Pour voir les autres types de publications sur ce sujet consultez le lien suivant : G4 stabilization.
Articles de revues sur le sujet « G4 stabilization »
Créez une référence correcte selon les styles APA, MLA, Chicago, Harvard et plusieurs autres
Consultez les 50 meilleurs articles de revues pour votre recherche sur le sujet « G4 stabilization ».
À côté de chaque source dans la liste de références il y a un bouton « Ajouter à la bibliographie ». Cliquez sur ce bouton, et nous générerons automatiquement la référence bibliographique pour la source choisie selon votre style de citation préféré : APA, MLA, Harvard, Vancouver, Chicago, etc.
Vous pouvez aussi télécharger le texte intégral de la publication scolaire au format pdf et consulter son résumé en ligne lorsque ces informations sont inclues dans les métadonnées.
Parcourez les articles de revues sur diverses disciplines et organisez correctement votre bibliographie.
1
Li, Conghui, Honghong Wang, Zhinang Yin, Pingping Fang, Ruijing Xiao, Ying Xiang, Wen Wang et al. « Ligand-induced native G-quadruplex stabilization impairs transcription initiation ». Genome Research 31, no 9 (16 août 2021) : 1546–60. http://dx.doi.org/10.1101/gr.275431.121.
Texte intégralRésumé :
G-quadruplexes (G4s) are noncanonical DNA secondary structures formed through the self-association of guanines, and G4s are distributed widely across the genome. G4 participates in multiple biological processes including gene transcription, and G4-targeted ligands serve as potential therapeutic agents for DNA-targeted therapies. However, genome-wide studies of the exact roles of G4s in transcriptional regulation are still lacking. Here, we establish a sensitive G4-CUT&Tag method for genome-wide profiling of native G4s with high resolution and specificity. We find that native G4 signals are cell type–specific and are associated with transcriptional regulatory elements carrying active epigenetic modifications. Drug-induced promoter-proximal RNA polymerase II pausing promotes nearby G4 formation. In contrast, G4 stabilization by G4-targeted ligands globally reduces RNA polymerase II occupancy at gene promoters as well as nascent RNA synthesis. Moreover, ligand-induced G4 stabilization modulates chromatin states and impedes transcription initiation via inhibition of general transcription factors loading to promoters. Together, our study reveals a reciprocal genome-wide regulation between native G4 dynamics and gene transcription, which will deepen our understanding of G4 biology toward therapeutically targeting G4s in human diseases.
2
Dharmaiah, Sharvari, Vasudev Tadimeti, Prit Benny Malgulwar, Christian Alvarez, Ahsan Farooqi et Jason Huse. « CBIO-04. G-QUADRUPLEX STABILIZATION ENHANCES REPLICATION STRESS AND DNA DAMAGE IN ATRX-DEFICIENT HIGH-GRADE GLIOMA ». Neuro-Oncology 23, Supplement_6 (2 novembre 2021) : vi27—vi28. http://dx.doi.org/10.1093/neuonc/noab196.105.
Texte intégralRésumé :
Abstract Loss of function mutations in α-thalassaemia/mental retardation X-linked (ATRX) are a critical molecular hallmark for invariably fatal high-grade glioma (HGG). Mutational inactivation of histone chaperone ATRX leads to accumulations of abnormal DNA secondary structures known as G-quadruplexes (G4s), thereby inducing replication stress and DNA damage. As G4s arise at GC-rich regions (i.e., pericentromeric and telomeric regions), ATRX-deficiency alters genome-wide accessibility of chromatin, leads to transcriptional dysregulation, and induces alternative lengthening of telomeres (ALT). Our goal is to target ATRX deficiency through G4 stabilizers, which represent a class of novel small molecule compounds that selectively bind to and stabilize G4 structures. However, the genomic consequences and efficacy of this therapy for ATRX-deficient HGG are poorly understood. We therefore sought to evaluate the molecular mechanisms that drive selective lethality in patient-derived ATRX-deficient glioma stem cells (GSCs), following G4 stabilization. We found that ATRX-deficient GSCs demonstrate dose-dependent enhanced sensitivity to G4 stabilization, compared to ATRX-intact controls. Cell viability assays confirmed the specificity of our G4 stabilizer in comparison to other commonly used G4 stabilizers. Interestingly, G4 stabilization activated p53-independent apoptosis in ATRX-deficient GSCs. Furthermore, ATRX-deficient GSCs exhibit upregulated expression of both ATR and ATM pathways upon G4 stabilization, indicating enhanced replication stress and DNA damage via double-stranded breaks, respectively. Our preliminary findings suggest that ATR and ATM activation leads to the inhibition of transcription factor NF-κB, which in turn drives apoptosis. Lastly, our data indicate that G4 stabilization perturbs the ALT phenotype in ATRX-deficient GSCs, likely contributing to telomeric dysfunction. Taken together, these findings suggest that G4 stabilizers could synergize with ionizing radiation, the standard of care, as they are both DNA-damaging therapies. Our work defines mechanisms of action and efficacy of a novel therapeutic strategy for ATRX-deficient HGG, with strong implications for other ATRX-deficient cancers.
