Articles de revues : « LHCSR1 »

1

Girolomoni, Laura, Stefano Cazzaniga, Alberta Pinnola, Federico Perozeni, Matteo Ballottari et Roberto Bassi. « LHCSR3 is a nonphotochemical quencher of both photosystems inChlamydomonas reinhardtii ». Proceedings of the National Academy of Sciences 116, n^o 10 (19 février 2019) : 4212–17. http://dx.doi.org/10.1073/pnas.1809812116.

Texte intégral

Résumé :

Photosynthetic organisms prevent oxidative stress from light energy absorbed in excess through several photoprotective mechanisms. A major component is thermal dissipation of chlorophyll singlet excited states and is called nonphotochemical quenching (NPQ). NPQ is catalyzed in green algae by protein subunits called LHCSRs (Light Harvesting Complex Stress Related), homologous to the Light Harvesting Complexes (LHC), constituting the antenna system of both photosystem I (PSI) and PSII. We investigated the role of LHCSR1 and LHCSR3 in NPQ activation to verify whether these proteins are involved in thermal dissipation of PSI excitation energy, in addition to their well-known effect on PSII. To this aim, we measured the fluorescence emitted at 77 K by whole cells in a quenched or unquenched state, using green fluorescence protein as the internal standard. We show that NPQ activation by high light treatment inChlamydomonas reinhardtiileads to energy quenching in both PSI and PSII antenna systems. By analyzing quenching properties of mutants affected on the expression of LHCSR1 or LHCSR3 gene products and/or state 1–state 2 transitions or zeaxanthin accumulation, namely,npq4,stt7,stt7 npq4,npq4 lhcsr1,lhcsr3-complementednpq4 lhcsr1andnpq1, we showed that PSI undergoes NPQ through quenching of the associated LHCII antenna. This quenching event is fast-reversible on switching the light off, is mainly related to LHCSR3 activity, and is dependent on thylakoid luminal pH. Moreover, PSI quenching could also be observed in the absence of zeaxanthin or STT7 kinase activity.

Styles APA, Harvard, Vancouver, ISO, etc.

2

Kosuge, Kotaro, Ryutaro Tokutsu, Eunchul Kim, Seiji Akimoto, Makio Yokono, Yoshifumi Ueno et Jun Minagawa. « LHCSR1-dependent fluorescence quenching is mediated by excitation energy transfer from LHCII to photosystem I in Chlamydomonas reinhardtii ». Proceedings of the National Academy of Sciences 115, n^o 14 (19 mars 2018) : 3722–27. http://dx.doi.org/10.1073/pnas.1720574115.

Texte intégral

Résumé :

Photosynthetic organisms are frequently exposed to light intensities that surpass the photosynthetic electron transport capacity. Under these conditions, the excess absorbed energy can be transferred from excited chlorophyll in the triplet state (3Chl*) to molecular O2, which leads to the production of harmful reactive oxygen species. To avoid this photooxidative stress, photosynthetic organisms must respond to excess light. In the green alga Chlamydomonas reinhardtii, the fastest response to high light is nonphotochemical quenching, a process that allows safe dissipation of the excess energy as heat. The two proteins, UV-inducible LHCSR1 and blue light-inducible LHCSR3, appear to be responsible for this function. While the LHCSR3 protein has been intensively studied, the role of LHCSR1 has been only partially elucidated. To investigate the molecular functions of LHCSR1 in C. reinhardtii, we performed biochemical and spectroscopic experiments and found that the protein mediates excitation energy transfer from light-harvesting complexes for Photosystem II (LHCII) to Photosystem I (PSI), rather than Photosystem II, at a low pH. This altered excitation transfer allows remarkable fluorescence quenching under high light. Our findings suggest that there is a PSI-dependent photoprotection mechanism that is facilitated by LHCSR1.

Styles APA, Harvard, Vancouver, ISO, etc.

3

Roach, Thomas. « LHCSR3-Type NPQ Prevents Photoinhibition and Slowed Growth under Fluctuating Light in Chlamydomonas reinhardtii ». Plants 9, n^o 11 (18 novembre 2020) : 1604. http://dx.doi.org/10.3390/plants9111604.

Texte intégral

Résumé :

Natural light intensities can rise several orders of magnitude over subsecond time spans, posing a major challenge for photosynthesis. Fluctuating light tolerance in the green alga Chlamydomonas reinhardtii requires alternative electron pathways, but the role of nonphotochemical quenching (NPQ) is not known. Here, fluctuating light (10 min actinic light followed by 10 min darkness) led to significant increase in NPQ/qE-related proteins, LHCSR1 and LHCSR3, relative to constant light of the same subsaturating or saturating intensity. Elevated levels of LHCSR1/3 increased the ability of cells to safely dissipate excess light energy to heat (i.e., qE-type NPQ) during dark to light transition, as measured with chlorophyll fluorescence. The low qE phenotype of the npq4 mutant, which is unable to produce LHCSR3, was abolished under fluctuating light, showing that LHCSR1 alone enables very high levels of qE. Photosystem (PS) levels were also affected by light treatments; constant light led to lower PsbA levels and Fv/Fm values, while fluctuating light led to lower PsaA and maximum P700+ levels, indicating that constant and fluctuating light induced PSII and PSI photoinhibition, respectively. Under fluctuating light, npq4 suffered more PSI photoinhibition and significantly slower growth rates than parental wild type, whereas npq1 and npq2 mutants affected in xanthophyll carotenoid compositions had identical growth under fluctuating and constant light. Overall, LHCSR3 rather than total qE capacity or zeaxanthin is shown to be important in C. reinhardtii in tolerating fluctuating light, potentially via preventing PSI photoinhibition.

Styles APA, Harvard, Vancouver, ISO, etc.

4

Dinc, Emine, Lijin Tian, Laura M. Roy, Robyn Roth, Ursula Goodenough et Roberta Croce. « LHCSR1 induces a fast and reversible pH-dependent fluorescence quenching in LHCII in Chlamydomonas reinhardtii cells ». Proceedings of the National Academy of Sciences 113, n^o 27 (22 juin 2016) : 7673–78. http://dx.doi.org/10.1073/pnas.1605380113.

Texte intégral

Résumé :

To avoid photodamage, photosynthetic organisms are able to thermally dissipate the energy absorbed in excess in a process known as nonphotochemical quenching (NPQ). Although NPQ has been studied extensively, the major players and the mechanism of quenching remain debated. This is a result of the difficulty in extracting molecular information from in vivo experiments and the absence of a validation system for in vitro experiments. Here, we have created a minimal cell of the green alga Chlamydomonas reinhardtii that is able to undergo NPQ. We show that LHCII, the main light harvesting complex of algae, cannot switch to a quenched conformation in response to pH changes by itself. Instead, a small amount of the protein LHCSR1 (light-harvesting complex stress related 1) is able to induce a large, fast, and reversible pH-dependent quenching in an LHCII-containing membrane. These results strongly suggest that LHCSR1 acts as pH sensor and that it modulates the excited state lifetimes of a large array of LHCII, also explaining the NPQ observed in the LHCSR3-less mutant. The possible quenching mechanisms are discussed.

Styles APA, Harvard, Vancouver, ISO, etc.

5

Gabilly, Stéphane T., Christopher R. Baker, Setsuko Wakao, Thien Crisanto, Katharine Guan, Ke Bi, Elodie Guiet, Carmela R. Guadagno et Krishna K. Niyogi. « Regulation of photoprotection gene expression in Chlamydomonas by a putative E3 ubiquitin ligase complex and a homolog of CONSTANS ». Proceedings of the National Academy of Sciences 116, n^o 35 (12 août 2019) : 17556–62. http://dx.doi.org/10.1073/pnas.1821689116.

Texte intégral

Résumé :

Photosynthetic organisms use nonphotochemical quenching (NPQ) mechanisms to dissipate excess absorbed light energy and protect themselves from photooxidation. In the model green alga Chlamydomonas reinhardtii, the capacity for rapidly reversible NPQ (qE) is induced by high light, blue light, and UV light via increased expression of LHCSR and PSBS genes that are necessary for qE. Here, we used a forward genetics approach to identify SPA1 and CUL4, components of a putative green algal E3 ubiquitin ligase complex, as critical factors in a signaling pathway that controls light-regulated expression of the LHCSR and PSBS genes in C. reinhardtii. The spa1 and cul4 mutants accumulate increased levels of LHCSR1 and PSBS proteins in high light, and unlike the wild type, they express LHCSR1 and exhibit qE capacity even when grown in low light. The spa1-1 mutation resulted in constitutively high expression of LHCSR and PSBS RNAs in both low light and high light. The qE and gene expression phenotypes of spa1-1 are blocked by mutation of CrCO, a B-box Zn-finger transcription factor that is a homolog of CONSTANS, which controls flowering time in plants. CONSTANS-like cis-regulatory sequences were identified proximal to the qE genes, consistent with CrCO acting as a direct activator of qE gene expression. We conclude that SPA1 and CUL4 are components of a conserved E3 ubiquitin ligase that acts upstream of CrCO, whose regulatory function is wired differently in C. reinhardtii to control qE capacity via cis-regulatory CrCO-binding sites at key photoprotection genes.

Styles APA, Harvard, Vancouver, ISO, etc.

6

Roach, Thomas, Chae Sun Na, Wolfgang Stöggl et Anja Krieger-Liszkay. « The non-photochemical quenching protein LHCSR3 prevents oxygen-dependent photoinhibition in Chlamydomonas reinhardtii ». Journal of Experimental Botany 71, n^o 9 (16 janvier 2020) : 2650–60. http://dx.doi.org/10.1093/jxb/eraa022.

Texte intégral

Résumé :

Abstract Non-photochemical quenching (NPQ) helps dissipate surplus light energy, preventing formation of reactive oxygen species (ROS). In Chlamydomonas reinhardtii, the thylakoid membrane protein LHCSR3 is involved in pH-dependent (qE-type) NPQ, lacking in the npq4 mutant. Preventing PSII repair revealed that npq4 lost PSII activity faster than the wild type (WT) in elevated O2, while no difference between strains was observed in O2-depleted conditions. Low Fv/Fm values remained 1.5 h after moving cells out of high light, and this qH-type quenching was independent of LHCSR3 and not accompanied by losses of maximum PSII activity. Culturing cells in historic O2 atmospheres (30–35%) increased the qE of cells, due to increased LHCSR1 and PsbS levels, and LHCSR3 in the WT, showing that atmospheric O2 tensions regulate qE capacity. Colony growth of npq4 was severely restricted at elevated O2, and npq4 accumulated more reactive electrophile species (RES) than the WT, which could damage PSI. Levels of PsaA (PSI) were lower in npq4 grown at 35% O2, while PsbA (PSII) levels remained stable. We conclude that even at high O2 concentrations, the PSII repair cycle is sufficient to maintain net levels of PSII. However, LHCSR3 has an important function in protecting PSI against O2-mediated damage, such as via RES.

