVANCES IN AGRICULTURE 5, n. 1 (20 ottobre 2015): 585–90. http://dx.doi.org/10.24297/jaa.v5i1.4509.

Testo completo

Abstract (sommario):

This study was conducted to evaluate the susceptibility of grapevine varieties to powdery mildew. Powdery mildew is a disease caused by a fungal, Erysiphenecator, and an obligate parasite of grapevine (Vitisvinifera L.). Powdery mildew causes drastic yield losses of 50 to 70%. Commercial grapevines grown in producing countries are susceptible to powdery mildew. Use of fungicides to control the disease is expensive and not environmentally friendly. Therefore, use of grapevine resistant varieties to powdery mildew is cost-effective control method. In this study, ten varieties (Black rose, Regina, Queen of Vineyards, Alphoncelavallee, Makutupora red, Chancellor, Halilibelyji, Syrah, Ruby seedless and Makutupora white) were screened for resistance to powdery mildew, using artificial inoculation of spore suspension and dry inoculums. Infected grape leaves were sampled from the field and grounded to obtain powder which was used as dry inoculum. The spore suspension inoculum was made by mixing powder with sterilized distilled water. The inoculation was done in two blocks with concentration of 2x105 spore/ml. Disease severity was evaluated based on a scale of 0 5; 0, means immune and 5, high level of disease severity. Results showed significant difference (P<0.05) of disease among grape vine varieties evaluated. It was found that 11.1% were resistant, 33.4% tolerant and 55% susceptible to disease. Grapevine variety Chancellor showed the highest level of resistance, and Black rose the most susceptible. The study demonstrates the effectiveness of using inoculation methods in screening resistance to powdery mildew.

Gli stili APA, Harvard, Vancouver, ISO e altri

25

Fernandez Martinez, R., F. J. Martinez-de-Pison Ascacibar, A. V. Pernia Espinoza e R. Lostado Lorza. "Predictive modelling in grape berry weight during maturation process: comparison of data mining, statistical and artificial intelligence techniques". Spanish Journal of Agricultural Research 9, n. 4 (1 dicembre 2011): 1156. http://dx.doi.org/10.5424/sjar/20110904-531-10.

Testo completo

Gli stili APA, Harvard, Vancouver, ISO e altri

26

Torres-Vila, L. M., J. Stockel, P. Lecharpentier e M. C. Rodríguez-Molina. "Artificial selection in pheromone permeated air increases mating ability of the European grape vine mothLobesia botrana(Lep., Tortricidae)". Journal of Applied Entomology 121, n. 1-5 (12 gennaio 1997): 189–94. http://dx.doi.org/10.1111/j.1439-0418.1997.tb01392.x.

Testo completo

Gli stili APA, Harvard, Vancouver, ISO e altri

27

Nobahar, Shokufeh, Shahla Mirzaeei, leila simaei e Zohreh Ahmadi. "Comparative Study of the Effect of Flavonoids and the Whey Extract on Enamel Microhardness: An In Vitro Study". Avicenna Journal of Dental Research 12, n. 3 (30 settembre 2020): 81–85. http://dx.doi.org/10.34172/ajdr.2020.17.

Testo completo

Abstract (sommario):

Background: Preventing caries or stopping primary caries lesions is one of the most important goals of oral health care. The aim of this study was to compare the effect of flavonoids and the whey extract on tooth enamel by measuring the microhardness of enamel following its demineralization. Methods: In general, 42 samples of healthy enamel were prepared in this experimental-laboratory study. After measuring the initial microhardness using Vickers hardness tester )Buehler, Lake Bluff, IL, USA(, the samples were immersed in the demineralization solution for 4 days and re-tested for microhardness. Then, the samples were randomly divided into three groups of 14 and treated, including the grape seed extract w/v8%, the whey extract, and the artificial saliva. The samples were in contact with the treatment material for 8 days in an incubator at 37°C and then their microhardness was evaluated again. Results: The analysis of covariance showed that there was a significant difference in the amount of microhardness changes between the study groups (P < 0.001) so that microhardness changes were the highest in the grape seed extract group while they decreased in the control group. However, the post hoc test showed no statistically significant difference between the whey extract and grape seed extract groups (P = 1.000). Finally, the control group had a statistically significant difference from the whey extract and grape seed extract groups. Conclusions: Both grape seed extract and whey extract increased remineralization and the microhardness of tooth enamel compared to the control group. Thus, these two substances can be considered as natural and effective substances in the non-invasive treatment of carious lesions.

Gli stili APA, Harvard, Vancouver, ISO e altri

28

Yun, H. K., C. Louime e J. Lu. "First Report of Anthracnose Caused by Elsinoe ampelina on Muscadine Grapes (Vitis rotundifolia) in Northern Florida". Plant Disease 91, n. 7 (luglio 2007): 905. http://dx.doi.org/10.1094/pdis-91-7-0905b.

