Articles de revues : « Sponsi »

1

Matter, E. Ann. « Eulogium sponsi de sponsa : Canons, Monks, and the Song of Songs ». Thomist : A Speculative Quarterly Review 49, n^o 4 (1985) : 551–74. http://dx.doi.org/10.1353/tho.1985.0003.

Texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

2

de Wet, Chris L. « “Illius sponsi thalamus fuit uterus virginis” ». Religion and Theology 27, n^o 3-4 (8 décembre 2020) : 299–328. http://dx.doi.org/10.1163/15743012-02703007.

Texte intégral

Résumé :

Abstract This article examines the image of Mary’s womb as the bridal chamber in which the Word and the flesh, the divine and the human natures of Christ, are united. The image presents the reader with a paradox – the Word and the flesh engage in a divine unification and comingling in the womb of the virgin. The study traces the development of the image in the earlier works of Augustine, and contextualises it within Augustine’s later thought, in which the body and sexuality are considered in a more positive light. The study aims to demonstrate that Augustine’s structuring of incarnational theology served as a framework for his views on sexuality – prelapsarian, postlapsarian, and eschatological sexuality – and the discourse of the incarnation, especially in his later thought, should be seen primarily as a discourse of sexuality.

Styles APA, Harvard, Vancouver, ISO, etc.

3

Traill, David A. « CAREFREE IN CORFU ? HORACE, EPISTLES 1.2.31 ». Classical Quarterly 67, n^o 1 (13 mars 2017) : 314–17. http://dx.doi.org/10.1017/s0009838817000052.

Texte intégral

Résumé :

nos numerus sumus et frugis consumere nati,sponsi Penelopae nebulones Alcinoiquein cute curanda plus aequo operata iuuentus,cui pulchrum fuit in medios dormire dies et 30ad strepitum citharae cessatum ducere curam.ut iugulent hominem, surgunt de nocte latrones:ut te ipsum serues, non expergisceris?We are ciphers, born to eat bread, the worthless suitors of Penelope and the young men of Alcinous’ court, all too concerned with keeping their skin attractive, who thought it a fine thing to sleep till midday and * * * To murder a man, thieves get up at night; to save yourself, won't you wake up?

Styles APA, Harvard, Vancouver, ISO, etc.

4

Eidinow, J. S. C. « A Note on Horace, Epistles 1.2.26 and 2.2.75 ». Classical Quarterly 40, n^o 2 (décembre 1990) : 566–68. http://dx.doi.org/10.1017/s0009838800043226.

Texte intégral

Résumé :

Scholars have long seen that Horace's treatment of Homer in this Epistle demands to be read in the tradition of moral allegory in which Ulysses becomes the type of the ‘man of virtue’ (‘rursus quid virtus et quid sapientia possit / utile proposuit nobis exemplar Ulixen’, 17–18): on such a reading, Circe becomes an allegory of foolish passion ‘to which Ulysses’ companions give in through their stultitia, and because of which they lose their reason and become no better than animals. Antisthenes, from whose writings such an allegorising approach probably developed, was regarded as an early Cynic, and the idea became the special province of Cynic-Stoic philosophy; scholars have therefore felt justified in seeing this epistle as a criticism of Epicureanism, represented by the sponsi Penelopae, nebulones, Alcinoique … iuventus, from the point of view of a Cynic or a syncretistic Stoic.

Styles APA, Harvard, Vancouver, ISO, etc.

5

Tejero, Eloy. « La sacramentalidad del matrimonio en la historia del pensamiento cristiano ». Ius Canonicum 14, n^o 27 (27 mars 2018) : 11–33. http://dx.doi.org/10.15581/016.14.21342.

Texte intégral

Résumé :

Adversus ulteriorem sacramentorum theologiam, quae sacramenti matrimonii considerationem firmare in e,fficatia intendet, SS. Patres admirabili copia symbolorum declarant matrimonii intimam societatem cum divino proposito salvandi. Ex hac perspectiva matrimonium simul est et mysterium et signum. Ab inicio Deus matrimonium secundum archetypum, quod Prius in intimitate sua custoditum posterius revelatum fuit, ordinavit. Ita mysterium matrimoniale originaliter convertitur in signo magni mysterii Christi sponsi Ecclesiae, simul ac Revelatio divina explicitatur et in Christo cons4/llmatur. Permansio matrimonii per diversas oeconomias salutis -quamvis ordo matrimonialis etiam patiatur diversos status quibus .homo possit inveniri- secum fert quod symbolismum matrimonii ut prophetia, vel typus, vel praefiguratio aut rememoratio magni mysterii Christi prospectum sit. Unitas qua SS. Patres duo contemplantur Testamenta explicat quod symbolismum sacramentorum proicietur per oeconomias salvlficas et quod in matrimonio assurgatur iam ab initio, etenim duobus primis hominibus iam fuit matrimonium, non yero cetera sacramenta. luxta character symbolicum, in doctrina Patrum eminet etiam alius aspectus sacramenti, qui incidit etiam in matrimonium. Significatio sacramenti romani obligationem ante divinitatem implicabat. Permansio huius significationis scriptis christianis, transformatae yero novitate christianismi, nullam post philologica studia thematis dubitationem. of,fert. In hoc sensu inspiciendum est quomodo fontes illius aetatis insistant in relatione matrimoniali configurata mysterio Christi. Matrimonium non est ductilis ad simplex pactum inter partes: custoditur in Christo et in Ecclesia. Ita apparet claraconvenientia inter symbolismum matrimonial e et naturam vinculi unionis sponsatorum.

Styles APA, Harvard, Vancouver, ISO, etc.

6

Sumilat, Deiske A. « Antibacterial Screening Activity of Several Sponges Against Staphylococcus aureus, Escherichia coli, Staphylococcus saprophyticus, dan Pseudomonas aeruginosa ». JURNAL ILMIAH PLATAX 7, n^o 2 (23 octobre 2019) : 455. http://dx.doi.org/10.35800/jip.7.2.2019.26026.

Texte intégral

Résumé :

Sponge samples collected around Manado waters were obtained 30 species and their crude extracted have been tested in vitro for their activity in inhibiting bacterial growth. Based on the results of antibacterial screening in 30 sponge extracts, there were 23 sponge extracts which had bioactivity in inhibiting the growth of S. aureus, E. coli, S. saprophyticus and P. aeruginosa, Sponge extract No. 43 (of 30 sponge extracts tested) was the most active in inhibiting bacterial growth and had the widest inhibition zone diameter.Keywords: screening, sponge, crude extract, antibacterial, ManadoABSTRAKSampel spons dikoleksi di sekitar Perairan Manado sebanyak 30 jenis/spesies, dimana ekstrak kasarnya telah diuji secara in vitro aktivitasnya dalam menghambat pertumbuhan bakteri. Berdasarkan hasil skrining antibakteri pada 30 ekstrak spons didapatkan hasil ada 23 ekstrak spons yang mempunyai bioaktivitas dalam menghambat pertumbuhan bakteri S. aureus, E. coli, S. saprophyticus dan P. aeruginosa, Ekstrak spons No. 3 (dari 30 ekstrak spons yang diuji) adalah yang paling aktif dalam menghambat pertumbuhan bakteri dan memiliki diameter zona hambat yang paling lebar.Kata kunci: skrining, spons, ekstrak kasar, antibakteri, Manado

Styles APA, Harvard, Vancouver, ISO, etc.

7

Wang, Qinghua, Jingwei Chen, Dexiang Wang, Minghui Shen, Huilong Ou, Jing Zhao, Ming Chen, Guoliang Yan et Jun Chen. « Rapid Hemostatic Biomaterial from a Natural Bath Sponge Skeleton ». Marine Drugs 19, n^o 4 (15 avril 2021) : 220. http://dx.doi.org/10.3390/md19040220.

Texte intégral

Résumé :

Uncontrolled bleeding is the main cause of mortality from trauma. Collagen has been developed as an important hemostatic material due to its platelet affinity function. A bath sponge skeleton is rich in collagen, also known as spongin. To understand the hemostatic effect of spongin, spongin materials, SX, SFM and SR were prepared from the bath sponge Spongia officinalis, and hemostatic experiments were performed. The SX, SFM and SR were significantly better than the positive control, type I collagen, in shortening the whole blood clotting time in vitro and hemostasis upon rat tail amputation. In a hemostatic experiment of rabbit common carotid artery injury, the hemostatic time and 3 h survival rate of the SFM group were 3.00 ± 1.53 min and 100%, respectively, which are significantly better than those of the commercial hemostat CELOX-A (10.33 ± 1.37 min and 67%, respectively). Additionally, the SFM showed good coagulation effects in platelet-deficient blood and defibrinated blood, while also showing good biocompatibility. Through a variety of tests, we speculated that the hemostatic activity of the SFM is mainly caused by its hyperabsorbency, high affinity to platelets and high effective concentration. Overall, the SFM and spongin derivates could be potential hemostatic agents for uncontrolled bleeding and hemorrhagic diseases caused by deficiency or dysfunction of coagulation factors.

Styles APA, Harvard, Vancouver, ISO, etc.

8

Ikhrar, Muhammad S., Adithya Yudistira et Defny S. Wewengkang. « UJI AKTIVITAS ANTIOKSIDAN Stylissa sp. DENGAN METODE DPPH (1,1-difenil-2-pikrilhidrazil) ». PHARMACON 8, n^o 4 (28 novembre 2019) : 961. http://dx.doi.org/10.35799/pha.8.2019.29376.

Texte intégral

Résumé :

ABSTRACTThis study aims to analyze the antioxidant activity of Stylissa sp., sponge. The Stylissa sp., sponge sample was obtained from the Lembeh Strait, waters Bitung. This research is an experimental laboratory by testing the ethanol extracts of Stylissa sp., sponge using DPPH method (1,1-diphenil2-pikrihidrazil) to analyze antioxidant activity using a spectrophotometer. The results of this study show the antioxidant levels of the Stylissa sp., sponge in the Lembeh Strait waters have antioxidant activity and the higher the concentration the higher the antioxidant levels produced. The greatest antioxidant level is found in Stylissa sp., sponge with a concentration of 100 mg / L. Keywords : Antioxidants, DPPH, Sponge Stylissa sp ABSTRAKPenelitian ini bertujuan untuk menganalisis aktivitas antioksidan dari Stylissa sp. Sampel Spons Stylissa sp di peroleh dari perairan Selat Lembeh, Bitung. Penelitian ini merupakan eksperimental laboratorium dengan pengujian terhadap ektrak etanol Spons Stylissa sp dengan metode DPPH (1,1-diphenil-2-pikrihidrazil) untuk menganalisis aktivitas antioksidan dengan menggunakan sprektrofotometer. Hasil penelitian ini memperlihatkan kadar antioksidan dari Spons Stylissa sp di perairan Selat Lembeh mempunyai aktivitas antioksidan dan semakin tinggi konsenstrasi semakin tinggi pula kadar antioksidan yang dihasilkan. Kadar antioksidan yang paling besar terdapat pada Spons Stylissa sp dengan konsentrasi 100 mg/L.Kata kunci : Antioksidan, DPPH, Spons Stylissa sp

Styles APA, Harvard, Vancouver, ISO, etc.

9

Rompis, Abrianto A. O., Fitje Losung, Deiske A. Sumilat, Agung B. Windarto, Stenly Wullur et Laurentius T. X. Lalamentik. « The Antibacterial Activity Of Several Sponges From The Waters Of Tasik Ria Against Escherichia coli And Staphylococcus aureus bacteria ». JURNAL ILMIAH PLATAX 7, n^o 1 (29 octobre 2018) : 1. http://dx.doi.org/10.35800/jip.7.1.2019.21435.

Texte intégral

Résumé :

The sponge is one of the sea organisms that has a prospect as a source of natural compounds including peptides, steroids, asetogenin, terpenoids, alkaloids, cyclic halide and nitrogen. This research was directed to obtain several species of sponges from the waters of Tasik Ria as well as testing the antibacterial activity of extracts from some of the sponge against the bacteria Escherichia coli and Staphylococcus aureus. From the identification, seven species of sponges were found, which consists of: Amphimedon sp., Axinosa sp., Aaptos sp., Theonella sp., Cribochalina sp., Hyrtios sp., and Lendenfeldia sp. The tests of antibacterial activity of the extracts from these sponges against test bacteria E. coli and S. aureus showed some positive results. Extract from Axinosa sp. sponge(16 mm) showed the strongest antibacterial activity on Escherichia coli bacteria. Followed by Hyrtios sp. extract (13.5 mm), Aaptos sp. extract (13 mm), Lendenfeldia sp. extract (13 mm) and Cribochalinai sp. extract(10.5 mm). While the the tests on Staphylococcus aureus bacteria showed that the strongest antibacterial activity was found from Axinosa sp. sponge extract (16.5 mm), followed by the extract from Aaptos sp. (15 mm), Lendenfeldia sp. extract (14.5 mm), Hyrtios sp. extract(13.5 mm) and Cribochalina sp. extract (11 mm).Keywords: Sponge, antibacterial, Escherichia coli, Staphylococcus aureus ABSTRAK Spons merupakan salah satu biota laut yang sangat prospektif sebagai sumber senyawa bahan-bahan alami antara lain peptide, terpenoid, steroid, asetogenin, alkaloid, halide siklik dan senyawa nitrogen. Penelitian ini diarahkan untuk mendapatkan beberapa spesies spons dari perairan Tasik Ria serta menguji aktivitas antibakteri dari beberapa ekstrak spons terhadap bakteri Escherichia coli dan bakteri Staphylococcus aureus. Hasil identifikasi spons ditemukan sebanyak tujuh spesies yang terdiri dari: Amphimedon sp., Axinosa sp., Aaptos sp., Theonella sp., Hyrtios sp., Cribochalina sp. dan Lendenfeldia sp.. Aktivitas antibakteri dari beberapa ekstrak spons terhadap bakteri uji E. coli dan S. aureus terdapat diameter zona hambat bervariasi yaitu bakteri Escherichia coli menunjukkan aktivitas antibakteri ekstrak spons terkuat pada spons Axinosa sp (16 mm), disusul ekstrak spons Hyrtios sp. (13,5 mm), ekstrak spons Aaptos sp. (13 mm), ekstrak spons Lendenfeldia sp. (13 mm) dan ekstrak spons Cribochalinai sp. (10,5 mm). Sedangkan pada bakteri Staphylococcus aureus menunjukkan aktivitas antibakteri ekstrak spons terkuat yaitu: ekstrak spons Axinosa sp. (16,5 mm), disusul ekstrak spons Aaptos sp. (15 mm), ekstrak spons Lendenfeldia sp. (14,5 mm), ekstrak spons Hyrtios sp. (13,5 mm) dan ekstrak spons Cribochalina sp.(11mm).Kata Kunci : Spons, Antibakteri, Escherichia coli, Staphylococcus aureus

Styles APA, Harvard, Vancouver, ISO, etc.

