Bibliographies thématiques / Mosaic Press / Articles de revues

Articles de revues sur le sujet « Mosaic Press »

Pour voir les autres types de publications sur ce sujet consultez le lien suivant : Mosaic Press.
Auteur : Grafiati
Publié le 26 juillet 2024

Créez une référence correcte selon les styles APA, MLA, Chicago, Harvard et plusieurs autres

Choisissez une source :

Consultez les 50 meilleurs articles de revues pour votre recherche sur le sujet « Mosaic Press ».

À côté de chaque source dans la liste de références il y a un bouton « Ajouter à la bibliographie ». Cliquez sur ce bouton, et nous générerons automatiquement la référence bibliographique pour la source choisie selon votre style de citation préféré : APA, MLA, Harvard, Vancouver, Chicago, etc.

Vous pouvez aussi télécharger le texte intégral de la publication scolaire au format pdf et consulter son résumé en ligne lorsque ces informations sont inclues dans les métadonnées.

Parcourez les articles de revues sur diverses disciplines et organisez correctement votre bibliographie.

1

Farzadfar, S., R. Pourrahim, A. R. Golnaraghi, S. Jalali et A. Ahoonmanesh. « Occurrence of Radish mosaic virus on Cauliflower and Turnip Crops in Iran ». Plant Disease 88, no 8 (août 2004) : 909. http://dx.doi.org/10.1094/pdis.2004.88.8.909a.

Texte intégral
Résumé :
During the spring and summer of 2003, symptoms of mosaic, mottle, and crinkle were observed in cauliflower (Brassica oleracea) and turnip (Brassica rapa) fields in the Qazvin and Esfahan provinces of Iran, respectively. Leaf extracts of these plants, made infective by mechanical inoculation, caused necrotic local lesions on Chenopodium amaranticolor, chlorotic ring spot on Nicotiana tabacum cv. Samsun, and chlorotic local lesions followed by systemic mosaic on Brassica rapa (1). Using double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) and specific polyclonal antibodies (As-0120 and PV-0355) that were kindly prepared by S. Winter (DSMZ, Braunschweig, Germany), the samples were tested for the presence of Radish mosaic virus (RaMV) (family Comoviridae, genus Comovirus). ELISA results showed that the original leaf samples and inoculated indicator plants reacted positively to RaMV antibodies. RaMV has been reported in the United States, Japan, and Europe on turnip and other crucifers (1,2). To our knowledge, this is the first report of RaMV occurring in Iran. References: (1) R. N. Campbell. Radish mosaic virus. No. 121 in: Descriptions of Plant Viruses. CMI/AAB, Surrey, England, 1973. (2) D. D. Sutic et al. Handb. Plant Virus Diseases. CRC Press, Boca Raton, FL, 1999.
Styles APA, Harvard, Vancouver, ISO, etc.
2

Dorot, Ruth. « Mosaic of Israel’s landscapes as an expression of geographical, cultural, and religious diversity ». Images. The International Journal of European Film, Performing Arts and Audiovisual Communication 25, no 34 (15 juin 2019) : 87–113. http://dx.doi.org/10.14746/i.2019.34.06.

Texte intégral
Résumé :
Dorot Ruth, Mosaic of Israel’s landscapes as an expression of geographical, cultural, and religious diversity. “Images” vol. XXV, no. 34. Poznań 2019. Adam Mickiewicz University Press. Pp. 87–113. ISSN 1731-450X. DOI 10.14746/i.2019.34.06. Israel is tiny in its dimensions, yet huge in the spectrum of its landscapes. It is ancient in its history, yet young as a state. In honor of the 70th independence day of the State of Israel, celebrated in 2018, this paper presents a mosaic of 12 landscape paintings, from the country’s most southern point to the most northern one, by Israeli artists who represent, in diverse styles, the state’s geographic and historic wealth in a visual-artistic sense.
Styles APA, Harvard, Vancouver, ISO, etc.
3

Moffitt, Sally. « Book Review : Jim Crow : A Historical Encyclopedia of the American Mosaic ». Reference & ; User Services Quarterly 55, no 2 (16 décembre 2015) : 181. http://dx.doi.org/10.5860/rusq.55n2.181a.

Texte intégral
Résumé :
Jim Crow: A Historical Encyclopedia of the American Mosaic is essentially an abridged edition of the editors’ earlier two-volume The Jim Crow Encyclopedia published by Greenwood Press in 2008. The 275 entries in the latter edition have been pared down to 104 “geared toward the needs of high school students” and selected to “focus on the most important people, events, and institutions involved in the creation, maintenance, and eventual dismembering of Jim Crow” (xv).
Styles APA, Harvard, Vancouver, ISO, etc.
4

Kenney, Padraic. « Peripheral Vision : Social Science and the History of Communist Eastern Europe ». Contemporary European History 10, no 1 (mars 2001) : 171–78. http://dx.doi.org/10.1017/s0960777301001096.

Texte intégral
Résumé :
Ivan T. Berend, Central and Eastern Europe 1944–1993: Detour from the Periphery to the Periphery (Cambridge: Cambridge University Press, 1996), 414 pp., $64.95 (hb), ISBN 0-521-55066-1, $24.95 (pb), ISBN 0-521-66352-0. Valerie Bunce, Subversive Institutions: The Design and Destruction of Socialism and the State (Cambridge: Cambridge University Press, 1999), 206 pp., $54.95 (hb), ISBN 0-521-58449-3; $19.95 (pb), ISBN 0-521-58592-9. Helena Flam, Mosaic of Fear: Poland and East Germany Before 1989 (Boulder, CO: East European Monographs, 1998; distributed by Columbia University Press, New York), 283 pp., $50.00, ISBN 0-880-33406-1. Leszek Dziegiel, Paradise in a Concrete Cage: Daily Life in Communist Poland – An Ethnologist's View (Kraków: Wydawnictwo Arcana, 1998), 307 pp., ISBN 8-386-22517-3. András Gero and Iván Peto, Unfinished Socialism: Pictures From the Kádár Era (New York and Budapest: Central European University Press, 1999), 250 pp., $29.95, ISBN 9-639-11650-5.
Styles APA, Harvard, Vancouver, ISO, etc.
5

Filipek, Dominique. « Review of : Young, T.H. (2012). Death by Prescription. Oakville : Mosaic Press. » Canadian Journal of Family and Youth / Le Journal Canadien de Famille et de la Jeunesse 10, no 1 (23 mars 2018) : 321–25. http://dx.doi.org/10.29173/cjfy29357.

Texte intégral
Styles APA, Harvard, Vancouver, ISO, etc.
6

Dimas-Lehndorf, Aleksander J. « Review of : Young, T.H. (2012). Death by Prescription. Oakville : Mosaic Press. » Canadian Journal of Family and Youth / Le Journal Canadien de Famille et de la Jeunesse 10, no 1 (23 mars 2018) : 361–65. http://dx.doi.org/10.29173/cjfy29364.

Texte intégral
Styles APA, Harvard, Vancouver, ISO, etc.
7

Rosal, Giovanna. « Review of : Young, T.H. (2012). Death by Prescription. Oakville : Mosaic Press. » Canadian Journal of Family and Youth / Le Journal Canadien de Famille et de la Jeunesse 10, no 1 (23 mars 2018) : 379–83. http://dx.doi.org/10.29173/cjfy29367.

Texte intégral
Styles APA, Harvard, Vancouver, ISO, etc.
8

Tameling, Taylor. « Review of : Young, T.H. (2012). Death by Prescription. Oakville : Mosaic Press. » Canadian Journal of Family and Youth / Le Journal Canadien de Famille et de la Jeunesse 10, no 1 (23 mars 2018) : 415–18. http://dx.doi.org/10.29173/cjfy29374.