Testo completo

Abstract (sommario):

Anthracnose of grapes is an economically devastating disease caused by Elsinoe ampelina (2). Warm, humid weather favors disease development, and therefore in the United States, it is generally restricted to grape-growing areas east of the Rocky Mountains. Vitis vinifera is highly susceptible to the disease, which is one of the principal factors preventing the development of an industry with this high-quality grape in the southeastern United States. Growers in this area produce local species-such as muscadine grapes (V. rotundifolia Michx.) and hybrids. Muscadine grapes are known for their resistance or “immunity” to many diseases found in bunch (Euvitis spp. Planch.) grape species (1). As yet, there has been no formal report of anthracnose or its causal agent on muscadine grapes. E. ampelina was detected on muscadine leaves for the first time in the experimental vineyard at the Center for Viticulture and Small Fruit Research during the summer of 2006. Approximately 40% of the 52 muscadine cultivars in the collection showed circular or irregular black spots typical of anthracnose mainly on young leaves and tendrils. However, no symptoms were observed on fruits, shoot tips, or any other plant part. To confirm the causal agent, infected leaves were surface sterilized with 75% ethanol, dipped in 2% sodium hypochlorite for 15 s, rinsed in distilled water, dissected into small 0.5-cm leaf discs, and plated on potato dextrose agar (PDA) and incubated at 28°C. Single-spore isolates were grown on PDA. Colonies were slow growing and appeared as dark red mounds with some mycelia. Conidia were cylindrical and hyaline with pointed ends consistent with previous reports for E. ampelina (2). The identity was also confirmed by using the following PCR primers to the 18S RNA: left primer; TCCGTAGGTGAACCTGCGGA and right primer; TCCTACCTGAT CCGAGGTCA designed on the basis of the alignment of E. ampelina sequences deposited in NCBI database. To fulfill Koch's postulates, symptoms were reproduced by artificial inoculation onto young muscadines (cv. Carlos) and bunch (cv. Cabernet Sauvignon) grapevines. A conidial suspension was prepared from single-conidial cultures, and three experimental vines of each species were sprayed with 0.5 ml of suspension (2 × 105 conidia per ml), whereas three control plants were sprayed with distilled water. The plants were incubated in a moist chamber at 28°C with 16 h of light. The first typical symptoms appeared on V. vinifera 4 days postinoculation and on the muscadines 6 days postinoculation. To our knowledge, this is the first report confirming anthracnose disease on muscadine grapes. References: (1) J. Lu et al. Acta Hortic. 528:479, 2000. (2) R. C. Pearson and A. C. Gohen. Anthracnose. Pages 18–19 in: Compendium of Grape Diseases. The American Phytopathological Society. St. Paul, MN, 1994.

Gli stili APA, Harvard, Vancouver, ISO e altri

29

García-Ruiz, E., V. Marco e I. Pérez-Moreno. "Laboratory rearing and life history of an emerging grape pest, Xylotrechus arvicola (Coleoptera: Cerambycidae)". Bulletin of Entomological Research 102, n. 1 (6 settembre 2011): 89–96. http://dx.doi.org/10.1017/s000748531100040x.

Testo completo

Abstract (sommario):

AbstractSeveral aspects of the biology of Xylotrechus arvicola (Olivier), an emerging grape pest, were studied under laboratory conditions. Four diets were tested to rear this species in the laboratory. Among them, only one made rearing from larva to adult possible. The highest mortality, in all cases, was recorded during the first days of larval development. Larvae were kept 45 days at 8°C to break diapause in order to reduce the normal field larval developmental time. The species' developmental time was similar between sexes, while pupal developmental time and weight were significantly greater for females than for males. As part of a complementary study, life table parameters of females obtained from the larvae reared on the artificial diet were compared to those of females emerged from field-infested grape root wood. Both laid the majority of eggs in the first two weeks after emergence, and they had a similar pre-laying period. Nevertheless, the females from the diet-reared larvae lived significantly longer, laid eggs over a longer period of time and showed higher fertility than those emerging from infested grape root, suggesting that diet fulfils larval nutritional needs. The species’ laboratory-reared population exhibited a low intrinsic growth rate value (rm=0.01) as a result of its long egg-to-adult developmental time and its high larval mortality.

Gli stili APA, Harvard, Vancouver, ISO e altri

30

Moreira, Andréa Nunes, José Vargas de Oliveira, José Eudes de Morais Oliveira, Geisa Mayana Miranda de Souza e Mariana Oliveira Breda. "Injuries caused by frankliniella spp. (thysanoptera: thripidae) on seedless grapes". Ciência e Agrotecnologia 38, n. 4 (agosto 2014): 328–34. http://dx.doi.org/10.1590/s1413-70542014000400002.

Testo completo

Abstract (sommario):

Thrips of the genus Frankliniella cause significant reduction on grape production. Little is known about its decision making approach in integrated pest management and information on thrips injuries to the vine is scarce, hindering the control of this pest. This study aimed to determine the species of thrips and injuries that cause damage to berries in seedless grapes clusters. The trial was conducted in an area cultivated with Vitis vinifera L., variety Thompson Seedless, using a randomized block design with five treatments and four replications. The treatments consisted of artificial infestation (zero, two, four and eight thrips per inflorescence), and treatment determined by the monitoring system of the grower. Each replication consisted of three plants with 10 inflorescences, which were artificially infested with thrips and covered with nonwoven fabric bags. During the cluster thinning, pre-harvest cleaning and harvest, the numbers of injuried berries and the berries with injuries were evaluated. The thrips species identified were: Frankliniella schultzei (Trybom), Frankliniella brevicaulis Hood, Frankliniella gemina Bagnall, Frankliniella gardeniae Moulton, and Frankliniella sp. A positive and significant correlation was observed between the number of injuries per fruit and the level of thrips infestation, obtained by the equation y = 2.55 + 48.54x (F= 59.98; P= 0.0001; r²= 0.51). The results suggest that the presence of a whitish halo around a small scar on fruit is associated with the presence of adult Frankliniella spp.