3
Desai, Nakshi, Viraj Shah et Bhaskar Datta. « Assessing G4-Binding Ligands In Vitro and in Cellulo Using Dimeric Carbocyanine Dye Displacement Assay ». Molecules 26, no 5 (5 mars 2021) : 1400. http://dx.doi.org/10.3390/molecules26051400.
Texte intégralRésumé :
G-quadruplexes (G4) are the most actively studied non-canonical secondary structures formed by contiguous repeats of guanines in DNA or RNA strands. Small molecule mediated targeting of G-quadruplexes has emerged as an attractive tool for visualization and stabilization of these structures inside the cell. Limited number of DNA and RNA G4-selective assays have been reported for primary ligand screening. A combination of fluorescence spectroscopy, AFM, CD, PAGE, and confocal microscopy have been used to assess a dimeric carbocyanine dye B6,5 for screening G4-binding ligands in vitro and in cellulo. The dye B6,5 interacts with physiologically relevant DNA and RNA G4 structures, resulting in fluorescence enhancement of the molecule as an in vitro readout for G4 selectivity. Interaction of the dye with G4 is accompanied by quadruplex stabilization that extends its use in primary screening of G4 specific ligands. The molecule is cell permeable and enables visualization of quadruplex dominated cellular regions of nucleoli using confocal microscopy. The dye is displaced by quarfloxin in live cells. The dye B6,5 shows remarkable duplex to quadruplex selectivity in vitro along with ligand-like stabilization of DNA G4 structures. Cell permeability and response to RNA G4 structures project the dye with interesting theranostic potential. Our results validate that B6,5 can serve the dual purpose of visualization of DNA and RNA G4 structures and screening of G4 specific ligands, and adds to the limited number of probes with such potential.
4
Psaras, Alexandra Maria, Katarina T. Chang, Taisen Hao et Tracy A. Brooks. « Targeted Downregulation of MYC through G-quadruplex Stabilization by DNAi ». Molecules 26, no 18 (13 septembre 2021) : 5542. http://dx.doi.org/10.3390/molecules26185542.
Texte intégralRésumé :
Modulating the expression or function of the enigmatic MYC protein has demonstrated efficacy in an array of cancer types and a marked potential therapeutic index and safety profile. Despite its high therapeutic value, specific and selective inhibitors or downregulating therapeutics have proven difficult to develop. In the current study, we expanded our work on a MYC promoter G-quadruplex (G4) stabilizing DNA clamp to develop an oligonucleotide interfering DNA (DNAi) therapeutic. We explored six DNAi for G4-stabilization through EMSA, DMS footprinting, and thermal stability studies, focusing on the DNAi 5T as the lead therapeutic. 5T, but not its scramble control 5Tscr, was then shown to enter the nucleus, modulate cell viability, and decrease MYC expression through G4-stabilization. DNAi 5T is thus described to be our lead DNAi, targeting MYC regulation through stabilization of the higher-order DNA G4 structure in the proximal promoter, and it is poised for further preclinical development as an anticancer therapeutic.
5
Dharmaiah, Sharvari, Ahsan Farooqi, Christian Alvarez, Vladislav Sharin, David Irvin et Jason Huse. « CBIO-18. G-QUADRUPLEX STABILIZATION TARGETS ATRX-DEFICIENT HIGH-GRADE GLIOMA VIA INDUCTION OF p53-INDEPENDENT APOPTOSIS ». Neuro-Oncology 22, Supplement_2 (novembre 2020) : ii19. http://dx.doi.org/10.1093/neuonc/noaa215.078.