Styles APA, Harvard, Vancouver, ISO, etc.

7

Kondo, Toru, Jesse B. Gordon, Alberta Pinnola, Luca Dall’Osto, Roberto Bassi et Gabriela S. Schlau-Cohen. « Microsecond and millisecond dynamics in the photosynthetic protein LHCSR1 observed by single-molecule correlation spectroscopy ». Proceedings of the National Academy of Sciences 116, n^o 23 (17 mai 2019) : 11247–52. http://dx.doi.org/10.1073/pnas.1821207116.

Texte intégral

Résumé :

Biological systems are subjected to continuous environmental fluctuations, and therefore, flexibility in the structure and function of their protein building blocks is essential for survival. Protein dynamics are often local conformational changes, which allows multiple dynamical processes to occur simultaneously and rapidly in individual proteins. Experiments often average over these dynamics and their multiplicity, preventing identification of the molecular origin and impact on biological function. Green plants survive under high light by quenching excess energy, and Light-Harvesting Complex Stress Related 1 (LHCSR1) is the protein responsible for quenching in moss. Here, we expand an analysis of the correlation function of the fluorescence lifetime by improving the estimation of the lifetime states and by developing a multicomponent model correlation function, and we apply this analysis at the single-molecule level. Through these advances, we resolve previously hidden rapid dynamics, including multiple parallel processes. By applying this technique to LHCSR1, we identify and quantitate parallel dynamics on hundreds of microseconds and tens of milliseconds timescales, likely at two quenching sites within the protein. These sites are individually controlled in response to fluctuations in sunlight, which provides robust regulation of the light-harvesting machinery. Considering our results in combination with previous structural, spectroscopic, and computational data, we propose specific pigments that serve as the quenching sites. These findings, therefore, provide a mechanistic basis for quenching, illustrating the ability of this method to uncover protein function.

Styles APA, Harvard, Vancouver, ISO, etc.

8

Tian, Lijin, Wojciech J. Nawrocki, Xin Liu, Iryna Polukhina, Ivo H. M. van Stokkum et Roberta Croce. « pH dependence, kinetics and light-harvesting regulation of nonphotochemical quenching inChlamydomonas ». Proceedings of the National Academy of Sciences 116, n^o 17 (8 avril 2019) : 8320–25. http://dx.doi.org/10.1073/pnas.1817796116.

Texte intégral

Résumé :

Sunlight drives photosynthesis but can also cause photodamage. To protect themselves, photosynthetic organisms dissipate the excess absorbed energy as heat, in a process known as nonphotochemical quenching (NPQ). In green algae, diatoms, and mosses, NPQ depends on the light-harvesting complex stress-related (LHCSR) proteins. Here we investigated NPQ inChlamydomonas reinhardtiiusing an approach that maintains the cells in a stable quenched state. We show that in the presence of LHCSR3, all of the photosystem (PS) II complexes are quenched and the LHCs are the site of quenching, which occurs at a rate of ∼150 ps−1and is not induced by LHCII aggregation. The effective light-harvesting capacity of PSII decreases upon NPQ, and the NPQ rate is independent of the redox state of the reaction center. Finally, we could measure the pH dependence of NPQ, showing that the luminal pH is always above 5.5 in vivo and highlighting the role of LHCSR3 as an ultrasensitive pH sensor.

Styles APA, Harvard, Vancouver, ISO, etc.

9

Dikaios, Ioannis, Christo Schiphorst, Luca Dall’Osto, Alessandro Alboresi, Roberto Bassi et Alberta Pinnola. « Functional analysis of LHCSR1, a protein catalyzing NPQ in mosses, by heterologous expression in Arabidopsis thaliana ». Photosynthesis Research 142, n^o 3 (3 juillet 2019) : 249–64. http://dx.doi.org/10.1007/s11120-019-00656-3.

Texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

10

Pinnola, Alberta, Hristina Staleva-Musto, Stefano Capaldi, Matteo Ballottari, Roberto Bassi et Tomáš Polívka. « Electron transfer between carotenoid and chlorophyll contributes to quenching in the LHCSR1 protein from Physcomitrella patens ». Biochimica et Biophysica Acta (BBA) - Bioenergetics 1857, n^o 12 (décembre 2016) : 1870–78. http://dx.doi.org/10.1016/j.bbabio.2016.09.001.

Texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

11

Kondo, Toru, Alberta Pinnola, Wei Jia Chen, Luca Dall'Osto, Roberto Bassi et Gabriela S. Schlau-Cohen. « Single-molecule spectroscopy of LHCSR1 protein dynamics identifies two distinct states responsible for multi-timescale photosynthetic photoprotection ». Nature Chemistry 9, n^o 8 (17 juillet 2017) : 772–78. http://dx.doi.org/10.1038/nchem.2818.

Texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

12

Correa-Galvis, Viviana, Petra Redekop, Katharine Guan, Annika Griess, Thuy B. Truong, Setsuko Wakao, Krishna K. Niyogi et Peter Jahns. « Photosystem II Subunit PsbS Is Involved in the Induction of LHCSR Protein-dependent Energy Dissipation in Chlamydomonas reinhardtii ». Journal of Biological Chemistry 291, n^o 33 (29 juin 2016) : 17478–87. http://dx.doi.org/10.1074/jbc.m116.737312.

Texte intégral

Résumé :

Non-photochemical quenching of excess excitation energy is an important photoprotective mechanism in photosynthetic organisms. In Arabidopsis thaliana, a high quenching capacity is constitutively present and depends on the PsbS protein. In the green alga Chlamydomonas reinhardtii, non-photochemical quenching becomes activated upon high light acclimation and requires the accumulation of light harvesting complex stress-related (LHCSR) proteins. Expression of the PsbS protein in C. reinhardtii has not been reported yet. Here, we show that PsbS is a light-induced protein in C. reinhardtii, whose accumulation under high light is further controlled by CO2 availability. PsbS accumulated after several hours of high light illumination at low CO2. At high CO2, however, PsbS was only transiently expressed under high light and was degraded after 1 h of high light exposure. PsbS accumulation correlated with an enhanced non-photochemical quenching capacity in high light-acclimated cells grown at low CO2. However, PsbS could not compensate for the function of LHCSR in an LHCSR-deficient mutant. Knockdown of PsbS accumulation led to reduction of both non-photochemical quenching capacity and LHCSR3 accumulation. Our data suggest that PsbS is essential for the activation of non-photochemical quenching in C. reinhardtii, possibly by promoting conformational changes required for activation of LHCSR3-dependent quenching in the antenna of photosystem II.

Styles APA, Harvard, Vancouver, ISO, etc.

13

Strenkert, Daniela, Stefan Schmollinger, Sean D. Gallaher, Patrice A. Salomé, Samuel O. Purvine, Carrie D. Nicora, Tabea Mettler-Altmann et al. « Multiomics resolution of molecular events during a day in the life of Chlamydomonas ». Proceedings of the National Academy of Sciences 116, n^o 6 (18 janvier 2019) : 2374–83. http://dx.doi.org/10.1073/pnas.1815238116.

Texte intégral

Résumé :

The unicellular green algaChlamydomonas reinhardtiidisplays metabolic flexibility in response to a changing environment. We analyzed expression patterns of its three genomes in cells grown under light–dark cycles. Nearly 85% of transcribed genes show differential expression, with different sets of transcripts being up-regulated over the course of the day to coordinate cellular growth before undergoing cell division. Parallel measurements of select metabolites and pigments, physiological parameters, and a subset of proteins allow us to infer metabolic events and to evaluate the impact of the transcriptome on the proteome. Among the findings are the observations thatChlamydomonasexhibits lower respiratory activity at night compared with the day; multiple fermentation pathways, some oxygen-sensitive, are expressed at night in aerated cultures; we propose that the ferredoxin, FDX9, is potentially the electron donor to hydrogenases. The light stress-responsive genesPSBS,LHCSR1, andLHCSR3show an acute response to lights-on at dawn under abrupt dark-to-light transitions, whileLHCSR3genes also exhibit a later, second burst in expression in the middle of the day dependent on light intensity. Each response to light (acute and sustained) can be selectively activated under specific conditions. Our expression dataset, complemented with coexpression networks and metabolite profiling, should constitute an excellent resource for the algal and plant communities.

Styles APA, Harvard, Vancouver, ISO, etc.

14

Allorent, Guillaume, Linnka Lefebvre-Legendre, Richard Chappuis, Marcel Kuntz, Thuy B. Truong, Krishna K. Niyogi, Roman Ulm et Michel Goldschmidt-Clermont. « UV-B photoreceptor-mediated protection of the photosynthetic machinery inChlamydomonas reinhardtii ». Proceedings of the National Academy of Sciences 113, n^o 51 (5 décembre 2016) : 14864–69. http://dx.doi.org/10.1073/pnas.1607695114.

Texte intégral

Résumé :

Life on earth is dependent on the photosynthetic conversion of light energy into chemical energy. However, absorption of excess sunlight can damage the photosynthetic machinery and limit photosynthetic activity, thereby affecting growth and productivity. Photosynthetic light harvesting can be down-regulated by nonphotochemical quenching (NPQ). A major component of NPQ is qE (energy-dependent nonphotochemical quenching), which allows dissipation of light energy as heat. Photodamage peaks in the UV-B part of the spectrum, but whether and how UV-B induces qE are unknown. Plants are responsive to UV-B via the UVR8 photoreceptor. Here, we report in the green algaChlamydomonas reinhardtiithat UVR8 induces accumulation of specific members of the light-harvesting complex (LHC) superfamily that contribute to qE, in particular LHC Stress-Related 1 (LHCSR1) and Photosystem II Subunit S (PSBS). The capacity for qE is strongly induced by UV-B, although the patterns of qE-related proteins accumulating in response to UV-B or to high light are clearly different. The competence for qE induced by acclimation to UV-B markedly contributes to photoprotection upon subsequent exposure to high light. Our study reveals an anterograde link between photoreceptor-mediated signaling in the nucleocytosolic compartment and the photoprotective regulation of photosynthetic activity in the chloroplast.