Gli stili APA, Harvard, Vancouver, ISO e altri

31

Summerson, Vasiliki, Claudia Gonzalez Viejo, Damir D. Torrico, Alexis Pang e Sigfredo Fuentes. "Detection of smoke-derived compounds from bushfires in Cabernet-Sauvignon grapes, must, and wine using Near-Infrared spectroscopy and machine learning algorithms". OENO One 54, n. 4 (27 novembre 2020): 1105–19. http://dx.doi.org/10.20870/oeno-one.2020.54.4.4501.

Testo completo

Abstract (sommario):

The number and intensity of wildfires are increasing worldwide, thereby raising the risk of smoke contamination of grapevine berries and the development of smoke taint in wine. This study aimed to develop five artificial neural network (ANN) models from berry, must, and wine samples obtained from grapevines exposed to different levels of smoke: (i) Control (C), i.e., no misting or smoke exposure; (ii) Control with misting (CM), i.e., in-canopy misting, but no smoke exposure; (iii) low-density smoke treatment (LS); (iv) high-density smoke treatment (HS) and (v) a high-density smoke treatment with misting (HSM). Models 1, 2, and 3 were developed using the absorbance values of near-infrared (NIR) berry spectra taken one day after smoke exposure to predict levels of 10 volatile phenols (VP) and 18 glycoconjugates in grapes at either one day after smoke exposure (Model 1: R = 0.98; R2 = 0.97; b = 1) or at harvest (Model 2: R = 0.98; R2 = 0.97; b = 0.97), as well as six VP and 17 glycoconjugates in the final wine (Model 3: R = 0.98; R2 = 0.95; b = 0.99). Models 4 and 5 were developed to predict the levels of six VP and 17 glycoconjugates in wine. Model 4 used must NIR absorbance spectra as inputs (R = 0.99; R2 = 0.99; b = 1.00), while Model 5 used wine NIR absorbance spectra (R = 0.99; R2 = 0.97; b = 0.97). All five models displayed high accuracies and could be used by grape growers and winemakers to non-destructively assess at near real-time the levels of smoke-related compounds in grapes and/or wine in order to make timely decisions about grape harvest and smoke taint mitigation techniques in the winemaking process.

Gli stili APA, Harvard, Vancouver, ISO e altri

32

Zhao, Wei, Qian Xie, Ana Karina Bedran-Russo, Shuang Pan, Junqi Ling e Christine D. Wu. "The preventive effect of grape seed extract on artificial enamel caries progression in a microbial biofilm-induced caries model". Journal of Dentistry 42, n. 8 (agosto 2014): 1010–18. http://dx.doi.org/10.1016/j.jdent.2014.05.006.

Testo completo

Gli stili APA, Harvard, Vancouver, ISO e altri

33

Janik, L. J., D. Cozzolino, R. Dambergs, W. Cynkar e M. Gishen. "The prediction of total anthocyanin concentration in red-grape homogenates using visible-near-infrared spectroscopy and artificial neural networks". Analytica Chimica Acta 594, n. 1 (giugno 2007): 107–18. http://dx.doi.org/10.1016/j.aca.2007.05.019.

Testo completo

Gli stili APA, Harvard, Vancouver, ISO e altri

34

Wen, Li, Feng, Du, Ren, Zhang, Ma, Li, Wang e Hu. "Grape Seed Procyanidin Extract (GSPE) Improves Goat Sperm Quality When Preserved at 4 °C". Animals 9, n. 10 (15 ottobre 2019): 810. http://dx.doi.org/10.3390/ani9100810.

Testo completo

Abstract (sommario):

Grape seed procyanidin extract (GSPE) has been shown to possess antioxidative effects. This experiment was designed to study the effect of GSPE during the liquid storage of goat semen. Semen samples were collected from six sexually mature goats. The samples were treated with different concentrations of GSPE (10, 30, 50, and 70 mg/L) in basic diluent and stored at 4 °C for 120 h; samples without GSPE were used as the control group. The results showed that sperm motility, acrosome membrane integrity, mitochondrial activity, plasma membrane integrity, total antioxidative capacity (T-AOC), catalase (CAT) activity, and superoxide dismutase (SOD) activity in the treatment groups were significantly higher than in the control group, whereas malondialdehyde (MDA) content was lower than in the control group (p < 0.05). In the treatment group, sperm quality in the 30 mg/L GSPE group was significantly higher than the other groups (p < 0.05). Furthermore, artificial insemination (AI) results showed that litter sizes were higher in the 30 mg/L GSPE group than in the control group (p < 0.05). In summary, this experiment showed that adding GSPE to the basic diluent improved sperm quality and that 30 mg/L of GSPE was the most suitable concentration for the liquid preservation of goat semen at 4 °C.

Gli stili APA, Harvard, Vancouver, ISO e altri

35

Arora, Arinder K., Noah Clark, Karen S. Wentworth, Stephen Hesler, Marc Fuchs, Greg Loeb e Angela E. Douglas. "Evaluation of RNA Interference for Control of the Grape Mealybug Pseudococcus maritimus (Hemiptera: Pseudococcidae)". Insects 11, n. 11 (28 ottobre 2020): 739. http://dx.doi.org/10.3390/insects11110739.

