Articles de revues : « LHCGR gene »

1

Montgomery, G. W., M. L. Tate, H. M. Henry, J. M. Penty et R. M. Rohan. « The follicle-stimulating hormone receptor and luteinizing hormone receptor genes are closely linked in sheep and deer ». Journal of Molecular Endocrinology 15, n^o 3 (décembre 1995) : 259–65. http://dx.doi.org/10.1677/jme.0.0150259.

Texte intégral

Résumé :

ABSTRACT Restriction fragment length polymorphisms were identified in sheep and deer using ovine cDNA probes for the FSH receptor (FSHR) and the LH receptor (LHCGR). FSHR and LHCGR were closely linked in sheep with no recombinants and neither receptor was linked to the Booroola fecundity gene (FecB). Both receptors were also closely linked in deer at a map distance of 3·3 cM. Linkage between the receptor genes assigns FSHR to sheep chromosome 3. Sequence analysis showed that the mammalian LHCGRs and FSHRs are more similar to each other than to mammalian TSH receptor (TSHR). Taken together, these data suggest that TSHR and the LHCGR/FSHR arose from a common ancestral gene by a process of chromosomal duplication. Subsequent duplication of the region containing the LH/FSH receptor and functional divergence could have given rise to the two gonadotrophin receptors present in mammals today.

Styles APA, Harvard, Vancouver, ISO, etc.

2

Cannon, Jennifer D., Srinivas V. Seekallu, Catherine A. VandeVoort et Charles L. Chaffin. « Association of luteinizing hormone receptor gene expression with cell cycle progression in granulosa cells ». American Journal of Physiology-Endocrinology and Metabolism 296, n^o 6 (juin 2009) : E1392—E1399. http://dx.doi.org/10.1152/ajpendo.90965.2008.

Texte intégral

Résumé :

During hormonally induced ovarian follicle growth, granulosa cell proliferation increases and returns to baseline prior to the administration of an ovulatory stimulus. Several key genes appear to follow a similar pattern, including the luteinizing hormone receptor (LHCGR), suggesting an association between cell cycle progression and gene expression. The expression of LHCGR mRNA in granulosa cells isolated from immature rats and treated in culture with FSH increased in a time-dependent manner, whereas administration of the cell cycle inhibitor mimosine completely suppressed expression. Although forskolin was able to induce luteinization in cells treated with mimosine, human chorionic gonadotropin had no effect, indicating the functional loss of LHCGR. The effects of mimosine on cell cycle progression and LHCGR mRNA expression were reversible within 24 h of mimosine removal. Cell cycle inhibition did not alter the stability of LHCGR mRNA, indicating that the primary effect was at the transcriptional level. To determine whether the relationship between LHCGR expression and cell cycle were relevant in vivo, immature rats were given a bolus of PMSG, followed by a second injection of either saline or PMSG 24 h later to augment levels of proliferation. The expression of LHCGR mRNA was elevated in the ovaries of animals receiving a supplement of PMSG. Mimosine also blocked cell cycle progression and LHCGR mRNA expression in macaque granulosa cells isolated following controlled ovarian stimulation cycles and in two different mouse Leydig tumor lines. These data collectively indicate that LHCGR mRNA is expressed as a function of the passage of cells across the G1-S phase boundary.

Styles APA, Harvard, Vancouver, ISO, etc.

3

Cheemakurthi, Ravi Krishna, Gottumukkala Achyuta Rama Raju, Thota Sivanaryana, Kalagara Madan, Kota Murali Krishna et Godi Sudhakar. « Case Report : A 54 base pair inactivating mutation of LHCGR in a 28-year old woman with poor ovarian response ». F1000Research 4 (18 mars 2015) : 72. http://dx.doi.org/10.12688/f1000research.6137.1.

Texte intégral

Résumé :

The luteinizing hormone/choriogonadotropin (LH/CG) receptor plays an important role in male and female infertility. Many studies have demonstrated that mutations at specific sites in LHCGR gene may result in mild or complete loss of receptor function. Insertions in exon-1 of LHCGR gene were first studied in male Leydig cell hypoplasia and later extended to female reproductive disorders. Previous studies have shown that these insertions play an important role in intrauterine insemination (IUI) and in vitro fertilization (IVF) outcome. Here we report a 54bp insertion in a 28-year old woman with infertility, recurrent cyst formation and failed stimulated IUI cycles. As the patient showed a blunted response to the ovarian stimulation and human chorionic gonadotropin (hCG) stimulation test, follicle stimulating hormone receptor (FSHR) and luteinizing hormone/choriogonadotropin (LHCGR) gene sequencing was performed. Gene sequence analysis revealed a 54bp homozygous insertion (GCTGCTGAAGCTGCTGCTGCTGCTGCAGCTGCTGAAGCTGCTGCTGCTGCTGCA) in the exon-1 of LHCGR gene. This mutation might have caused a decrease in receptor function in the present infertile patient, thus resulting in poor ovarian response.

Styles APA, Harvard, Vancouver, ISO, etc.

4

Lubis, Hilma Putri, Muhammad Fidel Ganis Siregar, Ichwanul Adenin, Binarwan Halim, Henry Salim Siregar et M. Oky Prabudi. « Association between Luteinizing Hormone/Choriogonadotropin Receptor Ins18LQ Gene Polymorphism and Polycystic Ovary Syndrome ». Open Access Macedonian Journal of Medical Sciences 8, A (10 août 2020) : 517–20. http://dx.doi.org/10.3889/oamjms.2020.4182.

Texte intégral

Résumé :

BACKGROUND: Polycystic ovary syndrome (PCOS) is one of the most common endocrine disorders of women in the childbearing period. However, its pathophysiology is still unclear. Certain polymorphisms of the luteinizing hormone/choriogonadotropin receptor (LHCGR) genes may lead to changes in the bioactivity of this hormone. The important functional role of LHCGR in the metabolism of androgen and ovulation, the LHCGR gene variant, may be related to the risk of PCOS. AIM: The aim of this study was to evaluate the association between LHCGR Ins18LQ gene polymorphism and PCOS. METHODS: A case–control study was performed in women with PCOS and non-PCOS from May 2019 to October 2019 in HFC IVF Center. We included 50 women with PCOS and 50 healthy controls. Polymorphism of the LHCGR (ins18LQ) gene was genotyped using polymerase chain reaction-restriction fragment length polymorphism. RESULTS: From this study, we found that there was no significant difference in the proportion of ages between the groups (p > 0.05). There were significant differences in the characteristics of body mass index, FSH level, LH level, and LH/FSH ratio between the PCOS and control groups (p < 0.05). We also found that the proportion of heterozygote variant non-ins/ins was higher in the PCOS group compared to the control group, but there was no significant difference between the polymorphisms of the non-ins and non-nonins variants between the PCOS and control groups (p = 0.269). The frequency of ins alleles was higher in the PCOS group compared to the control group. CONCLUSION: There was no significant association between LHCGR ins18LQ gene polymorphism and PCOS.

Styles APA, Harvard, Vancouver, ISO, etc.

5

Xu, Yufei, Yulin Chen, Niu Li, Xuyun Hu, Guoqiang Li, Yu Ding, Juan Li, Yiping Shen, Xiumin Wang et Jian Wang. « Novel compound heterozygous variants in the LHCGR gene identified in a subject with Leydig cell hypoplasia type 1 ». Journal of Pediatric Endocrinology and Metabolism 31, n^o 2 (26 janvier 2018) : 239–45. http://dx.doi.org/10.1515/jpem-2016-0445.

Texte intégral

Résumé :

Abstract Background: Leydig cell hypoplasia (LCH) is a rare disease and one of the causes of male disorder of sexual differentiation (DSD). Inactivating mutations in the luteinizing hormone/chorionic gonadotropin receptor (LHCGR) gene account for the underlying LCH pathogenicity. This study aimed to analyze the clinical presentation and diagnosis as well as highlight the molecular characteristics of a subject with LCH type 1. Case presentation: Clinical data were collected from the subject and analyzed. Next generation sequencing of the immediate family pedigree using peripheral blood genomic DNA was performed, and the relevant mutations were verified with Sanger sequencing. We describe the case of a 5-year-old patient with DSD, presenting with a lateral inguinal hernia accompanied by abnormal hormone tests. The genetic analysis revealed novel compound heterozygous variants in the LHCGR gene, including a splice site mutation (c.681-1 G>A) and a frameshift variant (c.1582_1585del ATAT, p.Ile528*). Conclusions: We identified novel compound heterozygous variants in the LHCGR gene, and expanded the genotype-phenotype correlation spectrum of LHCGR variants.

Styles APA, Harvard, Vancouver, ISO, etc.

6

Doroszko, Milena, Marcin Chrusciel, Joanna Stelmaszewska, Tomasz Slezak, Adolfo Rivero-Muller, Artur Padzik, Slawomir Anisimowicz et al. « Luteinizing Hormone and GATA4 Action in the Adrenocortical Tumorigenesis of Gonadectomized Female Mice ». Cellular Physiology and Biochemistry 43, n^o 3 (2017) : 1064–76. http://dx.doi.org/10.1159/000481718.