Texte intégralRésumé :
Abstract Gliomas are the most common primary malignant brain tumor in adults and mutational inactivation of histone chaperone ATRX is a critical molecular marker in the classification of high-grade glioma (HGG). ATRX loss occurs with concurrent mutations in TP53 and IDH1/2, altering genome-wide accessibility of chromatin and inducing replication stress and DNA damage via accumulations of abnormal G-quadruplex (G4) DNA secondary structures. While G4 stabilizers in particular hold strong therapeutic promise, the genomic consequences and efficacy of this treatment are poorly understood. We previously showed that chemical stabilization of G4s in ATRX-deficient normal human astrocytes (NHAs) results in lethality due to induction of replication stress, but it is unknown what drives this lethality in ATRX-deficient patient-derived preclinical models. We therefore sought to evaluate the mechanisms that underlie cell death in ATRX- and p53-deficient preclinical in vitro models following G4 stabilization. We found that ATRX-deficient glioma stem cells (GSCs) demonstrated dose-dependent enhanced sensitivity to G4 stabilization, compared to ATRX-intact controls. Evaluation of cell death mechanisms following G4 stabilization revealed a significant increase in cleaved caspase 3 expression and no p21 expression in ATRX-deficient GSCs, suggesting p53-independent apoptotic activation. Cell cycle flow analysis demonstrated G2/M checkpoint arrest in ATRX-deficient GSCs upon G4 stabilization, suggesting that p53 is nonfunctional at the G1/S checkpoint. Our preliminary findings now suggest that p73, a functional and structural homologue of p53, is activated and drives apoptosis in these ATRX-deficient GSCs. Furthermore, ATRX-deficient GSCs demonstrated upregulated expression of both pATR/pChk1 and pATM/pChk2, indicating enhanced replication stress and DNA damage via double-stranded breaks, respectively. These findings indicate that G4 stabilizers could potentially synergize with ionizing radiation, the current standard of care, as both therapies are DNA-damaging. Taken together, this study elucidates mechanisms of cytotoxicity and efficacy of a novel therapeutic strategy in ATRX-deficient preclinical models.
6
Ryazantsev, Dmitriy Y., Mikhail Yu Myshkin, Vera A. Alferova, Vladimir B. Tsvetkov, Elena Y. Shustova, Polina N. Kamzeeva, Polina V. Kovalets et al. « Probing GFP Chromophore Analogs as Anti-HIV Agents Targeting LTR-III G-Quadruplex ». Biomolecules 11, no 10 (26 septembre 2021) : 1409. http://dx.doi.org/10.3390/biom11101409.
Texte intégralRésumé :
Green fluorescent protein (GFP) chromophore and its congeners draw significant attention mostly for bioimaging purposes. In this work we probed these compounds as antiviral agents. We have chosen LTR-III DNA G4, the major G-quadruplex (G4) present in the long terminal repeat (LTR) promoter region of the human immunodeficiency virus-1 (HIV-1), as the target for primary screening and designing antiviral drug candidates. The stabilization of this G4 was previously shown to suppress viral gene expression and replication. FRET-based high-throughput screening (HTS) of 449 GFP chromophore-like compounds revealed a number of hits, sharing some general structural features. Structure-activity relationships (SAR) for the most effective stabilizers allowed us to establish structural fragments, important for G4 binding. Synthetic compounds, developed on the basis of SAR analysis, exhibited high LTR-III G4 stabilization level. NMR spectroscopy and molecular modeling revealed the possible formation of LTR-III G4-ligand complex with one of the lead selective derivative ZS260.1 positioned within the cavity, thus supporting the LTR-III G4 attractiveness for drug targeting. Selected compounds showed moderate activity against HIV-I (EC50 1.78–7.7 μM) in vitro, but the activity was accompanied by pronounced cytotoxicity.
7
Rocca, Roberta, Francesca Scionti, Matteo Nadai, Federica Moraca, Annalisa Maruca, Giosuè Costa, Raffaella Catalano et al. « Chromene Derivatives as Selective TERRA G-Quadruplex RNA Binders with Antiproliferative Properties ». Pharmaceuticals 15, no 5 (28 avril 2022) : 548. http://dx.doi.org/10.3390/ph15050548.