Texte intégral
Styles APA, Harvard, Vancouver, ISO, etc.
9

Tharani, Alim. « Review of : Young, T.H. (2012). Death by Prescription. Oakville : Mosaic Press. » Canadian Journal of Family and Youth / Le Journal Canadien de Famille et de la Jeunesse 10, no 1 (23 mars 2018) : 419–23. http://dx.doi.org/10.29173/cjfy29375.

Texte intégral
Styles APA, Harvard, Vancouver, ISO, etc.
10

Antunes, Nicole. « Book Review of : Young, T. (2014). Death by Prescription. Oakville : Mosaic Press. » Canadian Journal of Family and Youth / Le Journal Canadien de Famille et de la Jeunesse 11, no 1 (23 janvier 2019) : 300–303. http://dx.doi.org/10.29173/cjfy29420.

Texte intégral
Styles APA, Harvard, Vancouver, ISO, etc.
11

Gauthier, N. W., J. Polashock, T. T. Veetil, R. R. Martin et J. Beale. « First Report of Blueberry Mosaic Disease Caused by Blueberry mosaic associated virus in Kentucky ». Plant Disease 99, no 3 (mars 2015) : 421. http://dx.doi.org/10.1094/pdis-09-14-0946-pdn.

Texte intégral
Résumé :
In 2011, a grower in Casey County, Kentucky, observed persistent yellow, green, and red mosaic patterns on leaves of highbush blueberry plants. Twenty-three randomly-scattered cv. Bluecrop plants out of approximately 1,400 5-year-old plants showed symptoms, with coverage on each plant ranging from 5 to 100%. Asymptomatic canes bloomed normally and produced fruit; affected canes were stunted and did not bloom. These symptoms are generally consistent with those described for blueberry mosaic disease (BMD) (1,3), the casual agent of which is Blueberry mosaic associated virus (BlMaV) (4). All plants were purchased from a local nursery, but their origin was unknown. In 2012, leaves from each of five symptomatic plants were tested by reverse transcription-polymerase chain reaction (RT-PCR) for BlMaV. Total nucleic acid was isolated from the symptomatic leaves, and asymptomatic leaves of randomly selected healthy plants served as negative controls. The CTAB method was used as described (2), and RNA was isolated using lithium chloride. cDNA was synthesized using the SuperScript VILO cDNA synthesis kit (Invitrogen, Carlsbad, CA). Two different primer sets were used for detection of BlMaV; BlMaVCP5′-1F (GGTTGATGGATGCTTACGAA) and BlMaVRNA3-1378R (CTTCACTTACCACATTATACATCTC) to amplify a 1,370-bp portion of RNA3 and RNA2-2F (TTCGATCCCAGCCCTCTCCC) and RNA2-2R (AGGCAAAGGGAAAGAAATTCAGGTGTC) to amplify a 1,281-bp portion of RNA2. All symptomatic samples tested by RT-PCR yielded a fragment for each primer set, and the amplicon sizes were as expected. No fragments were amplified from the negative controls. To further confirm diagnosis, the primer sets noted above were used to re-amplify the same two fragments from each of three of the samples. These fragments were cloned and sequenced on the CEQ8000 (Beckman-Coulter, Brea, CA) using the GenomeLab DTCS Quick Start sequencing kit (Beckman-Coulter) and the universal M13 forward and reverse primers as well as internal primers: BlMaV-CP Int 1F (ACAATTAAGAAGTCCTCGTAT), BlMaV-CP Int 2F (ATGTCCGGATGCTAGTCGCT), and BlMaV RNA2 IntR (GGTGGGGACGGAATAATACAGAG). All sequences were consistent with those now published for BlMaV, with 98% identity at the nucleic acid level for both fragments. In 2013, the grower removed plants with more than 50% symptomatic tissue, and no newly symptomatic plants were observed that year. Sixteen remaining symptomatic plants, as well as 36 asymptomatic plants adjacent to those with symptoms, were sampled and tested by RT-PCR. All symptomatic plants were confirmed to be infected with BlMaV, as well as 30 of the 36 asymptomatic plants. It has been suggested that newly infected plants may take a year to express symptoms (5), which may explain the finding of 30 infected but asymptomatic plants. This is the first report of an association of BIMaV with BMD in Kentucky. These results indicate that BMD can establish in Kentucky blueberry fields. References: (1) R. R. Martin et al. Viruses 4:2831-2852, 2012. (2) J. J. Polashock et al. Plant Pathol. 58:1116, 2009. (3) D. C. Ramsdell. In: Compendium of Blueberry and Cranberry Diseases. APS Press, St. Paul, MN, 1995. (4) T. Thekke-Veetil et al. Virus Res. 189:92, 2014. (5) E. H. Varney. Phytopathology 47:307, 1957.
Styles APA, Harvard, Vancouver, ISO, etc.
12

Huang, J. G., Z. F. Fan, H. F. Li, G. Z. Tian et J. S. Hu. « First Report of Tomato mosaic virus on Hibiscus rosa-sinensis in China ». Plant Disease 88, no 6 (juin 2004) : 683. http://dx.doi.org/10.1094/pdis.2004.88.6.683c.

Texte intégral
Résumé :
Hibiscus rosa-sinensis Linn., family Malvaceae, is an attractive horticultural plant originating from China. Five viruses infecting H. rosa-sinensis that have been characterized previously are Hibiscus chlorotic ringspot virus (HCRSV, genus Carmovirus), Hibiscus latent ringspot virus (HLRSV, genus Nepovirus), Hibiscus yellow mosaic virus (genus Tobamovirus), Eggplant mottled dwarf virus (EMDV, genus Nucleorhabdovirus), and Okra mosaic virus (OkMV, genus Tymovirus) (2). Recently, two novel tobamoviruses infecting H. rosa-sinensis were characterized in Singapore and Florida (1). In this study, viral symptoms were observed on H. rosa-sinensis in Nanyang City in Henan Province, China. The systemic symptoms included dark and light green mosaic in young leaves, leaf puckering and malformation on older leaves, and significant stunting. Rod-shaped virus particles were isolated from H. rosa-sinensis expressing systemic symptoms. The virus was transmitted mechanically to 10 species from three families. Symptoms expressed on these plants included systemic leaf chlorosis and distortion on Lycopersicum esculentum, systemic mosaic on Capsicum annuum, Nicotiana tabacum, and Physalis floridana, and systemic chlorosis on Glycine max. N. tabacum-Xanthi nc and Datura stramonium were asymptomatic. The virus also produced chlorotic and necrotic local lesions on Chenopodium quinoa, C. amaranticolor, and C. murale. The virus was propagated in L. esculentum, N. tabacum, and P. floridana. Virions purified from systemically infected N. tabacum contained a single-stranded RNA of approximately 6.4 kb and a coat protein (CP) of approximately 17.6 kDa. The double-stranded RNA profile revealed a single band of approximately 6.4 kb. Sap extracted from virus-infected plants reacted positive with an antiserum prepared against Tobacco mosaic virus (TMV) using an antigen-coated plate enzyme-linked immunosorbent assay. The CP gene was amplified by reverse transcription-polymerase chain reaction with primers specific to Tomato mosaic virus (ToMV) and sequence data obtained from the resulting amplification product. The CP gene consisting of 159 amino acids (GenBank Accession No. AY313136) shared 99.37% identity with the ToMV Queensland isolate (GenBank Accession No. AF332868). On the basis of biology, serology, properties of virions, and the sequence of the CP gene, we conclude that the virus isolated from H. rosa-sinensis in China is Tomato mosaic virus(ToMV). References: (1) S. Adkins et al. Plant Dis. 87:1190, 2003. (2) M. H. V. van Regenmortel et al., eds. Virus Taxonomy. 7th Report of the ICTV, Academic Press, NY, 2000.
Styles APA, Harvard, Vancouver, ISO, etc.
13

Haynes, Margot. « SECOND LANGUAGE VOCABULARY ACQUISITION.James Coady & ; Thomas Huckin (Eds.). New York : Cambridge University Press, 1997. Pp. x + 299. $22.95 paper. » Studies in Second Language Acquisition 21, no 1 (mars 1999) : 150–52. http://dx.doi.org/10.1017/s0272263199221055.