10

Damayanti, Aspina, Asriani Ilyas et Firnanelty Firnanelty. « Isolasi Senyawa Metabolit Sekunder Ekstrak Etanol Spons Stylotella sp Asal Kepulauan Selayar ». ALCHEMY 8, n^o 2 (31 octobre 2020) : 12–15. http://dx.doi.org/10.18860/al.v8i2.10213.

Texte intégral

Résumé :

Isolation of secondary metabolite compound has been conducted from sponge Stylotella sp., Selayar Island. Stylotella sp., one of Demospongiae class sponge, is found spreading in Selayar Island. This study aims to determine secondary metabolite compounds contained in the ethanol extract of Stylotella sp. sponge by extraction, fractionation and purification methods. The purity test was carried out by three eluent systems of TLC, namely chloroform:ethyl acetate (9:1), n-hexane:acetone (9:1), and chloroform:acetone (9:1). Each eluent produced a single spot. FTIR analysis of Stylotella sp. isolate showed that the pure isolates contained alkaloid compounds with the appearance of a typical functional group of alkaloid compounds. Keywords: Alkaloids, sponge Stylotella sp, extraction Telah dilakukan isolasi senyawa metabolit sekunder dari spons Stylotella sp. asal Kepulauan Selayar. Spons Stylotella sp merupakan spons kelas Demospongiae yang ditemukan penyebarannya di Perairan Pulau Selayar. Penelitian ini bertujuan untuk mengetahui golongan senyawa metabolit sekunder yang terdapat pada ekstrak etanol spons Stylotella sp. dengan metode ekstraksi, fraksinasi dan pemurnian. Uji kemurnian dilakukan dengan uji tiga sistem eluen pada KLT yaitu kloroform:etil asetat (9:1), n-heksan:aseton (9:1), dan kloroform:aseton (9:1). Masing-masing eluen menghasilkan noda tunggal. Isolat hasil analisis FTIR menunjukkan bahwa isolat murni mengandung senyawa alkaloid dengan munculnya gugus fungsi khas senyawa golongan alkaloid. Kata kunci: Alkaloid, spons Stylotella sp., ekstraksi

Styles APA, Harvard, Vancouver, ISO, etc.

11

Sibarani, Samuel I. M., Adithya Yudistira et Deby A. Mpila. « UJI AKTIVITAS ANTIOKSIDAN SPONS Stylissa sp. DENGAN MENGGUNAKAN METODE DPPH (1,1-difenil-2-pikrilhidrazil) ». PHARMACON 9, n^o 3 (9 août 2020) : 419. http://dx.doi.org/10.35799/pha.9.2020.30027.

Texte intégral

Résumé :

ABSTRACTHabitat of sponge Stylissa sp., were under the sea and these sponges contain active compounds, which are more active than the compounds produced by terrestrial plants. Antioxidants are inhibitors of oxidation reactions due to the free radicals, which can cause weak damage to unsaturated cells, cell wall membranes, blood vessels, DNA bases, and lipid tissue, that causing disease. The study was conducted to determine the antioxidant activity of ethanol extracts of sponge Stylissa sp., which is located on the Bangka Island, Likupang District, North Minahasa Regency. Sponge Stylissa sp., was extracted by maceration with using ethanol. Testing of antioxidant activity was carried out by the DPPH method measured by a UV-Vis spectrophotometer. The results of the study showed that ethanol extracts of sponge Stylissa sp., has antioxidant activity in each concentration and the highest at a concentration of 100 mg / L. The conclusion is a ethanol extract of sponge Stylissa sp. have high antioxidant activity with a concentration of 25 mg/L (77,40%), concentration of 50 mg/L (85,63%), concentration of 75 mg/L (88,66%), and concentration 100 mg/L (88,96%). Key words: Stylissa sp. Sponge, Antioxidant, DPPH (1,1-diphenyl-2-picrylhydrazyl) ABSTRAKHabitat dari spons Stylissa sp. terdapat di bawah laut dan spons ini mengandung senyawa aktif yang persentase keaktifannya lebih besar dibandingkan dengan senyawa-senyawa yang dihasilkan oleh tumbuhan darat. Antioksidan adalah zat penghambat reaksi oksidasi akibat radikal bebas yang dapat menyebabkan kerusakan lemah tak jenuh, membran dinding sel, pembuluh darah, basa DNA, dan jaringan lipid sehingga menimbulkan penyakit. Penelitian dilakukan untuk mengetahui aktivitas antioksidan ekstrak etanol biota laut spons Stylissa sp. yang terdapat di pulau Bangka, Kecamatan Likupang, Kabupaten Minahasa Utara. Spons Stylissa sp. ini diekstrak dengan metode maserasi menggunakan etanol. Pengujian aktivitas antioksidan ini dilakukan dengan metode DPPH yang diukur dengan alat spektrofotometer UV-Vis. Hasil dari penelitian menunjukan bahwa ekstrak etanol spons Stylissa sp. memiliki aktivitas antioksidan disetiap konsentrasi dan yang tertinggi pada konsentrasi 100 mg/L. Kesimpulan yang didapat bahwa ekstrak etanol spons Stylissa sp. memiliki aktivitas antioksidan yang tinggi dengan konsentrasi 25 mg/L (77,40%), konsentrasi 50 mg/L (85,63%), konsentrasi 75 mg/L (88,66%), dan konsentrasi 100 mg/L (88,96%). Kata Kunci : Spons Stylissa sp., Antioksidan, DPPH (1,1-difenil-2-pikrilhidrazil)

Styles APA, Harvard, Vancouver, ISO, etc.

12

Novita, Novita, Nur Rahtiwi Anjarni et Fadilah Fadilah. « Spons dari Tepung Glukomanan dengan Penambahan Charcoal ». Equilibrium Journal of Chemical Engineering 3, n^o 2 (22 décembre 2020) : 45. http://dx.doi.org/10.20961/equilibrium.v3i2.43106.

Texte intégral

Résumé :

Abstrak. Telah dilakukan pembuatan spons dengan bahan dasar tepung glukomanan dengan penambahan charcoal. Pada percobaan ini dipelajari pengaruh dua jenis larutan alkali yaitu larutan Na2CO3 dan larutan NaOH terhadap karakteristik spons yang dihasilkan. Spons dibuat dengan cara melarutkan tepung glukomanan dalam air yang dilanjutkan dengan membusakan larutan dengan penambahan Sodium Laureth Sulfate (SLS) bersama-sama dengan penambahan charcoal. Larutan basa ditambahkan untuk membentuk gel basah. Spon kering diperoleh setelah proses thawing dan pengeringan dengan sinar matahari.Karakterisasi spons dilakukan dengan melihat rongga menggunakan mikroskop kamera serta menganalisis daya serap air, daya ekspansi spon basah serta nilai iod teradsorpsi. Spons yang dihasilkan mempunyai rongga dengan ukuran antara 0,1 mm sampai 0,25 mm. Spons dengan daya serap air dan daya ekspansi tinggi diperoleh pada penambahan larutan NaOH, massa charcoal yang ditambahkan sebesar 1gram serta ukuran charcoal +50-60 mesh. Sedangkan spons yang dihasilkan apabila menggunakan alkali berupa Na2CO3 dengan massa charcoal yang ditambahkan sebesar 0,5gram serta ukuran charcoal +60-70 mesh diperoleh diameter rata-rata rongga spons dan nilai iod teradsorpsi yang tinggi. Abstract. A sponge was made with a basic ingredient of glucomannan with the addition of charcoal. In this experiment, the effect of two types of alkaline solution i.e., Na2CO3 and NaOH, either the size and the amount of charcoal, were studied on the sponge's characteristics. The sponge was made by dissolving glucomannan flour in water. This step was followed by mixing the solution with Sodium Laureth Sulfate (SLS) and charcoal. The alkaline solution was added to form a wet gel. The dry sponge was obtained after thawing and sun drying. The sponge's characterization was done by observing the foam cavity using a camera microscope and analyzing water absorption, sponge expansion, and iodine adsorption. The sponge has cavities with a size between 0.1 mm to 0.25 mm. Sponges with water absorption and high expansion were obtained by adding NaOH solution, one gram of charcoal and the size of charcoal -50+60 mesh. Sponge produced using Na2CO3 with 0.5 gram charcoal with size - 60+70 mesh has a high diameter cavity and a high adsorbed iodine value. Keywords: glucomannan sponge, alkaline solution, charcoal

Styles APA, Harvard, Vancouver, ISO, etc.

13

Sukmaningrum, Krisnawati, Adithya Yudistira et Irma Antasionasti. « UJI AKTIVITAS ANTIOKSIDAN EKSTRAK ETANOL SPONS (Stylissa sp.) YANG DIKOLEKSI DARI TELUK MANADO ». PHARMACON 10, n^o 1 (24 février 2021) : 756. http://dx.doi.org/10.35799/pha.10.2021.32773.

Texte intégral

Résumé :

ABSTRACTThe Stylissa sp. were under the sea, and these sponge contains active compound, wich are more active than the compounds produced by teresterial plants. The purpose of this study was intended to test the antioxidant activity of the stylissa sp. Sample of the stylissa sp sponge was from the territorial of manado bay. This research an experimental laboratory by testing the ethanol extract of Stylissa sp sponge using DPPH method (1.1-diphenil-2-pikrhydrazil) to analyze antioxidant activity using spectrophotometri uv-vis with variations in concentrations 2, 4, 6, 8, and 10mg/ L. Was extracted Stylissa sp, sponge by maceration using ethanol 95% as a solvent. The value results of % inhibisi (2mg/ L); 86.50% (4mg/ L); 90.5% (6mg/L); 90.53% (8mg/ L) and 90,83 (10mg/L). The highest antioxidant activity at 10mg/L concentration with mean precentage 90.83% inhibisi. The result for this study indicate that the extract from ethanol Stylissa sp sponge has highest antioxidant activity.Keywords: Antioxidant, DPPH, Stylissa sp., bay of Manado ABSTRAKSpons Stylissa sp. terdapat di bawah laut dan spons ini mengandung senyawa aktif yang persentase keaktifannya lebih besar dibandingkan dengan senyawa-senyawa yang dihasilkan oleh tumbuhan darat. Penelitian ini bertujuan untuk menguji aktivitas antioksidan dari Stylissa sp. Sampel Spons Stylissa sp. di peroleh dari perairan Teluk Manado. Penelitian ini merupakan eksperimental laboratorium dengan pengujian terhadap ekstrak etanol Spons Stylissa sp dengan metode DPPH (1,1-diphenil-2-pikrihidrazil) untuk menguji aktivitas antioksidan yang diukur menggunakan Spektrofotometri UV-Vis dengan variasi konsentrasi 2, 4, 6, 8, dan 10mg/L. Ekstrak Spons Stylissa sp diperoleh dengan cara maserasi menggunakan pelarut etanol 95%. Hasil nilai % inhibisi rata-rata yang didapat yaitu 87,20% (2mg/L); 86,50% (4mg/L); 90,5% (6mg/L); 90,53% (8mg/L) dan 90,83 (10mg/L). Aktivitas antioksidan tertinggi terdapat pada konsentrasi 10mg/L dengan nilai % inhibisi rata-rata 90,83%. Hal ini menunjukkan bahwa ekstrak etanol Spons Stylissa sp memiliki aktivitas antioksidan yang tinggi.Kata kunci : Antioksidan, DPPH, Spons Stylissa sp., Teluk Manado

Styles APA, Harvard, Vancouver, ISO, etc.

14

Sayori, Nelly, Tresia S. Tururaja et Duaitd Kolibongso. « Komunitas Spons (Porifera) pada Ekosistem Terumbu Karang di Manokwari, Indonesia ». Jurnal Kelautan Tropis 25, n^o 3 (2 septembre 2022) : 400–410. http://dx.doi.org/10.14710/jkt.v25i3.14098.