Texte intégralRésumé :
In mammalian cells, telomerase transcribes telomeres in large G-rich non-coding RNA, known as telomeric repeat-containing RNA (TERRA), which folds into noncanonical nucleic acid secondary structures called G-quadruplexes (G4s). Since TERRA G4 has been shown to be involved in telomere length and translation regulation, it could provide valuable insight into fundamental biological processes, such as cancer growth, and TERRA G4 binders could represent an innovative strategy for cancer treatment. In this work, the three best candidates identified in our previous virtual screening campaign on bimolecular DNA/RNA G4s were investigated on the monomolecular Tel DNA and TERRA G4s by means of molecular modelling simulations and in vitro and in cell analysis. The results obtained in this work highlighted the stabilizing power of all the three candidates on TERRA G4. In particular, the two compounds characterized by a chromene scaffold were selective TERRA G4 binders, while the compound with a naphthyridine core acted as a dual Tel/TERRA G4-binder. A biophysical investigation by circular dichroism confirmed the relative stabilization efficiency of the compounds towards TERRA and Tel G4s. The TERRA G4 stabilizing hits showed good antiproliferative activity against colorectal and lung adenocarcinoma cell lines. Lead optimization to increase TERRA G4 stabilization may provide new powerful tools against cancer.
8
Flusberg, Deborah A., Noreen F. Rizvi, Victoria Kutilek, Christine Andrews, Peter Saradjian, Chad Chamberlin, Patrick Curran et al. « Identification of G-Quadruplex-Binding Inhibitors of Myc Expression through Affinity Selection–Mass Spectrometry ». SLAS DISCOVERY : Advancing the Science of Drug Discovery 24, no 2 (11 septembre 2018) : 142–57. http://dx.doi.org/10.1177/2472555218796656.
Texte intégralRésumé :
The Myc oncogene is overexpressed in many cancers, yet targeting it for cancer therapy has remained elusive. One strategy for inhibition of Myc expression is through stabilization of the G-quadruplex (G4), a G-rich DNA secondary structure found within the Myc promoter; stabilization of G4s has been shown to halt transcription of downstream gene products. Here we used the Automated Ligand Identification System (ALIS), an affinity selection–mass spectrometry method, to identify compounds that bind to the Myc G4 out of a pool of compounds that had previously been shown to inhibit Myc expression in a reporter screen. Using an ALIS-based screen, we identified hits that bound to the Myc G4, a small subset of which bound preferentially relative to G4s from the promoters of five other genes. To determine functionality and specificity of the Myc G4-binding compounds in cell-based assays, we compared inhibition of Myc expression in cells with and without Myc G4 regulation. Several compounds inhibited Myc expression only in the Myc G4-containing line, and one compound was verified to function through Myc G4 binding. Our study demonstrates that ALIS can be used to identify selective nucleic acid-binding compounds from phenotypic screen hits, increasing the pool of drug targets beyond proteins.
9
Salerno, Silvia, Elisabetta Barresi, Emma Baglini, Valeria Poggetti, Sabrina Taliani et Federico Da Settimo. « Dual Targeting Topoisomerase/G-Quadruplex Agents in Cancer Therapy—An Overview ». Biomedicines 10, no 11 (15 novembre 2022) : 2932. http://dx.doi.org/10.3390/biomedicines10112932.
Texte intégralRésumé :
Topoisomerase (Topo) inhibitors have long been known as clinically effective drugs, while G-quadruplex (G4)-targeting compounds are emerging as a promising new strategy to target tumor cells and could support personalized treatment approaches in the near future. G-quadruplex (G4) is a secondary four-stranded DNA helical structure constituted of guanine-rich nucleic acids, and its stabilization impairs telomere replication, triggering the activation of several protein factors at telomere levels, including Topos. Thus, the pharmacological intervention through the simultaneous G4 stabilization and Topos inhibition offers a new opportunity to achieve greater antiproliferative activity and circumvent cellular insensitivity and resistance. In this line, dual ligands targeting both Topos and G4 emerge as innovative, efficient agents in cancer therapy. Although the research in this field is still limited, to date, some chemotypes have been identified, showing this dual activity and an interesting pharmacological profile. This paper reviews the available literature on dual Topo inhibitors/G4 stabilizing agents, with particular attention to the structure–activity relationship studies correlating the dual activity with the cytotoxic activity.