Texte intégral
Résumé :
This multifaceted mosaic of vocabulary acquisition should be in every language professional's library, nudging us to look beyond size of vocabulary and toward a better understanding of what Meara (1996) has called its cognitive “organisation.”
Styles APA, Harvard, Vancouver, ISO, etc.
14

Rodriguez, R. L., S. Hong et D. P. Maxwell. « First Report and Partial Molecular Characterization of a New Begomovirus Associated with Pigeon Pea in Puerto Rico ». Plant Disease 85, no 10 (octobre 2001) : 1119. http://dx.doi.org/10.1094/pdis.2001.85.10.1119c.

Texte intégral
Résumé :
Pigeon pea (Cajanus cajan (L.) Millsp.) is an important edible legume crop in Puerto Rico. In late fall 1997, symptoms of a golden mosaic virus were observed in a pigeon pea planting in the municipality of Villalba. The symptoms resembled those incited by the Rhynchosia mosaic virus, a whitefly-transmitted virus, in pigeon pea (1). Tests with the 3F7 antigeminivirus antibody from Agdia (Elkhart, IN) confirmed the presence of a begomovirus in these symptomatic pigeon peas. Extraction of DNA from dried symptomatic foliar tissue was accomplished by the methods described in Rojas et al. (2), and subsequent viral DNA amplification was accomplished with the coat protein (CP) gene polymerase chain reaction primer pair AV494-AC1048 (3). A 550-bp fragment was cloned and sequenced (GenBank Accession No. AY028308). For sequence analysis, the BLAST program at the National Institutes of Health was used. The first match was 91% with the CP gene sequence (Accession No. AF070924) of a begomovirus from Clitoria falcata from Puerto Rico. The next three matches were approximately 86% with a begomovirus (accession no. AF058024) from Macroptilium lathyroides from Puerto Rico, Dicliptera yellow mottle virus (Accession No. AF139168) from Florida, and Tobacco apical stunt virus (Accession No. AF076855) from Mexico. On the basis of sequence analysis of this conserved region of the CP gene, it is concluded that the virus described in this report is a new virus, and thus named Pigeon pea golden mosaic virus. The only sequence for a begomovirus from a Rhynchosia sp. in GenBank is Rhynchosia golden mosaic virus from Honduras (accession no. AF239671). On the basis of sequence comparisons, the virus from pigeon pea is not an isolate of the Honduran Rhynchosia golden mosaic virus. References: (1) J. Bird et al. 1975. Pages 3–25 in: Tropical Diseases of Legumes. J. Bird and K. Maramorosch, eds. Academic Press, NY. (2) M. R. Rojas et al. Plant Dis. 77:340, 1993. (3) S. D. Wyatt and J. K. Brown. Phytopathology. 86:1288, 1996.
Styles APA, Harvard, Vancouver, ISO, etc.
15

Bush, Danika. « Book Review of : Young, Terence H. (2014) Death by Prescription. Oakville : Mosaic Press. » Canadian Journal of Family and Youth / Le Journal Canadien de Famille et de la Jeunesse 11, no 1 (23 janvier 2019) : 308–12. http://dx.doi.org/10.29173/cjfy29422.

Texte intégral
Styles APA, Harvard, Vancouver, ISO, etc.
16

Hoper, S. Sheeba. « Epidemic Mosaic : State-Wise Patterns and Impacts of Covid-19 in India ». Public Health Open Access 8, no 1 (2024) : 1–4. http://dx.doi.org/10.23880/phoa-16000277.

Texte intégral
Résumé :
After being discovered for the first time in Wuhan, China in December 2019, the extremely contagious coronavirus illness (COVID-19) quickly spread to 212 nations and territories worldwide, affecting millions of people. The sickness was discovered for the first time in India, a sizable nation of 1.3 billion people, on January 30, 2020, in a student who was returning from Wuhan. The extremely contagious coronavirus illness 2019 (COVID-19) was initially identified in Wuhan, China, in December 2019. Over two million people have been verified to have been infected by the disease, which has spread to 210 different nations and territories worldwide. The sickness was initially discovered in India on January 30, 2020, in Kerala in a student who had just returned from Wuhan. Thus far, 17615 individuals have been verified to be infected nationwide (19 April 2020). The majority of studies and press reports center on the total number of infected individuals in India. But considering the vastness and diversity of India, it could be wise to examine the disease's spread across each state independently, as well as the nation as a whole. The goal of this research is to present a thorough overview of the COVID-19 pandemic analysis in India, including state-by-state death rates and management strategies. We obtained articles from the official website that describe the COVID-19 management approach and the death rates in each state, as well as up-to-date data from 2022 and 2023. With 4.2 billion people, India is the nation with the biggest population. The nation's economy grew significantly as a result of this disaster. India saw the third-highest number of deaths worldwide and the second-highest number of confirmed positive cases. Nevertheless, considering the vastness and diversity of India, it is crucial to examine the disease's spread in each state independently, as conditions in each vary greatly. We analyses data on the number of infected individuals in each Indian state in this research (limited to those states with sufficient data for analysis). Our analysis is intended to assist state governments in more effectively allocating their little healthcare resources in anticipation of emerging health crises.
Styles APA, Harvard, Vancouver, ISO, etc.
17

Djehlane, Mohammed Ahmed. « The Image of Sultanate of Oman in the Contemporary Algerian Arabic Press ». Journal of Arts and Social Sciences [JASS] 9, no 2 (1 octobre 2018) : 43. http://dx.doi.org/10.24200/jass.vol9iss2pp43-56.

Texte intégral
Résumé :
This study tried to dive in the archives relating to Oman in the Algerian contemporary press, (1986-2016), and its goal is to look for the Oman presence in the Algerian press, and its role in consolidating of Algeria's Oman relations in the past and present. Based on the above, we have attempted in this study to analyze the subject - after a systematic approach- in the following topics: 1. Introduction to the interesting of Algerian journalists about Oman in modern-day. 2. Algerian press and the contemporary cultural scene in Oman. 3. Algerian press and document the views of the Algerian and Omani on topical issues. Among the findings of the research is the extrapolation of the huge amount of Algerian press material covered by the period of study. That the reasons of Omani-Algerian relationship extend in the depths of history, back to the second century AH, and she has stimulated the efforts of the press pioneers in Algeria and Zanzibar this relation and contributed to its consolidation in this modern age. The study also concluded that the image of the Sultanate of Oman in this press embodies a mosaic of high cultural characteristics. The first is: Oman's adherence to its religious and Arab identity. The second is: his struggle for his freedom and his struggle against colonialism throughout history. The third is: the wrapping of the Omani people around their political leadership and their pride in their scientists. The fourth: the sense of citizenship and co-existence and the entrenchment of the right to difference. The fifth: focus in the renaissance on the humans before the structures, and finally, the image of the Sultanate of Oman in short is: "Is the originality of history, the renaissance of the future, and a worthy example to study and follow-up".
Styles APA, Harvard, Vancouver, ISO, etc.
18

Djehlane, Mohammed Ahmed. « The Image of Sultanate of Oman in the Contemporary Algerian Arabic Press ». Journal of Arts and Social Sciences [JASS] 9, no 2 (1 octobre 2018) : 43–56. http://dx.doi.org/10.53542/jass.v9i2.2748.