Testo completo

Abstract (sommario):

The grape mealybug Pseudococcus maritimus (Ehrhorn, 1900) (Hemiptera: Pseudococcidae) is a significant pest of grapevines (Vitis spp.) and a vector of disease-causing grape viruses, linked to its feeding on phloem sap. The management of this pest is constrained by the lack of naturally occurring resistance traits in Vitis. Here, we obtained proof of concept that RNA interference (RNAi) using double-stranded RNA (dsRNA) molecules against essential genes for phloem sap feeding can depress insect survival. The genes of interest code for an aquaporin (AQP) and a sucrase (SUC) that are required for osmoregulation in related phloem sap-feeding hemipteran insects (aphids and whiteflies). In parallel, we investigated the grape mealybug genes coding non-specific nucleases (NUC), which reduce RNAi efficacy by degrading administered dsRNA. Homologs of AQP and SUC with experimentally validated function in aphids, together with NUC, were identified in the published transcriptome of the citrus mealybug Planococcus citri by phylogenetic analysis, and sequences of the candidate genes were obtained for Ps. maritimus by PCR with degenerate primers. Using this first sequence information for Ps. maritimus, dsRNA was prepared and administered to the insects via an artificial diet. The treatment comprising dsRNA against AQP, SUC and NUC significantly increased insect mortality over three days, relative to dsRNA-free controls. The dsRNA constructs for AQP and NUC were predicted, from sequence analysis to have some activity against other mealybugs, but none of the three dsRNA constructs have predicted activity against aphids. This study provides the basis to develop in planta RNAi strategies against Ps. maritimus and other mealybug pests of grapevines.

Gli stili APA, Harvard, Vancouver, ISO e altri

36

Maher, N., e D. Thiéry. "A bioassay to evaluate the activity of chemical stimuli from grape berries on the oviposition of Lobesia botrana (Lepidoptera: Tortricidae)". Bulletin of Entomological Research 94, n. 1 (febbraio 2004): 27–33. http://dx.doi.org/10.1079/ber2003276.

Testo completo

Abstract (sommario):

AbstractA two-choice bioassay was developed to evaluate the role of host-plant berry compounds on the oviposition site acceptance of the generalist moth Lobesia botrana (Denis & Shiffermüller). A key feature was the lining of the bioassay arena with felt which focused oviposition on the test substrates. Initial experiments comparing substrates with different physical features indicated that smooth textures and spherical shapes with interstices favour oviposition. Artificial oviposition substrates were thus constructed with glass spheres in order to test the behavioural activity of grapevine berry extracts. Only polar extracts obtained by soaking berries in methanol or water stimulated oviposition (more eggs were laid on the extract-treated substrate than on the control substrate), whereas more apolar ones obtained with chloroform or hexane had no significant effect. The prior removal of epicuticular waxes from grape berries before extraction did not enhance the stimulatory activity of the methanol extract. The oviposition response to this extract was dose-dependent. It is concluded that polar compounds present on grape berries act as oviposition stimulants for L. botrana.

Gli stili APA, Harvard, Vancouver, ISO e altri

37

Anikina, N. S., N. V. Gnilomedova, S. N. Cherviak, A. V. Vesiutova e M. V. Ermihina. "Rapid test for detecting artificial colorants in wine products". Аналитика и контроль 25, n. 2 (2021): 126–33. http://dx.doi.org/10.15826/analitika.2021.25.2.001.

Testo completo

Abstract (sommario):

The problem of wine color adulteration is relevant all over the world, and, therefore, establishing or refuting the fact of the colorant presence is an integral part of the techno-chemical control. There are many methods for determining artificial colorants (AC) in the alcoholic beverages with various levels of sensitivity and selectivity of detection as well as the promptness in generating the results and the cost of studying one sample. Current work is devoted to the development of a rapid test for detecting the artificial colorants in wines. It is based on the method of the International Organization of Vine and Wine, the principle of which is to fixate the acidic artificial colorants on a specially prepared woolen thread when boiling the sample of wine. The modification of analytical procedure included the reduction of the test sample aliquot, the number of operations and the examination time without compromising the reliability of the conclusion. In order to imitate the color of red wines, Azorubine (E122), Allura Red AC (E129) and Indigo Carmine (E132) food colorants were used. The objects of the research were: model systems based on wine, white and red wines, counterfeit wines provided by the controlling authorities, and concentrated grape must. It was shown that in the genuine wines, depending on the color saturation of the test sample caused by natural anthocyanins, the woolen thread was discoloring from light to dark beige; its color was enhancing from pale pink to deep ruby with the increase in the content of AC in wine. The sensitivity of the proposed method made it possible to determine the presence of AC at the rate of 0.1-0.2 mg/dm3 in wines. The method did not require expensive equipment and could be used in the laboratories of winemaking industry or by the controlling authorities for establishing the fact of adulteration of alcoholic and juice products.

Gli stili APA, Harvard, Vancouver, ISO e altri

38

Ebbenga, Dominique N., Eric C. Burkness e William D. Hutchison. "Evaluation of Exclusion Netting for Spotted-Wing Drosophila (Diptera: Drosophilidae) Management in Minnesota Wine Grapes". Journal of Economic Entomology 112, n. 5 (30 maggio 2019): 2287–94. http://dx.doi.org/10.1093/jee/toz143.