Styles APA, Harvard, Vancouver, ISO, etc.

15

Pinnola, Alberta, Leonardo Ghin, Elisa Gecchele, Matilde Merlin, Alessandro Alboresi, Linda Avesani, Mario Pezzotti, Stefano Capaldi, Stefano Cazzaniga et Roberto Bassi. « Heterologous Expression of Moss Light-harvesting Complex Stress-related 1 (LHCSR1), the Chlorophylla-Xanthophyll Pigment-protein Complex Catalyzing Non-photochemical Quenching, inNicotianasp. » Journal of Biological Chemistry 290, n^o 40 (10 août 2015) : 24340–54. http://dx.doi.org/10.1074/jbc.m115.668798.

Texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

16

Pi, Xiong, Lirong Tian, Huai-En Dai, Xiaochun Qin, Lingpeng Cheng, Tingyun Kuang, Sen-Fang Sui et Jian-Ren Shen. « Unique organization of photosystem I–light-harvesting supercomplex revealed by cryo-EM from a red alga ». Proceedings of the National Academy of Sciences 115, n^o 17 (9 avril 2018) : 4423–28. http://dx.doi.org/10.1073/pnas.1722482115.

Texte intégral

Résumé :

Photosystem I (PSI) is one of the two photosystems present in oxygenic photosynthetic organisms and functions to harvest and convert light energy into chemical energy in photosynthesis. In eukaryotic algae and higher plants, PSI consists of a core surrounded by variable species and numbers of light-harvesting complex (LHC)I proteins, forming a PSI-LHCI supercomplex. Here, we report cryo-EM structures of PSI-LHCR from the red alga Cyanidioschyzon merolae in two forms, one with three Lhcr subunits attached to the side, similar to that of higher plants, and the other with two additional Lhcr subunits attached to the opposite side, indicating an ancient form of PSI-LHCI. Furthermore, the red algal PSI core showed features of both cyanobacterial and higher plant PSI, suggesting an intermediate type during evolution from prokaryotes to eukaryotes. The structure of PsaO, existing in eukaryotic organisms, was identified in the PSI core and binds three chlorophylls a and may be important in harvesting energy and in mediating energy transfer from LHCII to the PSI core under state-2 conditions. Individual attaching sites of LHCRs with the core subunits were identified, and each Lhcr was found to contain 11 to 13 chlorophylls a and 5 zeaxanthins, which are apparently different from those of LHCs in plant PSI-LHCI. Together, our results reveal unique energy transfer pathways different from those of higher plant PSI-LHCI, its adaptation to the changing environment, and the possible changes of PSI-LHCI during evolution from prokaryotes to eukaryotes.

Styles APA, Harvard, Vancouver, ISO, etc.

17

Montgomery, G. W., M. L. Tate, H. M. Henry, J. M. Penty et R. M. Rohan. « The follicle-stimulating hormone receptor and luteinizing hormone receptor genes are closely linked in sheep and deer ». Journal of Molecular Endocrinology 15, n^o 3 (décembre 1995) : 259–65. http://dx.doi.org/10.1677/jme.0.0150259.

Texte intégral

Résumé :

ABSTRACT Restriction fragment length polymorphisms were identified in sheep and deer using ovine cDNA probes for the FSH receptor (FSHR) and the LH receptor (LHCGR). FSHR and LHCGR were closely linked in sheep with no recombinants and neither receptor was linked to the Booroola fecundity gene (FecB). Both receptors were also closely linked in deer at a map distance of 3·3 cM. Linkage between the receptor genes assigns FSHR to sheep chromosome 3. Sequence analysis showed that the mammalian LHCGRs and FSHRs are more similar to each other than to mammalian TSH receptor (TSHR). Taken together, these data suggest that TSHR and the LHCGR/FSHR arose from a common ancestral gene by a process of chromosomal duplication. Subsequent duplication of the region containing the LH/FSH receptor and functional divergence could have given rise to the two gonadotrophin receptors present in mammals today.

Styles APA, Harvard, Vancouver, ISO, etc.

18

Brandt, Peter, Helene Gleibs, Andrea Kohne et Wolfgang Wiessner. « Variabilität des "light-harvesting-systems" im Zellzyklus von Chlorella fusca / Variability of the Light-Harvesting-System during the Cell Cycle of Chlorella fusca ». Zeitschrift für Naturforschung C 40, n^o 1-2 (1 février 1985) : 115–21. http://dx.doi.org/10.1515/znc-1985-1-222.

Texte intégral

Résumé :

The seven chlorophyll-protein complexes CPIa, CPI, LHCP1, LHCP2, CPa, LHCP1 and LHCP11 known in part also from the chloroplasts of higher plants were isolated from Chlorella fusca. They were characterized by their molecular weight, their absorption maxima and their ratio of chlorophyll a/chlorophyll b. The composition of the chloropyhll-protein complexes changes during the cell cycle of Chlorella fusca. The ratio of LHCP/CPI decreases at the beginning of the light period and the ratio LHCP/CPa after the 2nd hour of the light period. Both quotients increase at the 5th hour of the light period, have a maximum at the 8th hour of the light period and decrease afterwards during the second part of the cell cycle. These alterations are no reflections of chlorophyll-accumulation, but cause modifications in the organization of the thylakoids and influence the photosynthetic efficiency of Chlorella fusca. The size of the PSI- and PSII-units during the cell cycle was estimated by these changes of the LHCP/CPI- and LHCP/CPa-ratios. In addition evidence is given that the assembly of LHCP1 and LHCP2 is no simple association of the monomeric forms of LHCPI or LHCPII.

Styles APA, Harvard, Vancouver, ISO, etc.

19

Rathod, Mithun Kumar, Sreedhar Nellaepalli, Shin-Ichiro Ozawa, Hiroshi Kuroda, Natsumi Kodama, Sandrine Bujaldon, Francis-André Wollman et Yuichiro Takahashi. « Assembly Apparatus of Light-Harvesting Complexes : Identification of Alb3.1–cpSRP–LHCP Complexes in the Green Alga Chlamydomonas reinhardtii ». Plant and Cell Physiology 63, n^o 1 (1 octobre 2021) : 70–81. http://dx.doi.org/10.1093/pcp/pcab146.

Texte intégral

Résumé :

Abstract The unicellular green alga, Chlamydomonas reinhardtii, contains many light-harvesting complexes (LHCs) associating chlorophylls a/b and carotenoids; the major LHCIIs (types I, II, III and IV) and minor light-harvesting complexes, CP26 and CP29, for photosystem II, as well as nine LHCIs (LHCA1–9), for photosystem I. A pale green mutant BF4 exhibited impaired accumulation of LHCs due to deficiency in the Alb3.1 gene, which encodes the insertase involved in insertion, folding and assembly of LHC proteins in the thylakoid membranes. To elucidate the molecular mechanism by which ALB3.1 assists LHC assembly, we complemented BF4 to express ALB3.1 fused with no, single or triple Human influenza hemagglutinin (HA) tag at its C-terminus (cAlb3.1, cAlb3.1-HA or cAlb3.1–3HA). The resulting complemented strains accumulated most LHC proteins comparable to wild-type (WT) levels. The affinity purification of Alb3.1-HA and Alb3.1–3HA preparations showed that ALB3.1 interacts with cpSRP43 and cpSRP54 proteins of the chloroplast signal recognition particle (cpSRP) and several LHC proteins; two major LHCII proteins (types I and III), two minor LHCII proteins (CP26 and CP29) and eight LHCI proteins (LHCA1, 2, 3, 4, 5, 6, 8 and 9). Pulse-chase labeling experiments revealed that the newly synthesized major LHCII proteins were transiently bound to the Alb3.1 complex. We propose that Alb3.1 interacts with cpSRP43 and cpSRP54 to form an assembly apparatus for most LHCs in the thylakoid membranes. Interestingly, photosystem I (PSI) proteins were also detected in the Alb3.1 preparations, suggesting that the integration of LHCIs to a PSI core complex to form a PSI–LHCI subcomplex occurs before assembled LHCIs dissociate from the Alb3.1–cpSRP complex.

Styles APA, Harvard, Vancouver, ISO, etc.

20

Pinnola, Alberta. « The rise and fall of Light-Harvesting Complex Stress-Related proteins as photoprotection agents during evolution ». Journal of Experimental Botany 70, n^o 20 (2 août 2019) : 5527–35. http://dx.doi.org/10.1093/jxb/erz317.

Texte intégral

Résumé :

This review on the evolution of quenching mechanisms for excess energy dissipation focuses on the role of Light-Harvesting Complex Stress-Related (LHCSR) proteins versus Photosystem II Subunit S (PSBS) protein, and the reasons for the redundancy of LHCSR in vascular plants as PSBS became established.

Styles APA, Harvard, Vancouver, ISO, etc.

21

Giovagnetti, Vasco, et Alexander V. Ruban. « The evolution of the photoprotective antenna proteins in oxygenic photosynthetic eukaryotes ». Biochemical Society Transactions 46, n^o 5 (28 août 2018) : 1263–77. http://dx.doi.org/10.1042/bst20170304.

Texte intégral

Résumé :

Photosynthetic organisms require rapid and reversible down-regulation of light harvesting to avoid photodamage. Response to unpredictable light fluctuations is achieved by inducing energy-dependent quenching, qE, which is the major component of the process known as non-photochemical quenching (NPQ) of chlorophyll fluorescence. qE is controlled by the operation of the xanthophyll cycle and accumulation of specific types of proteins, upon thylakoid lumen acidification. The protein cofactors so far identified to modulate qE in photosynthetic eukaryotes are the photosystem II subunit S (PsbS) and light-harvesting complex stress-related (LHCSR/LHCX) proteins. A transition from LHCSR- to PsbS-dependent qE took place during the evolution of the Viridiplantae (also known as ‘green lineage’ organisms), such as green algae, mosses and vascular plants. Multiple studies showed that LHCSR and PsbS proteins have distinct functions in the mechanism of qE. LHCX(-like) proteins are closely related to LHCSR proteins and found in ‘red lineage’ organisms that contain secondary red plastids, such as diatoms. Although LHCX proteins appear to control qE in diatoms, their role in the mechanism remains poorly understood. Here, we present the current knowledge on the functions and evolution of these crucial proteins, which evolved in photosynthetic eukaryotes to optimise light harvesting.