Texte intégral
Résumé :
This study tried to dive in the archives relating to Oman in the Algerian contemporary press, (1986-2016), and its goal is to look for the Oman presence in the Algerian press, and its role in consolidating of Algeria's Oman relations in the past and present. Based on the above, we have attempted in this study to analyze the subject - after a systematic approach- in the following topics: 1. Introduction to the interesting of Algerian journalists about Oman in modern-day. 2. Algerian press and the contemporary cultural scene in Oman. 3. Algerian press and document the views of the Algerian and Omani on topical issues. Among the findings of the research is the extrapolation of the huge amount of Algerian press material covered by the period of study. That the reasons of Omani-Algerian relationship extend in the depths of history, back to the second century AH, and she has stimulated the efforts of the press pioneers in Algeria and Zanzibar this relation and contributed to its consolidation in this modern age. The study also concluded that the image of the Sultanate of Oman in this press embodies a mosaic of high cultural characteristics. The first is: Oman's adherence to its religious and Arab identity. The second is: his struggle for his freedom and his struggle against colonialism throughout history. The third is: the wrapping of the Omani people around their political leadership and their pride in their scientists. The fourth: the sense of citizenship and co-existence and the entrenchment of the right to difference. The fifth: focus in the renaissance on the humans before the structures, and finally, the image of the Sultanate of Oman in short is: "Is the originality of history, the renaissance of the future, and a worthy example to study and follow-up".
Styles APA, Harvard, Vancouver, ISO, etc.
19

Beauregard, Ludger. « Knight, David B., ed. (1985) Our Geographic Mosaic. Ottawa, Carleton University Press, 217 p. » Cahiers de géographie du Québec 31, no 82 (1987) : 103. http://dx.doi.org/10.7202/021858ar.

Texte intégral
Styles APA, Harvard, Vancouver, ISO, etc.
20

Prandoni, I., L. Gregorini, P. Parma, H. R. De Ruiter, G. Vettolani, M. H. Wieringa et R. D. Ekers. « A Deep 20 cm Radio Mosaic of the ESO Key-project Galaxy Redshift Survey ». Symposium - International Astronomical Union 175 (1996) : 523–24. http://dx.doi.org/10.1017/s0074180900081717.

Texte intégral
Résumé :
In two strips of 22° × 1° and 5° × 1° near the SGP Vettolani et al. (1993, IA U Symposium 161, “Astronomy from Wide Field Imaging”, H.T. MacGillivray ed., Reidel, in press) have made a deep redshift survey as an ESO Key Project. All the galaxies down to bJ ≃ 19.4 were observed with the OPTO-PUS multi-fiber spectrograph on the 3.6 m telescope in La Silla, yielding 3348 redshifts. The survey has a typical depth of z = 0.1. It fully samples the optical luminosity function down to B = −15 and various galaxy populations (e.g. normal galaxies, LSBDs and BCDs) are present. Interestingly, emission lines (OII, Hβ, OIII) have been found in a large fraction of the galaxy spectra (≃ 40%), suggesting strong evolution of the galaxy population in terms of enhanced star formation.
Styles APA, Harvard, Vancouver, ISO, etc.
21

Herranz, M. C., D. Maeso, J. Soria et V. Pallás. « First Report of Peach latent mosaic viroid on Peach in Uruguay ». Plant Disease 86, no 12 (décembre 2002) : 1405. http://dx.doi.org/10.1094/pdis.2002.86.12.1405c.

Texte intégral
Résumé :
Peach latent mosaic viroid (PLMVd) (2) is widely distributed and causes yellow, chlorotic mosaics and delayed foliation, flowering, and ripening. Infected fruits display a cracked suture and are often dented, misshapen, frequently flattened, and discolored. In the greenhouse, PLMVd natural isolates are divided into severe or latent strains depending on whether they induce leaf symptoms on seedlings of the peach indicator GF-305. PLMVd was detected in 2001 during a survey in three locations in the Canelones Department, the main peach producing area in Uruguay. Fifty samples were tested for the presence of five viruses: Prunus necrotic ringspot virus (PNRSV), Prune dwarf virus (PDV), American plum line pattern virus (APLPV), Plum pox virus (PPV) and Apple chlorotic leaf spot virus (ACLSV); samples were also tested for the viroids affecting stone fruits, Hop stunt viroid (HSVd) and PLMVd. The analyses were completed with molecular hybridization using specific nonisotopic riboprobes for each virus (4). PLMVd, undescribed in Uruguay, was detected in 9 of 50 samples in three peach cultivars, Scarlet Pearl, EarliGrande, and Barcelo. The PLMVd-positive sample for ‘Scarlet Pearl’ showed mild mosaic symptoms on leaves whereas the two PLMVd-positives of ‘EarliGrande’ showed clear calico type symptoms. The remaining PLMVd-positive samples belonged to ‘Barcelo’ and showed no symptoms or mild chlorosis. The first two cultivars were imported from the United States, a source with a high percentage of PLMVd infections in peach germ plasm (1). In five of nine PLMVd-positive samples, the viroid occurred with PNRSV and in one with PDV and PNRSV. PLMVd has previously been reported in Brazil (3), but to our knowledge, this is the first report of PLMVd in Uruguay. These results reveal the importance of following strict sanitary practices with plant material used for propagation. Molecular tools are available to prescreen scion and rootstock sources for PLMVd. References: (1) M. L. Badenes and G. Llácer. Acta Hortic. 309:565, 1998. (2) R. Flores et al. Res. Virol. 141:109, 1990. (3) A. Hadidi et al. Plant Dis. 81:154, 1997. (4) V. Pallás et al. Detection of plant RNA viruses by non-isotopic dot-blot hybridization. Pages 461–468 in: Plant Virus Protocols: From Virus Isolation to Transgenic Resistance. G. Foster and S. Taylor, eds. Humana Press, Totowa, NJ. 1998.
Styles APA, Harvard, Vancouver, ISO, etc.
22

Blasing, Mutlu Konuk. « Mosaic Modernism : Anarchism, Pragmatism, Culture. David Kadlec. Baltimore : Johns Hopkins University Press, 2000. Pp. 331. » Modern Philology 102, no 1 (août 2004) : 148–51. http://dx.doi.org/10.1086/429204.

Texte intégral
Styles APA, Harvard, Vancouver, ISO, etc.
23

Matesic, Josip. « Hugh Jackson : Australians and the Christian God : An Historical Study. Melbourne : Mosaic Press, 2013 ; pp. 214. » Journal of Religious History 38, no 2 (juin 2014) : 292–93. http://dx.doi.org/10.1111/1467-9809.12176.

Texte intégral
Styles APA, Harvard, Vancouver, ISO, etc.
24

Busch, R. L. « N. N. Shneidman. Dostoevsky and Suicide. Oakville, Ontario : Mosaic Press, 1984. 124 pp. $9.95 (Can) (paper). » Canadian-American Slavic Studies 19, no 2 (1985) : 220–21. http://dx.doi.org/10.1163/221023985x00486.

Texte intégral
Styles APA, Harvard, Vancouver, ISO, etc.
25

Moosa, Ebrahim. « Islam : A Mosaic, Not a Monolith. By Vartan Gregorian. Brookings Institution Press, 2003. 164 pages. $15.95. » Journal of the American Academy of Religion 74, no 4 (11 octobre 2006) : 1023–25. http://dx.doi.org/10.1093/jaarel/lfl018.

Texte intégral
Styles APA, Harvard, Vancouver, ISO, etc.
26

Bloemraad, Irene. « Inside the Mosaic. Edited by Eric Fong. Toronto : University of Toronto Press, 2006. Pp. vii+260. » American Journal of Sociology 113, no 3 (novembre 2007) : 916–18. http://dx.doi.org/10.1086/524806.