Testo completo

Abstract (sommario):

Abstract Spotted-wing drosophila, Drosophila suzukii (Matsumura), an economically damaging invasive species of numerous fruit crops, was first detected in Minnesota in 2012. High fecundity, and short generation times facilitated a rapid rise in the global pest status of D. suzukii, particularly in North America and Europe. To date, the majority of crop injury research has focused on fruit crops such as blueberries, raspberries, and cherries. However, little is known regarding the impact of D. suzukii on the wine grape industry in the upper Midwest region of the United States. Field trials were conducted in Minnesota during the summers of 2017–2018 to examine season-long phenology of D. suzukii in wine grape vineyards and wineries, and to assess the efficacy of exclusion netting for control of D. suzukii. Four treatments were evaluated, 1) open plot check (control), 2) open plot treated with an insecticide, 3) exclusion netting, and 4) exclusion netting, with artificial infestations of D. suzukii adults. Exclusion netting was applied at véraison and removed at harvest. On each sample date, 20 berries (10 intact and 10 injured) were collected from each plot for dissection. The number of larvae and adults were recorded for each berry to determine infestation levels. As shown by mean larval infestations and injured berries across treatments, exclusion netting provided a significant reduction in the level of D. suzukii infested berries when compared with the untreated check. These results indicate that exclusion netting could provide an effective alternative management strategy for D. suzukii in wine grapes.

Gli stili APA, Harvard, Vancouver, ISO e altri

39

Han, Kyung-Hwa, Muhammad Ibrahim, Yong-Seon Zhang, Kang-Ho Jung, Hee-Rae Cho, Seung-Oh Hur e Yeon-Kyu Sonn. "Physico-chemical Properties of Disturbed Plastic Film House Soils under Cucumber and Grape Cultivation as Affected by Artificial Accumulation History". Korean Journal of Soil Science and Fertilizer 48, n. 2 (30 aprile 2015): 105–18. http://dx.doi.org/10.7745/kjssf.2015.48.2.105.

Testo completo

Gli stili APA, Harvard, Vancouver, ISO e altri

40

Farias, Maria Mercês Aquino Gouveia, Magatha Marquetti Lazzaris de Oliveira, Beatriz Helena Eger Schmitt, Eliane Garcia da Silveira e Silvana Marchiori de Araújo. "Erosive potential of sugar-free hard candies dissolved in water and artificial saliva". Brazilian Journal of Oral Sciences 15, n. 1 (13 ottobre 2016): 75. http://dx.doi.org/10.20396/bjos.v15i1.8647129.

Testo completo

Abstract (sommario):

Aim: To compare the acidity of sugar-free hard candies dissolved in water and artificial saliva. Methods: Sugar-free Flopi Florestal hard candies (grape, strawberry, cherry, orange, ginger, lemon balm, fennel) were selected and grouped in 2 groups: G-1 (candies dissolved in distilled water) and G-2 (candies dissolved in artificial saliva). Candies were triturated with a porcelain pestle, yielding two samples of 20 g. Samples were dissolved in 120 mL distilled water (G-1) and 120 mL artificial saliva (20 mM NaHCO3, 3 mM NaH2PO4.H2O and 1 mM CaCl2.2H2O) (G-2), obtaining three samples of 30 mL for each of the flavors and groups. pH was measured using potentiometer and combined glass electrode. Titratable acidity was evaluated by adding 100 μL 1M NaOH aliquots until reaching pH 5.5. For statistical analysis, analysis of variance (ANOVA) was used. Means were compared by the Tukey test at 5% significance level (p<0.05) Results: All flavors of G-1 showed pH values below 5.5. Comparison of groups in the same flavor showed a significant increase in pH in flavors of G-2. Comparison of the titratable acidity between G-1 and G-2, showed that fruit flavors were significantly different from each other, with reduced acidity in G-2. Conclusions: All evaluated candies are acid, and dilution in artificial saliva raised their pH and lowered their titratable acidity, reducing their erosive potential.

Gli stili APA, Harvard, Vancouver, ISO e altri

41

OLIVEIRA, Ana Luísa Botta Martins de, Camila Cruz LORENZETTI, Patrícia Petromilli Nordi Sasso GARCIA e Elisa Maria Aparecida GIRO. "Effect of finishing and polishing on color stability of a nanofilled resin immersed in different media". Revista de Odontologia da UNESP 43, n. 5 (ottobre 2014): 338–42. http://dx.doi.org/10.1590/rou.2014.054.