Texte intégral

Résumé :

Sponges are one of the most influential benthic organisms in coral reef ecosystems. Many studies on sponge communities have been carried out globally, from the tropics to the sub-tropics. However, in Indonesia, the sponge community has not been sufficiently observed, especially its diversity and interactions with habitats. Manokwari, a developing city north of the Bird's Head Seascape region, Papua has a lack of information on benthic communities and no reports of sponges. This study is to examine the sponge community (diversity and distribution) in coral reef ecosystem. This study found that sponge richness (species and morphology) was categorized as “low”, with only 11 species with 8 morphological forms. The most common species included Niphates erecta, Stylissa carteri, and Pseudoceratina purpurea, while the most common growth forms were massive and encrusting, accounting respectively for 27.3% and 18.2% of the total number of species. The highest diversity was found on the island of Kaki (5 species) with the island of Nusmapi having an uneven distribution of sponges. The results of our study found that there was no relationship between sponge diversity and morphology. This baseline information is essential for management of marine biodiversity hotspots in taking decisions for marine life conservation. Spons merupakan salah satu organisme bentik yang paling berpengaruh dalam ekosistem terumbu karang. Banyak penelitian tentang komunitas spons telah dilakukan secara global, dari daerah tropis hingga sub tropis. Namun di Indonesia, komunitas spons belum cukup diamati, terutama keanekaragaman dan interaksinya dengan habitat. Manokwari, kota berkembang di utara dari wilayah Bentang Laut Kepala Burung (BLKB), Papua memiliki kekurangan informasi tentang komunitas bentik dan tidak ada laporan tentang spons. Studi ini untuk mengkaji komunitas spons (keanekaragaman dan distribusi) pada ekosistem terumbu karang. Penelitian ini menemukan kekayaan spons (spesies dan morfologi) yang dikategorikan “rendah”, dengan hanya 11 spesies dengan 8 bentuk morfologi. Spesies yang paling umum termasuk Niphates erecta, Stylissa carteri, dan Pseudoceratina purpurea, sedangkan bentuk pertumbuhan yang paling umum adalah massif dan encrusting dengan menyumbang masing-masing 27,3% dan18,2% dari total jumlah spesies. Keanekaragaman tertinggi ditemukan di pulau Kaki (5 spesies) dengan pulau Nusmapi memiliki sebaran spons tidak merata. Hasil penelitian kami menemukan tidak ada hubungan antara keanekaragaman spons dengan bentuk morfologi. Informasi dasar ini sangat penting untuk pengelolaan hotspot keanekaragaman hayati dalam perumusan keputusan untuk konservasi biota laut.

Styles APA, Harvard, Vancouver, ISO, etc.

15

Hendra, Hendra, Adithya Yudistira et Surya Sumantri. « EVALUASI AKTIVITAS ANTIOKSIDAN EKSTRAK ETANOL SPONS Aplysina sp. DIPESISIR PANTAI LEMBEH KOTA BITUNG ». PHARMACON 9, n^o 3 (9 août 2020) : 458. http://dx.doi.org/10.35799/pha.9.2020.30032.

Texte intégral

Résumé :

ABSTRACT Aplysina sp., is one of the marine biota, which forms the coral reefs that contain active compounds, whose percentage of activity is greater than the compounds produced by terrestrial plants. This study aims to analyze the antioxidant activity of the sponge Aplysina sp. Sponge sample Aplysina sp., obtained from the waters of the Lembeh Strait, Bitung. This research is an experimental laboratory by testing the ethanol extract of sponge Aplysina sp., with the DPPH method [1,1-diphenyl-2-picrilhidrazil] to analyze antioxidant activity using a spectrophotometer UV-Vis. The results of this study showed that the ethanolic extract of the sponge Aplysina sp. Lembeh straits waters have antioxidant activity in each concentration test. The highest concentration has an antidote to free radical activity by reaching a percentage of 24,83%. Keywords : Aplysina sp., Antioxidants, Ethanol, DPPH ABSTRAK Spons Aplysina sp. merupakan salah satu biota laut penyusun terumbu karang yang mengandung senyawa aktif yang presentase keaktifannya lebih besar dibandingkan dengan senyawa-senyawa yang dihasilkan oleh tumbuhan darat.Penelitian ini bertujuan untuk menganalisis aktivitas antioksidan dari spons Aplysina sp. Sampel spons Aplysina sp. di peroleh dari perairan Selat Lembeh, Bitung. Penelitian ini merupakan eksperimental laboratorium dengan pengujian terhadap ektrak etanol spons Aplysina sp.dengan metode DPPH [1,1-difenil-2-pikrilhidrazil] untuk menganalisis aktivitas antioksidan dengan menggunakan sprektrofotometer UV-Vis. Hasil penelitian ini memperlihatkan ekstrak etanol spons Aplysina sp.di perairan selat lembeh mempunyai aktivitas antioksidan disetiap konsentrasi pengujiannya. Konsetrasi tertinggi memliki aktivitas penangkal radikal bebas dengan mencapai presentase 24,83%. Kata kunci :Aplysina sp., Antioksidan, Etanol, DPPH

Styles APA, Harvard, Vancouver, ISO, etc.

16

Membri, Desy Khartika, Adithya Yudistira et Surya Sumantri Abdullah. « UJI AKTIVITAS ANTIOKSIDAN EKSTRAK ETANOL SPONS Liosina paradoxa YANG DIKOLEKSI DARI PULAU MANTEHAGE ». PHARMACON 10, n^o 2 (17 mai 2021) : 774. http://dx.doi.org/10.35799/pha.10.2021.34024.

Texte intégral

Résumé :

ABSTRACTLiosina paradoxa sponge is one of the marine biota components that make up coral reefs which has bioactive potential which has not been widely utilized. These marine animals contain active compounds whose percentage of activity is greater than those produced by land plants. This study aims to determine the antioxidant activity of the Liosina paradoxa sponge. This research is a laboratory experiment with testing the ethanol extract of the sponge Liosina paradoxa with the DPPH [1,1-diphenyl-2-picrylhydrazyl] method to test its antioxidant activity using a UV-Vis spectrophotometer at a wavelength of 517 nm. The results showed that the ethanol extract of the Liosina paradoxa sponge was proven to have antioxidant activity in each concentration. The highest concentration has free radical scavenging activity by reaching a percentage of 54.70%. Keywords: Liosina paradoxa sponge, Antioxidant, DPPH, Mantehage ABSTRAKSpons Liosina paradoxa merupakan salah satu komponen biota laut penyusun terumbu karang yang mempunyai potensi bioaktif yang belum banyak dimanfaatkan. Hewan laut ini mengandung senyawa aktif yang persentase keaktifannya lebih besar dibandingkan dengan senyawa-senyawa yang dihasilkan oleh tumbuhan darat. Penelitian ini bertujuan untuk mengetahui aktivitas antioksidan dari spons Liosina paradoxa. Penelitian ini merupakan eksperimental laboratorium dengan pengujian terhadap ekstrak etanol spons Liosina paradoxa dengan metode DPPH [1,1-difenil-2-pikrilhidrazil] untuk menguji aktivitas antioksidan dengan menggunakan spektrofotometer UV-Vis pada panjang gelombang 517 nm. Hasil penelitian menunjukkan ekstrak etanol spons Liosina paradoxa terbukti memiliki aktivitas antioksidan disetiap konsentrasi pengujian. Konsentrasi tertinggi memiliki aktivitas penangkal radikal bebas dengan mencapai persentase 54,70%. Kata Kunci : Spons Liosina paradoxa, Antioksidan, DPPH, Mantehage

Styles APA, Harvard, Vancouver, ISO, etc.

17

Anton, Nurhati, Adithya Yudistira et Jainer Pasca Siampa. « UJI AKTIVITAS ANTIOKSIDAN DARI EKSTRAK ETANOL SPONS Ianthella basta DARI DESA TUMBAK KECAMATAN PUSOMAEN KABUPATEN MINAHASA TENGGARA ». PHARMACON 10, n^o 1 (24 février 2021) : 713. http://dx.doi.org/10.35799/pha.10.2021.32759.

Texte intégral

Résumé :

ABSTRACT Sponges are a component of coral reef biota that has bioactive compounds with a greater percentage of activity compared to compounds produced by terrestrial plants. This study aims to determine the presence of antioxidant activity in the ethanol extracts of sponge Ianthella basta from the waters of Tumbak Village. Ianthella basta sponge was extracted using maceration method with 96% ethanol solvent. Antioxidant activity testing was carried out using the DPPH method with a concentration of 100 µg / mL, 75 μg / mL, 50 μg / mL, and 25 μg / mL and Vitamin C p.a as positive control. Each sample was made three repetitions of the test. Testing using a UV-Vis spectrophotometer. The results showed that the ethanol extract of the Ianthella basta sponge had antioxidant activity with a percentage of 48.73% at a concentration of 100 µg / mL. Keywords: Ianthella basta sponge, Antioxidants, Extraction, DPPH ABSTRAK Spons merupakan salah satu komponen biota penyusun terumbu karang yang mempunyai senyawa bioaktif dengan persentase keaktifan lebih besar dibandingkan dengan senyawa-senyawa yang dihasilkan oleh tumbuhan darat. Penelitian ini bertujuan untuk mengetahui adanya aktivitas antioksidan di dalam ekstrak etanol Spons Ianthella basta dari perairan Desa Tumbak. Spons Ianthella basta diekstraksi menggunakan metode maserasi dengan pelarut etanol 96%. Pengujian aktivitas antioksidan dilakukan dengan menggunakan metode DPPH dengan konsentrasi 100 µg/mL, 75 µg/mL, 50 µg/mL, dan 25 µg/mL dan Vitamin C p.a sebagai kontrol positif. Masing-masing sampel dibuat tiga kali pengulangan uji. Pengujian menggunakan alat spektrofotometer UV-Vis. Hasil penelitian menunjukkan bahwa ektrak etanol Spons Ianthella basta memiliki aktivitas antioksidan dengan persentase sebesar 48,73% pada konsentrasi 100 µg/mL. Kata Kunci: Spons Ianthella basta, Antioksidan, Ekstraksi, DPPH

Styles APA, Harvard, Vancouver, ISO, etc.

18

Lampongajo, Stela Mahdalena, Adithya Yudistira et Erladys Rumondor. « UJI AKTIVITAS ANTIOKSIDAN EKSTRAK ETANOL SPONS (Mycale vansoesti Sensu) YANG DIKOLEKSI DARI KEPULAUAN MANTEHAGE ». PHARMACON 10, n^o 2 (17 mai 2021) : 812. http://dx.doi.org/10.35799/pha.10.2021.34029.

Texte intégral

Résumé :

ABSTRACTMycale sponges have potential as antioxidants. Mycale vansoesti Sensu is one of the dominant sponges in the Mantehage Islands, Manado. This study is a laboratory experimental study with the ethanol extract of Mycale Vansoesti Sensu sponge with the DPPH [1,1-diphenyl-2-picrylhydrazyl] method to analyze antioxidant activity using a spectrophotometer. The results of this study show that the antioxidant levels of the Mycale vansoesti Sensu Sponge in the waters of the island of Mantehage have antioxidant activity and the higher the concentration the higher the antioxidant content produced. The greatest antioxidant content is found in the Mycale vansoesti Sensu Sponge with a concentration of 0,35 mg / L. This shows that the extract of the Mycale vansosti Sensu sponge has vital potential as an antioxidant that provides added value in the pharmaceutical industry. Keywords: Antioxidant, DPPH, Mycale vansoesti Sensu, Mantehage Island. ABSTRAKSpons genus Mycale terdapat potensi sebagai antioksidan. Mycale vansoesti Sensu merupakan salah satu jenis spons yang cukup dominan dikepulauan Mantehage, Manado. Penelitian ini merupakan eksperimental laboratorium dengan pengujian terhadap ektrak etanol spons Mycale Vansoesti Sensu dengan metode DPPH [1,1-difenil-2-pikrilhidrazil] untuk menganalisis aktivitas antioksidan dengan menggunakan spektrofotometer. Hasil penelitian ini memperlihatkan kadar antioksidan dari Spons Mycale vansoesti Sensu di perairan pulau Mantehage mempunyai aktivitas antioksidan dan semakin tinggi konsentrasi semakin tinggi pula kadar antioksidan yang dihasilkan. Kadar antioksidan yang paling besar terdapat pada Spons Mycale vansoesti Sensu dengan konsentrasi 0,35 mg/L. Hal ini menunjukkan bahwa ekstrak spons Mycale vansosti Sensu memiliki potensi vital sebagai antioksidan yang memberikan nilai tambah dalam industri farmasi. Kata kunci : Antioksidan, DPPH, Mycale vansoesti Sensu, pulau Mantehage.

Styles APA, Harvard, Vancouver, ISO, etc.

19

Manurung, Merlyn D., Reiny A. Tumbol, Henneke D. Pangkey, Deiske A. Sumilat et Remy E. P. Mangindaan. « The use of Sponge Crude Extract to Increase Growth and Immune Response of Nile Tilapia Oreochromis niloticus ». JURNAL ILMIAH PLATAX 7, n^o 1 (8 mars 2019) : 256. http://dx.doi.org/10.35800/jip.7.1.2019.23228.