Texte intégral
Styles APA, Harvard, Vancouver, ISO, etc.
27

Kirschbaum, Stanislav. « The Socialist Pyramid : Elites and Power in YugoslaviaLenard J. Cohen Oakville : Mosaic Press, 1989, pp. 499 ». Canadian Journal of Political Science 23, no 2 (juin 1990) : 399–400. http://dx.doi.org/10.1017/s0008423900012580.

Texte intégral
Styles APA, Harvard, Vancouver, ISO, etc.
28

Davino, S., L. Bivona, G. Iacono et M. Davino. « First Report of Tomato torrado virus Infecting Tomato in Italy ». Plant Disease 94, no 9 (septembre 2010) : 1172. http://dx.doi.org/10.1094/pdis-94-9-1172a.

Texte intégral
Résumé :
In 2009 and 2010, approximately 2% of plants had disease symptoms, including initial leaflet chlorosis that later developed into necrotic spots and general necroses along the leaflet. Fruit production on affected plants was substantially reduced and necroses were also present. Total RNA was extracted from five symptomatic plant samples using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) and analyzed by reverse transcription (RT)-PCR with specific primer pair: TR2F (5′ GAAGGACGAAGAGCGACTG 3′), and TR2R (5′ AAGGTAGGTATGCGTTTGC 3′) (1). The primers amplified a 575-bp fragment within the coat protein Vp23 of Tomato torrado virus (ToTV). No RT-PCR products were observed when water or asymptomatic tomato plants were used as controls. The RT-PCR products were purified and directly sequenced in both directions. Pair-wise similarity analysis confirmed the presence of ToTV with 99% similarity to isolate PRI-ToTV0301 (GenBank Accession No. DQ388880) and 98% similarity to isolate Kra (Accession No. EU652402). A representative sequence was deposited with GenBank (Accession No. GU903899). To further confirm the presence of ToTV, dsRNA analysis was conducted on all five symptomatic plants and one healthy tomato plant (2). Electrophoresis of dsRNA showed two bands of approximately 5,400 and 7,800 nucleotides long, typical of ToTV in all samples, while a third band between the other two (approximately 6,400 nt) was detected. Serological testing using double-antibody sandwich-ELISA was also conducted on the five symptomatic and 25 additional plants from the same greenhouse that displayed typical Pepino mosaic virus (PepMV) symptoms only. Antibodies used for serological testing screened for the presence of PepMV, Tomato spotted wilt virus, Cucumber mosaic virus, and Tomato mosaic virus (Loewe Biochemica, Sauerlach, Germany). These tests detected PepMV in all samples with disease symptoms typical of PepMV, and in three of the five samples with the newly described symptoms. To our knowledge, this is the first report of ToTV in Italy, and in some plants, co-infection with PepMV was likely. All ToTV-infected tomato plants in the greenhouse were destroyed. References: (1) H. Pospieszny et al. Plant Dis. 91:1364, 2007. (2) J. Sambrook et al. Molecular Cloning. A Laboratory Manual. 2nd ed. Cold Spring Harbor Laboratory Press, Woodbury, NY, 1989.
Styles APA, Harvard, Vancouver, ISO, etc.
29

KITLV, Redactie. « Book Reviews ». New West Indian Guide / Nieuwe West-Indische Gids 62, no 1-2 (1 janvier 1988) : 51–101. http://dx.doi.org/10.1163/13822373-90002046.

Texte intégral
Résumé :
-Brenda Plummer, Carol S. Holzberg, Minorities and power in a black society: the Jewish community of Jamaica. Maryland: The North-South Publishing Company, Inc., 1987. xxx + 259 pp.-Scott Guggenheim, Nina S. de Friedemann ,De sol a sol: genesis, transformacion, y presencia de los negros en Colombia. Bogota: Planeta Columbiana Editorial, 1986. 47 1pp., Jaime Arocha (eds)-Brian L. Moore, Mary Noel Menezes, Scenes from the history of the Portuguese in Guyana. London: Sister M.N. Menezes, RSM, 1986. vii + 175 PP.-Charles Rutheiser, Brian L. Moore, Race, power, and social segmentation in colonial society: Guyana after slavery 1838-1891. New York; Gordon and Breach, 1987. 310 pp.-Thomas Fiehrer, Virginia R. Dominguez, White by definition: social classification in Creole Louisiana. Rutgers, New Jersey: Rutgers University Press, 1986. xviii + 325 pp.-Kenneth Lunn, Brian D. Jacobs, Black politics and urban crisis in Britain. Cambridge, London, New Rochelle, Melbourne and Sydney: Cambridge University Press, 1986. vii + 227 pp.-Brian D. Jacobs, Kenneth Lunn, Race and labour in twentieth-cenruty Britain, London: Frank Cass and Co. Ltd., 1985. 186 pp.-Kenneth M. Bilby, Dick Hebdige, Cut 'n' mix: culture, identity and Caribbean Music. New York: Metheun and Co. Ltd, 1987. 177 pp.-Riva Berleant-Schiller, Robert Dirks, The black saturnalia: conflict and its ritual expression on British West Indian slave plantations. Gainesville, Fl.: University of Florida Press, Monographs in Social Sciences No. 72. xvii + 228.-Marilyn Silverman, James Howe, The Kuna gathering: contemporary village politics in Panama. Austin, Texas: University of Texas Press, 1986. xvi + 326 pp.-Paget Henry, Evelyne Huber Stephens ,Democratic socialism in Jamaica: the political movement and social transformation in dependent capitalism. Princeton, N.J.: Princeton University Press, 1985. xx + 423 pp., John D. Stephens (eds)-Bridget Brereton, Scott B. Macdonald, Trinidad and Tobago: democracy and development in the Caribbean. New York, Connecticut, London: Praeger Publishers, 1986. ix + 213 pp.-Brian L. Moore, Kempe Ronald Hope, Guyana: politics and development in an emergent socialist state. Oakville, New York, London: Mosaic Press, 1985, 136 pp.-Roland I. Perusse, Richard J. Bloomfield, Puerto Rico: the search for a national policy. Boulder and London: Westview Press, Westview Special Studies on Latin America and the Caribbean, 1985. x + 192 pp.-Charles Gilman, Manfred Gorlach ,Focus on the Caribbean. 1986. Amsterdam/Philadelphia, John Benjamins., John A. Holm (eds)-Viranjini Munasinghe, EPICA, The Caribbean: survival, struggle and sovereignty. Washington, EPICA (Ecumenical Program for Interamerican Communication and Action), 1985.-B.W. Higman, Sidney W. Mintz, Sweetness and power: the place of sugar in modern history. New York: Elisabeth Sifton Books, Viking Penguin Inc., 1985. xxx + 274 pp.
Styles APA, Harvard, Vancouver, ISO, etc.
30

Turner, Monica, William Romme et Daniel Tinker. « Spatial and Temporal Patterns in Post-Fire Nitrogen Dynamics of Lodgepole Pine Forests in the Greater Yellowstone Ecosystem ». UW National Parks Service Research Station Annual Reports 25 (1 janvier 2001) : 149–50. http://dx.doi.org/10.13001/uwnpsrc.2001.3485.

Texte intégral
Résumé :
Our study addresses the effects of fire­generated landscape patterns, or variability in structure and composition of successional forest communities, on ecosystem processes such as biogeochemical cycling and productivity. Forest fire is a well-studied disturbance, yet little is known about the long-term implications of a fire-generated landscape mosaic for ecosystem processes. In particular, the dynamics of nitrogen turnover, availability, and sequestration following stand­replacing fire in conifer forests, has received surprisingly little research attention, even though nitrogen is thought to be a limiting factor in most coniferous forests (Smithwick et al. in press). Our current work in Grand Teton and Yellowstone National Parks builds on our previous and continuing long-term studies of the causes and consequences of fire in the Greater Yellowstone Ecosystem (Turner et al. 2003). The fires of 2000 provided new opportunities for studying spatial and temporal variation in ecosystem processes soon after severe disturbances and how these patterns develop and change through time.
Styles APA, Harvard, Vancouver, ISO, etc.
31

McKercher, William R. « Minorities and the Canadian State, Neil Nevitte and Allan Kornberg, eds., Oakville, Ont. : Mosaic Press, 1985, pp. 324. » Canadian journal of law and society 1 (1986) : 176–80. http://dx.doi.org/10.1017/s082932010000106x.