Texte intégral

Résumé :

Background/Aims: Physiological role of luteinizing hormone (LH) and its receptor (LHCGR) in adrenal remains unknown. In inhibin-α/Simian Virus 40 T antigen (SV40Tag) (inhα/Tag) mice, gonadectomy-induced (OVX) elevated LH triggers the growth of transcription factor GATA4 (GATA4)-positive adrenocortical tumors in a hyperplasia-adenoma-adenocarcinoma sequence. Methods: We investigated the role of LHCGR in tumor induction, by crossbreeding inhα/Tag with Lhcgr knockout (LuRKO) mice. By knocking out Lhcgr and Gata4 in Cα1 adrenocortical cells (Lhcgr-ko, Gata4-ko) we tested their role in tumor progression. Results: Adrenal tumors of OVX inhα/Tag mice develop from the hyperplastic cells localized in the topmost layer of zona fasciculata. OVX inhα/Tag/LuRKO only developed SV40Tag positive hyperplastic cells that were GATA4 negative, cleaved caspase-3 positive and did not progress into adenoma. In contrast to Lhcgr-ko, Gata4-ko Cα1 cells presented decreased proliferation, increased apoptosis, decreased expression of Inha, SV40Tag and Lhcgr tumor markers, as well as up-regulated adrenal- and down-regulated sex steroid gene expression. Both Gata4-ko and Lhcgr-ko Cα1 cells had decreased expression of steroidogenic genes resulting in decreased basal progesterone production. Conclusion: Our data indicate that LH/LHCGR signaling is critical for the adrenal cell reprogramming by GATA4 induction prompting adenoma formation and gonadal-like phenotype of the adrenocortical tumors in inhα/Tag mice.

Styles APA, Harvard, Vancouver, ISO, etc.

7

Jeong, Hwal, Hae Lee et Jin Hwang. « LHCGR Gene Analysis in Girls with Non-Classic Central Precocious Puberty ». Experimental and Clinical Endocrinology & ; Diabetes 127, n^o 04 (5 mars 2018) : 234–39. http://dx.doi.org/10.1055/s-0043-125067.

Texte intégral

Résumé :

Abstract Background Luteinizing hormone (LH) is a useful parameter in diagnosing precocious puberty. The pubertal response of serum LH to a GnRH stimulation test is varied, and clinical symptoms of precocious puberty are sometimes disproportionate with serum LH concentrations. Many patients present in a state of precocious puberty that advances rapidly, but the post-GnRH peak LH remains prepubertal. LH receptor mutations are suspected of involvement in the non-classic type of central precocious puberty (CPP). Objective To examine the association between LHCGR polymorphism and non-classic CPP in subjects exhibiting a peak LH<5 IU/L on a GnRH stimulation test. Methods: In total, 102 girls with non-classic CPP and 100 normal adult women were enrolled. All subjects underwent LHCGR gene analysis by the Sanger method, and patients and controls were compared. Auxological data and gonadotropin concentrations were analyzed in the 102 patients. Of these patients, 75 completed GnRH agonist treatment, and the treatment outcomes were analyzed. Results A total of seven variants were identified, including two missense mutations (g.48698754 G/A and g.48688613 G/A) that were found in the patient group (no patients contained both mutations). In silico analysis of these missense mutations suggested the possibility of damaging the LHCGR. However, no significant association was found between the identified LHCGR variants and non-classic CPP. GnRH agonist treatment decreased bone age advancement and increased predicted adult height. Conclusions LHCGR gene polymorphisms do not appear to be a major causative factor for the relatively low concentration of LH in patients with non-classic CPP. GnRH agonist treatment improved clinical parameters in these patients.

Styles APA, Harvard, Vancouver, ISO, etc.

8

Wang, Peng, Han Zhao, Tao Li, Wei Zhang, Keliang Wu, Mei Li, Yuehong Bian et al. « Hypomethylation of the LH/Choriogonadotropin Receptor Promoter Region Is a Potential Mechanism Underlying Susceptibility to Polycystic Ovary Syndrome ». Endocrinology 155, n^o 4 (1 avril 2014) : 1445–52. http://dx.doi.org/10.1210/en.2013-1764.

Texte intégral

Résumé :

Our previous genome-wide association study identified LH/choriogonadotropin receptor (LHCGR) as a susceptibility gene for polycystic ovary syndrome (PCOS). The objective of this study was to determine whether the genetic or epigenetic components associated with LHCGR participate in the pathogenesis of PCOS. The exons and flanking regions of LHCGR were sequenced from 192 women with PCOS, and no novel somatic mutations were identified. In addition, the methylation statuses of 6 cytosine-phosphate-guanine (CpG) sites in the promoter region of LHCGR were measured by pyrosequencing using peripheral blood cells from 85 women with PCOS and 88 control women. We identified 2 hypomethylated sites, CpG −174 (corrected P = .018) and −111 (corrected P = .006). Bisulfite sequencing then was performed to replicate these findings and detect additional CpG sites in the promoter. CpG +17 was significantly hypomethylated in women with PCOS (corrected P = .02). Methylation statuses were further evaluated using granulosa cells (GCs), and the region described was hypomethylated as a whole (P = .004) with 8 significantly hypomethylated sites (CpG −174, −148, −61, −43, −8, +10, +17, and +20). Transcription of LHCGR was elevated in women with PCOS compared with that in control women (P < .01). These findings were consistent with the decreased LHCGR methylation status associated with PCOS. The tendency of LHCGR to be hypomethylated across different tissues and its corresponding expression level suggest that hypomethylation of LHCGR is a potential mechanism underlying susceptibility to PCOS. Further studies are needed to evaluate whether a causal relationship exists between LHCGR methylation status and PCOS.

Styles APA, Harvard, Vancouver, ISO, etc.

9

Kulkarni, Rewa, Maria E. Teves, Angela X. Han, Jan M. McAllister et Jerome F. Strauss. « Colocalization of Polycystic Ovary Syndrome Candidate Gene Products in Theca Cells Suggests Novel Signaling Pathways ». Journal of the Endocrine Society 3, n^o 12 (16 septembre 2019) : 2204–23. http://dx.doi.org/10.1210/js.2019-00169.

Texte intégral

Résumé :

Abstract Genome-wide association studies identified loci associated with polycystic ovary syndrome (PCOS), including those near the LH receptor gene (LHCGR), a clathrin-binding protein (DENND1A) that functions as a guanine nucleotide exchange factor, and the gene encoding RAB5B, a GTPase involved in vesicular trafficking. We proposed that these three PCOS loci could be assembled into a functional network that contributes to altered gene expression in theca cells, resulting in increased androgen synthesis. The functional significance of this network was supported by our discovery that a truncated protein splice variant of the DENND1A gene, termed DENND1A.V2, is elevated in PCOS theca cells, and that forced expression of DENND1A.V2 in normal theca cells increased CYP11A1 and CYP17A1 expression and androgen synthesis, a hallmark of PCOS. In this study, we demonstrate the colocalization of LHCGR, DENND1AV.2, and RAB5B proteins in various cellular compartments in normal and PCOS theca cells by immunofluorescence. Human chorionic gonadotropin and forskolin stimulation was shown to affect the cytoplasmic distribution of LHCGR, DENND1A.V2, and RAB5B. DENND1A.V2 accumulated in the nuclei of the theca cells. Moreover, PCOS theca cells, following forskolin treatment, had a significantly greater relative abundance of nuclear DENND1A.V2. RAB5B also accumulated in the nuclei of PCOS theca cells treated with forskolin. In contrast, LHCGR did not enter the nucleus. This cytological evidence, and the previously reported increase in androgen biosynthesis with forced expression of DENND1A.V2 in normal theca cells, raises the possibility that DENND1A.V2 and RAB5B participate in increasing transcription of genes involved in androgen synthesis.

Styles APA, Harvard, Vancouver, ISO, etc.

10

Zhang, Zhiwei, Shuk-Wa Lau, Lingling Zhang et Wei Ge. « Disruption of Zebrafish Follicle-Stimulating Hormone Receptor (fshr) But Not Luteinizing Hormone Receptor (lhcgr) Gene by TALEN Leads to Failed Follicle Activation in Females Followed by Sexual Reversal to Males ». Endocrinology 156, n^o 10 (20 mai 2015) : 3747–62. http://dx.doi.org/10.1210/en.2015-1039.

