Littérature scientifique sur le sujet « Revertable »

Abstract Diffuse midline glioma (DMG) is a lethal brain tumor that typically occurs in children. Numerous studies have demonstrated the central role of the H3K27M mutation and secondary loss of H3K27 trimethylation (H3K27me3) in DMG tumorigenesis. Understanding how the H3K27M mutation alters the epigenetic landscape of the cell is necessary for revealing molecular targets that are critical to tumorigenesis. To investigate the epigenetic effects of H3K27M mutation in DMG, we developed revertant DMG cell lines with the mutant methionine residue reverted to wildtype (i.e., M27K). Revertant cells were analyzed for epigenetic changes and phenotypic differences in vitro and in vivo. H3M27K DMG cells grew in culture but displayed diminished proliferative capacity. H3M27K cells demonstrated total loss of H3K27M expression and restored trimethylation of H3K27 and H3K4. Furthermore, consistent with the hypothesis that the H3K27M mutation impacts H3 phosphorylation via expression of Aurora Kinase during mitosis, H3M27K cells demonstrated reduced expression of both Aurora Kinase A and phosphorylation of H3 serine residues 10 and 28. In line with the critical role of H3S10 phosphorylation in chromatin segregation, H3M27K cells also demonstrated restored chromosome segregation compared to H3K27M cells. In vivo data will be discussed. Revertance of the H3K27M mutation reduces tumorigenesis in DMG tumors. Isogenic H3M27K cells display reversal of key epigenetic changes associated with oncogenesis in DMG. The revertant H3M27K DMG model is a useful tool to investigate the downstream epigenetic reprogramming specific to H3K27M mutation in these tumors.

Introduction. Combination antiretroviral therapy is currently the main component of treatment for human immunodeficiency virus (HIV) infected patients. At the same time, the high mutational potential of the virus and the frequency of side effects of existing drugs dictate the need for the development and preclinical study of new, more effective and safer compounds.The aim of the study is to evaluate the specific types of toxicity of a new non-nucleoside inhibitor of human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RNA-dependent DNA revertase) (NNRTI) based on the substance 1-[2-(2-benzoylphenoxy)ethyl]-6-methyluracil, a benzophenone derivative.Material and methods. The study investigated reproductive toxicity, embryotoxicity, immunotoxicity, genotoxic (in micronucleus test in and comet assay) and allergenic properties of the test itemcompound. It was tested on three species of animals in two doses: the estimated therapeutic dose (1 TD) and its tenfold equivalent (10 TD). Taking into account the metabolic coefficients, the doses for rats (Rattus) were 9 and 90 mg/kg, for mice (Mus musculus), 21 and 210 mg/kg, and for guinea pigs (Cavia porcellus), 8 and 80 mg/kg, respectively.Results and discussion. According to the obtained results, a favorable safety profile of the tested compound was established. Negative effects on the immune system, reproductive function, the body of pregnant animals and the fetus were not observed, as well as the compound did not have genotoxic and allergenic properties.Conclusion. These data allows to consider the studied compound as a promising therapeutic candidate for the treatment of HIV-1 infection.

Relevance: Increased incidence of lung cancer globally and in Kazakhstan, lack of screening in hereditary cases, high mortality, and low survival of patients necessitate the study of the molecular genetic causes of the disease. At present, gene mutation studies for lung cancer diagnostics are expanding. However, many gene mutations revealed remain undercovered in the scientific literature, and there is not enough data on their prognostic and diagnostic value. The purpose of the study was to discover the specifics of the р53 gene mutations and reveal the EGFR exon 19 deletions and exon 21 L858R mutations in malignant tumors of the lung of various histogenesis. Methods: The mutations were studied in tumors (200 samples) and adjacent tissue (200 samples) of patients with lung cancer (squamous cell carcinoma (SCC) and adenocarcinoma (ADC) of the lung) by polymerase chain reaction (PCR), electrophoresis, and EcoR1- and Pst1-restriction of samples after p53 gene fragments and cDNA amplification and mRNA revertase treatment. Another 263 lung cancer samples were evaluated by real-time PCR for EGFR exon 19 deletions and EGFR exon 21 L858R mutations. Results: The p53 gene was not expressed in 50% of SCC and adenocarcinoma of the lung samples. Restriction revealed p53 mRNA mutations in 100% of SCC and 75% of ADC samples. p53 exon-intron 5-6 was mutated in 50% of ADC and 70% of SCC samples, exon-intron 7-9 – in 60% of SCC cases. EGFR exons 19 and 21 mutations found in 65 of 263 lung tumor samples were associated with increased sensitivity to EGFR tyrosine kinase inhibitors. Conclusion: The p53 gene mutations revealed in most samples of SCC and ADC of the lung could be used to diagnose lung cancer and predict its severity. The identified EGFR mutations allow predicting the effectiveness of targeted therapy.