Texte intégral

Résumé :

This study aims to examine the effect of sponge crude extract addition to the fish feed on growth and non-specific immune response of nile tilapia (O. niloticus) and determine the most effective dose of the extract in raising the growth and the non-specific immune response of nile tilapia (O. niloticus). The sponge sample was macerated and then evaporated using a rotary vacuum evaporator until the sample became a paste and mixed with feed. The fish were fed for 14 days respectively as much as 5% of body weight per day with feeding frequency of two times a day. The results showed that addition of sponge crude extract to the fish feed gave good effect on the growth and the non-specific immune response of nile tilapia (O. niloticus) with best dose of 40 g / kg feed.Keywords: Sponge extract, fish immune response, fish growth, immune response, immunostimulant. ABSTRAKPenelitian ini bertujuan untuk menguji pengaruh penambahan ekstrak kasar spons pada pakan ikan terhadap pertumbuhan dan respon imun non spesifik ikan nila (Oreochromis niloticus) serta menentukan dosis ekstrak kasar spons yang paling efektif dalam meningkatkan pertumbuhan dan respon imun non spesifik ikan nila (Oreochromis niloticus). Sampel spons dimaserasi kemudian dievaporasi menggunakan rotary vacuum evaporator sehingga diperoleh ekstrak kasar berbentuk pasta yang kemudian dicampurkan pada pakan. Ikan uji diberi pakan perlakuan 5% dari bobot biomassa selama 14 hari dengan frekuensi pemberian pakan dua kali sehari. Hasil penelitian menunjukan bahwa penambahan ekstrak kasar spons pada pakan ikan memberikan pengaruh yang baik terhadap pertumbuhan dan respon imun non spesifik ikan nila (Oreochromis niloticus), yang mana dosis yang terbaik adalah 40 gr / Kg pakan.Kata Kunci : Ekstrak spons, respon imun ikan, pertumbuhan ikan, respon imun, imunostimulan.

Styles APA, Harvard, Vancouver, ISO, etc.

20

Latif, Rizky Akbar, Defny S. Wewengkang et Henki Rotinsulu. « UJI DAYA HAMBAT ORGANISME LAUT SPONS Amphimedon sp., TERHADAP PERTUMBUHAN BAKTERI Staphylococcus aureus, Escherichia coli, DAN Jamur Candida albicans ». PHARMACON 8, n^o 3 (28 août 2019) : 561. http://dx.doi.org/10.35799/pha.8.2019.29331.

Texte intégral

Résumé :

Sponges are marine animals that can produce bioactives that are useful as anti-virus, anti-fungal, antibiotic, anti-cancer, anti-inflammatory, and antioxidants. Amphimedon sp., sponge itself is found in the waters of Lembeh islands, the City of Bitung. This study was to determine the inhibitory activity against the microorganisms growth of Amphimedon sp., sponge, against microbes of Staphylococcus aureus, Escherichia coli, and Candida albicans. Based on the results of the study, the extracts and fractions of Amphimedon sp., sponge samples did not have microbial inhibitory activity against the test microbes of Staphylococcus aureus, Escherichia coli, and Candida albicans Keywords : Amphimedon sp., Antimicrobial, Staphylococcus aureus, Escherichia coli, Candida albicans ABSTRAK Spons merupakan hewan laut yang dapat menghasilkan bioaktif yang bermanfaat sebagai anti virus, anti jamur, antibiotik, anti kanker, anti inflamasi, dan antioksidan. Spons Amphimedon sp sendiri ditemukan didaerah perairan pulau Lembeh kota bitung. Penelitian ini yaitu untuk mengetahui aktivitas daya hambat pertumbuhan mikroorganisme dari spons Amphimedon sp., terhadap mikroba Staphylococcus aureus, Escherichia coli, dan Candida albicans. Berdasarkan hasil penelitian menunjukkan ekstrak dan fraksi sampel spons Amphimedon sp., tidak memiliki aktivitas daya hambat terhadap mikroba uji Staphylococcus aureus, Escherichia coli, dan Candida albicans Kata kunci : Amphimedon sp., Antimikroba, Staphylococcus aureus, Escherichia coli, Candida albicans

Styles APA, Harvard, Vancouver, ISO, etc.

21

Kotel, Marcelinda N., Defny S. Wewengkang et Herny E. I. Simbala. « POTENSI ANTIMIKROBA DARI EKSTRAK DAN FRAKSI SPONS APLYSINA sp. TERHADAP MIKROBA UJI Escherichia coli, Staphylococcus aureus DAN Candida albicans ». PHARMACON 8, n^o 2 (28 mai 2019) : 268. http://dx.doi.org/10.35799/pha.8.2019.29291.

Texte intégral

Résumé :

ABSTRACT Sponge Aplysina sp. is one of the marine biota , which has bioactive compounds that can be used as medicinal ingredients. This study aims to determine the antimicrobial potential of the extracts and fractions of sponge Aplysina sp., against microbes tested of Escherichia coli, Staphylococcus aureus, and Candida albicans. Aplysina sp., sponge was extracted using maceration method with ethanol solvent and fractionated using methanol, n-hexan and chloroform solvents. To test the antimicrobial activity carried out by disk diffusion agar method and observations carried out 24 hours incubation period, with inhibition zones measured using a digital caliper. The results showed that samples of Aplysina sp., proved to have antimicrobial compounds to inhibit Gram –positive bacteria Staphylococcus aureus, and Gram- negative bacteria Escherichia coli, with the highest inhibitory zone activity, and found in Gram –positive Staphylococcus aureus bacteria with measurements of 7,37 mm. Keywords: Sponge Aplysina sp, Antimicrobial, Extraction, Fractionation. ABSTRAK Spons Aplysina sp merupakan salah satu biota laut yang memiliki senyawa bioaktif yang dapat dijadikan sebagai bahan obat. Penelitian ini bertujuan untuk mengetahui potensi antimikroba dari Ekstrak dan Fraksi Spons Aplysina sp Terhadap Mikroba Uji Echerichia coli, Staphylococcus aureus, dan Candida albicans. Spons Aplysina sp diekstraksi menggunakan metode maserasi dengan pelarut etanol dan difraksinasi menggunakan pelarut methanol, n-hexan, dan Kloroform. Untuk pengujian aktivitas antimikroba dilakukan dengan metode difusi agar dan pengamatan dilakukan 1x24 jam masa inkubasi, dengan zona hambat diukur menggunakan digital caliper. Hasil penelitian menunjukkan bahwa sampel Spons Aplysina sp terbukti memiliki senyawa antimikroba untuk menghambat bakteri Gram positif Staphylococcus aureus dan bakteri Gram negatif Echerichia coli, dengan aktivitas zona hambat tertinggi, terdapat pada bakteri Gram positif Staphylococcus aureus dengan hasil pengukuran 7,37 mm. Kata Kunci : Spons Aplysina sp, Antimikroba, Ekstraksi, Fraksinasi.

Styles APA, Harvard, Vancouver, ISO, etc.

22

Manumpil, Aprilia, Defny S. Wewengkang et Adithya Yudistira. « EVALUASI AKTIVITAS ANTIOKSIDAN EKSTRAK ETANOL SPONS Aplysina sp. DARI PERAIRAN SELAT LEMBEH KOTA BITUNG ». PHARMACON 8, n^o 1 (28 février 2019) : 127. http://dx.doi.org/10.35799/pha.8.2019.29246.

Texte intégral

Résumé :

ABSTRACTAplysina sp. Sponge is one of the marine biota making up coral reefs that contain active compounds whose percentage of activity is greater than the compounds produced by land plants. This study aims to determine the activity of antioxidant compounds from the ethanol extract of Aplysina sp. from Lembeh Strait Waters, Bitung City. Sponge Aplysina sp., was extracted by maceration with ethanol as a solvent. As a parameter, testing of antioxidant activity was carried out using the DPPH (1,1-diphenyl-2-picrylhydrazyl) method, which was measured using UV-Vis Spectrophotometry at a wavelength of 517 nm. The result showed the ethanol extract of Aplysina sp., sponge proven to have antioxidant activity in each concentration test. The highest concentration has an antidote to free radical activity by reaching a percentage of 46,13%. Keywords: Aplysina sp. Sponge, Antioxidant, Extraction, DPPH ABSTRAKSpons Aplysina sp. merupakan salah satu biota laut penyusun terumbu karang yang mengandung senyawa aktif yang presentase keaktifannya lebih besar dibandingkan dengan senyawa-senyawa yang dihasilkan oleh tumbuhan darat. Penelitian ini bertujuan untuk mengetahui aktivitas senyawa antioksidan dari ekstrak etanol Spons Aplysina sp. dari Perairan Selat Lembeh, Kota Bitung. Spons Aplysina sp. diekstraksi menggunakan metode maserasi dengan etanol sebagai pelarut. Sebagai parameter, pengujian aktivitas antioksidan dilakukan dengan metode DPPH (1,1-difenil-2-pikrilhidrazil) yang diukur menggunakan Spektrofotometri UV-Vis pada panjang gelombang 517 nm. Hasil penelitian menunjukkan ekstrak etanol spons Aplysina sp. terbukti memiliki aktivitas antioksidan disetiap konsentrasi pengujian.Konsentrasi tertinggi memiliki aktivitas penangkal radikal bebas dengan mencapai presentase 46,13%. Kata Kunci : Spons Aplysina sp, Antioksidan, Ekstraksi, DPPH

Styles APA, Harvard, Vancouver, ISO, etc.

23

Schram, Shifa A., Reiny A. Tumbol et Reni L. Kreckhoff. « The Use Of Marine Sponge Crude Extract To Improve The Resistance Of Tilapia Fish (Oreochromis niloticus) To Streptococcus agalactiae Infections ». JURNAL ILMIAH PLATAX 7, n^o 2 (2 juillet 2019) : 347. http://dx.doi.org/10.35800/jip.7.2.2019.23723.

Texte intégral

Résumé :

This study aims to examine the effect of the use of crude marine sponge extract on the resistance of streptococcus agalactiae infection in tilapia, Oreochromis niloticus, and to establish the effective dose of crude sponge extract in improving the immune system and the growth of the fish. The sponge used in the study was Cribrochalina sp. taken from Malalayang waters, Manado. The fish were taken from Freshwater Aquaculture Center, Tatelu. The fish were acclimatized for a week. After being acclimatized the fish were given feed added with sponge crude extract as a treatment with different concentrations of 20 g, 40 g and 60 g / Kg of feed for 14 days as much as 5% / body weight / day with the frequency of feeding twice a day at 10:00 am and at 5:00 p.m. After being treated, the fish was challenged with S. agalactiae. The data collected consisted of tilapia resistance, Total Leukocyte Count (TLC) as immune parameters and absolute growth. The results showed that the addition of crude extracts of Cribrochalina sp. into feed can increase TLC and growth of tilapia (p <0.05). The best results were achieved in fish fed with the addition of sponge crude extract of 40 g/kg feed. The survival rate of tilapia fed with treatment diet then challenged with pathogenic bacteria S. agalactiae showed the best results (100% survival rate) compared to controls (75%). In conclusion, feeding with a crude extract of Cribrochalina sp. has the potential to increase the immune system and growth of tilapia.Keywords: Crude Extract, Marine Sponges, Cribrochalina sp., Tilapia, Resistance, Streptococcus agalactiaeABSTRAKPenelitian ini bertujuan untuk mengkaji pengaruh penggunaan ekstrak kasar spons laut terhadap resistensi ikan nila dalam menghadapi serangan Streptococcus agalactiae, mengidentifikasi spons yang digunakan, serta mengukur pengaruh serta menetapkan dosis pemberian ekstrak kasar spons untuk meningkatkan sistem imun dan pengaruhnya terhadap pertumbuhan ikan nila. Spons yang digunakan dalam penelitian adalah spons Cribrochalina sp. yang diambil dari perairan Malalayang. Ikan uji diambil dari Balai Budidaya Air Tawar Tatelu, Provinsi Sulawesi Utara. Ikan diaklimatisasi selama seminggu. Setelah diaklimatisasi ikan diberi pakan yang ditambahkan dengan ekstrak kasar spons sebagai perlakuan dengan konsentrasi berbeda yaitu 0 g, 20 g, 40 g dan 60 g/kg pakan selama 14 hari sebanyak 5%/berat tubuh/hari dengan frekuensi pemberian pakan dua kali sehari yaitu jam 10.00 pagi dan jam 17.00 sore. Setelah diberi perlakuan, ikan diuji tantang dengan bakteri S. agalactiae. Data yang dikumpulkan terdiri dari kelangsunganhidup ikan nila. Total leukosit sebagai parameter imun dan pertumbuhan mutlak. Hasil penelitian mendapatkan bahwa penambahan ekstrak kasar spons Cribrochalina sp. ke dalam pakan mampu meningkatkan total leukosit dan pertumbuhan ikan nila (p<0.05). Dimana hasil terbaik dicapai pada ikan yang diberi pakan dengan penambahan ekstrak kasar spons sebanyak 40 g/kg pakan. Kelangsungan hidup ikan nila yang diberi pakan perlakuan yang diuji tantang dengan bakteri patogen menunjukkan hasil yang paling baik (tingkat kelangsungan hidup 100%) dibandingkan dengan kontrol (75%). Sebagai kesimpulan bahwa pemberian pakan dengan ekstrak kasar spons Cribrochalina sp. berpotensi untuk meningkatkan sistem kekebalan tubuh dan pertumbuhan pada ikan nila.Kata Kunci: Ekstrak kasar, Spons laut, Cribrochalina sp., Tilapia, Resistensi, Streptococcus agalactiae

Styles APA, Harvard, Vancouver, ISO, etc.