Styles APA, Harvard, Vancouver, ISO, etc.

22

Levin, Guy, et Gadi Schuster. « LHC-like Proteins : The Guardians of Photosynthesis ». International Journal of Molecular Sciences 24, n^o 3 (28 janvier 2023) : 2503. http://dx.doi.org/10.3390/ijms24032503.

Texte intégral

Résumé :

The emergence of chlorophyll-containing light-harvesting complexes (LHCs) was a crucial milestone in the evolution of photosynthetic eukaryotic organisms. Light-harvesting chlorophyll-binding proteins form complexes in proximity to the reaction centres of photosystems I and II and serve as an antenna, funnelling the harvested light energy towards the reaction centres, facilitating photochemical quenching, thereby optimizing photosynthesis. It is now generally accepted that the LHC proteins evolved from LHC-like proteins, a diverse family of proteins containing up to four transmembrane helices. Interestingly, LHC-like proteins do not participate in light harvesting to elevate photosynthesis activity under low light. Instead, they protect the photosystems by dissipating excess energy and taking part in non-photochemical quenching processes. Although there is evidence that LHC-like proteins are crucial factors of photoprotection, the roles of only a few of them, mainly the stress-related psbS and lhcSR, are well described. Here, we summarize the knowledge gained regarding the evolution and function of the various LHC-like proteins, with emphasis on those strongly related to photoprotection. We further suggest LHC-like proteins as candidates for improving photosynthesis in significant food crops and discuss future directions in their research.

Styles APA, Harvard, Vancouver, ISO, etc.

23

Xue, Huidan, Sonja Verena Bergner, Martin Scholz et Michael Hippler. « Novel insights into the function of LHCSR3 in Chlamydomonas reinhardtii ». Plant Signaling & ; Behavior 10, n^o 12 (2 décembre 2015) : e1058462. http://dx.doi.org/10.1080/15592324.2015.1058462.

Texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

24

Lorenzen, Mette, John Erik Nielsen, Christine Hjorth Andreassen, Anders Juul, Birgitte Grønkær Toft, Ewa Rajpert-De Meyts, Gedske Daugaard et Martin Blomberg Jensen. « Luteinizing Hormone Receptor Is Expressed in Testicular Germ Cell Tumors : Possible Implications for Tumor Growth and Prognosis ». Cancers 12, n^o 6 (26 mai 2020) : 1358. http://dx.doi.org/10.3390/cancers12061358.

Texte intégral

Résumé :

Luteinizing hormone/choriogonadotropin receptor (LHCGR) regulates gonadal testosterone production and recent studies have suggested a growth-regulatory role in somatic cancers. Here, we established that LHCGR is expressed in a fraction of seminoma cells and germ cell neoplasia in situ (GCNIS), and the seminoma-derived cell line TCam2 released LHCGR into the medium. LH treatment induced proliferation of TCam2 cells in vitro, while hCG treatment induced a non-significant 51% increase in volume of tumors formed in a TCam2 xenograft model. A specific ELISA was used to detect a soluble LHCGR in serum. Serum concentrations of soluble LHCGR could not distinguish 4 patients with GCNIS and 216 patients with testicular germ cell tumors (TGCTs) from 297 infertile or 148 healthy young men. Instead, serum LHCGR levels were significantly higher in 112 patients with a seminoma >5 cm or elevated serum lactate dehydrogenase (LDH) compared with men harboring smaller seminomas <2 cm or normal LDH levels. Serum LHCGR levels in TGCT patients could not predict relapse irrespective whether determined pre- or post-orchiectomy. Combined, these novel findings suggest that LHCGR may be directly involved in the progression and growth of seminomas, and our retrospective pilot study suggests that serum LHCGR may have some prognostic value in men with seminoma.

Styles APA, Harvard, Vancouver, ISO, etc.

25

Crovetto, Francesca, Francesc Figueras, Fatima Crispi, Stefania Triunfo, Michael Pugia, Luis Lasalvia, Anne E. Chambers et al. « Forms of Circulating Luteinizing Hormone Human Chorionic Gonadotropin Receptor for the Prediction of Early and Late Preeclampsia in the First Trimester of Pregnancy ». Fetal Diagnosis and Therapy 38, n^o 2 (2015) : 94–102. http://dx.doi.org/10.1159/000371516.

Texte intégral

Résumé :

Objective: To explore the value of circulating luteinizing human chorionic gonadotropin receptor (LHCGR) forms for the prediction of preeclampsia (PE) in the first trimester of pregnancy. Methods: Case-control study, based on a cohort of 5,759 pregnancies, including 20 early PE, 20 late PE, and 300 controls. We recorded/measured maternal characteristics, mean arterial pressure (MAP), uterine artery (UtA) Doppler, placental growth factor (PlGF), soluble Fms-like tyrosine kinase-1 (sFtl-1), and LHCGR forms (hCG-LHCGR and soluble LHCGR), and their independent predictive values were analyzed by logistic regression. Results: For early PE, the model included black ethnicity, chronic hypertension, previous PE, MAP, UtA Doppler, PlGF, sFlt-1, and LHCGR forms, achieving detection rates (DR) of 83% at 10% of false-positive rates (FPR) [AUC: 0.961 (95% CI: 0.921-1)]. For late PE, the model included body mass index, previous PE, UtA Doppler, PlGF, sFlt-1, and LHCGR forms, with DR of 75% at 10% of FPR [AUC: 0.923 (95% CI: 0.871-0.976)]. In both early and late PE, LHCGR forms improved DR by 6-15%. Conclusions: LHCGR forms improved the prediction for early and late PE. These results should be confirmed in larger prospective studies.

Styles APA, Harvard, Vancouver, ISO, etc.

26

Doroszko, Milena, Marcin Chrusciel, Joanna Stelmaszewska, Tomasz Slezak, Adolfo Rivero-Muller, Artur Padzik, Slawomir Anisimowicz et al. « Luteinizing Hormone and GATA4 Action in the Adrenocortical Tumorigenesis of Gonadectomized Female Mice ». Cellular Physiology and Biochemistry 43, n^o 3 (2017) : 1064–76. http://dx.doi.org/10.1159/000481718.

Texte intégral

Résumé :

Background/Aims: Physiological role of luteinizing hormone (LH) and its receptor (LHCGR) in adrenal remains unknown. In inhibin-α/Simian Virus 40 T antigen (SV40Tag) (inhα/Tag) mice, gonadectomy-induced (OVX) elevated LH triggers the growth of transcription factor GATA4 (GATA4)-positive adrenocortical tumors in a hyperplasia-adenoma-adenocarcinoma sequence. Methods: We investigated the role of LHCGR in tumor induction, by crossbreeding inhα/Tag with Lhcgr knockout (LuRKO) mice. By knocking out Lhcgr and Gata4 in Cα1 adrenocortical cells (Lhcgr-ko, Gata4-ko) we tested their role in tumor progression. Results: Adrenal tumors of OVX inhα/Tag mice develop from the hyperplastic cells localized in the topmost layer of zona fasciculata. OVX inhα/Tag/LuRKO only developed SV40Tag positive hyperplastic cells that were GATA4 negative, cleaved caspase-3 positive and did not progress into adenoma. In contrast to Lhcgr-ko, Gata4-ko Cα1 cells presented decreased proliferation, increased apoptosis, decreased expression of Inha, SV40Tag and Lhcgr tumor markers, as well as up-regulated adrenal- and down-regulated sex steroid gene expression. Both Gata4-ko and Lhcgr-ko Cα1 cells had decreased expression of steroidogenic genes resulting in decreased basal progesterone production. Conclusion: Our data indicate that LH/LHCGR signaling is critical for the adrenal cell reprogramming by GATA4 induction prompting adenoma formation and gonadal-like phenotype of the adrenocortical tumors in inhα/Tag mice.

Styles APA, Harvard, Vancouver, ISO, etc.

27

Cheung, Janelle, Noor A. Lokman, Riya D. Abraham, Anne M. Macpherson, Eunice Lee, Frank Grutzner, Nicolae Ghinea, Martin K. Oehler et Carmela Ricciardelli. « Reduced Gonadotrophin Receptor Expression Is Associated with a More Aggressive Ovarian Cancer Phenotype ». International Journal of Molecular Sciences 22, n^o 1 (23 décembre 2020) : 71. http://dx.doi.org/10.3390/ijms22010071.

Texte intégral

Résumé :

Follicle-stimulating hormone (FSH) and luteinising hormone (LH) play important roles in regulating cell growth and proliferation in the ovary. However, few studies have explored the expression of FSH and LH receptors (FSHR and LHCGR) in ovarian cancer, and their functional roles in cancer progression remain inconclusive. This study investigated the potential impact of both mRNA (FSHR, LHCGR) and protein (FSHR, LHCGR) expression on ovarian cancer progression using publicly available online databases, qRT-PCR (high grade serous ovarian cancers, HGSOC, n = 29 and benign ovarian tumors, n = 17) and immunohistochemistry (HGSOC, n = 144). In addition, we investigated the effect of FSHR and LHCGR siRNA knockdown on the pro-metastatic behavior of serous ovarian cancer cells in vitro. High FSHR or high LHCGR expression in patients with all subtypes of high-grade ovarian cancer was significantly associated with longer progression-free survival (PFS) and overall survival (OS). High FSHR protein expression was associated with increased PFS (p = 0.050) and OS (p = 0.025). HGSOC patients with both high FSHR and high LHCGR protein levels had the best survival outcome, whilst both low FSHR and low LHCGR expression was associated with poorest survival (p = 0.019). Knockdown of FSHR significantly increased the invasion of serous ovarian cancer cells (OVCAR3 and COV362) in vitro. LHCGR knockdown also promoted invasion of COV362 cells. This study highlights that lower FSHR and LHCGR expression is associated with a more aggressive epithelial ovarian cancer phenotype and promotes pro-metastatic behaviour.