Texte intégral

Résumé :

Gonadotropins are primary hormones that control vertebrate reproduction. In a recent study, we analyzed the impacts of FSH and LH on zebrafish reproduction by disrupting FSH and LH-β genes (fshb and lhb) using transcription activator-like effector nuclease (TALEN) technology. Using the same approach, we successfully deleted FSH and LH receptor genes (fshr and lhcgr) in the present study. In contrast to the deficiency of its cognate ligand FSH, the fshr-deficient females showed a complete failure of follicle activation with all ovarian follicles arrested at the primary growth-previtellogenic transition, which is the marker for puberty onset in females. Interestingly, after blockade at the primary growth stage for varying times, all females reversed to males, and all these males were fertile. In fshr-deficient males, spermatogenesis was normal in adults, but the initiation of spermatogenesis in juveniles was retarded. In contrast to fshr, the deletion of the lhcgr gene alone caused no obvious phenotypes in both males and females; however, double mutation of fshr and lhcgr resulted in infertile males. In summary, our results in the present study showed that Fshr was indispensable to folliculogenesis and the disruption of the fshr gene resulted in a complete failure of follicle activation followed by masculinization into males. In contrast, lhcgr does not seem to be essential to zebrafish reproduction in both males and females. Neither Fshr nor Lhcgr deficiency could phenocopy the deficiency of their cognate ligands FSH and LH, which is likely due to the fact that Fshr can be activated by both FSH and LH in the zebrafish.

Styles APA, Harvard, Vancouver, ISO, etc.

11

Aktar Karakaya, Amine, Atilla Çayır, Edip Unal, Aslı Beştaş, Aslı Ece Solmaz et Yusuf Kenan Haspolat. « A rare cause of primary amenorrhea : LHCGR gene mutations ». European Journal of Obstetrics & ; Gynecology and Reproductive Biology 272 (mai 2022) : 193–97. http://dx.doi.org/10.1016/j.ejogrb.2022.03.033.

Texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

12

Lopez, Antoine-Guy, Céline Duparc, Sylvie Renouf, Elise Machevin, Vincent L. Guillou, Jean-Christophe Sabourin, Guillaume Defortescu et al. « RF33 | PSUN04 Luteinizing Hormone-Chorionic Gonadotrophin Receptor in Pheochromocytomas ». Journal of the Endocrine Society 6, Supplement_1 (1 novembre 2022) : A143—A144. http://dx.doi.org/10.1210/jendso/bvac150.292.

Texte intégral

Résumé :

Abstract Background Pheochromocytomas and paragangliomas (PPGL) are catecholamine-producing neuroendocrine tumors that arise from the adrenal medulla or ganglia and display the highest heritability rate among all human tumours. Genomic analyses allowed identification of molecular subgroups of PPGL which are organized into 2 main clusters. Cluster 1 contains SDHx- and VHL-mutated tumors which do not produce epinephrine while cluster 2 includes the epinephrine-secreting PPGL related to RET, NF1, TMEM127 and MAX mutations. PPGL must be early diagnosed and treated to prevent adrenergic crises which can be life-threatening. Detection of PPGL is particularly important during pregnancy since PPGL are associated with a high risk of either maternal or fetal complications in this context. Reciprocally, pregnancy can favor adrenergic crises in patients with previously undiagnosed or silent pheochromocytoma (PCC). These dangerous events can be triggered by tumor compression resulting from fetus growth, or labor and delivery. However, it is known that surges in plasma catecholamines may also occur during early gestation suggesting that pregnancy may also activate the secretory activity of PPGL through the involvement of non-mechanical factors, such as gestational hormones. Methods In the present study, we report a case of silent PCC revealed in a pregnant woman by life-threatening adrenergic myocarditis occurring at 31 weeks of gestation. Analysis of PPGL susceptibility genes showed the presence of a heterozygous germline RET variant of uncertain significance. The fact that the first symptoms of catecholamine excess had appeared during the first trimester of pregnancy led us to conduct in vitro studies to investigate the effects of estradiol and the pregnancy hormone chorionic gonadotropin (hCG) on epinephrine secretion by cultured cells derived from the resected patient's tumor. Expression of luteinizing hormone/chorionic gonadotropin receptor (LHCGR) was searched for in the tumor and an additional series of 12 PCC by RT-qPCR and immunohistochemistry. LHCGR expression was also analyzed in silico in the PPGL cohorts of the COMETE and The Cancer Genome Atlas (TCGA) databases. Results hCG stimulated epinephrine secretion by primary cultured PCC cells. The tumor expressed the LHCG receptor, which was colocalized with catecholamine-producing enzymes. A similar expression pattern of the LHCG receptor was also observed in 5 out of a series of 12 PCCs. Moreover, in silico studies revealed that PPGL display the highest expression levels of LHCGR mRNA among the 32 solid tumor types of TCGA cohort. Interestingly, expression of LHCGR was higher in cluster 2 than in cluster 1 PPGL. Conclusion We show that PCC can express functional LHCG receptor. Consequently, pregnancy may activate catecholamine production by previously silent pheochromocytoma as early as the first trimester of gestation especially in women with gene mutations that predispose to cluster 2 epinephrine-secreting PCC. Presentation: Sunday, June 12, 2022 12:30 p.m. - 2:30 p.m., Monday, June 13, 2022 1:18 p.m. - 1:23 p.m.

Styles APA, Harvard, Vancouver, ISO, etc.

13

Bakhtyukov, Andrey A., Kira V. Derkach, Maxim A. Gureev, Dmitry V. Dar’in, Viktor N. Sorokoumov, Irina V. Romanova, Irina Yu Morina, Anna M. Stepochkina et Alexander O. Shpakov. « Comparative Study of the Steroidogenic Effects of Human Chorionic Gonadotropin and Thieno[2,3-D]pyrimidine-Based Allosteric Agonist of Luteinizing Hormone Receptor in Young Adult, Aging and Diabetic Male Rats ». International Journal of Molecular Sciences 21, n^o 20 (11 octobre 2020) : 7493. http://dx.doi.org/10.3390/ijms21207493.

Texte intégral

Résumé :

Low-molecular-weight agonists of luteinizing hormone (LH)/human chorionic gonadotropin (hCG) receptor (LHCGR), which interact with LHCGR transmembrane allosteric site and, in comparison with gonadotropins, more selectively activate intracellular effectors, are currently being developed. Meanwhile, their effects on testicular steroidogenesis have not been studied. The purpose of this work is to perform a comparative study of the effects of 5-amino-N-tert-butyl-4-(3-(1-methylpyrazole-4-carboxamido)phenyl)-2-(methylthio)thieno[2,3-d] pyrimidine-6-carboxamide (TP4/2), a LHCGR allosteric agonist developed by us, and hCG on adenylyl cyclase activity in rat testicular membranes, testosterone levels, testicular steroidogenesis and spermatogenesis in young (four-month-old), aging (18-month-old) and diabetic male Wistar rats. Type 1 diabetes was caused by a single streptozotocin (50 mg/kg) injection. TP4/2 (20 mg/kg/day) and hCG (20 IU/rat/day) were administered for 5 days. TP4/2 was less effective in adenylyl cyclase stimulation and ability to activate steroidogenesis when administered once into rats. On the 3rd–5th day, TP4/2 and hCG steroidogenic effects in young adult, aging and diabetic rats were comparable. Unlike hCG, TP4/2 did not inhibit LHCGR gene expression and did not hyperstimulate the testicular steroidogenesis system, moderately increasing steroidogenic proteins gene expression and testosterone production. In aging and diabetic testes, TP4/2 improved spermatogenesis. Thus, during five-day administration, TP4/2 steadily stimulates testicular steroidogenesis, and can be used to prevent androgen deficiency in aging and diabetes.

Styles APA, Harvard, Vancouver, ISO, etc.

14

Boufermes, Radia, Mansouria Belhocine, Zaina Amirat et Farida Khammar. « Assessment of Testicular Lhcgr mRNA Expression Correlated with Testis and Seminal Vesicle Activities in the Libyan jird (Meriones libycus, Rodentia : Muridae) during Breeding Season Compared with Nonbreeding Season ». Animals 11, n^o 2 (27 janvier 2021) : 320. http://dx.doi.org/10.3390/ani11020320.

Texte intégral

Résumé :

The Libyan jird (Meriones libycus, 1823) is a wild desert rodent that is a seasonal breeder species adapted to breed when the environmental conditions can satisfy the energy and hydrous requirements of pregnant and nursing females to ensure that births occur at the most favorable time of the year. We assessed gene expression of testicular luteinizing hormone receptor (Lhcgr) correlated to testis activity. The expression of Lhcgr was evaluated using quantitative Real Time-Polymerase Chain Reaction (qRT-PCR and the testis activity by a histological method in adult male Libyan jirds during the nonbreeding and breeding seasons. Our results showed that Lhcgr mRNA expression increased in autumn during the nonbreeding season and decreased in spring during the breeding season. This expression varied in contrast to testicular structure or function and plasma testosterone levels. These results help to elucidate this desert rodent’s seasonal sexual activity, which is correlated with central regulation.

Styles APA, Harvard, Vancouver, ISO, etc.

15

Ali, Abdul-Rahim A., Omar F. Abdul-Rasheed et Ula M. Al-Kawaz. « The Impact of Luteinizing Hormone/Chorionic Gonadotropin Hormone Receptor Gene Polymorphism rs68073206 in Men with Non-obstructive Azoospermia : A Case-control Study ». Open Access Macedonian Journal of Medical Sciences 9, A (25 septembre 2021) : 894–900. http://dx.doi.org/10.3889/oamjms.2021.6821.