24

Tumiwa, Priscila Irene, Adithya Yudistira et Defny S. Wewengkang. « AKTIVITAS ANTIMIKROBA EKSTRAK ETIL ASETAT JAMUR LAUT YANG DIISOLASI DARI ORGANISME LAUT SPONS Phylospongioa lamellosa YANG DIAMBIL DARI PERAIRAN DESA TUMBAK, KECAMATAN PUSOMAEN, KABUPATEN MINAHASA TENGGARA TERHADAP MIKROBA Staphylococcus aureus, Escherichia coli, dan Candida albicans ». PHARMACON 8, n^o 4 (28 novembre 2019) : 851. http://dx.doi.org/10.35799/pha.8.2019.29362.

Texte intégral

Résumé :

ABSTRACT Sponges are multi-cell marine invertebrates whose tissue and organ functions are very simple which live in coral reef ecosystems. Sponges are known to produce bioactive compounds because of their symbiotic relationships with microorganisms so that they have the potential to be developed in the field of medicine including as an antimicrobial. This study aims to determine whether the fungus associated with Phyllospongia lamellose sponge taken from the waters of, Southeast Minahasa Regency has antimicrobial activity. This research includes sampling, isolation and fungal inoculation, fermentation, extraction with acetone and then fractionated with ethyl acetate solvent,dried until it gets crude extracts and is carried out as well as antimicrobial testing against Staphylococcus aureus, Escherichia coli, and Candida albicans. Antimicrobial activity was obtained from inhibitory zones formed around the paper disk against the test microbes. From the results of the study concluded that the fungus associated with the Phyllospongia lamellose sponge has antimicrobial activity against the bacteria Staphylococcus aureus, Escherichia coli, and Candida albicans. Keywords: Phyllospongia lamellose sponge, Antimicrobial, Stapylococcus aureu, Escherichia coli, Candida albicans. ABSTRAK Spons merupakan invertebrata laut multi sel yang fungsi jaringan dan organnya sangat sederhana yang hidup pada ekosistem terumbu karang. Spons diketahui menghasilkan senyawa bioaktif karena adanya hubungan simbiotik dengan mikro organisme sehingga berpotensi untuk dikembangkan dalam bidang pengobatan diantaranya sebagi antimikroba. Penelitian ini bertujuan untuk mengetahui apakah jamur yang berasosiasi dengan spons Phyllospongia lamellose yang diambil dari perairan Desa Tumbak, Kecamatan Posumaen, Kabupaten Minahasa Tenggara memiliki aktivitas antimikroba. Penelitian ini meliputi kegiatan pengambilan sampel spons Phyllospongia lamellose, isolasi dan inokulasi jamur yang berasosiasi dengan spons, fermentasi, ektraksi dengan aseton kemudian difraksinasi dengan pelarut etil asetat, dikeringkan hingga mendapat ekstrak kasar dan dilakukan serta pengujian antimikroba terhadap bakteri Staphylococcus aureus, Escherichia coli, dan jamur Candida albicans. Aktivitas antimikroba didapatkan dari zona hambat yang terbentuk disekitaran cakram kertas terhadap mikroba uji. Dari hasil penelitian disimpulkan bahwa jamur yang berasosiasi dengan spons Phyllospongia lamellose memiliki aktivitas antimikroba terhadap bakteri Staphylococcus aureus, Escherichia coli, dan jamur Candida albicans. Kata Kunci : Spons Phyllospongia lamellose, Antimikroba, Stapylococcus aureu, Escherichia coli, Candida albicans.

Styles APA, Harvard, Vancouver, ISO, etc.

25

Setyadji, Bram, et Sisco Panggabean. « PENGARUH SUBSTRAT DAN KEDALAMAN TERHADAP PERTUMBUHAN SPONS (Callyspongia sp.) DI PERAIRAN JEPARA ». BAWAL Widya Riset Perikanan Tangkap 3, n^o 3 (7 février 2017) : 175. http://dx.doi.org/10.15578/bawal.3.3.2010.175-181.

Texte intégral

Résumé :

Potensi spons sebagai bioindikator (biomonitoring dan biomarker), bioremidiasi maupun untuk kebutuhan farmasi dan komersial telah banyak diidentifikasi melalui penelitian-penelitian sebelumnya. Penelitian ini bertujuan untuk memberikan informasi dasar mengenai pengaruh faktor lingkungan (substrat dan kedalaman perairan) terhadap pertumbuhan spons Callyspongia sp. Penelitian ini menggunakan metode eksperimental. Hasil penelitian menunjukan rata-rata laju pertumbuhan panjang spons Callyspongia sp. lebih tinggi pada kedalaman 2 m dibandingkan 1 m pada substrat ban dan jaring. Hubungan antara spons dengan substrat tidak menunjukan perbedaan yang berarti,sedangkan kedalaman diduga merupakan faktor yang lebih berpengaruh terhadap pertumbuhan spons jenis ini. The use of sponge as bioindicator (biomonitoring and biomarker), bioremidiation and pharmaceutical purposes have been widely reported in many studies. However little is known about knowledge of their biological and ecological aspect. The aim of this study was to presents basic information about the influence of substrate and depth on growth of Callyspongia sp. The results showed that the average of length growth of Callyspongia sp. in the water depth 2 m more higher than1 m in both net and tire subtrates here were no differences of growth between net and tire as a substrate, while depth was likely put more influence on the growth of this sponge.

Styles APA, Harvard, Vancouver, ISO, etc.

26

Murniasih, Tutik, Joko Tri Wibowo, Masteria Yunovilsa Putra, Febriana Untari et Mery Maryani. « Pengaruh Nutrisi Dan Suhu Terhadap Selektivitas Potensi Antibakteri Dari Bakteri Yang Berasosiasi Dengan Spons ». Jurnal Kelautan Tropis 21, n^o 1 (3 avril 2018) : 65. http://dx.doi.org/10.14710/jkt.v21i1.2084.

Texte intégral

Résumé :

Abstract The Influence of nutrient and temperature to the antibacterial selectivity of Sponge Associated-Bacteria Production of pharmacological activity by marine microorganism is strongly influenced by nutrition and environmental conditions. In this study would discuss about the influence of several type of media to the production of antibacterial agent by sponge-. associated microorganisms. About 3 sponges tissue Theonella sp, Callispongia sp. and Lithistide sp. collected from Seribu Island will be used for the host of associated microorganism. Agar medium used for isolation were M1 that contained amylum, yeast extract and peptone, M2 (10% marine broth media) contained yeast extract and peptone, M3 only sea water without adding any nutrients. Beside the nutrient variation, heat sock treatment at 50oC toward the sponge solution also apply to this study. The bacterial isolation data indicated that bacterial density in (CFU/100µL) of Theonella sp, Callispongia sp. and Lithistide sp. were minimum when spreading in M3 medium with heat sock treatment. This data showed that limiting in nutrient and heating could increasing bacterial selectivity. The antibacterial activity capability of bacterial strains isolated using M1, M2 and M3 respectively in range were 81,8-90,9%; 50-87,5% and; 66,7 -100%. This results showed that less nutrient of media will rise the number of antibacterial activity strains,and decreasing of bacterial density. This study reported that the minimum nutrient of isolation media and heat shock treatment could be used for selecting the antibacterial strains of sponge associated bacteria. Keywords : isolation media, antibacterial, nutrient, microbial symbiont AbstrakAktifitas farmakologi yang dihasilkan oleh mikroorganisme laut sangat dipengaruhi oleh nutrisi dan kondisi lingkungan. Hal tersebut mendorong untuk digali lebih dalam tentang aspek-aspek yang mempengaruhi seleksi mikroba potensial pada spons. Metode isolasi mikroba dari jaringan spons menjadi kunci dalam menguak potensi mikroba simbionnya. Dalam penelitian ini akan membahas pengaruh berbagai media isolasi bakteri yang berasosiasi dengan spons asal Kep. Seribu. Terhadap 3 specimen spons Theonella sp., Callispongia sp. dan Lithistide sp. dilakukan isolasi bakteri dengan metode direct sampling menggunakan media M1, M2 dan M3. Media M1 mengandung nutrisi antara lain amilum, ekstrak khamir dan pepton, sedangkan media M2 mengandung sumber nutrisi ekstrak khamir dan pepton dan M3 hanya media agar dan air laut. Selain variasi nutrient dalam media, perlakuan pemanasan pada suhu 50oC juga akan dilakukan terhadap larutan sampel spons sebelum dilakukan penyebaran pada media isolasi. Hasil isolasi bakteri yang diisolasi spons Theonella sp, Callispongia sp. dan Lithistide sp. menunjukkan bahwa kepadatan minimum diperoleh dengan menggunakan media M3 dengan perlakuan pemanansan. Dari data isolasi bakteri menunjukkan bahwa selain kandungan nutrient yang minimum, perlakuan pemanasan akan menurunkan kepadatan jumlah bakteri yang tumbuh, sehingga pemanasan merupakan salah satu cara dalam seleksi isolasi bakteri yang berasosiasi dengan spons. Hasil analisis aktivitas antibakteri menunjukkan bahwa persentase strain-strain bakteri yang aktif terhadap antimikroba Vibrio eltor, Eschericia coli dan Bacillus subtilis dengan variasi media M1 berkisar antara 81,8-90,9%; M2 berkisar 50-87,5% dan M3 berkisar 66,7-100%. Dari data tersebut disimpulkan bahwa semakin sedikitnya nutrisi media isolasi maka semakin tingginya mikroba-mikroba potensial penghasil antibiotik. Media M3 merupakan media yang selektif untuk isolasi mikroba potensial dari spons, terbukti dengan tingginya prosentase bakteri yang aktif dan berkurangnya jumlah koloni yang tumbuh.Kata kunci : media isolasi, antibakteri, nutrisi, mikroba simbion

Styles APA, Harvard, Vancouver, ISO, etc.

27

Larasati, Stefanie Jessica Henny, Agus Sabdono et Mada Triandala Sibero. « Identifikasi Molekuler Kapang Asosiasi Spons menggunakan Metode DNA Barcoding ». Journal of Marine Research 10, n^o 1 (14 février 2021) : 48–54. http://dx.doi.org/10.14710/jmr.v10i1.28334.

Texte intégral

Résumé :

Spons merupakan organisme yang memiliki pori-pori dan termasuk kedalam filum Porifera. Hewan ini merupakan filter feeders dimana spons menyaring makanannya masuk kedalam rongga tubuhnya, sehingga spons dapan memakan partikel organik algae, dan mikroba, termasuk kapang. Kapang merupakan mikroorganisme eukariotik dari kingdom fungi, multiseluler, menghasilkan miselium tanpa pembentukan badan buah. Kapang dapat berfungsi sebagai penjaga keseimbangan ekosistem di perairan. Tujuan dari penelitian ini adalah mengidentifikasi dua isolat kapang yang telah diisolasi dari inang spons di ekosistem mangrove dengan menggunakan DNA barcoding. Metode dalam penelitian ini yaitu peremajaan isolat, karakterisasi morfologi yaitu warna koloni, tekstur, reverse, exudates, sclerotia, bentuk konidia, konidiofor, spora, dan septa. Identifikasi molekuler dari ekstraksi DNA, amplifikasi, elektroforesis, visualisasi DNA, sekuens dan BLAST. Optimasi suhu annealing dilakukan pada amplifikasi DNA. Berdasarkan identifikasi molekuler dengan menggunakan primer universal ITS1 5' TCCGTAGGTGAACCTGCGG 3' dan ITS4 5' TCCTCCGCTTATTGATATGC 3' dan persamaan homologi, isolat MKMS 2.1 merupakan Trichoderma reesei (100%) dan PKMS 2.2 merupakan spesies Fusarium solani (99,81%). A sponge is an organism that has pores and belongs to the Porifera phylum. These animals are filter feeders where the sponge filters its food into the body cavity, so the sponge can eat organic algae particles, and microbes, including fungi. Mold is a eukaryotic microorganism from Fungi kingdom, multicellular, that forms mycelium without fruiting body formation. Mold has an important role in balancing the environmental quality in an ecosystem. The purpose of this study was to identify two molds that had been isolated from sponge in the mangrove ecosystem using DNA barcoding. The study was conducted in April-October 2019 in Laboratory of Tropical Marine Biotechnology using the experimental laboratory method. The methods in this research were isolation refreshment, morphological characterization which were consisted of colony color, texture, reverse, exudates, sclerotia, conidia, conidiophores, spores, and septa. Molecular identification consisted of DNA extraction, amplification, electrophoresis, DNA visualization, sequences and BLAST. Annealing temperature optimization is carried out on DNA amplification. Based on molecular identification using universal primers ITS1 5 'TCCGTAGGTGAACCTGCGG 3' and ITS4 5 'TCCTCCGCTTATTGATATGC 3' and homological equations, MKMS 2.1 isolates were identified as Trichoderma reesei (100%) and PKMS 2.2 were identified as Fusarium solani (99.81%).

Styles APA, Harvard, Vancouver, ISO, etc.

28

SWANTARA, I. MADE DIRA, et WIWIK SUSANAH RITA. « Aktivitas Antikanker Ekstrak Spons Hyrtios Erecta ». Indonesian Journal of Cancer 9, n^o 4 (5 décembre 2015) : 141. http://dx.doi.org/10.33371/ijoc.v9i4.396.