Aim. To demonstrate the results of polymerase chain reaction in real time.Materials and methods. The gum fragment was placed in 1 ml of RNA-leiter ("QIAGEN", Germany), incubated for a day at +4C, samples were stored at -70 °C.To obtain cDNA from the RNA matrix, a ready-made set of reagents MMLV RT Kit ("Eurogen", Russia) was used, the reaction was carried out according to the attached instructions. 2 µl of random decanucleotide primer (Random dN) and 1 µl of sterile RNase-free water were added to 6 µl of RNA, heated at +70C in a “Termit” thermostat (“DNA-Technology”, Russia) for 2 min to melt secondary RNA structures, then stored on ice (+4C). 4 ml of 5X buffer was added to the reaction mixture for the synthesis of the first chain (280 mM Tris-HCl, 375 mM KCl, 30 mM MgCl2, pH 8,7), 2 ml of dNTP mixture, 2 ml of DTT and 2 ml of sterile water free of RNase. Immediately before the reaction, 1 ml of MMLV revertase (reverse transcriptase of mouse leukemia virus) was added to the mixture and added to the RNA. The test tubes were heated in the Gnome thermostat (“DNA- Technology”, Russia) at +39C for 60 minutes, then at +70C for 10 minutes in the “Termit” thermostat (“DNA-Technology”, Russia).Results. The expression of IL-4, IL-10, IL-6, IL-12b, IL-1ß, MMP9 mRNA was not detected in the studied samples. The results of the polymerase chain reaction in real time showed that the expression levels of the proinflammatory cytokine TNFa and TIMP1 genes did not differ in both the autograft group and the collagen membrane group. The expression of MMP 2 and TIMP 2 was higher in the group using a collagen membrane, which is probably associated with tissue regeneration processes.Conclusions. Fibro-guide collagen matrix shows no less effective clinical results in comparison with autografts

Relevance: Increased incidence of lung cancer globally and in Kazakhstan, lack of screening in hereditary cases, high mortality, and low survival of patients necessitate the study of the molecular genetic causes of the disease. At present, gene mutation studies for lung cancer diagnostics are expanding. However, many gene mutations revealed remain undercovered in the scientific literature, and there is not enough data on their prognostic and diagnostic value. The purpose of the study was to discover the specifics of the р53 gene mutations and reveal the EGFR exon 19 deletions and exon 21 L858R mutations in malignant tumors of the lung of various histogenesis. Methods: The mutations were studied in tumors (200 samples) and adjacent tissue (200 samples) of patients with lung cancer (squamous cell carcinoma (SCC) and adenocarcinoma (ADC) of the lung) by polymerase chain reaction (PCR), electrophoresis, and EcoR1- and Pst1-restriction of samples after p53 gene fragments and cDNA amplification and mRNA revertase treatment. Another 263 lung cancer samples were evaluated by real-time PCR for EGFR exon 19 deletions and EGFR exon 21 L858R mutations. Results: The p53 gene was not expressed in 50% of SCC and adenocarcinoma of the lung samples. Restriction revealed p53 mRNA mutations in 100% of SCC and 75% of ADC samples. p53 exon-intron 5-6 was mutated in 50% of ADC and 70% of SCC samples, exon-intron 7-9 – in 60% of SCC cases. EGFR exons 19 and 21 mutations found in 65 of 263 lung tumor samples were associated with increased sensitivity to EGFR tyrosine kinase inhibitors. Conclusion: The p53 gene mutations revealed in most samples of SCC and ADC of the lung could be used to diagnose lung cancer and predict its severity. The identified EGFR mutations allow predicting the effectiveness of targeted therapy

Diversi lettori chiedono informazioni su quale sia la forma italiana corrispondete al verbo inglese to revert, che ha usi tecnici in biologia e in informatica. I lettori citano revertire per l’uso in biologia, e revertare per l’uso in informatica, ma dichiarano di non aver trovato questi verbi nei dizionari.