Texte intégral

Résumé :

Background: The functional consequences of the luteinizing hormone/chorionic gonadotropin hormone receptor (LHCGR) gene single nucleotide polymorphism (rs68073206) on male infertility in patients with non-obstructive azoospermia (NOA) is not clear. Objective: To examine whether the presence of LHCGR gene; rs68073206 single nucleotide polymorphisms (SNPs) can be associated with incidence of non-obstructive azoospermia. Materials and methods: A case-control study comprised of a total of 70 unrelated Iraqi infertile men with non-obstructive azoospermia (zero sperm in semen) whose were on two groups: Group I that were diagnosed to have NOA but didn’t receive infertility treatment yet (33 patient with age of 31.58±1.059 year) and group II that were receiving injectable gonadotropin treatment (37 patient with age of 33.46±1.173 year). In addition to 34 age and BMI matched healthy fertile normozoospermic men (according to the parameters of WHO, 2010). The study population was genotyped by TaqMan assay for LHCGR gene single nucleotide polymorphism (rs68073206). The level of each hormone was estimated by immunoassay technique while the sperm analyses were conducted in accordance with the World Health Organization criteria. Results: The study revealed a statistically significant higher hormonal level of serum inhibin B in infertile group I patients with wild GG genotype (246.445±224.106 pg/ml), and the p-value is (0.0439) as compared to that hormone levels of GT and TT genotypes carriers that were (85.969±71.685 pg/ml) and (56.420±23.988 pg/ml) respectively. ). The genotyping variations of patients, whether carrying the homozygous GG, heterozygous GT or homozygous TT genotype, did not reveal a statistically significant difference in distribution as compared to control individuals. Conclusions: The LHCGR gene rs68073206 polymorphisms in our population having non-obstructive azoospermia can be suggested to have a modulating potential in variable gonadotropin sensitivity. The detected non-significant difference in genotypic prevalence can be attributable to the limited sample size.

Styles APA, Harvard, Vancouver, ISO, etc.

16

Hsu, Meng-Chieh, Leang-Shin Wu, De-Shien Jong et Chih-Hsien Chiu. « KISS1R signaling modulates gonadotropin sensitivity in mouse Leydig cell ». Reproduction 160, n^o 6 (décembre 2020) : 843–52. http://dx.doi.org/10.1530/rep-20-0328.

Texte intégral

Résumé :

Kisspeptin and its receptor KISS1R have been proven as pivotal regulators on controlling the hypothalamus–pituitary–gonad axis. Inactivating mutations in one of them cause idiopathic hypogonadotropic hypogonadism in human as well as rodent models. Notably, gonadotropin insensitivity, failure in hCG response, was presented in the male patients with loss-function-mutations in KISS1R gene; this reveals the essential role of KISS1R signaling in regulating testosterone production beyond the hypothalamic functions of kisspeptin. In this study, we hypothesized that the autocrine action of kisspeptin on Leydig cells may modulate steroidogenesis. Based on the mouse cell model, we first demonstrated that the cAMP/protein kinase A (PKA)/cAMP response element-binding protein (CREB) signaling pathway mediated gonadotropin-induced kisspeptin expression. By using siRNA interfering technique, knockdown of Kiss1r in MA-10 cells, a mouse Leydig tumor cell line, significantly reduced progesterone productions in both basal and hCG-treated conditions. Integrating the results from both quantitative real-time PCR and steroidogenic enzyme-activity assay, we found that this steroidogenic defect was associated with decreased luteinizing hormone/choriogonadotropin receptor (Lhcgr) and StAR protein (Star) expressions. Furthermore, exogenous expression of human LHCGR completely rescued hCG-stimulated progesterone production in the KISS1R-deficient cells. In conclusion, we proposed that the reproductive functions of KISS1R signaling in Leydig cell include modulating Lhcgr and steroidogenic gene expressions, which may shed the light on the pathophysiology of gonadotropin insensitivity.

Styles APA, Harvard, Vancouver, ISO, etc.

17

Ponomarenko, Ponomarenko I. V., Polonikov A. V. Polonikov et Churnosov M. I. Churnosov. « POLYMORPHIC LOCI OF THE LHCGR GENE ARE ASSOCIATED WITH THE DEVELOPMENT OF UTERINE LEIOMYOMA ». Akusherstvo i ginekologiia 10_2018 (31 octobre 2018) : 86–91. http://dx.doi.org/10.18565/aig.2018.10.86-91.

Texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

18

Doroszko, Milena, Marcin Chrusciel, Joanna Stelmaszewska, Tomasz Slezak, Slawomir Anisimowicz, Ursula Plöckinger, Marcus Quinkler et al. « GnRH antagonist treatment of malignant adrenocortical tumors ». Endocrine-Related Cancer 26, n^o 1 (janvier 2019) : 103–17. http://dx.doi.org/10.1530/erc-17-0399.

Texte intégral

Résumé :

Aberrantly expressed G protein-coupled receptors in tumors are considered as potential therapeutic targets. We analyzed the expressions of receptors of gonadotropin-releasing hormone (GNRHR), luteinizing hormone/chorionic gonadotropin (LHCGR) and follicle-stimulating hormone (FSHR) in human adrenocortical carcinomas and assessed their response to GnRH antagonist therapy. We further studied the effects of the GnRH antagonist cetrorelix acetate (CTX) on cultured adrenocortical tumor (ACT) cells (mouse Cα1 and Y-1, and human H295R), and in vivo in transgenic mice (SV40 T-antigen expression under inhibin α promoter) bearing Lhcgr and Gnrhr in ACT. Both models were treated with control (CT), CTX, human chorionic gonadotropin (hCG) or CTX+hCG, and their growth and transcriptional changes were analyzed. In situ hybridization and qPCR analysis of human adrenocortical carcinomas (n = 11–13) showed expression of GNRHR in 54/73%, LHCGR in 77/100% and FSHR in 0%, respectively. CTX treatment in vitro decreased cell viability and proliferation, and increased caspase 3/7 activity in all treated cells. In vivo, CTX and CTX+hCG (but not hCG alone) decreased ACT weights and serum LH and progesterone concentrations. CTX treatment downregulated the tumor markers Lhcgr and Gata4. Upregulated genes included Grb10, Rerg, Nfatc and Gnas, all recently found to be abundantly expressed in healthy adrenal vs ACT. Our data suggest that CTX treatment may improve the therapy of human adrenocortical carcinomas by direct action on GNRHR-positive cancer cells inducing apoptosis and/or reducing gonadotropin release, directing tumor cells towards a healthy adrenal gene expression profile.

Styles APA, Harvard, Vancouver, ISO, etc.

19

Tagmazian, Аrina Аndranikovna, Anna Leonidovna Arkhipova, Artyom Vladimirovich Brigida, Eugene Aleksandrovich Klimov et Svetlana Nikolaevna Kovalchuk. « Frequencies of genotypes and alleles of rs41256848 in the LHCGR gene in the population of black-and-white holsteinized cattle ». Agrarian Scientific Journal, n^o 7 (15 juillet 2019) : 73–76. http://dx.doi.org/10.28983/asj.y2019i7pp73-76.

Texte intégral

Résumé :

Embryo transfer technique is one of the key in accelerated reproduction of cattle. One of the most important stages is the selection of donor cows that are most sensitive to the procedure of hormonal stimulation of ovulation. One of the promising genetic markers of the reproductive status of cattle is currently the gene encoding the luteinizing hormone / choriogonadotropin receptor (LHCGR). One of the SNP in the LHCGR gene of cattle has already been described in the literature as associated with the number of oocytes and the quality of embryos - rs41256848 (c.1401G> T, p.Trp467Cys). The purpose of this work was to estimate the frequencies of genotypes and alleles of this substitution in the population of Black-and-White holsteinized cattle (190 cows). Genotyping was performed by PCR-RFLP method. In the studied population of cattle, the frequency of the G allele associated with higher rates in the total number of oocytes and the number of embryos survived after transplantation, as well as with the least number of unfertilized oocytes, is 63.2%.

Styles APA, Harvard, Vancouver, ISO, etc.

20

Zhou, Junhua, Sheerazed Boulkroun, Claudia P. Cabrera, Elena A. B. Azizan, Fabio Fernandes-Rosa, Emily Cottrell, Giulia Argentesi et al. « CTNNB1-Mutant Aldosterone-Producing Adenomas With Somatic Mutations of GNA11/GNAQ Have Distinct Phenotype and Genotype ». Journal of the Endocrine Society 5, Supplement_1 (1 mai 2021) : A65—A66. http://dx.doi.org/10.1210/jendso/bvab048.133.