Texte intégral
Styles APA, Harvard, Vancouver, ISO, etc.
32

Schmahl, Wolfgang, Erika Griesshaber, Lurdes Fernandez-Diaz, Andreas Ziegler, Klemens Kelm, Bernd Maier, Fitriana Nindiyasari et Guntram Jordan. « Hierarchical structure of CaCO3biominerals – mesocrystals and functionalization ». Acta Crystallographica Section A Foundations and Advances 70, a1 (5 août 2014) : C239. http://dx.doi.org/10.1107/s2053273314097605.

Texte intégral
Résumé :
Skeletal parts and teeth of marine organisms, avian eggshells, trilobite and isopod eyes, and many more biomineralized tissues consist of bio-calcite or bio-aragonite crystals. We explore the nano- to micro-scale architectures of these materials by electron backscatter diffraction (EBSD) and complementary techniques. In contrast to their inorganic cousins the biogenic "crystals" are hybrid composites with small amounts of organic matrix controlling morphogenesis and critically improving mechanical performance or other functions. For the biominerals meso-crystal-like structures are ubiquitous, consisting of co-oriented nano-blocks with a mosaic-spread of a few degrees, depending on the organism and on the size of the mesocrystal entity[1, 2, 3]. The nano-mosaic can be attributed to growth by nano-particle accretion from an amorphous or gel-like precursor, where relics of organic matrix cause misorientations between the crystallized nano-blocks. Recently we were able to reproduce this feature in gel-grown calcite [Nindiyasari et al., Crystal Growth and Design, in press]. The mesocrystal-co-orientation spreads on to the micro- and even millimeter-scale, frequently with a fractal nature of co-oriented hierarchical units [Maier et al., Acta Biomaterialia, accepted for publication]. The hierarchically structured morphology of the composite crystal or polycrystal is always directed by organic matrix membranes. Sea urchin teeth show a multiplex composite crystal architecture, where different subunits of engineered shapes, Mg-contents, and small misalignments are essential prerequisites for self-sharpening [1]. The figure shows an EBSD map of dendritic interdigitating calcite crystals in an avian egg shell (color coding for crystal orientation) with an misorientation profile along the grey line.
Styles APA, Harvard, Vancouver, ISO, etc.
33

Bernier, Serge. « Reid, Escott, Hungary and Suez 1956 : A View From New Delhi. Oakville (Ontario), Mosaic Press Publishers, 1986, 163 p. » Études internationales 19, no 4 (1988) : 746. http://dx.doi.org/10.7202/702433ar.

Texte intégral
Styles APA, Harvard, Vancouver, ISO, etc.
34

Chan, A. L. « Islam : A Mosaic, Not A Monolith. By Vartan Gregorian. Washington, D.C. : Brookings Institution Press, 2003. xi+164 pp. np. » Journal of Church and State 46, no 3 (1 juin 2004) : 647–48. http://dx.doi.org/10.1093/jcs/46.3.647.

Texte intégral
Styles APA, Harvard, Vancouver, ISO, etc.
35

Galbraith, James K. « RalphLandau, TimothyTaylor, and GavinWright, Eds.,The Mosaic of Economic Growth.Stanford, CA : Stanford Univ. Press, 1996. xii + 450, index, $18.95. » Journal of Comparative Economics 23, no 3 (décembre 1996) : 345–47. http://dx.doi.org/10.1006/jcec.1996.0073.

Texte intégral
Styles APA, Harvard, Vancouver, ISO, etc.
36

Колаковић, Александра. « ЕРНЕСТ ДЕНИ И СРБИ : О „НАЈВЕЋЕМ ПРИЈАТЕЉУ СЛОВЕНАˮ ПОВОДОМ СТОГОДИШЊИЦЕ СМРТИ ERNEST DENIS AND SERBS : ABOUT “THE GREATEST FRIEND OF THE SLAVSˮ ON THE OCCASION OF THE CENTENARY OF DEATH ». Историјски часопис, no 70/2021 (30 décembre 2021) : 493–514. http://dx.doi.org/10.34298/ic2170493k.

Texte intégral
Résumé :
The work of Ernest Denis (1849–1921), a historian, professor and diplomat, is embedded in the idea of the “eternal friendship” between the French and the Serbs. However, one hundred years after his death, the man, in whose house in the Latin Quarter there is L’Institut d’études slaves within Sorbonne University, is unknown to the broader public. In the interwar period, Denis, who from 1912 was also a member of the Serbian Royal Academy, was respected as the “advocate of the subjugated people” and “the greatest friend of the Slavs”. However, after 1945, his work sank into oblivion, except for historians and history buffs. The aim of this paper is to shed light on the work of this French intellectual, based on archival records (Les Archives nationales de France – Site de Paris), the press, his works and memories of his contemporaries. The revaluation of the personality and work of Ernest Denis on the occasion of centenary of his death, is a chance to piece together the mosaic of remembrance and highlight the activities of the present-day L’Institut d’études slaves at Sorbonne.
Styles APA, Harvard, Vancouver, ISO, etc.
37

POULIN, ROBERT. « The Geographic Mosaic of Coevolution. By J. N. Thompson, pp. 443. University of Chicago Press, USA, 2005. ISBN 0 226 79762 7. £20 (US$28) ». Parasitology 131, no 5 (28 octobre 2005) : 726. http://dx.doi.org/10.1017/s0031182005229086.

Texte intégral
Résumé :
It could be argued that much of evolution is really coevolution. Organisms do not exist in an ecological vacuum, but as parts of a network of interacting species. A given species may compete with others for access to prey species used as food, while itself serving as food to predator and parasite species. Natural selection will drive reciprocal evolutionary changes between interacting species. Across its geographical range, a species will encounter different local networks, since the same set of species do not co-occur everywhere. Thus, coevolutionary outcomes will vary in space, forming a geographical mosaic shaped by local adaptation and gene flow. This is the theme of John Thompson's new book, in which the author develops a conceptual framework for the study of coevolution.
Styles APA, Harvard, Vancouver, ISO, etc.
38

Starasta, Leslie. « The African American Experience2008187The African American Experience. Westport, CT : Greenwood Press 2007. Pricing varies according to type of library and user population Last visited November 2007 URL : www.greenwood.com/mosaic/aae/ American Mosaic Databases ». Reference Reviews 22, no 4 (2 mai 2008) : 47. http://dx.doi.org/10.1108/09504120810872346.

Texte intégral
Styles APA, Harvard, Vancouver, ISO, etc.
39

Rice, Ian. « RICKHELMES-HAYES, Measuring the Mosaic : An Intellectual Biography of John Porter. Toronto, ON : University of Toronto Press, 2010, 588 p. » Canadian Review of Sociology/Revue canadienne de sociologie 48, no 4 (novembre 2011) : 458–61. http://dx.doi.org/10.1111/j.1755-618x.2011.01273.x.

Texte intégral
Styles APA, Harvard, Vancouver, ISO, etc.
40

Se, T., et S. Kanematsu. « First Report of Tulip band breaking virus in Mosaic Diseased Tulip in Japan ». Plant Disease 86, no 12 (décembre 2002) : 1405. http://dx.doi.org/10.1094/pdis.2002.86.12.1405a.