Texte intégral

Résumé :

ABSTRACTAnticancer activity test of the ethanol extract of sponge Hyrtios erecta from Pari Island beach (Jakarta) has been conducted. Extraction of the sponge was carried out by 70% ethanol at room temperature. Toxicity screening test was carried out based on Bhrine Shrimp Lethality Test (BSLT). Invitro anticancer activity test of the extract was carried out using HeLa cell line. Based on the results, it was found that ethanol extract of Hyrtios erecta sponges has anticancer activity with LC50 of 26.35 ppm.ABSTRAKTelah dilakukan uji antikanker ekstrak etanol spons Hyrtios erecta yang berasal dari perairan Pulau Pari Kepulauan Seribu, Jakarta. Ekstraksi dilakukan dengan cara maserasi menggunakan etanol 70% pada temperatur kamar. Skrining toksisitas dilakukan dengan metode Bhrine Shrimp Lethality Test (BSLT). Uji antikanker secara invitro ekstrak tersebut menggunakan sel HeLa. Berdasarkan hasil penelitian ini diperoleh bahwa ekstrak etanol spons Hyrtios erecta bersifat antikanker dengan harga LC50 sebesar 26,35 ppm.

Styles APA, Harvard, Vancouver, ISO, etc.

29

Macpal, Fransisca, Adithya Yudistira et Defny S. Wewengkang. « UJI AKTIVITAS ANTIMIKROBA DARI JAMUR LAUT YANG BERASOSIASI DENGAN ORGANISME LAUT SPONS Callyspongia aerizusa ». PHARMACON 8, n^o 4 (28 novembre 2019) : 1007. http://dx.doi.org/10.35799/pha.8.2019.29382.

Texte intégral

Résumé :

ABSTRACTSponge is the lowest level hollow animal without a spine. Sponges are one of the components of coral reef biota that have bioactive potential that has not been widely used. This study aims to determine whether there is antimicrobial activity of marine fungi associated with sponge Callyspongia aerizusa obtained from Southeast Minahasa Regency, North Sulawesi, against the growth of microbes such as Staphylococcus aureus, Escherichia coli and Candida albicans. Samples were obtained then extracted by maceration using acetone and fractionated using liquid-liquid fractionation with ethyl acetate solvents. The results of this study indicate that the extract from the fungus associated with the Callyspongia aerizusa sponge has activity against Escherichia coli and Candida albicans. Keywords: Antimicrobials, Callyspongia aerizusa, Candida albicans, Escherichia coli, Marine fungi, Staphylococcus aureus. ABSTRAKSponge (spons laut) adalah hewan berongga tanpa tulang belakang yang paling rendah tingkatannya. Spons merupakan salah satu komponen biota penyusun terumbu karang yang mempunyai potensi bioaktif yang belum banyak dimanfaatkan. Penelitian ini bertujuan untuk mengetahui apakah terdapat aktivitas antimikroba dari jamur laut yang berasosiasi dengan spons Callyspongia aerizusa yang di peroleh dari Kabupaten Minahasa Tenggara, Sulawesi Utara, terhadap pertumbuhan mikroba seperti Staphylococcus aureus, Escherichia coli dan Candida albicans. Sampel diperoleh kemudian diekstraksi secara maserasi dengan aseton dan difraksinasi dengan menggunakan fraksinasi cair-cair menggunakan pelarut etil asetat. Hasil penelitian ini menunjukkan bahwa ekstrak dari jamur yang berasosiasi dengan spons Callyspongia aerizusa memiliki aktivitas terhadap bakteri Escherichia coli dan bakteri Candida albicans. Kata kunci: Antimikroba, Callyspongia aerizusa, Candida albicans Escherichia coli,.Jamur laut, Staphylococcus aureus

Styles APA, Harvard, Vancouver, ISO, etc.

30

Tunggali, Sitti N., Herny E. I. Simbala et Henki Rotinsulu. « UJI DAYA HAMBAT EKSTRAK DAN FRAKSI SPONS Aaptos Aaptos TERHADAP PERTUMBUHAN Escherichia coli, Staphylococcus aureus, dan Candida albicans ». PHARMACON 8, n^o 1 (28 février 2019) : 168. http://dx.doi.org/10.35799/pha.8.2019.29251.

Texte intégral

Résumé :

ABSTRACT Sponge Aaptos aaptos is a marine biota that has great potential, which can be applied, in the pharmaceutical field because of the presence of large compounds in inhibiting microbial growth. This study aims to determine the inhibitory activity of extracts and fractions of sponge Aaptos aaptos on microbial growth of Escherichia coli, Staphylococcus aureus, and Candida albicans. The samples were extracted by maceration with 96 % ethanol and fractioned with n-hexane, choloroform and methanol. Testing is done using the Disc Diffusion Agar method. Crude ethanol extract and fraction of sponge Aaptos aaptos showed the greatest antimicrobial activity against Staphylococcus aureus and categorized as strong, with an average value of 20.32 mm for ethanol extract with strong categories, chloroform fraction 13,28 mm with medium category and methanol fractions 18,48 mm strong category. Keyword: Aaptos aaptos, antimicrobial activity, Escherichia coli, Staphylococcus aureus, Candida albicans. ABSTRAK Spons Aaptos aaptos merupakan biota laut yang memiliki potensi sebagai antimikroba yang dapat diterapkan di bidang farmasi dengan kandungan senyawa yang besar dalam menghambat pertumbuhan mikroba. Penelitian ini bertujuan untuk mengetahui aktivitas daya hambat dari ekstrak dan fraksi spons Aaptos aaptos terhadap pertumbuhan mikroba Escherichia coli, Staphylococcus aureus, dan Candida albicans. Sampel diekstraksi secara maserasi dengan etanol dan difraksinasi dengan pelarut n–heksan, kloroform dan metanol. Pengujian dilakukan dengan menggunakan metode Disc Diffusion Agar. Ekstrak kasar etanol dan fraksi dari Spons Aaptos aaptos menunjukkan aktivitas antimikroba paling besar terhadap Staphylococcus aureus dan dikategorikan kuat, dengan nilai rata – rata 20,32 mm untuk ekstrak etanol dengan kategori kuat, fraksi kloroform 13,28 mm, kategori sedang dan fraksi metanol 18,48 mm kategori kuat.Kata Kunci : Aaptos aaptos, aktivitas antimikroba, Escherichia coli, Staphylococcus aureus, Candida albicans

Styles APA, Harvard, Vancouver, ISO, etc.

31

Ehrlich, Hermann, Oksana V. Kaluzhnaya, Mikhail V. Tsurkan, Alexander Ereskovsky, Konstantin R. Tabachnick, Micha Ilan, Allison Stelling et al. « First report on chitinous holdfast in sponges (Porifera) ». Proceedings of the Royal Society B : Biological Sciences 280, n^o 1762 (7 juillet 2013) : 20130339. http://dx.doi.org/10.1098/rspb.2013.0339.

Texte intégral

Résumé :

A holdfast is a root- or basal plate-like structure of principal importance that anchors aquatic sessile organisms, including sponges, to hard substrates. There is to date little information about the nature and origin of sponges’ holdfasts in both marine and freshwater environments. This work, to our knowledge, demonstrates for the first time that chitin is an important structural component within holdfasts of the endemic freshwater demosponge Lubomirskia baicalensis . Using a variety of techniques (near-edge X-ray absorption fine structure, Raman, electrospray ionization mas spectrometry, Morgan–Elson assay and Calcofluor White staining), we show that chitin from the sponge holdfast is much closer to α-chitin than to β-chitin. Most of the three-dimensional fibrous skeleton of this sponge consists of spicule-containing proteinaceous spongin. Intriguingly, the chitinous holdfast is not spongin-based, and is ontogenetically the oldest part of the sponge body. Sequencing revealed the presence of four previously undescribed genes encoding chitin synthases in the L. baicalensis sponge. This discovery of chitin within freshwater sponge holdfasts highlights the novel and specific functions of this biopolymer within these ancient sessile invertebrates.

Styles APA, Harvard, Vancouver, ISO, etc.

32

Liempepas, Angelika, Widya A. Lolo et Paulina V. Y. Yamlean. « ISOLASI DAN UJI ANTIBAKTERI DARI ISOLAT BAKTERI YANG BERASOSIASI DENGAN SPONS Callyspongia aerizusa SERTA IDENTIFIKASI SECARA BIOKIMIA ». PHARMACON 8, n^o 2 (28 mai 2019) : 380. http://dx.doi.org/10.35799/pha.8.2019.29304.

Texte intégral

Résumé :

ABSTRACT Sponge Callyspongia aerizusa contain potential bioactive compound that can be utilized in the health sector. Extract of sea sponge Callyspongia aerizusa, can hamper the growth of Salmonella typhi bacteria, Streptococcus pyogenes, Shigella and Staphylococcus epidermidis. The aim of this study was to test the antibacterial activity against Escherichia coli and Staphylococcus aureus bacteria and identify the type of symbionic bacteria of Callyspongia aerizusa sponge based on their physiological and biochemical characteristics. The method of testing the antibacterial activity was agar diffusion method (Kirby and Baurer diffusion disc). There were three bacterial isolates namely T1, T2, and T3 isolates. The result showed that T1, T2, and T3bacterial isolates had antibacterial activity against Escherichia coli and Staphylococcus aureus test bacteria. Based on the biochemical test, T2bacterial isolates were identified as Bronchothrix bacteria and T1and T3 bacterial identified as Desulfotomaculum. Keywords: Callyspongia aerizusa, Antibacterial activity, symbiont bacteria, Biochemical Identification ABSTRAKSpons Callyspongia aerizusa memiliki kandungan senyawa bioaktif potensial yang dapat dimanfaatkan dibidang kesehatan. Ekstrak spons laut Callyspongia aerizusa dapat menghambat pertumbuhan bakteri Salmonella typhi, Streptococcus pyogenes, Shigella dan Staphylococcus epidermidis. Penelitian ini bertujuan untuk menguji aktivitas antibakteri dari bakteri simbion spons Callyspongia aerizusa terhadap bakteri Escherichia coli dan Staphylococcuc aureus dan mengidentifikasi jenis bakteri simbion spons Callyspongia aerizusa berdasarkan karakteristik fisiologis dan biokimianya. Metode pengujian aktivitas antibakteri yang digunakan yaitu metode difusi agar (disc diffusion Kirby and Baurer). Terdapat tiga isolat bakteri yaitu isolat T1, T2, dan T3. Hasil penelitian menunjukan bahwa isolat bakteri T1, T2, dan T3 memiliki aktivitas antibakteri terhadap bakteri uji Escherichia coli dan Staphylococcuc aureus. Berdasarkan uji biokima, isolat bakteri T2 diduga sebagai bakteri Brochothrix dan isolat bakteri T1 dan T3 diduga sebagai bakteri Desulfotomaculum.Kata kunci: Callyspongia aerizusa, Aktivitas antibakteri, Bakteri simbion, Identifikasi Biokimia

Styles APA, Harvard, Vancouver, ISO, etc.

33

Maisaroh, Dian Sari, Yahya Abdillah Al Hanif, Misbakhul Munir et Nor Sa'adah. « Uji Ekstrak Spons Laut Jenis Ptilocaulis marquezii dari Perairan Kendit sebagai Potensi Antibakteri Escherichia coli ». Journal of Marine Research 12, n^o 1 (1 février 2023) : 161–66. http://dx.doi.org/10.14710/jmr.v12i1.36278.

Texte intégral

Résumé :

Guna mengetahui potensi bioaktivitas senyawa yang terkandung serta mengetahui uji ekstrak spons Ptilocaulis marquezii terhadap pertumbuhan bakteri Eschercia coli. Penelitian dilakukan secara eksperimen berupa uji ekstrak berupa pembuatan ekstrak spons Ptilocaulis marquezii dengan maserasi serta evaporasi dengan rotary vacuum evaporator pada suhu 40°C hingga ekstrak terbentuk. Dilakukan pengujian dengan metode Difusi cakram atau Kirby-Bauer test. Pengujian fitokimia guna mengetahui kandungan senyawa aktif. Hasil yang diperoleh didapatkan ekstrak dengan konsentrasi 40% yang memiliki kemampuan sedang. Pada uji fitokimia mengandung alkoloid dan triptenoid. Ekstrak spons Ptilocaulis marquezii pada konsentrasi 40% dengan zona hambat sebesar 9.5 mm dalam kategori sedang dan pada konsentrasi lainnya yaitu 10%, 20%, 60% dan 80% berkategori lemah. Senyawa alkaloid menghambat pertumbuhan Escherichia Coli dengan merusak susunan peptidoglycan. Pada senyawa triterpenoid merusak membran plasma pada bakteri Escherichia coli. Knowing the potential bioactivity of the compounds contained and knowing the test of the extract of the Ptilocaulis marquezii sponge of Eschercia coli bacteria. The research was carried out experimentally in the form of extract testing in the form of making Ptilocaulis marquezii sponge extract by maceration and evaporation with a rotary vacuum evaporator at a temperature of 40°C until the extract was formed. The test was carried out using the disc diffusion method or the Kirby-Bauer test. Phytochemical testing to determine the content of active compounds. The results obtained were extracts with a concentration of 40% which had moderate abilities. The phytochemical test contains alkaloids and triptenoids. Ptilocaulis marquezii sponge extract at a concentration of 40% with an inhibition zone of 9.5 mm in the medium category and at other concentrations of 10%, 20%, 60% and 80% in the weak category. Alkaloids inhibit the growth of Escherichia Coli by destroying the peptidoglycan structure. The triterpenoid compounds damage the plasma membrane of Escherichia coli bacteria.

Styles APA, Harvard, Vancouver, ISO, etc.

34

Liang, Yong-Qian, Xiao-Jian Liao, Bing-Xin Zhao et Shi-Hai Xu. « Novel 3,4-seco-3,19-dinorspongian and 5,17-epoxy-19-norspongian diterpenes from the marine sponge Spongia sp. » Organic Chemistry Frontiers 7, n^o 20 (2020) : 3253–61. http://dx.doi.org/10.1039/d0qo00977f.

Texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

35

Ratu, Kartini, Herny E. I. Simbala et Henki Rotinsulu. « UJI AKTIVITAS ANTIMIKROBA EKSTRAK DAN FRAKSI SPONS Phyllospongia lamellosa DARI PERAIRAN TUMBAK, MINAHASA TENGGARA TERHADAP PERTUMBUHAN MIKROBA Escherichia coli, Staphylococcus aureus DAN Candida albicans ». PHARMACON 8, n^o 4 (28 novembre 2019) : 815. http://dx.doi.org/10.35799/pha.8.2019.29358.

Texte intégral

Résumé :

ABSTRACT Sponges are a component of coral reef biota. These sea animals are known to contain compounds that have the potential to be developed in the field of medicine, including as an antimicrobial. This study aims to determine the antimicrobial activity of Phyllospongia lamellosa sponge against the growth of Staphylococcus aureus, Escherichia coli and Candida albicans collected in the waters of Tumbak, Posumaen District, Southeast Minahasa. The antimicrobial activity test was carried out by agar diffusion method. The results showed that the extract and fraction of Phyllospongia lamellose had antimicrobial activity seen in the inhibition zone formed around the paper disk against the test microbes. Ethanol extrack and fraction from Phyllospongia lamellosa sponge showed the greatest antimicrobial activity against Candida albicans with an average value of 13,33 mm was categorized as strong , than in Staphylococcus aureus with an average value of 13 mm is categorized as strong and on Escherichia coli 11 mm categorized as strong. Keywords :Phyllospongia lamellosa, antimicrobial activity, Escherichia coli, Staphylococcus aureus, Candida albicans ABSTRAK Spons merupakan salah satu komponen biota penyusun terumbu karang. Hewan laut ini diketahui mengandung senyawa- senyawa yang berpotensi untuk dikembangkan dalam bidang pengobatan, diantaranya sebagai antimikroba. Penelitian ini bertujuan untuk mengetahui aktivitas antimikroba spons Phyllospongia Lamellosa terhadap pertumbuhan Staphylococcus aureus, Escherichia coli dan Candida albicans yang diambil pada perairan Tumbak Kecamatan Posumaen, Minahasa Tenggara. Uji aktifitas antimikroba dilakukan dengan metode difusi agar. Hasil penelitian menunjukkan bahwa ekstrak dan fraksi spons Phyllospongia lamellose memiliki aktifitas antimikroba dilihat zona hambat yang terbentuk disekitar cakram kertas terhadap mikroba uji. Ekstrak etanol dan fraksi dari Spons Phyllospongia lamellosa menunjukkan aktivitas antimikroba paling kuat terhadap candida albicans dengan nilai rata-rata 13,33 mm dikategorikan kuat, kemudian pada Staphylococcus aureus dengan nilai rata-rata 13 mm dikategorikan kuat, dan pada Escherichia coli 11 mm dikategorikan kuat. Kata Kunci : Phyllospongia lamellosa, aktivitas antimikroba, Escherichia coli, Staphylococcus aureus, Candida albicans

Styles APA, Harvard, Vancouver, ISO, etc.

36

Phan, Chin-Soon, Takashi Kamada, Toshiyuki Hamada et Charles S. Vairappan. « Cytotoxic Sesterterpenoids from Bornean Sponge Spongia sp. » Records of Natural Products 12, n^o 6 (30 juin 2018) : 643–47. http://dx.doi.org/10.25135/rnp.69.18.01.209.

Texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

37

Sun, Dong-Yu, Guan-Ying Han, Na-Na Yang, Le-Fu Lan, Xu-Wen Li et Yue-Wei Guo. « Racemic trinorsesquiterpenoids from the Beihai sponge Spongia officinalis : structure and biomimetic total synthesis ». Organic Chemistry Frontiers 5, n^o 6 (2018) : 1022–27. http://dx.doi.org/10.1039/c7qo01091e.

Texte intégral

Résumé :

Two rare new furan butanolides, sponalisolides A (1) and B (2), were isolated from the Beihai sponge Spongia officinalis, and fully characterized by extensive spectroscopic analysis and biomimetic total synthesis.

Styles APA, Harvard, Vancouver, ISO, etc.

38

Rangian, Liviani, Elvy Like Ginting, Stenly Wullur, Erly Kaligis, Sandra Tilaar et Reiny Tumbol. « Amplification Of Bacterial Isolate Sf1 Associated With Sponge Facaplysynopsis sp. From Tongkeina, North Sulawesi ». JURNAL ILMIAH PLATAX 6, n^o 2 (31 juillet 2018) : 77. http://dx.doi.org/10.35800/jip.6.2.2018.20636.

Texte intégral

Résumé :

This study was conducted with the aim of amplifying the isolate of SF1 symbiont sponge Facaplysynopsis sp. from Tongkeina, North Sulawesi. Samples are obtained and stored in the Lab. Molecular Biology and Marine Pharmacology, FPIK Unsrat. The genomic DNA of the samples was isolated using protocols from the Innu PREP Mini DNA Kit. The DNA of the SF1 symbionary bacteria was amplified by PCR (Polymerase Chain Reaction) using an 8F primer (5'-AGAGTITGATCCTGGCTA-3 ') and 1492 R (5'TACCTTACGACTT-3'). DNA bacteria SF1 successfully amplified marked by the appearance of the band of DNA that looks less clear, with a length of 600 bp.Keywords: Bacterial Isolate, Sponge, AmplificationABSTRAKPenelitian ini dilakukan dengan tujuan mengamplifikasi isolat bakteri SF1 simbion spons Facaplysynopsis sp dari perairan Tongkeina, Sulawesi Utara. Sampel diperoleh dan tersimpan di Lab. Biologi Molekuler dan Farmasitika Laut, FPIK Unsrat. DNA genom dari sampel diisolasi menggunakan protokol dari Innu PREP DNA Mini Kit. DNA bakteri simbion SF1 diamplifikasi dengan PCR (Polymerase Chain Reaction) dengan menggunakan primer 8F (5’-AGAGTITGATCCTGGCTA-3’) dan 1492 R (5’TACCTTACGACTT-3’). DNA bakteri SF1 berhasil diamplifikasi ditandai dengan munculnya pita DNA yang terlihat kurang jelas, dengan panjang 600 bp.Kata Kunci: Bakteri Simbion, Spons, Amplifikasi

Styles APA, Harvard, Vancouver, ISO, etc.

39

Luntungan, Brigita Michelle, Defny S. Wewengkang et Erladys Rumondor. « UJI AKTIVITAS ANTIBAKTERI EKSTRAK DAN FRAKSI SPONS Mycale Vansoesti DARI PERAIRAN PULAU MANTEHAGE MINAHASA UTARA TERHADAP PERTUMBUHAN BAKTERI Escherichia coli DAN Staphylococcus aureus ». PHARMACON 10, n^o 2 (17 mai 2021) : 889. http://dx.doi.org/10.35799/pha.10.2021.34040.

Texte intégral

Résumé :

ABSTRACTSponges are multi-cell marine biota whose tissue and organ functions are very simple. In the development of medicine, sponges have been shown to contain active compounds as guiding compounds in the synthesis of the latest drugs. The purpose of this study was to determine the antibacterial activity of the extracts and fractions of the sponge Mycale vansoesti collected from the waters of Mantehage Island against Escherichia coli and Staphylococcus aureus bacteria. The sponge samples were extracted using the maceration method with 95% ethanol. The antibacterial activity test used the disc diffusion agar method of Kirby and Bauer. The results showed that Mycale vansoesti sponge produced antibacterial activity in all extracts and fractions used namely ethanol extract, chloroform fraction, n-hexane fraction, and methanol fraction against Escherichia coli and Staphylococcus aureus bacteria with a value of about 6.63-8.82 mm and included in the moderate category of inhibition, this is proven by the formation of a clear zone around the disc. Keywords: Mycale vansoesti, Antibacterial, Staphylococcus aureus, Escherichia coli ABSTRAKSpons merupakan biota laut multi sel yang fungsi jaringan dan organnya sangat sederhana. Dalam perkembangan pengobatan, spons terbukti mengandung senyawa aktif sebagai senyawa pemandu dalam sintesis obat-obatan terbaru. Tujuan dari penelitian ini untuk mengetahui adanya aktivitas antibakteri dari ekstrak dan fraksi spons Mycale vansoesti yang diperoleh dari perairan Pulau Mantehage terhadap bakteri Escherichia coli dan Staphylococcus aureus. Metode ekstraksi yang digunakan adalah maserasi dengan pelarut etanol 95%. Pengujian Aktivitas Antibakteri menggunakan metode difusi agar Kirby and Bauer. Hasil penelitian menunjukkan bahwa spons Mycale vansoesti menghasilkan aktivitas antibakteri pada semua ekstrak dan fraksi yang digunakan yaitu ekstrak etanol, fraksi kloroform, fraksi n-heksan, dan fraksi metanol terhadap bakteri Escherichia coli dan Staphylococcus aureus dengan nilai sekitar 6,63-8,82 mm dan termasuk dalam daya hambat kategori sedang. Hal ini dibuktikan dengan terbentuknya zona bening disekitar cakram. Kata Kunci : Mycale vansoesti, Antibakteri, Staphylococcus aureus, Escherichia coli

Styles APA, Harvard, Vancouver, ISO, etc.

40

Watupongoh, Cavieta C. A., Defny S. Wewengkang et Henki Rotinsulu. « AKTIVITAS ANTIMIKROBA DARI EKSTRAK DAN FRAKSI ORGANISME LAUT SPONS Stylissa carteri YANG DIKOLEKSI DARI PERAIRAN SELAT LEMBEH KOTA BITUNG ». PHARMACON 8, n^o 3 (28 août 2019) : 662. http://dx.doi.org/10.35799/pha.8.2019.29390.

Texte intégral

Résumé :

ABSTRACTSponge is a multi-cell marine biota whose tissue and organ functions are very simple. Sponges have considerable potentially in producing active compounds that can be used in the pharmaceutical world. This study aimed to determine the presence of antimicrobial activity from extracts and fractions of the Stylissa carteri Sponge on against the microbes of Staphylococcus aureus, Escherichia coli, and Candida albicans. The extraction process was carried out by maceration using ethanol solvent, and fractionation was carried out using methanol, n-hexane and chloroform solvents. Antimicrobial activity was carried out by disk diffusion agar method. The results showed that the crude ethanol extracts and methanol fractions of the Stylissa carteri sponge actively inhibited the growth of Staphylococcus aureus, Escherichia coli, and Candida albicans microbes. Keywords: Stylissa carteri, antimicrobial, Staphylococcus aureus, Escherichia coli, Candida albicans. ABSTRAKSpons merupakan biota laut multi sel yang fungsi jaringan dan organnya sangat sederhana. Spons memiliki potensi cukup besar dalam menghasilkan senyawa aktif yang dapat digunakan dalam dunia farmasi. Penelitian ini bertujuan untuk menentukan adanya Aktivitas Antimikroba dari ekstrak dan fraksi Spons Stylissa carteri terhadap mikroba Staphylococcus aureus, Escherichia coli, dan Candida albicans. Dilakukan proses ekstraksi dengan cara maserasi terhadap sampel menggunakan pelarut etanol, dan dilakukan fraksinasi menggunakan pelarut metanol, n-heksan dan kloroform. Aktivitas antimikroba dilakukan dengan metode difusi agar. Hasil penelitian menunjukkan bahwa ekstrak kasar dan fraksi metanol dari spons Stylissa carteri aktif menghambat pertumbuhan mikroba Staphylococcus aureus, Escherichia coli, dan Candida albicans. Kata Kunci : Stylissa carteri, antimikroba, Staphylococcus aureus, Escherichia coli, Candida albicans.

Styles APA, Harvard, Vancouver, ISO, etc.

41

Mangurana, Wa Ode Intiyani, Yusnaini Yusnaini et Sahidin Sahidin. « ANALISIS LC-MS/MS (Liquid Crhomatogaph Mass Spectrometry) DAN METABOLIT SEKUNDER SERTA POTENSI ANTIBAKTERI EKSTRAK n-HEKSANA SPONS Callyspongia aerizusa YANG DIAMBIL PADA KONDISI TUTUPAN TERUMBU KARANG YANG BERBEDA DI PERAIRAN TELUK STARING ». Jurnal Biologi Tropis 19, n^o 2 (14 août 2019) : 131. http://dx.doi.org/10.29303/jbt.v19i2.1126.