Texte intégral

Résumé :

Abstract Background: We report (this meeting) somatic mutation of GNA11/Q in CTNNB1-mutant APAs. The recurrent co-driver mutation causes reversible hypertension in puberty, pregnancy, or menopause. We have investigated the molecular mechanism of this association. Methods: Gene expression profiles in 3 double mutant APAs were studied by unsupervised hierarchical clustering analysis and enrichment analysis of 362 differentially expressed genes and validated by qPCR, IFC and IHC in 10 double mutant APAs or transfected primary adrenal cells. Multiple region biopsies were performed in 7 adrenals adjacent to double-mutant APAs and 4 APAs with KCNJ5 or CACNA1D mutations. The findings of APA mutations in adjacent adrenals were replicated in each case by ddPCR ± NGS. Results: Unsupervised hierarchical clustering analysis showed clustering of the double-mutant APAs, and a high proportion of genes were many-fold upregulated compared to other APAs. LHCGR, TMEM132E, DKK1, C9orf84, FAP, GNRHR and MPP3 are among the genes with high expression. A small number of genes are down-regulated in the double-mutant APAs, including CYP11B1. qPCR confirmed an average of ~10 to 1000-fold higher expression of the hallmark genes in double-mutants. Enrichment analysis showed significant enrichment of features or terms concerned with cell junction and cell adhesion (P<10–8). IFC confirmed LHCGR intensity was 31–144 fold higher in primary adrenal cells with GNA11-p.Gln209Pro transfection and high CTNNB1 intensity. LHCGR intensity was qualitatively and quantitatively associated with immunofluorescence for CTNNB1. IHC of double-mutant APAs showed absent CYP11B1 but strong staining of CYP11B2. qPCR confirmed a lower CYP11B1/CYP11B2 ratio and a higher LHCGR expression (P<10–3, both). IHC confirmed LHCGR positivity in double-mutant APAs but distribution varied both within and between cells. Adjacent ZG was hyperplastic, with absence of both CYP11B1 and CYP11B2 staining, but weak/moderate staining for LHCGR. The same GNA11 ± CTNNB1 somatic mutations were detected in multiple regions of the adjacent adrenals to 3 double mutant APAs. qPCR of hallmark APA genes differed from the APAs. High concordance between ddPCR, NGS and Sanger sequencing of the findings of APA mutations in adjacent adrenals when analysed in the same sample. No mutations were found in 4 adrenals adjacent to APAs with KCNJ5 or CACNA1D mutations, nor in other 4 adrenals adjacent to double-mutant APAs. Conclusions: Patients harboring APAs with somatic mutations in both GNA11/GNAQ Q209 and CTNNB1 have distinct phenotype in both the APAs and their adjacent adrenals. Same GNA11 ± CTNNB1 somatic mutations were found in the adjacent adrenals to double mutant APAs. We infer that a double-hit within related pathways is more likely than a single-hit to cause large increases in expression of LHCGR, and of other genes which may influence clinical presentation.

Styles APA, Harvard, Vancouver, ISO, etc.

21

Li, Di Yan, Long Zhang, Ming Yao Yang, Huai Liang Xu, Hua Dong Yin, Ying Li et Qing Zhu. « Effect of luteinizing hormone/choriogonadotropin receptor (LHCGR) gene on chicken reproductive traits ». Molecular Biology Reports 40, n^o 12 (6 novembre 2013) : 7111–16. http://dx.doi.org/10.1007/s11033-013-2834-6.

Texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

22

Wang, Yizi, Minghui Chen, Jian Xu, Xinyan Liu, Yuwei Duan, Canquan Zhou et Yanwen Xu. « Core clock gene Bmal1 deprivation impairs steroidogenesis in mice luteinized follicle cells ». Reproduction 160, n^o 6 (décembre 2020) : 955–67. http://dx.doi.org/10.1530/rep-20-0340.

Texte intégral

Résumé :

Luteinization is the event of corpus luteum formation, a way of follicle cells transformation and a process of steroidogenesis alteration. As the core clock gene, Bmal1 was involved in the regulation of ovulation process and luteal function afterwards. Till now, the underlying roles of luteinization played by Bmal1 remain unknown. To explore the unique role of Bmal1 in luteal steroidogenesis and its underlying pathway, we investigated the luteal hormone synthesis profile in Bmal1 knockout female mice. We found that luteal hormone synthesis was notably impaired, and phosphorylation of PI3K/NfκB pathway was significantly activated. Then, the results were verified in in vitro cultured cells, including isolated Bmal1 interference granulosa cells (GCs) and theca cells (TCs), respectively. Hormones levels of supernatant culture media and mRNA expressions of steroidogenesis-associated genes (star, Hsd3β2, cyp19a1 in GCs, Lhcgr, star, Hsd3β2, cyp17a1 in TCs) were mutually decreased, while the phosphorylation of PI3K/NfκB was promoted during in vitro luteinization. After PI3K specific-inhibitor LY294002 intervention, mRNA expressions of Lhcgr and Hsd3β2 were partially rescued in Bmal1 interference TCs, together with significantly increased androstenedione and T synthesis. Further exploration in TCs demonstrated BMAL1 interacted directly but negatively with NfκB p65 (RelA), a subunit which was supposed as a mediator in Bmal1-governed PI3K signaling regulation. Taken together, we verified the novel role of Bmal1 in luteal steroidogenesis, achieving by negative interplay with RelA-mediated PI3K/NfκB pathway.

Styles APA, Harvard, Vancouver, ISO, etc.

23

Tagmazyan, А. А., A. L. Arkhipova et S. N. Kovalchuk. « METHOD OF REAL-TIME PCR FOR DETECTION OF SS52050737 POLYMORPHISM OF LHCGR GENE IN CATTLE ». International Journal of Applied and Fundamental Research (Международный журнал прикладных и фундаментальных исследований), n^o 7 2019 (2019) : 88–92. http://dx.doi.org/10.17513/mjpfi.12805.

Texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

24

Özcabı, Bahar, Feride Tahmiscioğlu Bucak, Serdar Ceylaner, Rahşan Özcan, Cenk Büyükünal, Oya Ercan, Beyhan Tüysüz et Olcay Evliyaoğlu. « Testotoxicosis : Report of Two Cases, One with a Novel Mutation in LHCGR Gene ». Journal of Clinical Research in Pediatric Endocrinology 7, n^o 3 (5 septembre 2015) : 242–48. http://dx.doi.org/10.4274/jcrpe.2067.

Texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

25

Ge, S. F., M. N. Romanov, P. J. Sharp, D. W. Burt, I. R. Paton et I. C. Dunn. « Mapping of the luteinizing hormone/choriogonadotropin receptor gene (LHCGR ) to chicken chromosome 3 ». Animal Genetics 32, n^o 1 (février 2001) : 50. http://dx.doi.org/10.1111/j.1365-2052.2001.0647i.pp.x.

Texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

26

Rousseau-Merck, M. F., M. Misrahi, M. Atger, H. Loosfelt, E. Milgrom et R. Berger. « Localization of the human luteinizing hormone/choriogonadotropin receptor gene (LHCGR) to chromosome 2p21 ». Cytogenetic and Genome Research 54, n^o 1-2 (1990) : 77–79. http://dx.doi.org/10.1159/000132962.

Texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

27

Ge, S. F., M. N. Romanov, P. J. Sharp, D. W. Burt, I. R. Paton et I. C. Dunn. « Mapping of the luteinizing hormone/choriogonadotropin receptor gene (LHCGR) to chicken chromosome 3 ». Animal Genetics 32, n^o 1 (février 2001) : 50. http://dx.doi.org/10.1046/j.1365-2052.2001.0647i.x.

Texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

28

Nakao, Kohshiro, Hiroshi Kishi, Fumiharu Imai, Hiroto Suwa, Takashi Hirakawa et Takashi Minegishi. « TNF-α Suppressed FSH-Induced LH Receptor Expression Through Transcriptional Regulation in Rat Granulosa Cells ». Endocrinology 156, n^o 9 (30 juin 2015) : 3192–202. http://dx.doi.org/10.1210/en.2015-1238.

Texte intégral

Résumé :

Several inflammatory cytokines regulate ovarian function. TNF-α is produced in granulosa cells under physiological conditions and has a reciprocal action on follicle development. In contrast, in pelvic inflammatory diseases, TNF-α is excessively produced in the pelvic cavity and has an adverse effect on reproductive functions. The objective of this study was to elucidate the mechanism of action of TNF-α on the expression of LH receptor (LHR) in immature rat granulosa cells. TNF-α suppressed FSH-induced LHR mRNA and protein expression and was not associated with cAMP accumulation. By using a luciferase assay, the construct containing base pairs −1389 to −1 of the rat Lhcgr promoter revealed that TNF-α decreased FSH-induced promoter activity. In response to TNF-α, nuclear factor (NF)-κB p65 was translocated to the nucleus, and the suppressive effect of TNF-α on LHR mRNA expression was abrogated by an NF-κB inhibitor. In a chromatin immunoprecipitation assay, TNF-α induced the association of NF-κB p65 with the rat Lhcgr transcriptional promoter region. NF-κB p65 and histone deacetylase (HDAC) interact to mediate expression of several genes at a transcriptional level. HDAC activity is thought to induce tight connections within local chromatin structures and repress gene transcription. Furthermore, the TNF-α–induced suppression of LHR mRNA expression was blocked by an HDAC inhibitor. Taken together, these results suggest that the interaction of NF-κB p65 with HDAC in the promoter region of rat Lhcgr might be responsible for TNF-α action on the regulation of LHR.