Testo completo

Abstract (sommario):

OBJECTIVE: The purpose of this study was to evaluate the effect of finishing and polishing on color stability of a nanofilled composite resin (Filtek Z350 XT) according to different immersion media.MATERIAL AND METHOD: Composite disks (10 mm diameter, 2 mm thickness) were prepared for each group (n = 6) using a stainless steel mold. The groups were divided according to the presence or absence of finishing and polishing procedure and immersion media (artificial saliva, artificial juice- KAPO(r) Coca-Cola(r)flavors: pineapple, orange, strawberry and grape). The finishing and polishing procedures were performed using Super -Snap(r) disks. The specimens were stored in artificial saliva for 24 hours (baseline) and were analyzed using a color spectrophotometer by CIELab system. Then, they were immersed in different media for 5 minutes, 3 times a day, every 4 hours during 60 days. They were stored in artificial saliva at 37 ± 1°C during the immersion intervals. After this time, new measure of color was performed. The data were analyzed using Kruskall-Wallis test and Mann- Whitney test. The significance level was 5%.RESULT: The results showed that the finishing/polishing not significantly influence the color stability of resin composite (p > 0.05). There was no statistically significant difference in the color stability of the studied resin after immersion in different media (p > 0.05).CONCLUSION: The finishing and polishing procedures and the immersion media did not have influence on color stability of nanofilled resin Filtek Z350 XT.

Gli stili APA, Harvard, Vancouver, ISO e altri

42

Honma, Hideharu, Maiko Shishido e Satoshi Taira. "Effects of Timing and Frequency of Artificial Pollination on Fruit Set and Berry Quality in Japanese Wild Grape Vitis coignetiae Pulliat". Horticultural Research (Japan) 6, n. 2 (2007): 229–32. http://dx.doi.org/10.2503/hrj.6.229.

Testo completo

Gli stili APA, Harvard, Vancouver, ISO e altri

43

Farzaneh, Vahid, Alireza Ghodsvali, Hamid Bakhshabadi, Zahra Dolatabadi, Farahnaz Farzaneh, Isabel S. Carvalho e Khashayar Sarabandi. "Screening of the alterations in qualitative characteristics of grape under the impacts of storage and harvest times using artificial neural network". Evolving Systems 9, n. 1 (27 novembre 2017): 81–89. http://dx.doi.org/10.1007/s12530-017-9212-x.

Testo completo

Gli stili APA, Harvard, Vancouver, ISO e altri

44

Summerson, Vasiliki, Claudia Gonzalez Viejo, Colleen Szeto, Kerry L. Wilkinson, Damir D. Torrico, Alexis Pang, Roberta De Bei e Sigfredo Fuentes. "Classification of Smoke Contaminated Cabernet Sauvignon Berries and Leaves Based on Chemical Fingerprinting and Machine Learning Algorithms". Sensors 20, n. 18 (7 settembre 2020): 5099. http://dx.doi.org/10.3390/s20185099.

Testo completo

Abstract (sommario):

Wildfires are an increasing problem worldwide, with their number and intensity predicted to rise due to climate change. When fires occur close to vineyards, this can result in grapevine smoke contamination and, subsequently, the development of smoke taint in wine. Currently, there are no in-field detection systems that growers can use to assess whether their grapevines have been contaminated by smoke. This study evaluated the use of near-infrared (NIR) spectroscopy as a chemical fingerprinting tool, coupled with machine learning, to create a rapid, non-destructive in-field detection system for assessing grapevine smoke contamination. Two artificial neural network models were developed using grapevine leaf spectra (Model 1) and grape spectra (Model 2) as inputs, and smoke treatments as targets. Both models displayed high overall accuracies in classifying the spectral readings according to the smoking treatments (Model 1: 98.00%; Model 2: 97.40%). Ultraviolet to visible spectroscopy was also used to assess the physiological performance and senescence of leaves, and the degree of ripening and anthocyanin content of grapes. The results showed that chemical fingerprinting and machine learning might offer a rapid, in-field detection system for grapevine smoke contamination that will enable growers to make timely decisions following a bushfire event, e.g., avoiding harvest of heavily contaminated grapes for winemaking or assisting with a sample collection of grapes for chemical analysis of smoke taint markers.

Gli stili APA, Harvard, Vancouver, ISO e altri

45

Kondratieva, N. P., R. I. Korepanov, I. R. Ilyasov, R. G. Bolshin, M. G. Krasnolutskaya, Ye N. Somova e M. G. Markova. "The Efficiency of Automated Control Microprocessor Systems for LED Irradiation Installations". Agricultural Machinery and Technologies 12, n. 3 (26 luglio 2018): 32–37. http://dx.doi.org/10.22314/2073-7599-2018-12-3-32-37.

Testo completo

Abstract (sommario):

Crop productivity is significantly affected by the dose of optical radiation. In particular, southern crops do not have enough time to ripen in a temperate climate because of decreased daylight duration. In conditions of protected soil due to low irradiance and a short daylight duration in autumn-winter months, the cultivation of fully developed plants is possible only with the use of artificial radiation sources. The use of LED phytoinstallations with the help of microprocessorbased automatic control systems allows obtaining the required dose of optical radiation.(Purpose of research)To substantiate, as exemplified by meristematic grape plants, the effectiveness of LED phytoinstallations and their impact on the increase in the leaf surface area; to develop multicolored LED phytoinstallations; to offer new technical solutions to improve the efficiency of the microprocessor system of automatic control of LED phytoinstallations.(Materials and methods)the authors have carried out experiments with meristematic grape plants of RF48 variety (in vitro) at the stages of their rooting and adaptation. The following equipment has been used: LED phytoirradiator with a changing spectrum using a microprocessor control system, “blinking” led phytoirradiator, multicolored phytoiradiator with the addition of UV LEDs. The authors have developed on the basis of microcontroller Arduino uno a microprocessor dispensing system of the spectral components of the areas of the photosynthetically active radiation to automatically control the operation of LEDbased phytoinstallations.(Results and discussion)it has been shown that a LED irradiator with a changing spectral composition, as compared to a luminescent irradiator, at the stage of rooting of grape microsprouts contributes to a significant increase in the leaf surface area of microplants at 100 percent rooting of sprouts. The blinking phytoirradiator and the UVLED phytoirradiator, as compared to the fluorescent ones, contributed to an insignificant increase in leaf area of plants at the adaptation stage of grape microplants.(Conclusions)The authors have confirmed the need to further improve the efficiency of the microprocessorbased automatic control system of LED irradiation installations.