Styles APA, Harvard, Vancouver, ISO, etc.

28

Gridelet, Virginie, Marie Tsampalas, Sarah Berndt, Marie-Thérèse Hagelstein, Chantal Charlet-Renard, Valérie Conrath, Fabien Ectors et al. « Evidence for cross-talk between the LH receptor and LH during implantation in mice ». Reproduction, Fertility and Development 25, n^o 3 (2013) : 511. http://dx.doi.org/10.1071/rd11241.

Texte intégral

Résumé :

The present study investigated the first interaction that occurs between the blastocyst and endometrium during implantation. Given the ethical objections to studying implantation in humans, a mouse model was used to study the dialogue between luteinising hormone (LH) and luteinising hormone receptor (LHCGR). Several studies performed on LHCGR-knockout mice have generated controversy regarding the importance of the dialogue between LH and LHCGR during implantation. There has been no demonstration of a bioactive LH-like signal produced by the murine blastocyst. The first aim of the present study was to examine and quantify, using radioimmunoassay, the generation of a bioactive LH signal by the murine blastocyst. We went on to examine and quantify endometrial Lhcgr expression to validate the mouse model. Expression of LHCGR in mouse uteri was demonstrated using immunohistochemistry and western blot analysis. To quantify the expression of Lh in the mouse blastocyst and Lhcgr in the endometrium, reverse transcription–polymerase chain reaction (RT-PCR) and real-time quantitative (q) RT-PCR were performed. The results demonstrate that Lhcgr expression in BALB/c mouse endometrial epithelium is increased at the time of implantation and indicate that LHCGR may contribute to the implantation process. In support of this hypothesis, we identified a bioactive LH signal at the time of murine blastocyst implantation.

Styles APA, Harvard, Vancouver, ISO, etc.

29

Wang, Peng, Han Zhao, Tao Li, Wei Zhang, Keliang Wu, Mei Li, Yuehong Bian et al. « Hypomethylation of the LH/Choriogonadotropin Receptor Promoter Region Is a Potential Mechanism Underlying Susceptibility to Polycystic Ovary Syndrome ». Endocrinology 155, n^o 4 (1 avril 2014) : 1445–52. http://dx.doi.org/10.1210/en.2013-1764.

Texte intégral

Résumé :

Our previous genome-wide association study identified LH/choriogonadotropin receptor (LHCGR) as a susceptibility gene for polycystic ovary syndrome (PCOS). The objective of this study was to determine whether the genetic or epigenetic components associated with LHCGR participate in the pathogenesis of PCOS. The exons and flanking regions of LHCGR were sequenced from 192 women with PCOS, and no novel somatic mutations were identified. In addition, the methylation statuses of 6 cytosine-phosphate-guanine (CpG) sites in the promoter region of LHCGR were measured by pyrosequencing using peripheral blood cells from 85 women with PCOS and 88 control women. We identified 2 hypomethylated sites, CpG −174 (corrected P = .018) and −111 (corrected P = .006). Bisulfite sequencing then was performed to replicate these findings and detect additional CpG sites in the promoter. CpG +17 was significantly hypomethylated in women with PCOS (corrected P = .02). Methylation statuses were further evaluated using granulosa cells (GCs), and the region described was hypomethylated as a whole (P = .004) with 8 significantly hypomethylated sites (CpG −174, −148, −61, −43, −8, +10, +17, and +20). Transcription of LHCGR was elevated in women with PCOS compared with that in control women (P < .01). These findings were consistent with the decreased LHCGR methylation status associated with PCOS. The tendency of LHCGR to be hypomethylated across different tissues and its corresponding expression level suggest that hypomethylation of LHCGR is a potential mechanism underlying susceptibility to PCOS. Further studies are needed to evaluate whether a causal relationship exists between LHCGR methylation status and PCOS.

Styles APA, Harvard, Vancouver, ISO, etc.

30

Cannon, Jennifer D., Srinivas V. Seekallu, Catherine A. VandeVoort et Charles L. Chaffin. « Association of luteinizing hormone receptor gene expression with cell cycle progression in granulosa cells ». American Journal of Physiology-Endocrinology and Metabolism 296, n^o 6 (juin 2009) : E1392—E1399. http://dx.doi.org/10.1152/ajpendo.90965.2008.

Texte intégral

Résumé :

During hormonally induced ovarian follicle growth, granulosa cell proliferation increases and returns to baseline prior to the administration of an ovulatory stimulus. Several key genes appear to follow a similar pattern, including the luteinizing hormone receptor (LHCGR), suggesting an association between cell cycle progression and gene expression. The expression of LHCGR mRNA in granulosa cells isolated from immature rats and treated in culture with FSH increased in a time-dependent manner, whereas administration of the cell cycle inhibitor mimosine completely suppressed expression. Although forskolin was able to induce luteinization in cells treated with mimosine, human chorionic gonadotropin had no effect, indicating the functional loss of LHCGR. The effects of mimosine on cell cycle progression and LHCGR mRNA expression were reversible within 24 h of mimosine removal. Cell cycle inhibition did not alter the stability of LHCGR mRNA, indicating that the primary effect was at the transcriptional level. To determine whether the relationship between LHCGR expression and cell cycle were relevant in vivo, immature rats were given a bolus of PMSG, followed by a second injection of either saline or PMSG 24 h later to augment levels of proliferation. The expression of LHCGR mRNA was elevated in the ovaries of animals receiving a supplement of PMSG. Mimosine also blocked cell cycle progression and LHCGR mRNA expression in macaque granulosa cells isolated following controlled ovarian stimulation cycles and in two different mouse Leydig tumor lines. These data collectively indicate that LHCGR mRNA is expressed as a function of the passage of cells across the G1-S phase boundary.

Styles APA, Harvard, Vancouver, ISO, etc.

31

Lu, Xuefeng, Zheng Yan, Renfei Cai, Shuzin Khor, Ling Wu, Lihua Sun, Yun Wang et al. « Pregnancy and Live Birth In Women With Pathogenic LHCGR Variants Using Their Own Oocytes ». Journal of Clinical Endocrinology & ; Metabolism 104, n^o 12 (8 août 2019) : 5877–92. http://dx.doi.org/10.1210/jc.2019-01276.

Texte intégral

Résumé :

Abstract Context The LH/chorionic gonadotropin receptor (LHCGR) is mainly expressed in gonads and plays important roles in estradiol production, ovulation, and luteal formation. Women with pathogenic LHCGR variants suffer from infertility, and successful fertility treatments for such women have never been reported. Objective The purpose of this study was to determine whether women with pathogenic LHCGR variants can achieve successful pregnancies through in vitro fertilization. Design Three women with LH resistance and infertility and their parents underwent exome sequencing. The biochemical characteristics and functional effects of LHCGR mutation were assessed in transfected human embryonic kidney -293T cells and primary granulosa cells. Results All affected women harbored pathogenic LHCGR variants. The LHCGR variants lacked cell surface localization and signal transduction abilities in vitro and in vivo. After dual triggering and prolonging the interval between triggering and oocyte pick-up, all three patients achieved oocytes and high-quality embryos. After frozen embryo transfer, one woman successfully birthed twins, and one woman successfully birthed a live boy. Apart from difficulties in oocyte retrieval, no obvious abnormalities in fertilization or during embryo development and pregnancy were identified in these patients. Conclusions This study is, to our knowledge, the first to report successful assisted reproductive treatment of women with pathogenic LHCGR variants using their own oocytes. Our results supported that defects in LHCGR disrupted ovulation but had no effect on fertilization and embryo development.

Styles APA, Harvard, Vancouver, ISO, etc.

32

Karpinska, Barbara, Sarah Owdah Alomrani et Christine H. Foyer. « Inhibitor-induced oxidation of the nucleus and cytosol in Arabidopsis thaliana : implications for organelle to nucleus retrograde signalling ». Philosophical Transactions of the Royal Society B : Biological Sciences 372, n^o 1730 (14 août 2017) : 20160392. http://dx.doi.org/10.1098/rstb.2016.0392.

Texte intégral

Résumé :

Concepts of organelle-to-nucleus signalling pathways are largely based on genetic screens involving inhibitors of chloroplast and mitochondrial functions such as norflurazon, lincomycin (LINC), antimycin A (ANT) and salicylhydroxamic acid. These inhibitors favour enhanced cellular oxidation, but their precise effects on the cellular redox state are unknown. Using the in vivo reduction–oxidation (redox) reporter, roGFP2, inhibitor-induced changes in the glutathione redox potentials of the nuclei and cytosol were measured in Arabidopsis thaliana root, epidermal and stomatal guard cells, together with the expression of nuclear-encoded chloroplast and mitochondrial marker genes. All the chloroplast and mitochondrial inhibitors increased the degree of oxidation in the nuclei and cytosol. However, inhibitor-induced oxidation was less marked in stomatal guard cells than in epidermal or root cells. Moreover, LINC and ANT caused a greater oxidation of guard cell nuclei than the cytosol. Chloroplast and mitochondrial inhibitors significantly decreased the abundance of LHCA1 and LHCB1 transcripts. The levels of WHY1 , WHY3 and LEA5 transcripts were increased in the presence of inhibitors. Chloroplast inhibitors decreased AOXA1 mRNA levels, while mitochondrial inhibitors had the opposite effect. Inhibitors that are used to characterize retrograde signalling pathways therefore have similar general effects on cellular redox state and gene expression. This article is part of the themed issue ‘Enhancing photosynthesis in crop plants: targets for improvement’.

Styles APA, Harvard, Vancouver, ISO, etc.

33

Costa, Marcia Helena Soares, Sorahia Domenice, Ana Claudia Latronico, Regina Matsunaga Martin, Mirian Yumie Nishi, Antonio Marmo Lucon, Berenice Bilharinho Mendonca et Maria Candida Barisson Villares Fragoso. « Analysis of glucose-dependent insulinotropic peptide receptor (GIPR) and luteinizing hormone receptor (LHCGR) expression in human adrenocortical hyperplasia ». Arquivos Brasileiros de Endocrinologia & ; Metabologia 53, n^o 3 (avril 2009) : 326–31. http://dx.doi.org/10.1590/s0004-27302009000300005.