Styles APA, Harvard, Vancouver, ISO, etc.

29

Evliyaoğlu, Olcay. « Reply ; Testotoxicosis : Report of Two Cases, One with a Novel Mutation in LHCGR Gene ». Journal of Clinical Research in Pediatric Endocrinology 8, n^o 1 (1 mars 2016) : 107. http://dx.doi.org/10.4274/jcrpe.2765.

Texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

30

Owens, Lisa Ann, Stine Gry Kristensen, Avi Lerner, Georgios Christopoulos, Stuart Lavery, Aylin C. Hanyaloglu, Kate Hardy, Claus Yding Andersen et Stephen Franks. « Gene Expression in Granulosa Cells From Small Antral Follicles From Women With or Without Polycystic Ovaries ». Journal of Clinical Endocrinology & ; Metabolism 104, n^o 12 (5 juillet 2019) : 6182–92. http://dx.doi.org/10.1210/jc.2019-00780.

Texte intégral

Résumé :

Abstract Context Polycystic ovary syndrome (PCOS) is the most common cause of anovulation. A key feature of PCOS is arrest of follicles at the small- to medium-sized antral stage. Objective and Design To provide further insight into the mechanism of follicle arrest in PCOS, we profiled (i) gonadotropin receptors; (ii) characteristics of aberrant steroidogenesis; and (iii) expression of anti-Müllerian hormone (AMH) and its receptor in granulosa cells (GCs) from unstimulated, human small antral follicles (hSAFs) and from granulosa lutein cells (GLCs). Setting GCs from hSAFs were collected at the time of cryopreservation of ovarian tissue for fertility preservation and GLCs collected during oocyte aspiration before in vitro fertilization/intracytoplasmic sperm injection. Participants We collected hSAF GCs from 31 women (98 follicles): 10 with polycystic ovaries (PCO) and 21 without. GLCs were collected from 6 women with PCOS and 6 controls undergoing IVF. Main Outcome Measures Expression of the following genes: LHCGR, FSHR, AR, INSR, HSD3B2, CYP11A1, CYP19, STAR, AMH, AMHR2, FST, INHBA, INHBB in GCs and GLCs were compared between women with PCO and controls. Results GCs in hSAFs from women with PCO showed higher expression of LHCGR in a subset (20%) of follicles. Expression of FSHR (P < 0.05), AR (P < 0.05), and CYP11A1 (P < 0.05) was lower, and expression of CYP19A1 (P < 0.05), STAR (P < 0.05), HSD3B2 (P = NS), and INHBA (P < 0.05) was higher in PCO GCs. Gene expression in GL cells differed between women with and without PCOS but also differed from that in GCs. Conclusions Follicle arrest in PCO is characterized in GCs by differential regulation of key genes involved in follicle growth and function.

Styles APA, Harvard, Vancouver, ISO, etc.

31

Ponomarenko, I. V., I. V. Batlutskaya, V. S. Orlova, O. A. Efremova et M. I. Churnosov. « The Polymorphism rs7579411 of the LHCGR Gene Is Associated with the Development of Endometrial Hyperplasia ». Russian Journal of Genetics 58, n^o 9 (septembre 2022) : 1129–34. http://dx.doi.org/10.1134/s1022795422090137.

Texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

32

Chen, Huatao, Lijia Zhao, Makoto Kumazawa, Nobuhiko Yamauchi, Yasufumi Shigeyoshi, Seiichi Hashimoto et Masa-aki Hattori. « Downregulation of core clock gene Bmal1 attenuates expression of progesterone and prostaglandin biosynthesis-related genes in rat luteinizing granulosa cells ». American Journal of Physiology-Cell Physiology 304, n^o 12 (15 juin 2013) : C1131—C1140. http://dx.doi.org/10.1152/ajpcell.00008.2013.

Texte intégral

Résumé :

Ovarian circadian oscillators have been implicated in the reproductive processes of mammals. However, there are few reports regarding the detection of ovarian clock-controlled genes (CCGs). The present study was designed to unravel the mechanisms through which CCG ovarian circadian oscillators regulate fertility, primarily using quantitative RT-PCR and RNA interference against Bmal1 in rat granulosa cells. Mature granulosa cells were prepared from mouse Per2-destabilized luciferase ( dLuc) reporter gene transgenic rats. A real-time monitoring system of Per2 promoter activity was employed to detect Per2-dLuc oscillations. The cells exposed to luteinizing hormone (LH) displayed clear Per2-dLuc oscillations and a rhythmic expression of clock genes ( Bmal1, Per1, Per2, Rev-erbα, and Dbp). Meanwhile, the examined ovarian genes ( Star, Cyp19a1, Cyp11a1, Ptgs2, Lhcgr, and p53) showed rhythmic transcript profiles except for Hsd3b2, indicating that these rhythmic expression genes may be CCGs. Notably, Bmal1 small interfering (si)RNA treatment significantly decreased both the amplitude of Per2-dLuc oscillations and Bmal1 mRNA levels compared with nonsilencing RNA treatment in luteinizing granulosa cells. Depletion of Bmal1 by siRNA decreased the transcript levels of clock genes ( Per1, Per2, Rev-erbα, and Dbp) and examined ovarian genes ( Star, Cyp19a1, Cyp11a1, Ptgs2, Hsd3b2, and Lhcgr). Accordingly, knockdown of Bmal1 also inhibited the synthesis of progesterone and prostaglandin E2, which are associated with crucial reproductive processes. Collectively, these data suggest that ovarian circadian oscillators regulate the synthesis of steroid hormones and prostaglandins through ovarian-specific CCGs in response to LH stimuli. The present study provides new insights into the physiologic significance of Bmal1 related to fertility in ovarian circadian oscillators.

Styles APA, Harvard, Vancouver, ISO, etc.

33

Santos, S. E. C., H. Murua Escobar, L. H. Sider, S. Winkler, S. M. Aoki, M. P. Milazzotto, F. Campagnari et al. « DNA sequence, polymorphism, and mapping of luteinizing hormone receptor fragment (LHCGR) gene in Great Dane dogs ». Animal Genetics 35, n^o 1 (février 2004) : 74–75. http://dx.doi.org/10.1111/j.0268-9146.2003.01080.x.

Texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

34

Daussac, A., P. Barat, N. Servant, M. Yacoub, S. Missonier, F. Lavran, L. Gaspari, C. Sultan et F. Paris. « Testotoxicosis without Testicular Mass : Revealed by Peripheral Precocious Puberty and Confirmed by Somatic LHCGR Gene Mutation ». Endocrine Research 45, n^o 1 (8 août 2019) : 32–40. http://dx.doi.org/10.1080/07435800.2019.1645163.

Texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

35

Yang, Wu-Cai, Ke-Qiong Tang, Shu-Jing Li, Lu-Ming Chao et Li-Guo Yang. « Polymorphisms of the bovine luteinizing hormone/choriogonadotropin receptor (LHCGR) gene and its association with superovulation traits ». Molecular Biology Reports 39, n^o 3 (11 juin 2011) : 2481–87. http://dx.doi.org/10.1007/s11033-011-0999-4.

Texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

36

Sosa, Ahmed S. A., Sally Ibrahim, Karima Gh M. Mahmoud, Mohamed M. Ayoub, Mohamed S. S. Abdo et Mahmoud F. Nawito. « Expression profiling of primary cultured buffalo granulosa cells from different follicular size in comparison with their in vivo counterpart ». Zygote 28, n^o 3 (10 mars 2020) : 233–40. http://dx.doi.org/10.1017/s0967199420000088.

Texte intégral

Résumé :

SummaryThis study aimed to: (i) characterize cultured granulosa cells (GCs) from different follicle sizes morphologically and molecularly; and (ii) select a suitable model according to follicular size that maintained GC function during culture. Buffalo ovaries were collected from a slaughterhouse and follicles were classified morphologically into: first group ≤ 4 mm, second group 5–8 mm, third group 9–15 mm and fourth group 16–20 mm diameter. GC pellets were divided into two portions. The first portion served as the control fresh pellet, and the secondwas used for 1 week for GC culture. Total RNA was isolated, and qRT-PCR was performed to test for follicle-stimulating hormone receptor (FSHR), cytochrome P450 19 (CYP19), luteinizing hormone/choriogonadotropin receptor (LHCGR), proliferating cell nuclear antigen (PCNA), apoptosis-related cysteine peptidase (CASP3), anti-Müllerian hormone (AMH), and phospholipase A2 group III (PLA2G3) mRNAs. Estradiol (E2) and progesterone (P4) levels in the culture supernatant and in follicular fluids were measured using enzyme-linked immunosorbent assay (ELISA). Basic DMEM-F12 medium maintained the morphological appearance of cultured GCs. The relative abundance of FSHR, CYP19, and LHCGR mRNAs was 0.001 ≤ P ≤ 0.01 and decreased at the end of culture compared with the fresh pellet. There was a fine balance between expression patterns of the proliferation marker gene (PCNA) and the proapoptotic marker gene (CASP3). AMH mRNA was significantly increased (P < 0.001) in cultured GCs from small follicles, while cultured GCs from other three categories (5–8 mm, 9–15 mm and 16–20 mm) showed a clear reduction (P < 0.001). Interestingly, the relative abundance of PLA2G3 mRNA was significantly (P < 0.001) increased in all cultured GCs. E2 and P4 concentrations were significantly (P < 0.001) decreased in all cultured groups. Primary cultured GCs from small follicles could be a good model for better understanding follicular development in Egyptian buffaloes.