Texte intégral
Résumé :
Tulip (Tulipa spp.) is an ornamental plant of major economic importance in Japan. Regions in Toyama Prefecture are some of the most productive for producing tulip bulbs, shipping approximately 50 million bulbs annually. However, mosaic diseases caused by viruses such as Tulip breaking virus (TBV) currently limit bulb production in these areas. Only the potyviruses TBV and Lily mottle virus (LMoV) have been reported infecting tulip in Japan. A virus isolate from tulip with flower-breaking symptom in Toyama Prefecture was tentatively named OE4 and was presumed to be LMoV after detection by LMoV-specific reverse transcription-polymerase chain reaction (RT-PCR) (4). When OE4 was mechanically inoculated on test plants (13 species from six families), RT-PCR confirmed that it infected plants in the Liliaceae (Tulipa spp., Lilium formosanum, and L. concolor) with mosaic symptoms but did not induce any symptoms in Chenopodium quinoa, Tetragonia tetragonoides, and Nicotiana benthamiana. According to Dekker et al. (2) LMoV and Tulip band breaking virus (TBBV) infected Tulipa spp. and TBBV did not infect C. quinoa, T. tetragonoides, N. clevelandii, and N. benthamiana, species that were local or systemic hosts for LMoV. To analyze the genomic sequence of OE4, a primer set was designed for amplifying the coat protein (CP) gene of LMoV, with 5′ -GCAAATGAGACACTCAATG-3′ as a forward primer and 5′-TTACATAGAAATTCCAAGTAAG-3′ as a reverse primer. The fragment obtained was cloned and sequenced (DDBJ/EMBL/GenBank Accession No. AB078007). The CP gene of OE4 consisted of 825 nucleotides and had 86.5% identity (90.6% identity in deduced amino acid sequence) with the CP gene of LMoV-Netherlands (S44147) (3). When it was compared with partial sequences (277 nucleotides) of LMoV (S60810) and TBBV (S60805) (2), the nucleotide sequence identities were 89.9 and 96.4%, respectively. Multiple alignment and a phylogenetic tree based on the 277 nt of the tulip potyviruses, including OE4, showed the close relationship between OE4 and TBBV. These results indicated that OE4 was an isolate of TBBV. However, the CP amino acid sequence identity between TBBV and LMoV was more than 80%, and it seemed logical that TBBV be assigned to a strain of LMoV, according to potyvirus species demarcating criteria (1). Another screening using RT-PCR based detection, and an inoculation test for 55 flower-breaking tulips collected from fields in Toyama Prefecture revealed that four tulip plants were infected with TBBV and 54 with TBV. This suggests that TBV is more prevalent than TBBV, and we need to produce an attenuated virus of TBV, which will be effective for managing tulip breaking disease in the prefecture. References: (1) P. H. Berger et al. Family Potyviridae. Pages 703–724 in: Virus Taxonomy. Academic Press, San Diego, CA, 2000. (2) E. L. Dekker et al. J. Gen. Virol. 74:881, 1993. (3) S. A. Langeveld et al. J. Gen. Virol. 72:1531, 1991. (4) T. Se and S. Kanematsu. Ann. Phytopathol. Soc. Jpn. 64:420, 1998.
Styles APA, Harvard, Vancouver, ISO, etc.
41

Delibašić, G., B. Tanović, J. Hrustic, I. Stanković, A. Bulajić, A. Vučurović et B. Krstić. « First Report of the Natural Infection of Robinia pseudoacacia with Alfalfa mosaic virus ». Plant Disease 97, no 6 (juin 2013) : 851. http://dx.doi.org/10.1094/pdis-12-12-1136-pdn.

Texte intégral
Résumé :
Robinia pseudoacacia L. (family Fabaceae), commonly known as black locust, is native to the southeastern United States, but has been widely planted and naturalized in temperate regions worldwide. In Europe it is often planted alongside streets and in parks, not only because of the dense canopy and impressive flower clusters in spring, but also because it tolerates air pollution well. In June 2012, several black locust trees exhibiting yellow leaf spots accompanied by mottling and leaf deformation were observed in a park in Backa Topola, North Backa District, Serbia. Numerous aphid colonies were found colonizing symptomatic trees. Leaves collected from nine symptomatic and 10 asymptomatic trees were tested for the presence of three common aphid-transmitted viruses, Alfalfa mosaic virus (AMV), Cucumber mosaic virus, and Potato virus Y, using double-antibody sandwich (DAS)-ELISA with commercial polyclonal antibody (Bioreba AG, Reinach, Switzerland). Commercial positive and negative controls and extracts from healthy black locust leaves were included in each assay. AMV was serologically detected in all symptomatic and also in four of the asymptomatic trees, while no other tested viruses were found. Sap from affected leaves of a ELISA-positive sample (373-12) was mechanically inoculated onto five plants each of Chenopodium quinoa and Nicotiana benthamiana using 0.01 M phosphate buffer (pH 7). Symptoms including local chlorotic leaf lesions followed by mosaic on C. quinoa and a bright yellow mosaic on N. benthamiana were observed on all inoculated plants 5 and 10 days post-inoculation, respectively. The identity of the virus was confirmed using reverse transcription (RT)-PCR analysis. Total RNAs from all naturally and mechanically infected plants were isolated using RNeasy Plant Mini Kit (Qiagen, Hilden, Germany). RT-PCR was carried out using the One-Step RT-PCR Kit (Qiagen) with primer pair CP AMV1 and CP AMV2 specific to the partial CP gene and 3′-UTR of AMV RNA 3 (1). Total RNAs from Serbian AMV isolate from alfalfa (GenBank Accession No. FJ527748) and RNA extract from healthy leaves of R. pseudoacacia were used as positive and negative controls, respectively. All tested plants, as well as the positive control, yielded an amplicon of the correct predicted size (751 bp), while no amplicon was recorded in the healthy control. The amplified product of isolate 373-12 was purified with QIAquick PCR Purification Kit (Qiagen) and sequenced on ABI PRISM 3700 DNA analyzer (Macrogen, South Korea) in both directions (KC288155). Pairwise comparison of the 373-12 isolate CP sequence with those available in GenBank, conducted with MEGA5 software (4), revealed the maximum nucleotide identity of 99% (99% amino acid identity) with the soybean isolate (HQ185569) from Tennessee. AMV has a worldwide distribution and its natural host range includes over 150 plant species, including many herbaceous and several woody plants (2). To our knowledge, this is the first report of R. pseudoacacia as a natural host of AMV worldwide. This finding has potentially significant implications for the successful production of susceptible crops, considering that black locust could act as an important link in the epidemiology of AMV as it may serve as a virus reservoir (3). References: (1) M. M. Finetti-Sialer et al. J. Plant Pathol. 79:115, 1997. (2) R. Hull. Comparative Plant Virology. 2nd ed. Elsevier Academic Press, Burlington, MA, 2009. (3) E. E. Muller et al. Plant Dis. 96:506, 2012. (4) K. Tamura et al. Mol. Biol. Evol. 28:2731, 2011.
Styles APA, Harvard, Vancouver, ISO, etc.
42

Ely, Richard G. « TonyCupit, RosGooden and KenManley, eds. : From Five Barley Loaves : Australian Baptists in Global Mission. Melbourne : Mosaic Press, 2013 ; pp. xxvi + 678. » Journal of Religious History 40, no 2 (juin 2016) : 280–82. http://dx.doi.org/10.1111/1467-9809.12359.

Texte intégral
Styles APA, Harvard, Vancouver, ISO, etc.
43

Weiner, Steve, Jon Seligman, Liat Nadav-Ziv, Elie Haddad, Yotam Asscher, Maria Ovechkina, Lior Regev, Eugenia Mintz et Elisabetta Boaretto. « The mosaic tesserae in the industrial Byzantine wine press, Yavne, Israel : A natural unusually hard chalk or a chemically transformed chalk ? » Journal of Archaeological Science 161 (janvier 2024) : 105906. http://dx.doi.org/10.1016/j.jas.2023.105906.