10
Davis, Edward T., Joseph Pagkalos et Branko Kopjar. « Polyethylene manufacturing characteristics have a major effect on the risk of revision surgery in cementless and hybrid total hip arthroplasties ». Bone & ; Joint Journal 102-B, no 1 (janvier 2020) : 90–101. http://dx.doi.org/10.1302/0301-620x.102b1.bjj-2019-0779.r1.
Texte intégralRésumé :
Aims The aim of this study was to identify the effect of the manufacturing characteristics of polyethylene acetabular liners on the survival of cementless and hybrid total hip arthroplasty (THA). Methods Prospective cohort study using linked National Joint Registry (NJR) and manufacturer data. The primary endpoint was revision for aseptic loosening. Cox proportional hazard regression was the primary analytical approach. Manufacturing variables included resin type, crosslinking radiation dose, terminal sterilization method, terminal sterilization radiation dose, stabilization treatment, total radiation dose, packaging, and face asymmetry. Total radiation dose was further divided into G1 (no radiation), G2 (> 0 Mrad to < 5 Mrad), G3 (≥ 5 Mrad to < 10 Mrad), and G4 (≥ 10 Mrad). Results A total of 5,329 THAs were revised, 1,290 of which were due to aseptic loosening. Total radiation dose, face asymmetry, and stabilization treatments were found to significantly affect implant survival. G1 had the highest revision risk for any reason and for aseptic loosening and G3 and G4 the lowest. Compared with G1, the adjusted hazard ratio for G2 was 0.74 (95% confidence interval (CI) 0.64 to 0.86), G3 was 0.36 (95% CI 0.30 to 0.43), and G4 was 0.38 (95% CI 0.31 to 0.47). The cumulative incidence of revision for aseptic loosening at 12 years was 0.52 and 0.54 per 100 THAs for G3 and G4, respectively, compared with 1.95 per 100 THAs in G1. Asymmetrical liners had a lower revision risk due to aseptic loosening and reasons other than aseptic loosening compared with symmetric (flat) liners. In G3 and G4, stabilization with vitamin E and heating above melting point performed best. Conclusion Polyethylene liners with a total radiation dose of ≥ 5 Mrad, an asymmetrical liner face, and stabilization with heating above the melting point demonstrate best survival. Cite this article: Bone Joint J 2020;102-B(1):90–101
11
Dharmaiah, Sharvari, Brandon Chen, Prit Benny Malgulwar, Vasudev Tadimeti, Ahsan Farooqi et Jason Huse. « DNAR-11. CHARACTERIZING THE GENOMIC CONSEQUENCES OF G-QUADRUPLEX STABILIZATION IN ATRX-DEFICIENT HIGH-GRADE GLIOMA ». Neuro-Oncology 24, Supplement_7 (1 novembre 2022) : vii92—vii93. http://dx.doi.org/10.1093/neuonc/noac209.343.
Texte intégralRésumé :
Abstract α-thalassaemia/mental retardation X-linked (ATRX) mutations are a critical molecular marker for high-grade glioma (HGG). These mutations lead to accumulations of abnormal DNA secondary G-quadruplex (G4) structures, thereby inducing replication stress and DNA damage. As G4s arise at GC-rich regions (i.e., pericentromeric and telomeric regions), ATRX-deficiency alters genome-wide accessibility of chromatin and causes transcriptional dysregulation. However, the genomic consequences of this in the context of ATRX-deficiency are poorly understood. Our goal is to target ATRX deficiency through G4 stabilizers, a class of novel small molecule compounds that selectively bind to and stabilize G4s. Using a combination of functional experiments such as cell viability, western blot, flow cytometry, RNA-sequencing (RNA-seq), and immunofluorescence (IF), we evaluated the mechanisms that drive selective lethality upon G4 stabilization. Patient-derived glioma stem cells (GSCs) were treated with either vehicle (DMSO) or varying doses of CX-5461 (G4 stabilizer, Senhwa Biosciences). Excitingly, ATRX-deficient GSCs demonstrate dose-dependent enhanced sensitivity to G4 stabilization, compared to ATRX-intact and vehicle controls. Cell viability assays confirmed the specificity of CX-5461 in comparison to other commercially used G4 stabilizers. G4 stabilization activated p53-independent apoptosis and exhibited G2/M arrest in ATRX-deficient GSCs and, interestingly, upregulated expression of both ATR and ATM pathways, indicating enhanced replication stress and DNA damage, respectively. IF staining confirmed enhanced induction of replication stress and DNA damage markers 53BP1 and gH2AX. Our preliminary findings suggest that ATR and ATM activation leads to Cyclin D1 degradation and inhibition of transcription factor NF-κB, thereby driving apoptosis. In fact, RNA-seq analyses revealed positive enrichment of apoptosis, DNA repair, and NF-κB pathways and negative enrichment of the G2/M checkpoint in ATRX-deficient GSCs treated with CX-5461. Our work defines mechanisms of action and efficacy of a novel therapeutic strategy for pre-clinical ATRX-deficient HGG models, with strong implications for other ATRX-deficient cancers and potential translation into clinical practice.