Styles APA, Harvard, Vancouver, ISO, etc.

37

Yerle, M., O. Galman, Y. Lahbib-Mansais et J. Gellin. « Localization of the pig luteinizing hormone/choriogonadotropin receptor gene (LHCGR) by radioactive and nonradioactive in situ hybridization ». Cytogenetic and Genome Research 59, n^o 1 (1992) : 48–51. http://dx.doi.org/10.1159/000133198.

Texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

38

Ben Hadj Hmida, Imen, Soumaya Mougou-Zerelli, Anis Hadded, Sarra Dimassi, Molka Kammoun, Joelle Bignon-Topalovic, Mohamed Bibi, Ali Saad, Anu Bashamboo et Ken McElreavey. « Novel homozygous nonsense mutations in the luteinizing hormone receptor ( LHCGR ) gene associated with 46,XY primary amenorrhea ». Fertility and Sterility 106, n^o 1 (juillet 2016) : 225–29. http://dx.doi.org/10.1016/j.fertnstert.2016.03.008.

Texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

39

Veraguas, D., S. R. Cuevas, P. F. Gallegos, F. O. Castro et L. Rodriguez-Alvarez. « 189 EFFECT OF THE OVARIAN STIMULATION OF ANESTROUS CATS WITH eCG ON MORPHOLOGICAL QUALITY AND GENE EXPRESSION PROFILE OF CUMULUS-OOCYTE COMPLEXES ». Reproduction, Fertility and Development 29, n^o 1 (2017) : 203. http://dx.doi.org/10.1071/rdv29n1ab189.

Texte intégral

Résumé :

The objective of this research was to evaluate the effect of eCG on morphological quality and gene expression profile of cumulus-oocyte complexes (COC) recovered from anestrous cats. For this purpose, 3 experimental groups were made. Group 1 consisted of 11 oestrous cats (oestrous); Group 2 had 13 anestrous cats (anestrous); and Group 3 was made up of 11 anestrous cats treated with a single subcutaneous dose of 200 IU of eCG. In oestrous and anestrous groups the ovaries were obtained directly by ovariohysterectomy, whereas in the eCG group this was achieved 4 days after the dose injection. In all groups, each cat corresponded to an individual biological replicate, whereby the COC recovered from each cat were classified and processed separately for the experiments of gene expression analysis and in vitro maturation (IVM). The COC were collected by slicing of the ovaries and classified morphologically as grade I (excellent), grade II (good), grade III (fair), and grade IV (poor) quality. For gene expression analysis, pools of 8 to 10 grade I and II immature COC were made, resulting in 7 pools for each group. Quantitative RT-PCR was performed for gonadotrophin receptor genes (FSHR and LHCGR), FSH-induced genes (EGFR, EGR1, ESR2, and PTGS2), and genes related to oocyte competence (GDF9, BMP15, and GATM). The gene SDHA was used as the internal control. The total remaining proportion of grade I and II COC were used for IVM, and maturation rate was measured by visualisation of the first polar body. Statistical analysis was performed using the Kruskal–Wallis test. No differences were found in the total number of COC (mean ± standard deviation) recovered per cat among the oestrous (56.8 ± 20.5), anestrous (80.2 ± 35.2), and eCG groups (96.5 ± 62.0; P > 0.05). With respect to morphological quality of COC, the eCG group had a higher proportion of grade I COC (33.6 ± 11.0%) than the oestrous and anestrous groups (16.5 ± 8.7 and 8.9 ± 6.0%, respectively; P < 0.05). However, the anestrous group had a higher proportion of grade II COC (26.8 ± 6.4%) than the eCG group (21.1 ± 6.6%; P < 0.05). On the other hand, the eCG group had a lower proportion of grade III and IV COC (45.3 ± 12.8%) than the anestrous group (64.3 ± 9.1%; P < 0.05), without differences from the oestrous group (57.1 ± 12.0%; P > 0.05). Concerning to gene expression analysis, COC from the eCG group had a higher relative expression of FSHR, LHCGR, and EGFR than COC from the oestrous and anestrous group (P < 0.05). Furthermore, the COC from the eCG group had a higher relative expression of EGR1 than COC from the anestrous group and a higher expression of ESR2 than COC from the oestrous group (P < 0.05). However, COC from the eCG group had a lower relative expression of GATM and PTGS2 than COC from the oestrous group and a lower expression of GDF9 and BMP15 than COC from the anestrous group (P < 0.05). Although a higher number of oocytes with a first polar body could be seen in the eCG group after IVM, no significant differences in the maturation rate were found among the eCG (55.3 ± 13.2), oestrous (43.7 ± 11.1), and anestrous groups (47.9 ± 13.6; P > 0.05). In conclusion, the treatment with eCG improved the morphological quality of COC recovered from anestrous cats, which agrees with an increased relative expression of FSHR, LHCGR, EGFR, EGR1, and ESR2 and might be related to an enhanced competence of COC.

Styles APA, Harvard, Vancouver, ISO, etc.

40

Huang, Xin, Cuifang Hao, Xiaofang Shen, Xiaoyan Liu, Yinghua Shan, Yuhua Zhang et Lili Chen. « Differences in the transcriptional profiles of human cumulus cells isolated from MI and MII oocytes of patients with polycystic ovary syndrome ». REPRODUCTION 145, n^o 6 (juin 2013) : 597–608. http://dx.doi.org/10.1530/rep-13-0005.

Texte intégral

Résumé :

Polycystic ovary syndrome (PCOS) is a common endocrine and metabolic disorder in women. The abnormalities of endocrine and intra-ovarian paracrine interactions may change the microenvironment for oocyte development during the folliculogenesis process and reduce the developmental competence of oocytes in PCOS patients who are suffering from anovulatory infertility and pregnancy loss. In this microenvironment, the cross talk between an oocyte and the surrounding cumulus cells (CCs) is critical for achieving oocyte competence. The aim of our study was to investigate the gene expression profiles of CCs obtained from PCOS patients undergoing IVF cycles in terms of oocyte maturation by using human Genome U133 Plus 2.0 microarrays. A total of 59 genes were differentially expressed in two CC groups. Most of these genes were identified to be involved in one or more of the following pathways: receptor interactions, calcium signaling, metabolism and biosynthesis, focal adhesion, melanogenesis, leukocyte transendothelial migration, Wnt signaling, and type 2 diabetes mellitus. According to the different expression levels in the microarrays and their putative functions, six differentially expressed genes (LHCGR, ANGPTL1, TNIK, GRIN2A, SFRP4, and SOCS3) were selected and analyzed by quantitative RT-PCR (qRT-PCR). The qRT-PCR results were consistent with the microarray data. Moreover, the molecular signatures (LHCGR, TNIK, and SOCS3) were associated with developmental potential from embryo to blastocyst stage and were proposed as biomarkers of embryo viability in PCOS patients. Our results may be clinically important as they offer a new potential strategy for competent oocyte/embryo selection in PCOS patients.

Styles APA, Harvard, Vancouver, ISO, etc.

41

Donadeu, F. X., S. D. Sontakke et J. Ioannidis. « MicroRNA indicators of follicular steroidogenesis ». Reproduction, Fertility and Development 29, n^o 5 (2017) : 906. http://dx.doi.org/10.1071/rd15282.

Texte intégral

Résumé :

MicroRNAs (miRNAs) can provide useful biomarkers of tissue function. The aim of the present study was to determine, in bovine follicles (n = 66; diameter 4–22 mm), the relationship among several indices of steroidogenesis and levels of 15 miRNAs previously identified to be associated with follicle development. Oestradiol levels, the oestradiol : progesterone (E : P) ratio and cytochrome P450 family 19 subfamily A member 1 (CYP19A1) expression were strongly correlated with each other (ρ > 0.8) and with LH/choriogonadotropin receptor (LHCGR) expression (ρ ≥ 0.6; P < 0.01). Levels of nine different miRNAs in the follicular wall were correlated (P < 0.01) with oestradiol, the E : P ratio and CYP19A1, with miR-873 showing the strongest correlation in each case (ρ > 0.7). Analyses of follicular fluid miRNAs identified miR-202 as correlated with oestradiol, the E : P ratio and CYP19A1 (ρ > 0.5; P < 0.01). When considering all follicle end-points together, we found that using a cut-off value of E : P = 1 overestimated the number of oestrogen-inactive follicles, whereas using CYP19A1 as a classifier provided a clearer separation of follicle samples based on oestrogen activity, in agreement with the E : P ratio, LHCGR expression and levels of miR-873 and miR-202. In conclusion, we identified miR-873 and miR-202 as miRNAs whose levels in follicular tissues can be used as indicators of steroidogenic capacity in bovine. We showed that these or other gene expression parameters, in addition or alternatively to the E : P ratio, should be used to accurately classify follicles based on steroidogenic capacity.