Introduction. Among these viruses, the most harmful are viruses that are part of the wood furrow complex (Rugose wood complex), namely: wood furrow Rupestris - Rupestris stem pitting (RSPaV); Grapevine virus B (GVB); Grapevine virus A (GVA) - Grapevine virus A (GVA); pitted wood LN 33 - LN 33 stem grooving. These viruses are part of the European Community certification system and must be tested for the presence of these viruses in the production of seedlings. Grape viruses cause great damage to vineyards in the south of Ukraine, especially viruses of the wood complex of the furrow complex (Rugose wood complex) (eng. - RWC). The purpose of the research was to identify the presence of symptoms of viruses of this complex on vineyards in Odessa region and their identification. Methods. To conduct these studies, phytosanitary examination for the presence of wood furrow complex viruses was used, and real-time polymerase chain reaction (RT- -PCR) was used to identify viruses. Materials and methods research. The work used phytosanitary survey of vineyards in Ovidiopol, Bolgrad and Izmail districts of Odessa region, with a total area of 500 hectares. Samples with and without symptoms of virus infection were taken for real-time PCR diagnosis with hybridization-fluorescence detection (Real time PCR). To identify viruses of the RWC complex, the selection, storage and preparation of samples of grape plants was performed according to ISO 16578: 2013. Samples for RT-PCR were prepared according to the method of the authors, leaves or scrapes of woody shoots, in the amount of 100 mg, placed in a homogenizer (Tube-mill control, IKA, China) carefully ground, poured 2 ml of extraction GGB) buffer: Na2CO3 - 1.59 g / l, NaHCO3 - 2.93 g / l, 2% PVP-40, 0.2% BSA, 0.5 g / l Tween-20, 10 g / l Na2S2O5 ( pH 9.0) and incubated at 95 ºC for 10 minutes in the thermostat "Dry block" TDB-120 (Biosan, Latvia). After that, the samples were kept in the refrigerator for 3 hours at +4 ºC. Isolation of RNA viruses was performed according to the method, namely: 2 μl of the sample was added to 23 μl of the reaction mixture (H2O - 12.0 μl; 10 × PCR buffer - 2.5 μl; sucrose + cresol - 2.5 μl; 4 mm dNTP - 1.25 μl (1.76 mm -2.84 μl), DTT (dithiothreitol) - 1.24 μl, pr1 (10 pmol) - 1.25 μl, pr2 (10 pmol) - 1.25 μl, Taq polymerase (2.5 u / µl) (Pfu DNA, Fermentas, Lithuania) - 0.25 μl, revertase (200 u / µl) (RevertAidTM M-MuLV, Fermentas, Lithuania) - 0.04 μl, Mg2 + (50mM) - 0.75 μl, covered with a layer of oil for PCR and performed RT-PCR. RT-PCR in real time was performed using forward and reverse primers, fluorescently labeled DNA probes, the reaction mixture in the amount of 20 μl (H2O - 8.5 μl; 10 × PCR buffer - 2.5 μl; sucrose + cresol - 2.5 μl, 4 mm dNTP - 2.5 μl (1.76 mm - 2.84 μl), DTT - 1.24 μl, pr1 - 0.5 μm, pr2 - 0.5 μm, fluorescent probe - 0 , 1 μM, Taq polymerase (2.5 u / µl) (Pfu DNA, Fermentas, Lithuania) - 0.25 μl, revertase (200 u / µl) (RevertAidTM M-MuLV, Fermentas, Lithuania) - 0.04 μg; Mg2 + - 3.0 mm and 5 μl of NС, or PС, or internal control, or test sample (at the bottom of the tube). Concentrations of forward, reverse primers, fluorescent DNA probes were selected empirically. used a negative control sample (NCS) - 1xPLR buffer and a positive control sample (PCR) - biomaterial from the test system for ELISA (Agritest, Italy). NC from grape mitochondria. The following primers and labeled probes (Fermentas, Lithuania) were used to identify RT-PCR viruses in real time according to]: for grape wood furrow complex A (GVA) virus: GVA-77 f - CGACCGAAATATGTACCTGAATACTC - direct; GVA-192 r1 - TTTGCTAGCTTTAGGACCTACTATATCTACCT - reverse; GVA-192 r2 - CTTGCTAGCcTTAGGtCCTACTATATCTACCT - reverse; GVA-104 p - CTTCGGGTACATCGCCTTGGTCG - probe. To the virus B of the grape wood furrow complex (GVB): GVB-92 f1 - CTAGGAGTGCGGCTAAACGAA - direct; GVB-95 f2 - GGAGTGCGGCCAAACGA - direct; GVB-202 r1 - CCTTAACCTCGTCCTGTGATATGGT - reverse; GVB-119p2 - ACCGTTACGGCCGTTGTTACTGTTGTGGTAG - probe Reverse transcription and amplification