Gli stili APA, Harvard, Vancouver, ISO e altri

46

Thompson, Richard D., e John T. Quaife. "Liquid Chromatographic Determination of Methyl Anthranilate in Artificially Flavored Nonalcoholic Beverages". Journal of AOAC INTERNATIONAL 84, n. 2 (1 marzo 2001): 493–97. http://dx.doi.org/10.1093/jaoac/84.2.493.

Testo completo

Abstract (sommario):

Abstract A liquid chromatographic method was developed that provides a simple and rapid means of determining methyl anthranilate (MA) in carbonated and noncarbonated, artificial grape-flavored, nonalcoholic beverages. The proposed procedure, which was applied to 12 different products, uses a Nova-Pak C18 column, a mobile phase containing acetonitrile–0.025M KH2PO4 (40 + 60), pH 3.00, and UV detection at 220 nm. Assay values ranged from 0.35 to 16.6 Μg MA/mL. The intralaboratory precision (relative standard deviation) for the products ranged from 0.51 to 2.23% (n = 5), and recoveries via fortification ranged from 83.6 to 102.4%. The limits of quantitation and detection were 0.00417 and 0.00125 μg/mL, respectively, and the analyte response was linear over a 100-fold concentration range (0.0001–0.01 mg/mL).

Gli stili APA, Harvard, Vancouver, ISO e altri

47

Salmon, Jean-Michel, Nathalie Mailhac, François-Xavier Sauvage, Marie-José Biron e Jean-Pierre Robin. "Reinforcement of the radiative and thermic stresses of the grape vine. Repercussions on yeast surface microflora". OENO One 31, n. 4 (31 dicembre 1997): 185. http://dx.doi.org/10.20870/oeno-one.1997.31.4.1078.

Testo completo

Abstract (sommario):

All along the ripening period, the radiative and thermic stresses of the grapevine may be reinforced by the use of a reflective soil cover (aluminized film). Such a treatment leads to repercussions on the berries, on the must composition and finally on the wine quality. During such a preliminary experiment, we demonstrated that the temperature increase and/or the reinforcement of the reflected ultraviolet radiations (measured at 254 nm) at the level of grape berries severely impaired the development of yeast cells at their surfaces. By means of an artificial inoculation of grapes at the beginning of the ripening period with a mixture of four different yeast genera (Saccharomyces cerevisiae, Hanseniaspora uvarum, Pichiafermentans and Schizosaccharomyces pombe), we demonstrated that the repartition of yeast genera amongst this population was affected by the treatment of stocks with the aluminized film: during the experiment presented in this paper, the Saccharomyces genus was favoured. One may consider by extension similar effects resulting from the reflective properties of some natural soils. Such effects may considerably influence the distribution of wild yeast flora during the spontaneous fermentation of musts. If such an hypothesis is confirmed at a local or regional level, it will represent a first significant piece of the definition of one of the aspects of the" terroir" effect on the characteristics of wines.

Gli stili APA, Harvard, Vancouver, ISO e altri

48

Haleem, Raed A., Samir K. Abdullah e Jaladet M. S. Jubrael. "Identification and pathogenicity of Botryosphaeria parva associated with grapevine decline in Kurdistan region - Iraq". Acta Agrobotanica 65, n. 1 (2012): 71–78. http://dx.doi.org/10.5586/aa.2012.045.

Testo completo

Abstract (sommario):

During a survey on fungi associated with decline symptoms on grapevine cultivars growing in Kurdistan region of Iraq, several isolates of Botryosphaeria species were encountered. All isolates were identified as Botryosphaeria parva Pennycook and Samuels. Pathogenicity test for isolate DKI 1 was performed on two cultivars, Taefi and Rashmew. Under greenhouse conditions, one-year grape rooted cuttings were inoculated with the pathogen isolate by two methods, injecting the spore suspension into the green shoots and by artificial inoculation of wounded shoots with mycelial mat. The highest canker length (15.0 mm) was produced after four months on the shoots of the Taife cultivar artificially inoculated with mycelial mat of the pathogen. Under field conditions, two methods of inoculation were adopted, wounding the green shoots and drilling a hole in the arms of mature vine, followed by inoculation with mycelial mat. The highest canker length (11.17 mm) was obtained after 5 months on wounded shoots of the Rashmew cultivar and with a significant difference from the Taefi cultivar. The pathogen caused a reduction in fresh and dry weight of green shoots and roots compared with the non-inoculated control. This is the first report on B. parva in Iraq.

Gli stili APA, Harvard, Vancouver, ISO e altri

49

Wang, M. N., e X. M. Chen. "First Report of Oregon Grape (Mahonia aquifolium) as an Alternate Host for the Wheat Stripe Rust Pathogen (Puccinia striiformis f. sp. tritici) Under Artificial Inoculation". Plant Disease 97, n. 6 (giugno 2013): 839. http://dx.doi.org/10.1094/pdis-09-12-0864-pdn.