12
Psaras, Alexandra Maria, Simonas Valiuska, Véronique Noé, Carlos J. Ciudad et Tracy A. Brooks. « Targeting KRAS Regulation with PolyPurine Reverse Hoogsteen Oligonucleotides ». International Journal of Molecular Sciences 23, no 4 (14 février 2022) : 2097. http://dx.doi.org/10.3390/ijms23042097.
Texte intégralRésumé :
KRAS is a GTPase involved in the proliferation signaling of several growth factors. The KRAS gene is GC-rich, containing regions with known and putative G-quadruplex (G4) forming regions. Within the middle of the G-rich proximal promoter, stabilization of the physiologically active G4mid structure downregulates transcription of KRAS; the function and formation of other G4s within the gene are unknown. Herein we identify three putative G4-forming sequences (G4FS) within the KRAS gene, explore their G4 formation, and develop oligonucleotides targeting these three regions and the G4mid forming sequence. We tested Polypurine Reverse Hoogsteen hairpins (PPRHs) for their effects on KRAS regulation via enhancing G4 formation or displacing G-rich DNA strands, downregulating KRAS transcription and mediating an anti-proliferative effect. Five PPRH were designed, two against the KRAS promoter G4mid and three others against putative G4FS in the distal promoter, intron 1 and exon 5. PPRH binding was confirmed by gel electrophoresis. The effect on KRAS transcription was examined by luciferase, FRET Melt2, qRT-PCR. Cytotoxicity was evaluated in pancreatic and ovarian cancer cells. PPRHs decreased activity of a luciferase construct driven by the KRAS promoter. PPRH selectively suppressed proliferation in KRAS dependent cancer cells. PPRH demonstrated synergistic activity with a KRAS promoter selective G4-stabilizing compound, NSC 317605, in KRAS-dependent pancreatic cells. PPRHs selectively stabilize G4 formation within the KRAS mid promoter region and represent an innovative approach to both G4-stabilization and to KRAS modulation with potential for development into novel therapeutics.
13
Truong, Tuom T. T., Thu M. T. Dao, Trang P. T. Phan, Hoang D. Nguyen, Dung H. Nguyen et Dung Thanh Dang. « Inhibition of protein expression by the interaction of G-Quadruplex and RHAU peptide in E. coli ». Science and Technology Development Journal 22, no 4 (24 janvier 2020) : 378–84. http://dx.doi.org/10.32508/stdj.v22i4.1712.
Texte intégralRésumé :
Introduction: G-quadurplex (G4) formation plays a role in many biological processes such as replication, transcription, translation and telomeric maintenance. Stabilization of G4 structure by peptide has recently emerged as a potential approach in the regulation of protein expression. In this study, we reported on regulation of cyan fluorescent protein (CFP) expression by the interaction of G4 and RNA helicase associated with AU-rich elements (RHAU) peptide in E. coli.
Methods: A sequence of TTGGGTGGGTGGGTGGGT (formed into G4 structure) was genetically applied to cfp gene as a reporter gene (g4-cfp). Both g4-cfp and DHX36 (or ΔDHX36) genes were cloned to pET-Duet1 vector that allowed to simultaneously express both G4-CFP protein and RHAU (or ΔRHAU) protein under IPTG inducer.