Texte intégral

Résumé :

Abstrak : Spons merupakan bagian dari biota komponen penyusun ekosistem terumbu karang yang memiliki kandungan bioaktif. Salah satu jenis spons yang memiliki kandungan bioaktif adalah C. aerizusa. Tujuan dari penelitian ini adalah untuk melihat perbedaan kandungan bioaktif pada kondisi terumbu karang yang berbeda. Metode yang digunakan dalam survei kondisi terumbu karang dan penentuan stasiun pengamatan menggunakan metode Point Intercept Transect (PIT). Pemeriksaan metabolit sekunder menggunakkan metode Kromatografi lapis tipis menurut Harborne (1987), perbedaan kandungan senyawanya menggunakan analisis LC-MS/MS, pengujian aktivitas antibakteri menggunakkan metode sumuran. Hasil penelitian kondisi tutupan karang menunjukan bahwa kondisi tutupan karang hidup 19-65% dengan kategori buruk hingga baik. Jumlah senyawa pada stasiun I mencapai 15 dan jumlah senyawa pada stasiun II mencapai 13. Kandungan Metabolit Sekunder untuk C. aerizusa dari kedua stasiun sama, yaitu aktif terhadap alkoloid, steroid, flavonoid, terpenoid, dan saponin. Potensi Antibakteri Ekstrak n-heksana Spons C. aerizusa untuk stasiun I dan II tidak aktif terhadap E. coli namun Spons C. aerizusa stasiun I dan II aktif terhadap aktivitas S. mutans. Kata Kunci : n-heksana, Terumbu karang, metabolit sekunder, antibakteri Abstract : Sponges are part of the biota that make up the coral reef ecosystem that contains bioactive ingredients. One type of sponge that has a bioactive content is C. aerizusa. The purpose of this study was to see differences in bioactive content in different coral reef conditions. The method used in the coral reef condition survey and the determination of observation stations using the Point Intercept Transect (PIT) method. Examination of secondary metabolites using the thin layer chromatography method according to Harborne (1987), differences in the content of compounds using LC-MS / MS analysis, testing the antibacterial activity using the well method. The results of the research on coral cover conditions showed that the conditions of live coral cover were 19-65% with a bad to good category. The number of compounds at station I reached 15 and the number of compounds in station II reached 13. Secondary Metabolite content for C. aerizusa from both stations was equally active against alkoloid, steroid, flavonoids, terpenoids, and saponins. Antibacterial Potential of n-hexane Extract of C. aerizusa Sponge for stations I and II were not active against E. coli but sponge C. aerizusa station I and II were active against S. mutans activity.Keywords : n-hexane, coral reefs, secondary metabolites, antibacterial

Styles APA, Harvard, Vancouver, ISO, etc.

42

Urban, S., et RJ Capon. « Cometins (A-C), New Furanosesterterpenes From an Australian Marine Sponge, Spongia sp. » Australian Journal of Chemistry 45, n^o 8 (1992) : 1255. http://dx.doi.org/10.1071/ch9921255.

Texte intégral

Résumé :

The known marine furanosesterterpene furospinosulin-1 (1), together with three new furanosesterterpenes, namely cometin-A (2), cometin-B (3) and cometin-C (4), were isolated from a marine sponge, Spongia sp., collected during commercial trawling operations in the Great Australian Bight. The structures of these metabolites were determined by detailed spectroscopic analysis and chemical derivatization . The antibiotic property of the crude ethanol extract of this sponge was attributed solely to the furanosesterterpene tetronic acid cometin -A (2).

Styles APA, Harvard, Vancouver, ISO, etc.

43

Zainuddin, Muhammad, Delianis Pringgenies, Ocky Karna Radjasa, Haeruddin Haeruddin, Aninditia Sabdaningsih et Vivi Endar Herawati. « Optimasi pH Dan Salinitas Media Kultur Terhadap Pertumbuhan Dan Aktivitas Protease Ektraseluler Bakteri Bacillus Firmus Dari Ekosistem Padang Lamun Nusa Lembongan – Bali. » Journal of Tropical Marine Science 5, n^o 2 (5 novembre 2022) : 140–48. http://dx.doi.org/10.33019/jour.trop.mar.sci.v5i2.2862.

Texte intégral

Résumé :

Spons merupakan organisme porifera yang hidup di dasar perairan. Spons memiliki hubungan simbiotik dengan bakteri. Chalinula pseudomolitba merupakan jenis spons yang hidup di perairan Nusa Lembongan Bali dan memiliki bakteri simbion Bacillus firmus. Bacillus firmus memiliki aktivitas proteolitik dengan menghasilkan enzim protease ekstrasluler. Bakteri ini memiliki potensi untuk dikembangkan menjadi probiotik dalam meremediasi protein pada limbah organik sisa pakan tambak budidaya udang. Dalam upaya produksi bakteri Bacillus firmus untuk probiotik maka diperlukan optimasi pH dan salinitas media kultur. Tujuan dari penelitian ini adalah melakukan optimasi pH dan salinitas media kultur bakteri Bacillus firmus dari simbion sponge Chalinula pseudomolitba yang memiliki aktivitas proteolitik. Penelitian menggunakan metode eksperimen aboratoris. Penelitian telah berhasil melakukan uji optimasi pH dan salinitas media kultur terhadap pertumbuhan dan aktivitas enzim protease ektraseluler bakteri. Hasil penelitian menunjukkan bahwa bakteri Bacillus firmus memiliki laju pertumbuah dan aktivitas protease terbaik pada kondisi kultur dengan pH 8 yaitu dengan nilai sebesar 0,174 dan 31,763 IU/ml. Selain itu juga memiliki laju pertumbuah dan aktivitas protease terbaik pada salinitas media 30 ppt dengan nilai sebesar 0,186 dan 35,278 IU/ml.

Styles APA, Harvard, Vancouver, ISO, etc.

44

Murtihapsari, Murtihapsari, Mathelda K. Roreng, Apriani Parubak et Alif Rahman. « Uji Aktivitas Antimalaria dari Spons Xestospongia sp. Asal Pulau Yapen secara In Vivo ». Jurnal Kelautan Tropis 24, n^o 2 (19 mai 2021) : 177–84. http://dx.doi.org/10.14710/jkt.v24i2.10107.

Texte intégral

Résumé :

It is generally admitted that marine sponge has rich of secondary metabolite as alkaloids, peptides and terpene. Those various compounds can be used for antimalarial drug. This study aims to evaluate the in vivo antimalarial activity and to characterize the effectiveness of dose (ED50) of n-hexane extracted from Xestospongia sp. by using the Plasmodium berghei infected to mices. In the present study, we used Peter’s four day suppressive test, where the mice infected with Plasmodium berghei intra peritoneal with a suspension containing infected red blood cell origin from donor mice with parasitemia. Results of present study exhibited that the sponge Xestospongia sp. contains secondary metabolite including tritepenoid/steroid, alkaloid and saponin. Furthermore, an in vivo test revealed the affectivity dose (ED50) was 0.24 mg/kg of body weight. This finding is categorized a signifant decreasing level of parasitemia. Secara umum, spons laut mempunyai kandungan metabolit sekunder seperti alkaloid, peptide dan terpena. Berbagai senyawa tersebut dapat dimanfaatkan sebagai obat antimalaria. Penelitian ini bertujuan untuk mengetahui kandungan kimia dan mengevaluasi aktivitas antimalarial secara in vivo untuk efektivitas dosis (ED50) ekstrak n-heksana dari spons Xestospongia sp. dengan menggunakan Plasmodium berghei yang diinfeksi ke tikus. Penelitian ini digunakan metode the 4-day Supresive Test, dimana mencit yang diinfeksi Plasmodium berghei secara intra peritoneal dengan suspensi yang mengandung sel darah merah terinfeksi yang berasal dari mencit donor. Hasil penelitian ini menunjukkan adanya kandungan metabolit sekunder diantaranya tritepenoid/steroid, alkaloid dan saponin. Selanjutnya, uji in vivo diperoleh nilai ED50 sebesar 0,24 mg/kg BB dikelompokan sangat baik, yang dapat menurunkan tingkat parasitemia secara signifikan. Dengan demikian, spons laut asal pulau Yapen dapat dijadikan sebagai sumber metabolit potensial untuk obat antimalaria.

Styles APA, Harvard, Vancouver, ISO, etc.

45

Duckworth, Alan R. « Substrate type affects the abundance and size of a coral-reef sponge between depths ». Marine and Freshwater Research 67, n^o 2 (2016) : 246. http://dx.doi.org/10.1071/mf14308.

Texte intégral

Résumé :

Substrate stability could influence abundance and size patterns of benthic organisms and thus affect community structure. Sponges on coral reefs are often found growing on calcareous rock and rubble that vary in stability, with loose rubble more easily moved by water flow, which is typically strongest in shallower water. Using the common Indo-Pacific sponge, Coscinoderma matthewsi (Lendenfeld, 1886), the present study examines the interaction of substrate type and depth (6 and 12m) on sponge abundance, size, morphology and skeletal properties (i.e. spongin fibres). Coscinoderma matthewsi was three times less common at 6m, with most sponges at this depth attached to rock, even though rubble had higher percentage cover. Mean sponge length, width and height were all greatest at 12m, with sponges growing largest on rock, probably because it is a more stable substrate for survival and growth. Morphology varied between depths, with most C. matthewsi individuals at 6m having a massive shape, whereas many sponges at 12m grew large lobes; this increases their surface area and possibly promotes filtration. Spongin density, length and width varied greatly among individuals; however, there was no consistent pattern across depth.

Styles APA, Harvard, Vancouver, ISO, etc.

46

Katili, Syifa Sari, Defny S. Wewengkang et Henki Rotinsulu. « UJI AKTIVITAS ANTIMIKROBA EKSTRAK ETANOL ORGANISME LAUT SPONS Ianthella basta TERHADAP BEBERAPA MIKROBA PATOGEN ». PHARMACON 9, n^o 1 (28 février 2020) : 100. http://dx.doi.org/10.35799/pha.9.2020.27415.

Texte intégral

Résumé :

ABSTRACTSponges are multicellular metazoa animals belonging to the Porifera phylum, which has a different structure from other metazoans. The purpose of this study was to determine whether ethanol extracts from the marine organism sponge Ianthella basta have antimicrobial activity against several pathogenic microbes Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa and Candida albicans. The extraction method used is maceration with 96% ethanol solvent. The method used is the Diffusion Method (Disc Diffusion Kirby and Bauer). The antimicrobial activity test uses a 6 mm paper disc with 50 µL absorption per disc. The results of crude ethanol extract of Ianthella basta sponge from all test microbes, namely Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa and Candida albicans, were seen to provide the greatest inhibitory activity against Staphylococcus aureus bacteria with an average of inhibitory zone of 7.00 mm categorize as intermediate The results obtained showed that the crude extract of the sponge Ianthella basta has antimicrobial activity because it can inhibit the growth of Staphylococcus aureus, Escherichia coli and Candida albicans microbes even though the inhibition zone is categorized as intermediate. Keywords: Ianthella basta, antimicrobial, Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa, Candida albicans. ABSTRAKSpons adalah hewan metazoa multiseluler tergolong ke dalam filum Porifera, yang memiliki perbedaan struktur dengan metazoan lainnya. Tujuan penelitian ini ialah untuk mengetahui apakah ekstrak etanol dari organisme laut spons Ianthella basta memiliki aktivitas antimikroba terhadap beberapa mikroba patogen Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa dan Candida albicans. Metode ekstraksi yang digunakan adalah maserasi dengan pelarut etanol 96%. Metode yang digunakan yaitu Metode Difusi (Disc Diffusion Kirby and Bauer). Pengujian aktivitas antimikroba ini menggunakan kertas cakram (paper disc) berukuran 6 mm dengan daya serap 50 µL tiap cakram. Hasil ekstrak kasar etanol Spons Ianthella basta dari semua mikroba uji yaitu Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa dan Candida albicans, terlihat yang memberikan daya hambat paling besar terdapat pada bakteri Staphylococcus aureus dengan jumlah rata – rata zona hambat yaitu 7,00 mm dengan kategori sedang. Hasil penelitian yang diperoleh menunjukkan bahwa ekstrak kasar dari Spons Ianthella basta memiliki aktivitas antimikroba karena mampu menghambat pertumbuhan mikroba uji Staphylococcus aureus, Escherichia coli dan Candida albicans walaupun dengan zona hambat yang dikategorikan sedang. Kata Kunci : Ianthella basta, antimikroba, Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa, Candida albicans.

Styles APA, Harvard, Vancouver, ISO, etc.

47

Lumsdon, D., RJ Capon, SG Thomas et AA Beveridge. « A New Sesterterpene Tetronic Acid and a Pentaprenylated p-Quinol From an Australian Marine Sponge, Spongia sp. » Australian Journal of Chemistry 45, n^o 8 (1992) : 1321. http://dx.doi.org/10.1071/ch9921321.

Texte intégral

Résumé :

The sesterterpene tetronic acid (1) and the pentaprenylated p- quinol (2) have been isolated from a specimen of sponge, Spongia sp., collected at a depth of 23 m from Port Phillip Bay, Australia. Structures were assigned on the basis of detailed spectroscopic analysis.

Styles APA, Harvard, Vancouver, ISO, etc.

48

Domingo, M., M. Martı́n-Baranera, F. Sanz, C. Sierra et M. J. Uriz. « Validating spongia, an expert system for sponge identification ». Expert Systems with Applications 16, n^o 4 (mai 1999) : 379–84. http://dx.doi.org/10.1016/s0957-4174(99)00013-5.

Texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

49

De Giulio, A., S. De Rosa, G. Di Vincenzo et N. Zavodnik. « Terpenoids from the North Adriatic Sponge Spongia officinalis ». Journal of Natural Products 52, n^o 6 (novembre 1989) : 1258–62. http://dx.doi.org/10.1021/np50066a010.

Texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

50

Han, Guan-Ying, Dong-Yu Sun, Lin-Fu Liang, Li-Gong Yao, Kai-Xian Chen et Yue-Wei Guo. « Spongian diterpenes from Chinese marine sponge Spongia officinalis ». Fitoterapia 127 (juin 2018) : 159–65. http://dx.doi.org/10.1016/j.fitote.2018.02.010.

Texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

Articles de revues sur le sujet « Sponsi »

Créez une référence correcte selon les styles APA, MLA, Chicago, Harvard et plusieurs autres