Testo completo

Abstract (sommario):

As the primary host of the stripe rust pathogen, Puccinia striiformis f. sp. tritici (Pst), wheat can be infected by both aeciospores and urediniospores, and later is the host that gives rise to urediniospores and teliospores. Barberry species (e.g., Berberis vulgaris) can be infected by basidiospores, produced from the teliospores of wheat plants, and later gives rise to pycniospores and aeciospores, which has been demonstrated through artificial inoculation (3). Oregon grape (Mahonia aquifolium), closely related to Berberis, is a native evergreen shrub that is also grown as an ornamental plant in the Pacific Northwest. To determine if M. aquifolium can also serve as an alternate host for Pst, we conducted artificial inoculations under controlled conditions. Seeds of M. aquifolium collected from Pullman, WA, were sown in pots filled with soil mixture, and plants were grown in a greenhouse under wheat-growing conditions (1). In the first experiment, conducted in May to June 2011, the inoculum was telia collected from artificially inoculated wheat cv. Avocet S with urediniospores of isolate 09-134 (race PST-127) from the greenhouse. In the second experiment, conducted in July to August 2011, the inoculum was telia collected from naturally infected wheat cv. Nugaines with urediniospores from isolate 11-292 (race PST-127) from an experimental field near Pullman. For each experiment, mature teliospores of 60 telia from a single wheat plant were suspended in 1.0 ml of distilled water and inoculated with a fine paint brush onto the leaves of seven or eight 10- to 15-day-old plants of M. aquifolium. Plants were incubated initially in a dew chamber at 10°C for 72 h in darkness, then transferred to a growth chamber with a diurnal temperature cycle of 10 to 24°C and a 16 h light/8 h dark cycle (1). Reddish pycnia with nectar appeared on adaxial surfaces of inoculated leaves at 12 days post-inoculation (DPI), and reddish aecia were produced on the baxial surface at 16 DPI. All 15 M. aquifolium leaves of the 15 plants inoculated with teliospores produced pycnia and aecia. Seedlings of Nugaines and Avocet S, wheat cultivars that are susceptible to all Pst races (1), were then inoculated with a water suspension of aeciospores of 30 aecia collected from the M. aquifolium plants. Wheat plants were incubated as described above for M. aquifolium. Uredinia appeared at 15 DPI, and telia were produced after an additional 15 days. From these uredinia that formed on inoculated wheat, a total of 30 single-uredinium isolates were obtained using the standard procedure (1). Virulence tests were carried out on 20 wheat differentials for 10 randomly selected urediniospore isolates, revealing six virulence patterns. When tested with four selected Pst SSR markers (PstP001, PstP003, PstP005, PstP029) (2) and compared to other race PST-127 isolates, all 10 progeny isolates were homozygous, as were the parental isolates (09-134, 11-292). The virulence tests and marker genotypes verified that the urediniospore isolates resulted from infection by aecia, produced by parental isolate 09-134 through its sexual cycle on M. aquifolium. The study exhibited the completed sexual lifecycle of Pst through the five spore stages on wheat and M. aquifolium in a controlled setting, and suggests that under appropriate weather conditions, M. aquifolium may serve as an alternate host for Pst. Due to the wide distribution of M. aquifolium, further studies are needed to determine if the species can be infected by Pst under natural conditions. References: (1) X. M. Chen et al. Can. J. Plant Pathol. 32:315, 2010. (2) P. Cheng et al. Mol. Ecol. Resour. 12:779, 2012. (3) Y. Jin et al. Phytopathology 100:432, 2010.

Gli stili APA, Harvard, Vancouver, ISO e altri

50

Nair, NG. "Fungi associated with bunch rot of grapes in the Hunter Valley". Australian Journal of Agricultural Research 36, n. 3 (1985): 435. http://dx.doi.org/10.1071/ar9850435.

Testo completo

Abstract (sommario):

Botrytis cinerea was isolated from apparently healthy and surface-sterilized grape Vitis vinifera L. flowers and berries. It appears that style and stigma could be the major sites of infection in Shiraz cultivar. Fungicide (benomyl) spray at bud burst and at 75% flowering lowered the incidence of B. cinerea latent infection of flowers. It is pointed out that latent infection of flowers can, under favourable conditions, lead to the development of relatively high level of inoculum and consequently high risk of berry rot. The demonstration of latent infection by B. cinerea could have important implications in the development of a management system for bunch rot control in the Hunter Valley. B. cinerea, Alternaria alternata, Rhizopus sp., Gonatobotrys simplex, Aspergillus niger, Cladosporium cladosporioides, Fusarium sporotrichioides, Epicoccum nigrum and Bipolaris bicolor were isolated frequently from flowers and berries. There appears to be diversity in the fungal flora associated with flowers and berries in Shiraz. Artificial inoculation of mature berries with A. alternata, Rhizopus sp. and A. niger resulted in some degree of rotting. It appears, therefore, that these fungi associated with berries may play a part in the development of berry rot.

Gli stili APA, Harvard, Vancouver, ISO e altri

Articoli di riviste sul tema "Artificial grape"

Cita una fonte nei formati APA, MLA, Chicago, Harvard e in molti altri stili