Results: The level of G4-CFP expression in the presence of RHAU (pD64) was around 2-fold and 3-fold lower than that of G4-CFP expression in the presence of ΔRHAU (pD65) and G4-CFP expression alone (pD21), respectively.
Conclusion: RHAU might selectively bind G4 structure of mRNA of G4-CFP, resulting in inhibition of G4-CFP expression in E. coli. The G4 and RHAU peptide interaction would provide a promising approach for inhibition of gene expression in many biomedical applications.
14
Safdar, Muhammad Hassan, Hang Lin, Sarah Dagher, Jonathan Dickerhoff, Danzhou Yang et Michael K. Wendt. « Abstract 5005 : Targeted down regulation of FGFR1 through G-quadruplex stabilization in metastatic breast cancer ». Cancer Research 83, no 7_Supplement (4 avril 2023) : 5005. http://dx.doi.org/10.1158/1538-7445.am2023-5005.
Texte intégralRésumé :
Abstract Metastatic breast cancer (MBC) is the most advanced stage of breast cancer. Our understanding of the molecular mechanisms which drive MBC remain incomplete. Epithelial to mesenchymal transition (EMT) and mesenchymal to epithelial transition (MET) promote drug resistance and metastasis. It has been reported that fibroblast growth factor receptor 1 (FGFR1) plays a key role during the EMT:MET cycle. Furthermore, FGFR1 is amplified in 13% of primary and 20% of metastatic breast cancer patients. Therefore, optimizing inhibition of FGFR1 is crucial for the therapeutic targeting of the late stage breast cancer. First, we examined the efficacies of FGFR kinase inhibitors in the murine based dormant 4T07 tumor model. Inhibition of FGFR kinase activity leads to tumor growth inhibition but fail to eradicate dormant breast cancer cells. Therefore, we explored broader approaches to inhibit FGFR1 expression in addition to blockade of its kinase activity. G-quadruplex (G4) structures are secondary DNA structures commonly found upstream of transcriptional start sites (TSS) of oncogenes restricting their expression. Consequently, pharmacological stabilization of G4 structures within the promoters of cancer-related genes via use of small molecules has emerged as a promising therapeutic approach in cancer. Results herein demonstrate that the proximal promoter of FGFR1 contains sequences that form G4. Circular dichroism was used to verify formation of G4 in the FGFR1 proximal promoter. Importantly, use of the G4-binding compound CX-5461 stabilized the FGFR1 G4 structure, blocked the transcriptional activity of the FGFR1 proximal promoter and decreased FGFR1 expression. Therefore, we implemented the G4 stabilizers in FGFR1 expressing and metastatic drug-resistant cell lines. This approach results in dramatic downregulation of FGFR1 in the protein level after treatment with the G4 stabilizer. G4 stabilizing agents also interfere with constitutive FGFR1 and EMT-driven FGFR1 expression. Importantly, use of the G4-targeting compound CX5461 effectively blocked FGFR1 expression and inhibited FGFR1 downstream signaling, resulting in eradication of dormant breast cancer cells using a 3D culture model system. Finally, in vivo application of CX5461 reduced pulmonary tumor growth and prolonged animal survival in an FGFR1-driven model of metastasis. In conclusion, our evaluation of FGFR kinase inhibitors validates clinically observed resistance to this approach in MBC. Moreover, our findings suggest that G4 stabilization may be a potential therapeutic strategy for FGFR1 expressing MBC. Citation Format: Muhammad Hassan Safdar, Hang Lin, Sarah Dagher, Jonathan Dickerhoff, Danzhou Yang, Michael K. Wendt. Targeted down regulation of FGFR1 through G-quadruplex stabilization in metastatic breast cancer. [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2023; Part 1 (Regular and Invited Abstracts); 2023 Apr 14-19; Orlando, FL. Philadelphia (PA): AACR; Cancer Res 2023;83(7_Suppl):Abstract nr 5005.
15
Obi, Ikenna, Matilda Rentoft, Vandana Singh, Jan Jamroskovic, Karam Chand, Erik Chorell, Fredrik Westerlund et Nasim Sabouri. « Stabilization of G-quadruplex DNA structures in Schizosaccharomyces pombe causes single-strand DNA lesions and impedes DNA replication ». Nucleic Acids Research 48, no 19 (12 octobre 2020) : 10998–1015. http://dx.doi.org/10.1093/nar/gkaa820.