Texte intégral

Résumé :

OBJECTIVE: To analyze the aberrant expression of the GIPR and LHCGR in different forms of adrenocortical hyperplasia: ACTH-independent macronodular adrenal hyperplasia (AIMAH), primary pigmented nodular adrenocortical disease (PPNAD) and diffuse adrenal hyperplasia secondary to Cushing's disease (DAHCD). METHODS: We quantified GIPR and LHCGR expressions using real time PCR in 20 patients with adrenocortical hyperplasia (seven with AIMAH, five with PPNAD, and eight with DAHCD). Normal adrenals tissues were used as control and the relative expression was compared with β-actin. RESULTS: GIPR and LHCGR expressions were demonstrated in all tissues studied. Median GIPR and LHCGR mRNA levels were 1.6; 0.4; 0.5 and 1.3; 0.9; 1.0 in adrenocortical tissues from AIMAH, PPNAD and DAHCD respectively. There were no differences between GIPR and LHCGR expressions in all tissues studied. CONCLUSIONS: GIPR and LHCGR overexpression were not identified in the studied cases, thus suggesting that this molecular mechanism is not involved in adrenocortical hyperplasia in our patients.

Styles APA, Harvard, Vancouver, ISO, etc.

34

Tokutsu, R., et J. Minagawa. « Energy-dissipative supercomplex of photosystem II associated with LHCSR3 in Chlamydomonas reinhardtii ». Proceedings of the National Academy of Sciences 110, n^o 24 (28 mai 2013) : 10016–21. http://dx.doi.org/10.1073/pnas.1222606110.

Texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

35

de la Cruz Valbuena, Gabriel, Franco V. A. Camargo, Rocio Borrego-Varillas, Federico Perozeni, Cosimo D’Andrea, Matteo Ballottari et Giulio Cerullo. « Molecular Mechanisms of Nonphotochemical Quenching in the LHCSR3 Protein of Chlamydomonas reinhardtii ». Journal of Physical Chemistry Letters 10, n^o 10 (mai 2019) : 2500–2505. http://dx.doi.org/10.1021/acs.jpclett.9b01184.

Texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

36

Nwonuma, Charles O., Tabitha A. Adelani-Akande, Omorefosa O. Osemwegie, Abiola F. Olaniran et Toluwani A. Adeyemo. « Comparative study of in vitro antimicrobial potential and phytochemicals of some medical plants ». F1000Research 8 (30 mai 2019) : 81. http://dx.doi.org/10.12688/f1000research.17094.2.

Texte intégral

Résumé :

Background: Plants in traditional healthcare services in West Africa were selected based on ethnobotanical data for this study. Aqueous and ethanol extracts from these plants’ parts were comparatively screened for phytochemicals and in vitro antimicrobial activity. Methods: The antimicrobial activity of five medicinal plants’ extracts (aqueous and ethanol) were evaluated against Proteus mirabilis (LHC201), Pseudomonas aeruginosa (LHC181) and Aspergillus fumigates (LUML56) using the agar-well diffusion protocol. Retailed chloramphenicol and griseofulvin were used as positive controls respectively. Phytochemicals and percentage yield were determined by modified standard methods. Results: The target bacteria showed varied degrees of susceptibility to both aqueous and ethanol extracts. A. fumigates was insensitive to the treatments. The ethanol extracts of the sampled plants’ parts showed better inhibitory performance against the target bacteria compared to aqueous extracts. Aqueous and ethanol extracts of Aframomum melegueta, Moringa oleifera and Cola nitida showed marginal difference in inhibitory activity with higher inhibition zones observed for the ethanol extracts of A. melegueta seed and M. oleifera pod against the target bacteria. Phytochemicals composition and density observed in extractants and plants’ parts also varied. Phenols were detected in both the aqueous and ethanolic extracts of C. nitida and C. acuminata, but appeared relatively richer in extracts of A. melegueta seeds and C. albidium fruits. C. nitida, C. acuminate and A. melegueta extracts were positive for flavonoids which were undetected in C. albidium fruits, M. oleifera seeds and pod extracts. No single extract had all the phytochemicals assayed. Conclusions: Screened extracts of medicinal plants’ parts used for this study showed promise antibacterial and resource for developing safer pharmaceutics. Optimization of the antibacterial potential of the extracts for commercial exploitation requires further studies. This study has provided information on the antibacterial property of C. albidum fruits which was hitherto underutilized for traditional medicine purpose.

Styles APA, Harvard, Vancouver, ISO, etc.

37

Nwonuma, Charles O., Tabitha A. Adelani-Akande, Omorefosa O. Osemwegie, Abiola F. Olaniran et Toluwani A. Adeyemo. « Preliminary in vitro antimicrobial potential and phytochemicals study of some medical plants ». F1000Research 8 (16 janvier 2020) : 81. http://dx.doi.org/10.12688/f1000research.17094.3.

Texte intégral

Résumé :

Background: Plants in traditional healthcare services in West Africa were selected based on ethnobotanical data for this study. Aqueous and ethanol extracts from these plants’ parts were comparatively screened for phytochemicals and in vitro antimicrobial activity. Methods: The antimicrobial activity of five medicinal plants’ extracts (aqueous and ethanol) were evaluated against Proteus mirabilis (LHC201), Pseudomonas aeruginosa (LHC181) and Aspergillus fumigates (LUML56) using the agar-well diffusion protocol. Retailed chloramphenicol and griseofulvin were used as positive controls respectively. Phytochemicals and percentage yield were determined by modified standard methods. Results: The target bacteria showed varied degrees of susceptibility to both aqueous and ethanol extracts. A. fumigates was insensitive to the treatments. The ethanol extracts of the sampled plants’ parts showed better inhibitory performance against the target bacteria compared to aqueous extracts. Aqueous and ethanol extracts of Aframomum melegueta, Moringa oleifera and Cola nitida showed marginal difference in inhibitory activity with higher inhibition zones observed for the ethanol extracts of A. melegueta seed and M. oleifera pod against the target bacteria. Phytochemicals composition and density observed in extractants and plants’ parts also varied. Phenols were detected in both the aqueous and ethanolic extracts of C. nitida and C. acuminata, but appeared relatively richer in extracts of A. melegueta seeds and C. albidium fruits. C. nitida, C. acuminate and A. melegueta extracts were positive for flavonoids which were undetected in C. albidium fruits, M. oleifera seeds and pod extracts. No single extract had all the phytochemicals assayed. Conclusions: Screened extracts of medicinal plants’ parts used for this study showed promise antibacterial and resource for developing safer pharmaceutics. Optimization of the antibacterial potential of the extracts for commercial exploitation requires further studies. This study has provided information on the antibacterial property of C. albidum fruits which was hitherto underutilized for traditional medicine purpose.

Styles APA, Harvard, Vancouver, ISO, etc.

38

Zheng, Cuihong, Thippeswamy Gulappa, Bindu Menon et K. M. J. Menon. « Association between LH receptor regulation and ovarian hyperstimulation syndrome in a rodent model ». Reproduction 160, n^o 2 (août 2020) : 239–45. http://dx.doi.org/10.1530/rep-20-0058.

Texte intégral

Résumé :

Ovarian hyperstimulation syndrome (OHSS) is a common complication of ovarian stimulation associated with the administration of human chorionic gonadotropin (hCG) during assisted reproduction. We have determined the expression of luteinizing hormone receptor (Lhcgr) mRNA, vascular endothelial growth factor (VEGF), and its transcription factor, HIF1α, during the periovulatory period in a rodent model of OHSS and compared these results with normal ovulatory periods. These results showed that the downregulation of Lhcgr mRNA in response to conditions that mimic preovulatory LH surge was significantly impaired in the OHSS group compared to the complete downregulation seen in the control group. Most importantly, the downregulation of luteinizing hormone receptor mRNA expression following hCG administration was sustained in the control group up to 48 h, whereas it remained at significantly higher levels in the OHSS group. This impairment of hCG-induced Lhcgr downregulation in the OHSS group was accompanied by significantly elevated levels of VEGF and its transcription factor, HIF1α. Furthermore, the downregulation of Lhcgr that occurs in response to a preovulatory LH surge in normal cycles was accompanied by low levels of VEGF. This study shows that, while downregulation of Lhcgr as well as low VEGF levels are seen in response to a preovulatory LH surge in normal ovarian cycle, impaired Lhcgr downregulation and elevated VEGF levels were found in the OHSS group.

Styles APA, Harvard, Vancouver, ISO, etc.

39

Juel Mortensen, Li, Mette Lorenzen, Anne Jørgensen, Jakob Albrethsen, Niels Jørgensen, Søren Møller, Anna-Maria Andersson, Anders Juul et Martin Blomberg Jensen. « Possible Relevance of Soluble Luteinizing Hormone Receptor during Development and Adulthood in Boys and Men ». Cancers 13, n^o 6 (16 mars 2021) : 1329. http://dx.doi.org/10.3390/cancers13061329.

Texte intégral

Résumé :

Luteinizing hormone (LH) and human chorionic gonadotropin (hCG) are agonists for the luteinizing hormone receptor (LHCGR) which regulates male reproductive function. LHCGR may be released into body fluids. We wish to determine whether soluble LHCGR is a marker for gonadal function. Cross-sectional, longitudinal, and intervention studies on 195 healthy boys and men and 396 men with infertility, anorchia, or Klinefelter Syndrome (KS) were used to correlate LHCGR measured in serum, seminal fluid, urine, and hepatic/renal artery and vein with gonadal function. LHCGR was determined in fluids from in vitro and in vivo models of human testicular tissue and cell lines, xenograft mouse models, and human fetal kidney and adrenal glands. Western blot showed LHCGR fragments in serum and gonadal tissue of similar size using three different antibodies. The LHCGR-ELISA had no species cross-reactivity or unspecific reaction in mouse serum even after human xenografting. Instead, sLHCGR was released into the media after the culture of a human fetal kidney and adrenal glands. Serum sLHCGR decreased markedly during puberty in healthy boys (p = 0.0001). In healthy men, serum sLHCGR was inversely associated with the Inhibin B/FSH ratio (β −0.004, p = 0.027). In infertile men, seminal fluid sLHCGR was inversely associated with serum FSH (β 0.006, p = 0.009), sperm concentration (β −3.5, p = 0.003) and total sperm count (β −3.2, p = 0.007). The injection of hCG lowered sLHCGR in serum and urine of healthy men (p < 0.01). In conclusion, sLHCGR is released into body-fluids and linked with pubertal development and gonadal function. Circulating sLHCGR in anorchid men suggests that sLHCGR in serum may originate from and possibly exert actions in non-gonadal tissues. (ClinicalTrials: NTC01411527, NCT01304927, NCT03418896).