Texte intégral
Styles APA, Harvard, Vancouver, ISO, etc.
44

Peeler Clements, Helen. « The American Indian Experience201040Advisory Editor Loriene Roy. The American Indian Experience. Westport, CT : Greenwood Press 2008. Contact publisher for pricing information Last visited September 2009 Updated semi‐annually URL : www.greenwood.com/mosaic/aie/product_info.aspx American Mosaic ». Reference Reviews 24, no 1 (19 janvier 2010) : 54–55. http://dx.doi.org/10.1108/09504121011012120.

Texte intégral
Styles APA, Harvard, Vancouver, ISO, etc.
45

Bruce, Scott G. « Eric J. Goldberg, In the Manner of the Franks : Hunting, Kingship, and Masculinity in Early Medieval Europe. The Middle Ages Series. Philadelphia, PA : University of Pennsylvania Press, 2020, 338 pp. » Mediaevistik 34, no 1 (1 janvier 2021) : 390–92. http://dx.doi.org/10.3726/med.2021.01.76.

Texte intégral
Résumé :
In this book, Eric Goldberg examines the hunting of animals in the Carolingian period as an expression of early medieval masculinity, as a feature of premodern political culture, and as a window onto one of the many ways that the Frankish people interacted with the natural world. Drawing evidence from a wide range of literary sources from chronicles to saints’ lives, and a host of documentary evidence like laws and administrative records, with occasional nods to art historical and archaeological testimony, Goldberg presents his study over the course of eight chapters. Some of these chapters proceed chronologically, while others treat particular topics with an emphasis on evidence from the eighth and ninth centuries. Taken together, this monograph presents a convincing mosaic of the centrality of hunting in the social and cultural worlds of Carolingian elites.
Styles APA, Harvard, Vancouver, ISO, etc.
46

Lebas, B. S. M., F. M. Ochoa-Corona, D. R. Elliott, J. Z. Tang et B. J. R. Alexander. « Detection of Poinsettia mosaic virus by RT-PCR in Euphorbia spp. in New Zealand ». Plant Disease 91, no 1 (janvier 2007) : 110. http://dx.doi.org/10.1094/pd-91-0110a.

Texte intégral
Résumé :
Euphorbia pulcherrima (poinsettias) are commonly infected with Poinsettia mosaic virus (PnMV), which resembles the Tymovirus genus in its morphology and viral properties (2) but is closer to the Marafivirus genus at the sequence level (1). Symptoms induced by PnMV range from leaf mottling and bract distortion to symptomless (2). The presence of PnMV in plants imported into New Zealand had never been proven. Leaves of 10 E. pulcherrima samples and six samples from other Euphorbia spp. (E. atropurpurea, E. lambii, E. leuconeura, E. mellifera, E. milii, and E. piscatorial) were collected in the Auckland area, North Island in 2002. Isometric particles of 26 to 30 nm in diameter were observed with electron microscopy in 3 of 10 E. pulcherrima samples. These three samples produced systemic chlorosis and crinkling symptoms on mechanically inoculated Nicotiana benthamiana, which tested PnMV positive by double-antibody sandwich (DAS)-ELISA (Agdia, Elkart, IN). No particles or symptoms on N. benthamiana were observed with the other Euphorbia spp., which were also PnMV-negative by DAS-ELISA. A reverse transcription-polymerase chain reaction (RT-PCR) was developed to further characterize PnMV. Specific primers were designed from the PnMV complete genome sequence (Genbank Accession No. AJ271595) using the Primer3 web-based software (4). Primer PnMV-F1 (5′-CCTGTATTGTCTCTTGCCGTCC-3′) and primer PnMV-R1 (5′-AGAGGAAAGGAAAAGGTGGAGG-3′) amplified a 764-bp product from nt 5291 of the 5′-end RNA polymerase gene to nt 6082 of the 3′-untranslated region (UTR). Total RNA was extracted from leaf samples using the Qiagen Plant RNeasy Kit (Qiagen Inc., Chastworth, CA). RT was carried out by using PnMV-R1 primer and MMLV reverse transcriptase (Promega, Madison, WI). The PCR was performed in a 20-μl volume reaction containing 2 μl cDNA, 1× Taq reaction buffer, 1.5 mM MgCl2, 0.2 mM dNTPs, 0.2 μM PnMV-F1 primer, and 1 U of Taq polymerase (Promega) with a denaturation step (94°C for 5 min), 30 amplification cycles (94°C for 30 s; 55°C for 30 s; 72°C for 1 min), and a final elongation (72°C for 5 min). The sequence of the RT-PCR product (Genbank Accession No. DQ462438) had 98.7% amino acid identity to PnMV. PCR products were obtained from two of three PnMV ELISA-positive E. pulcherrima and three of three PnMV ELISA-positive symptomatic N. benthamiana. The failure to amplify the fragment from all ELISA-positive PnMV is likely because of the presence of inhibitors and latex in E. pulcherrima (3) that make the RNA extraction difficult. Thus, while RT-PCR may be useful for further characterizing PnMV isolate sequences, ELISA may be more reliable for virus detection. In conclusion, to our knowledge, this is the first report of PnMV in E. pulcherrima but not in other Euphorbia spp. in New Zealand. E. pulcherrima plants have been imported into New Zealand for nearly 40 years, and the virus is probably widespread throughout the country via retail nursery trading. References: (1) B. G. Bradel et al. Virology 271:289, 2000. (2) R. W. Fulton and J. L. Fulton. Phytopathology 70:321, 1980. (3) D.-E. Lesemann et al. Phytopathol. Z. 107:250, 1983. (4) S. Rozen and S. Skaletsky. Page 365 in: Bioinformatics Methods and Protocols: Methods in Molecular Biology. S. Krawetz and S. Misener, eds. Humana Press, Totowa, NJ, 2000.
Styles APA, Harvard, Vancouver, ISO, etc.
47

Hueckstedt, Robert A. « The Clever Adulteress and Other Stories : A Treasury of Jain Literature. Edited by Phyllis Granoff. Oakville, Ontario : Mosaic Press. 1990. 290 pp. » Journal of Asian Studies 51, no 1 (février 1992) : 193–95. http://dx.doi.org/10.2307/2058401.

Texte intégral
Styles APA, Harvard, Vancouver, ISO, etc.
48

Grimes, John. « The Clever Adultress and Other Stories : A Treasury of Jain Literature Phyllis Granoff, editor Oakville, ON : Mosaic Press, 1990. iv + 209 p ». Studies in Religion/Sciences Religieuses 21, no 1 (mars 1992) : 112. http://dx.doi.org/10.1177/000842989202100120.

Texte intégral
Styles APA, Harvard, Vancouver, ISO, etc.
49

Strong, John S. « Speaking of Monks : Religious Biography in India and China. By Phyllis Granoff and Koichi Shinohara. Oakville, Ont. : Mosaic Press, 1992. viii, 232 pp. » Journal of Asian Studies 53, no 3 (août 1994) : 915–16. http://dx.doi.org/10.2307/2059751.

Texte intégral
Styles APA, Harvard, Vancouver, ISO, etc.
50

Ankeny, Rachel A. « Angela N.H. Creager,The Life of a Virus : Tobacco Mosaic Virus as an Experimental Model, 1930–1965. Chicago : University of Chicago Press, 2002 ». Metascience 12, no 3 (novembre 2003) : 341–44. http://dx.doi.org/10.1023/b:mesc.0000005858.71060.50.

Texte intégral
Styles APA, Harvard, Vancouver, ISO, etc.
Nous offrons des réductions sur tous les plans premium pour les auteurs dont les œuvres sont incluses dans des sélections littéraires thématiques. Contactez-nous pour obtenir un code promo unique!

Vers la bibliographie