included the following cycles: at 50 ° C for 2 minutes, 95 ° C for 15 minutes and 45 cycles of 95 ° C for 15 sec. and 57 ° C - 1 min. Amplification was performed in a programmable thermal cycler Rotor-Gene 6000 (Corbett Research Pty Ltd., Australia). Accounting for analysis results, calculation of threshold cycles was performed using Rotor-Gene 6000 Series Software 1.7. The sample was considered positive, in the analysis of which there is an increase in the fluorescent signal on one of the color channels of the amplifier. Results. As a result of optimizing the conditions of real-time RT-PCR, a successful concentration of MgCl2 was selected for the highest fluorescence signal intensity and it was found that the fluorescent signal curve was more optimal at MgCl2 concentration in the range 3.0 - 2.5 mm. As a result of the conducted researches only the virus B of a complex of furrowing of grapes was identified, other viruses were not revealed As a result of phytosanitary inspection of vineyards of Bolgrad, Izmiil and Ovidiopol districts of Odessa region, symptoms of viral damage to grape plants were revealed. For the first time, grape viruses were identified by a modified RT- PCR method, and diagnostic conditions were selected. Conclusions and prospects. As a result of phytosanitary inspection, grape viruses belonging to the furrow complex were found. The lesions of grape bushes by viruses of the wood furrow complex on the vineyards of the Bolgrad district of Odessa region were detected and identified. During the diagnosis, the PCR parameters were optimized, namely, the annealing temperature and magnesium concentration were tested. The obtained data will allow timely detection of viruses of the grape furrow complex, which can lead to a significant reduction in yield and prevent their spread. As a result of phytosanitary inspection of vineyards of Ovidiopol, Bolgrad and Izmail districts of Odessa region, 2 grape bushes with symptoms of viral disease of the grape furrow complex were found. For the first time in Ukraine, the method of real-time polymerase chain reaction with hybridization-fluorescence detection was used to diagnose viral disease, and the reaction conditions were selected and optimized. As a result of identification of the causative agent of the wood furrow complex by the RT-RF-PCR method, it was established that the vines were affected by the B complex virus (GVB).

2010/2011
In this work I present a novel approach to the use of biomolecules as constructive material for an autonomous DNA-based platform on which is possible to do sensing consequently actuating the object after the transduction of an environmental signal. The new approach is based on a DNA origami obtained by folding a long polynucleotide with hundreds of shorter oligonucleotides and resulting in a well defined and ordered disks of a diameter of about 100nm. Each disk is composed of two main parts, an external ring and an internal disk, connected each other in only two diametrically opposite points. A linear single stranded DNA molecule, the probe, is inserted on the upper face of the internal moving disk, perpendicularly to the connections and to the axis of constrain; as far as the probe remains single stranded, the DNA-object appears planar, but when it gets in contact with its complementary ssDNA called “target”, forming a double stranded DNA, it opens the origami’s structure. The realization of such autonomous organic structure is preliminary to its application in many contests. The actuation principle was first applied for the development of a revertable biosensing platform, where the addition of a third single stranded molecule, displaces the target from the probe restoring the initial state of the origami. The same principle was also improved with real samples such as viral RNAs. In this thesis, I report the setting up of the single components of the device: complex DNA based objects, the switching mechanism, the validation with real samples and the possible applications of the whole system.
XXIV Ciclo
1982