Styles APA, Harvard, Vancouver, ISO, etc.

40

Lazzaretti, Clara, Valentina Secco, Elia Paradiso, Samantha Sperduti, Claudia Rutz, Annika Kreuchwig, Gerd Krause, Manuela Simoni et Livio Casarini. « Identification of Key Receptor Residues Discriminating Human Chorionic Gonadotropin (hCG)- and Luteinizing Hormone (LH)-Specific Signaling ». International Journal of Molecular Sciences 22, n^o 1 (25 décembre 2020) : 151. http://dx.doi.org/10.3390/ijms22010151.

Texte intégral

Résumé :

(1) The human luteinizing hormone (LH)/chorionic gonadotropin (hCG) receptor (LHCGR) discriminates its two hormone ligands and differs from the murine receptor (Lhr) in amino acid residues potentially involved in qualitative discerning of LH and hCG. The latter gonadotropin is absent in rodents. The aim of the study is to identify LHCGR residues involved in hCG/LH discrimination. (2) Eight LHCGR cDNAs were developed, carrying “murinizing” mutations on aminoacidic residues assumed to interact specifically with LH, hCG, or both. HEK293 cells expressing a mutant or the wild type receptor were treated with LH or hCG and the kinetics of cyclic adenosine monophosphate (cAMP) and phosphorylated extracellular signal-regulated kinases 1/2 (pERK1/2) activation was analyzed by bioluminescence resonance energy transfer (BRET). (3) Mutations falling within the receptor leucine reach repeat 9 and 10 (LRR9 and LRR10; K225S +T226I and R247T), of the large extracellular binding domain, are linked to loss of hormone-specific induced cAMP increase, as well as hCG-specific pERK1/2 activation, leading to a Lhr-like modulation of the LHCGR-mediated intracellular signaling pattern. These results support the hypothesis that LHCGR LRR domain is the interaction site of the hormone β-L2 loop, which differs between LH and hCG, and might be fundamental for inducing gonadotropin-specific signals. (4) Taken together, these data identify LHCGR key residues likely evolved in the human to discriminate LH/hCG specific binding.

Styles APA, Harvard, Vancouver, ISO, etc.

41

Weng, Jinyang, Asad Rehman, Pengli Li, Liying Chang, Yidong Zhang et Qingliang Niu. « Physiological and Transcriptomic Analysis Reveals the Responses and Difference to High Temperature and Humidity Stress in Two Melon Genotypes ». International Journal of Molecular Sciences 23, n^o 2 (10 janvier 2022) : 734. http://dx.doi.org/10.3390/ijms23020734.

Texte intégral

Résumé :

Due to the frequent occurrence of continuous high temperatures and heavy rain in summer, extremely high-temperature and high-humidity environments occur, which seriously harms crop growth. High temperature and humidity (HTH) stress have become the main environmental factors of combined stress in summer. The responses of morphological indexes, physiological and biochemical indexes, gas exchange parameters, and chlorophyll fluorescence parameters were measured and combined with chloroplast ultrastructure and transcriptome sequencing to analyze the reasons for the difference in tolerance to HTH stress in HTH-sensitive ‘JIN TAI LANG’ and HTH-tolerant ‘JIN DI’ varieties. The results showed that with the extension of stress time, the superoxide dismutase (SOD), peroxidase (POD), and ascorbate peroxidase (APX) activities of the two melon varieties increased rapidly, the leaf water content increased, and the tolerant varieties showed stronger antioxidant capacity. Among the sensitive cultivars, Pn, Fv/Fm, photosystem II, and photosystem I chlorophyll fluorescence parameters were severely inhibited and decreased rapidly with the extension of stress time, while the HTH-tolerant cultivars slightly decreased. The cell membrane and chloroplast damage in sensitive cultivars were more severe, and Lhca1, Lhca3, and Lhca4 proteins in photosystem II and Lhcb1-Lhcb6 proteins in photosystem I were inhibited compared with those in the tolerant cultivar. These conclusions may be the main reason for the different tolerances of the two cultivars. These findings will provide new insights into the response of other crops to HTH stress and also provide a basis for future research on the mechanism of HTH resistance in melon.

Styles APA, Harvard, Vancouver, ISO, etc.

42

Jackowski, Grzegorz, et Stefan Jansson. « Characterization of Photosystem II Antenna Complexes Separated by Non-Denaturing Isoelectric Focusing ». Zeitschrift für Naturforschung C 53, n^o 9-10 (1 octobre 1998) : 841–48. http://dx.doi.org/10.1515/znc-1998-9-1010.

Texte intégral

Résumé :

CP26, CP29 and three different LHC II subcomplexes have been purified from a carnation photosystem II (PSII) preparation using non-denaturing isoelectric focusing in a vertical polyacrylamide slab gel. The identity of the fractions was established by absorption spectroscopy, SDS-PAGE and immunoblotting. CP26 comprised a single apoprotein of 26.6 kDa and CP29 contained two apoproteins of 28.8 and 28.5 kDa. LHC II subcomplex A consisted of Lhcb1 homotrimers, and subcomplexes B and C consisted of Lhcb1/Lhcb2 and Lhcb1/Lhcb3 heterotrimers, respectively. We discuss the data in relation to the organization of the PS II antenna in vivo.

Styles APA, Harvard, Vancouver, ISO, etc.

43

Lubis, Hilma Putri, Muhammad Fidel Ganis Siregar, Ichwanul Adenin, Binarwan Halim, Henry Salim Siregar et M. Oky Prabudi. « Association between Luteinizing Hormone/Choriogonadotropin Receptor Ins18LQ Gene Polymorphism and Polycystic Ovary Syndrome ». Open Access Macedonian Journal of Medical Sciences 8, A (10 août 2020) : 517–20. http://dx.doi.org/10.3889/oamjms.2020.4182.

Texte intégral

Résumé :

BACKGROUND: Polycystic ovary syndrome (PCOS) is one of the most common endocrine disorders of women in the childbearing period. However, its pathophysiology is still unclear. Certain polymorphisms of the luteinizing hormone/choriogonadotropin receptor (LHCGR) genes may lead to changes in the bioactivity of this hormone. The important functional role of LHCGR in the metabolism of androgen and ovulation, the LHCGR gene variant, may be related to the risk of PCOS. AIM: The aim of this study was to evaluate the association between LHCGR Ins18LQ gene polymorphism and PCOS. METHODS: A case–control study was performed in women with PCOS and non-PCOS from May 2019 to October 2019 in HFC IVF Center. We included 50 women with PCOS and 50 healthy controls. Polymorphism of the LHCGR (ins18LQ) gene was genotyped using polymerase chain reaction-restriction fragment length polymorphism. RESULTS: From this study, we found that there was no significant difference in the proportion of ages between the groups (p > 0.05). There were significant differences in the characteristics of body mass index, FSH level, LH level, and LH/FSH ratio between the PCOS and control groups (p < 0.05). We also found that the proportion of heterozygote variant non-ins/ins was higher in the PCOS group compared to the control group, but there was no significant difference between the polymorphisms of the non-ins and non-nonins variants between the PCOS and control groups (p = 0.269). The frequency of ins alleles was higher in the PCOS group compared to the control group. CONCLUSION: There was no significant association between LHCGR ins18LQ gene polymorphism and PCOS.

Styles APA, Harvard, Vancouver, ISO, etc.

44

Zhang, Xuan, Yinghui Wei, Xiaoxuan Li, Chengyu Li, Liangliang Zhang, Zhaojun Liu, Yan Cao et al. « The Corticosterone–Glucocorticoid Receptor–AP1/CREB Axis Inhibits the Luteinizing Hormone Receptor Expression in Mouse Granulosa Cells ». International Journal of Molecular Sciences 23, n^o 20 (18 octobre 2022) : 12454. http://dx.doi.org/10.3390/ijms232012454.

Texte intégral

Résumé :

Under stress conditions, luteinizing hormone (LH)-mediated ovulation is inhibited, resulting in insufficient oocyte production and excretion during follicular development. When the body is stressed, a large amount of corticosterone (CORT) is generated, which will lead to a disorder of the body’s endocrine system and damage to the body. Our previous work showed that CORT can block follicular development in mice. Since LH acts through binding with the luteinizing hormone receptor (Lhcgr), the present study aimed to investigate whether and how corticosterone (CORT) influences Lhcgr expression in mouse ovarian granulosa cells (GCs). For this purpose, three-week-old ICR female mice were injected intraperitoneally with pregnant mare serum gonadotropin (PMSG). In addition, the treatment group was injected with CORT (1 mg/mouse) at intervals of 8 h and the control group was injected with the same volume of methyl sulfoxide (DMSO). GCs were collected at 24 h, 48 h, and 55 h after PMSG injection. For in vitro experiments, the mouse GCs obtained from healthy follicles were treated with CORT alone, or together with inhibitors against the glucocorticoid receptor (Nr3c1). The results showed that the CORT caused a downregulation of Lhcgr expression in GCs, which was accompanied by impaired cell viability. Moreover, the effect of the CORT was mediated by binding to its receptor (Nr3c1) in GCs. Further investigation revealed that Nr3c1 might regulate the transcription of Lhcgr through inhibiting the expression of Lhcgr transcription factors, including AP1 and Creb. Taken together, our findings suggested a possible mechanism of CORT-induced anovulation involving the inhibition of Lhcgr expression in GCs by the CORT–Nr3c1–AP1/Creb axis.

Styles APA, Harvard, Vancouver, ISO, etc.

45

Lizneva, Daria, Kseniia Ievleva, Anisa Gumerova, Eleanor Shelly, Funda Korkmaz, Valeriia Muradova, Jessica Netto et al. « RF10 | PMON205 LH/CG Receptor Activation Protects Mice from Diet-Induced Obesity and Modifies Adipose Tissue Immune Response ». Journal of the Endocrine Society 6, Supplement_1 (1 novembre 2022) : A27—A28. http://dx.doi.org/10.1210/jendso/bvac150.058.