Styles APA, Harvard, Vancouver, ISO, etc.

42

Juel Mortensen, Li, Martin Blomberg Jensen, Peter Christiansen, Ann-Margrethe Rønholt, Anne Jørgensen, Hanne Frederiksen, John E. Nielsen et al. « Germ Cell Neoplasia in Situ and Preserved Fertility Despite Suppressed Gonadotropins in a Patient With Testotoxicosis ». Journal of Clinical Endocrinology & ; Metabolism 102, n^o 12 (5 octobre 2017) : 4411–16. http://dx.doi.org/10.1210/jc.2017-01761.

Texte intégral

Résumé :

Abstract Context Testotoxicosis is an autosomal-dominant, male-limited disorder. Activating mutations in the luteinizing hormone receptor gene (LHCGR) cause high autonomous testosterone secretion, resulting in early-onset peripheral precocious puberty. Little is known about long-term consequences of testotoxicosis. Case Description We present a rare case of a patient followed for 25 years with two remarkable outcomes: preserved fertility and germ cell neoplasia in situ (GCNIS). He presented with precocious puberty at 10 months of age and was diagnosed with testotoxicosis due to a de novo heterozygous Asp578Tyr mutation in LHCGR. Testicular biopsy in childhood showed Leydig cell hyperplasia with altered cell maturation. From infancy throughout adulthood, elevated testosterone and estradiol, low inhibin B and anti-Müllerian hormone, and completely suppressed follicle-stimulating hormone and luteinizing hormone were noted. Height acceleration and advanced bone age resulted in a reduced final height. Semen analysis revealed ongoing spermatogenesis, and the patient fathered a child by natural conception. Ketoconazole treatment decreased circulating testosterone in childhood, supported by experimental suppression of testosterone production in his adult testis tissue cultured ex vivo. At 25 years of age, ultrasound revealed a testicular tumor, identified as a Leydig cell adenoma, but unexpectedly with GCNIS present in adjacent seminiferous tubules. Conclusion The case illustrates that absence of gonadotropins but high intratesticular testosterone concentration is sufficient for spermatogenesis and to allow fatherhood. Our study is also the first description, to our knowledge, of GCNIS in a patient with testotoxicosis. We recommend regular clinical examination and ultrasonic evaluation of the testes in these patients due to potential increased risk of malignancy.

Styles APA, Harvard, Vancouver, ISO, etc.

43

Jeha, George S., Elizabeth D. Lowenthal, Wai-Yee Chan, Shao-Ming Wu et Lefkothea P. Karaviti. « Variable presentation of precocious puberty associated with the D564G mutation of the LHCGR gene in children with testotoxicosis ». Journal of Pediatrics 149, n^o 2 (août 2006) : 271–74. http://dx.doi.org/10.1016/j.jpeds.2006.03.017.

Texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

44

Teino, Indrek, Antti Matvere, Sulev Kuuse, Sulev Ingerpuu, Toivo Maimets, Arnold Kristjuhan et Tarmo Tiido. « Transcriptional repression of the Ahr gene by LHCGR signaling in preovulatory granulosa cells is controlled by chromatin accessibility ». Molecular and Cellular Endocrinology 382, n^o 1 (janvier 2014) : 292–301. http://dx.doi.org/10.1016/j.mce.2013.10.011.

Texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

45

Hassan, Heba Amin, M. L. Essawi, M. K. Mekkawy et I. Mazen. « Novel mutations of the LHCGR gene in two families with 46,XY DSD causing Leydig cell hypoplasia I ». Hormones 19, n^o 4 (14 juillet 2020) : 573–79. http://dx.doi.org/10.1007/s42000-020-00226-6.

Texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

46

Yan, Mei, Julaiti Dilihuma, Yanfei Luo, Baoerhan Reyilanmu, Yiping Shen et Maimaiti Mireguli. « Novel Compound Heterozygous Variants in the LHCGR Gene in a Genetically Male Patient with Female External Genitalia ». Journal of Clinical Research in Pediatric Endocrinology 11, n^o 2 (1 juin 2019) : 211–17. http://dx.doi.org/10.4274/jcrpe.galenos.2018.2018.0197.

Texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

47

Liu, Ka-Cheuk, Rudolf S. S. Wu et Wei Ge. « Luteinizing hormone receptor (lhcgr) as a marker gene for characterizing estrogenic endocrine-disrupting chemicals in zebrafish ovarian follicle cells ». General and Comparative Endocrinology 192 (octobre 2013) : 89–94. http://dx.doi.org/10.1016/j.ygcen.2013.06.023.

Texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

48

Robic, Annie, Thomas Faraut, Katia Feve, Sarah Djebali, Armelle Prunier, Catherine Larzul et Laurence Liaubet. « Correlation Networks Provide New Insights into the Architecture of Testicular Steroid Pathways in Pigs ». Genes 12, n^o 4 (9 avril 2021) : 551. http://dx.doi.org/10.3390/genes12040551.

Texte intégral

Résumé :

Steroid metabolism is a fundamental process in the porcine testis to provide testosterone but also estrogens and androstenone, which are essential for the physiology of the boar. This study concerns boars at an early stage of puberty. Using a RT-qPCR approach, we showed that the transcriptional activities of several genes providing key enzymes involved in this metabolism (such as CYP11A1) are correlated. Surprisingly, HSD17B3, a key gene for testosterone production, was absent from this group. An additional weighted gene co-expression network analysis was performed on two large sets of mRNA-seq to identify co-expression modules. Of these modules, two containing either CYP11A1 or HSD17B3 were further analyzed. This comprehensive correlation meta-analysis identified a group of 85 genes with CYP11A1 as hub gene, but did not allow the characterization of a robust correlation network around HSD17B3. As the CYP11A1-group includes most of the genes involved in steroid synthesis pathways (including LHCGR encoding for the LH receptor), it may control the synthesis of most of the testicular steroids. The independent expression of HSD17B3 probably allows part of the production of testosterone to escape this control. This CYP11A1-group contained also INSL3 and AGT genes encoding a peptide hormone and an angiotensin peptide precursor, respectively.

Styles APA, Harvard, Vancouver, ISO, etc.

49

Nery da Silva, Arthur, Luana Alves, Germana Vizzotto Osowski, Leandro Sabei, Priscila Assis Ferraz, Guilherme Pugliesi, Mariana Groke Marques, Ricardo Zanella et Adroaldo José Zanella. « Housing Conditions and a Challenge with Lipopolysaccharide on the Day of Estrus Can Influence Gene Expression of the Corpus Luteum in Gilts ». Genes 13, n^o 5 (26 avril 2022) : 769. http://dx.doi.org/10.3390/genes13050769.

Texte intégral

Résumé :

The corpus luteum (CL) is a temporary endocrine gland that plays a decisive role in the reproductive physiology of gilts. Recently, it has been suggested that exogenous factors may compromise the normal functioning of the CL. In the present study, we aimed to understand to what extent an acute and systemic challenge with lipopolysaccharide (LPS) on the day of estrus could compromise gene expression of gilts’ CLs housed in different welfare conditions. For this, we housed 42 gilts in three different housing systems: crates, indoor group pens, and outdoor housing. Then, we challenged six females from each group with LPS and eight with saline (SAL) on the day of estrus. After slaughtering the gilts on the fifth day after the challenge, ovaries were collected for gene expression analysis by RT-qPCR. Housing system and LPS challenge did not have a significant interaction for any genes evaluated; thus, their effects were studied separately. We identified significant (p < 0.05) downregulation of the angiogenic genes VEGF and FTL1 among LPS-challenged animals. Meanwhile, we also observed upregulation of HSD3B1 gene among LPS-challenged animals. We found that STAR and LHCGR genes were differentially expressed depending on the housing system, which indicates that the environment may affect adaptation capabilities. Our results indicate that an acute health challenge on the estrus day alters CL gene expression; however, the role of the housing system remains uncertain.

Styles APA, Harvard, Vancouver, ISO, etc.

50

Zielen, A. C., M. J. Khan, N. Pollock, H. Jiang, J. Ahmed, R. Nazli, M. Jabeen, A. Yatsenko et A. Rajkovic. « A novel homozygous frame-shift variant in the LHCGR gene is associated with primary ovarian insufficiency in a Pakistani family ». Clinical Genetics 94, n^o 3-4 (17 juillet 2018) : 396–97. http://dx.doi.org/10.1111/cge.13406.

Texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

Articles de revues sur le sujet « LHCGR gene »

Créez une référence correcte selon les styles APA, MLA, Chicago, Harvard et plusieurs autres