Texte intégral

Résumé :

Abstract Menopause is associated with the loss of LH ovulatory surges and enhanced visceral adiposity. Visceral fat depots increase from 5-8% at premenopause to 15-20% of total body fat at postmenopause. Here, we report that high-dose LH, hCG, or small molecule LH/CGR agonist ORG43553 injected twice-a-week into 14-weeks-old C57BL/6 male mice protects them from diet-induced obesity. Testosterone levels were elevated in mice treated with LH or hCG, but not with ORG43553. Notably, the anti-obesity action of LH/hCG is independent of testosterone, as blocking the androgen receptor using flutamide yielded similar results. Importantly, male Lhcgr knockout mice on a high-fat diet treated with LH failed to display a reduction in adiposity, confirming the in vivo specificity of action. Furthermore, our data phenocopied Lhcgr haploinsufficiency in mice. We confirmed the presence of Lhcgr in mouse genital and inguinal fat pads, adipose-derived stromal vascular cells, as well as in differentiated and undifferentiated 3T3-L1 murine adipocytes by qPCR, RNAscope in situ hybridization, and immunohistochemistry. Sanger sequencing showed that the extracellular domain of Lhcgr in genital fat depot was identical to the ovarian receptor. Similarly, we identified LHCGR in human subcutaneous and visceral fat depots. Binding of intraperitoneally injected AlexaFluor-488-labeled hCG was found not only in mouse ovary, but also in genital and subcutaneous fat pad, further confirming the presence of LHCGR in adipose tissue. This binding could be competitively displaced in 3T3-L1 cells using unlabeled hCG. LH, hCG and ORG43553 activated ERK1/2 in a dose-dependent manner in undifferentiated and differentiated 3T3-L1 cells, suggesting that the adipose LHCGR is fully functional. LH, hCG, and ORG43553 reduced adipogenic differentiation in 3T3-L1 cells, which is further confirmed by RNA sequencing. Moreover, we observed, that LH and hCG also alters several aspects of immune response in adipose tissue, including inflammatory response and adaptive immunity. In conclusion, we demonstrated that LH/CG receptors are present and fully functional in adipose tissue, and that high-dose intermittent activation of LHCGR in mouse fat depots protects mice from diet-induced obesity and modifies adipose tissue immune response. Presentation: Saturday, June 11, 2022 1:42 p.m. - 1:47 p.m., Monday, June 13, 2022 12:30 p.m. - 2:30 p.m.

Styles APA, Harvard, Vancouver, ISO, etc.

46

Costa, Marcia Helena Soares, Ana Claudia Latronico, Regina Matsunaga Martin, Angela S. Barbosa, Madson Q. Almeida, Claudimara Ferini Pacicco Lotfi, Helena P. Lima Valassi et al. « Expression profiles of the glucose-dependent insulinotropic peptide receptor and LHCGR in sporadic adrenocortical tumors ». Journal of Endocrinology 200, n^o 2 (29 octobre 2008) : 167–75. http://dx.doi.org/10.1677/joe-08-0395.

Texte intégral

Résumé :

Glucose-dependent insulinotropic peptide receptor (GIPR) and LHCGR are G-protein-coupled receptors with a wide tissue expression pattern. Aberrant expression of these receptors has rarely been demonstrated in adult sporadic adrenocortical tumors with a lack of data on pediatric tumors. We quantified the GIPR and LHCGR expression in a large cohort of 55 patients (25 children and 30 adults) with functioning and non-functioning sporadic adrenocortical tumors. Thirty-eight tumors were classified as adenomas whereas 17 were carcinomas. GIPR and LHCGR expression were analyzed by real-time PCR and normal human pancreatic and testicular tissue samples were used as positive controls. Mean expression values were determined by fold increase in comparison with a normal adrenal pool. GIPR mRNA levels were significantly higher in adrenocortical carcinomas than in adenomas from both pediatric and adult groups. LHCGR expression was similar in both carcinomas and adenomas from the pediatric group but significantly lower in carcinomas than in adenomas from the adult group (median 0.06 and 2.3 respectively, P<0.001). GIPR was detected by immunohistochemistry in both pediatric and adult tumors. Staining and real-time PCR results correlated positively only when GIPR mRNA levels were increased at least two-fold in comparison with normal adrenal expression levels. In conclusion, GIPR overexpression was observed in pediatric and adult adrenocortical tumors and very low levels of LHCGR expression were found in all adult adrenocortical carcinomas.

Styles APA, Harvard, Vancouver, ISO, etc.

47

Scholz, Martin, Philipp Gäbelein, Huidan Xue, Laura Mosebach, Sonja Verena Bergner et Michael Hippler. « Light‐dependent N‐terminal phosphorylation of LHCSR3 and LHCB4 are interlinked in Chlamydomonas reinhardtii ». Plant Journal 99, n^o 5 (30 mai 2019) : 877–94. http://dx.doi.org/10.1111/tpj.14368.

Texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

48

Xu, Yufei, Yulin Chen, Niu Li, Xuyun Hu, Guoqiang Li, Yu Ding, Juan Li, Yiping Shen, Xiumin Wang et Jian Wang. « Novel compound heterozygous variants in the LHCGR gene identified in a subject with Leydig cell hypoplasia type 1 ». Journal of Pediatric Endocrinology and Metabolism 31, n^o 2 (26 janvier 2018) : 239–45. http://dx.doi.org/10.1515/jpem-2016-0445.

Texte intégral

Résumé :

Abstract Background: Leydig cell hypoplasia (LCH) is a rare disease and one of the causes of male disorder of sexual differentiation (DSD). Inactivating mutations in the luteinizing hormone/chorionic gonadotropin receptor (LHCGR) gene account for the underlying LCH pathogenicity. This study aimed to analyze the clinical presentation and diagnosis as well as highlight the molecular characteristics of a subject with LCH type 1. Case presentation: Clinical data were collected from the subject and analyzed. Next generation sequencing of the immediate family pedigree using peripheral blood genomic DNA was performed, and the relevant mutations were verified with Sanger sequencing. We describe the case of a 5-year-old patient with DSD, presenting with a lateral inguinal hernia accompanied by abnormal hormone tests. The genetic analysis revealed novel compound heterozygous variants in the LHCGR gene, including a splice site mutation (c.681-1 G>A) and a frameshift variant (c.1582_1585del ATAT, p.Ile528*). Conclusions: We identified novel compound heterozygous variants in the LHCGR gene, and expanded the genotype-phenotype correlation spectrum of LHCGR variants.

Styles APA, Harvard, Vancouver, ISO, etc.

49

Cheemakurthi, Ravi Krishna, Gottumukkala Achyuta Rama Raju, Thota Sivanaryana, Kalagara Madan, Kota Murali Krishna et Godi Sudhakar. « Case Report : A 54 base pair inactivating mutation of LHCGR in a 28-year old woman with poor ovarian response ». F1000Research 4 (18 mars 2015) : 72. http://dx.doi.org/10.12688/f1000research.6137.1.

Texte intégral

Résumé :

The luteinizing hormone/choriogonadotropin (LH/CG) receptor plays an important role in male and female infertility. Many studies have demonstrated that mutations at specific sites in LHCGR gene may result in mild or complete loss of receptor function. Insertions in exon-1 of LHCGR gene were first studied in male Leydig cell hypoplasia and later extended to female reproductive disorders. Previous studies have shown that these insertions play an important role in intrauterine insemination (IUI) and in vitro fertilization (IVF) outcome. Here we report a 54bp insertion in a 28-year old woman with infertility, recurrent cyst formation and failed stimulated IUI cycles. As the patient showed a blunted response to the ovarian stimulation and human chorionic gonadotropin (hCG) stimulation test, follicle stimulating hormone receptor (FSHR) and luteinizing hormone/choriogonadotropin (LHCGR) gene sequencing was performed. Gene sequence analysis revealed a 54bp homozygous insertion (GCTGCTGAAGCTGCTGCTGCTGCTGCAGCTGCTGAAGCTGCTGCTGCTGCTGCA) in the exon-1 of LHCGR gene. This mutation might have caused a decrease in receptor function in the present infertile patient, thus resulting in poor ovarian response.

Styles APA, Harvard, Vancouver, ISO, etc.

50

Potorac, Iulia, Ashutosh Trehan, Kamila Szymańska, Julie Fudvoye, Albert Thiry, Ilpo Huhtaniemi, Adrian F. Daly, Albert Beckers, Anne-Simone Parent et Adolfo Rivero-Müller. « Compound heterozygous mutations in the luteinizing hormone receptor signal peptide causing 46,XY disorder of sex development ». European Journal of Endocrinology 181, n^o 2 (août 2019) : K11—K20. http://dx.doi.org/10.1530/eje-19-0170.

Texte intégral

Résumé :

Testosterone production by the fetal testis depends on a functional relationship between hCG and the LH/chorionic gonadotropin receptor (LHCGR). Failure of the receptor to correctly respond to its ligand leads to impaired sexual differentiation in males. A phenotypically female patient with pubertal delay had a 46,XY karyotype and was diagnosed with 46,XY disorder of sex development (DSD). Novel compound heterozygous LHCGR mutations were found in the signal peptide: a duplication p.L10_Q17dup of maternal origin, and a deletion (p.K12_L15del) and a p.L16Q missense mutation of paternal origin. cAMP production was very low for both the deletion and duplication mutations and was halved for the missense mutant. The duplication and missense mutations were both expressed intracellularly, but at very low levels at the cell membrane; they were most likely retained in the endoplasmic reticulum. The deletion mutant had a very limited intracellular expression, indicating impaired biosynthesis. There was reduced expression of all three mutants, which was most marked for the deletion mutation. There was also decreased protein expression of all three mutant receptors. In the deletion mutation, the presence of a lower-molecular-weight band corresponding to LHCGR monomer, probably due to lack of glycosylation, and a lack of bands corresponding to dimers/oligomers suggests absent ER entry. This novel case of 46,XY DSD illustrates how different LHCGR signal peptide mutations led to complete receptor inactivation by separate mechanisms. The study underlines the importance of specific regions of signal peptides and expands the spectrum of LHCGR mutations.

Styles APA, Harvard, Vancouver, ISO, etc.

Articles de revues sur le sujet « LHCSR1 »

Créez une référence correcte selon les styles APA, MLA, Chicago, Harvard et plusieurs autres