Texte intégralRésumé :
Abstract G-quadruplex (G4) structures are stable non-canonical DNA structures that are implicated in the regulation of many cellular pathways. We show here that the G4-stabilizing compound PhenDC3 causes growth defects in Schizosaccharomyces pombe cells, especially during S-phase in synchronized cultures. By visualizing individual DNA molecules, we observed shorter DNA fragments of newly replicated DNA in the PhenDC3-treated cells, suggesting that PhenDC3 impedes replication fork progression. Furthermore, a novel single DNA molecule damage assay revealed increased single-strand DNA lesions in the PhenDC3-treated cells. Moreover, chromatin immunoprecipitation showed enrichment of the leading-strand DNA polymerase at sites of predicted G4 structures, suggesting that these structures impede DNA replication. We tested a subset of these sites and showed that they form G4 structures, that they stall DNA synthesis in vitro and that they can be resolved by the breast cancer-associated Pif1 family helicases. Our results thus suggest that G4 structures occur in S. pombe and that stabilized/unresolved G4 structures are obstacles for the replication machinery. The increased levels of DNA damage might further highlight the association of the human Pif1 helicase with familial breast cancer and the onset of other human diseases connected to unresolved G4 structures.
16
Safdar, Muhammad, Hang Lin, Sarah Dagher, Jonathan Dickerhoff, Mitchell Ayers, Luis Solorio, Danzhou Yang, Michael Wendt et Saeed Akhand. « Abstract PO2-18-06 : Targeting fibroblast growth factor receptor (FGFR1) expression through G-quadruplex stabilization inhibits metastatic breast cancer ». Cancer Research 84, no 9_Supplement (2 mai 2024) : PO2–18–06—PO2–18–06. http://dx.doi.org/10.1158/1538-7445.sabcs23-po2-18-06.
Texte intégralRésumé :
Abstract Metastatic breast cancer (MBC) is the most advanced stage of breast cancer. Our understanding of the molecular mechanisms which drive MBC remain incomplete. Epithelial to mesenchymal transition (EMT) and mesenchymal to epithelial transition (MET) promote drug resistance and metastasis. It has been reported that fibroblast growth factor receptor 1 (FGFR1) plays a key role during the EMT:MET cycle. Furthermore, FGFR1 is amplified in 13% of primary and 20% of metastatic breast cancer patients. Therefore, optimizing inhibition of FGFR1 is crucial for the therapeutic targeting of the late stage breast cancer. First, we examined the efficacies of FGFR kinase inhibitors in the murine based dormant 4T07 tumor model. Inhibition of FGFR kinase activity leads to tumor growth inhibition but fail to eradicate dormant breast cancer cells. Therefore, we explored broader approaches to inhibit FGFR1 expression in addition to blockade of its kinase activity. G-quadruplex (G4) structures are secondary DNA structures commonly found upstream of transcriptional start sites (TSS) of oncogenes restricting their expression. Consequently, pharmacological stabilization of G4 structures within the promoters of cancer-related genes via use of small molecules has emerged as a promising therapeutic approach in cancer. Results herein demonstrate that the proximal promoter of FGFR1 contains sequences that form G4. Circular dichroism was used to verify formation of G4 in the FGFR1 proximal promoter. Importantly, use of the G4-binding compound CX-5461 stabilized the FGFR1 G4 structure, blocked the transcriptional activity of the FGFR1 proximal promoter and decreased FGFR1 expression. Therefore, we implemented the G4 stabilizers in FGFR1 expressing and metastatic drug-resistant BC cell lines. This approach results in dramatic downregulation of FGFR1 at the protein level after treatment with the G4 stabilizer. G4 stabilizing agents also interfere with ectopic FGFR1 expression and EMT-driven FGFR1 expression. Importantly, use of the G4-targeting compound CX5461 effectively blocked FGFR1 expression and inhibited FGFR1 downstream signaling, resulting in eradication of dormant breast cancer cells. Finally, in vivo application of CX5461 reduced FGFR1 expression, blocked pulmonary tumor formation and prolonged animal survival. In conclusion, consistent with the clinical observations our evaluation of FGFR kinase inhibitors validates the resistance to FGFR kinase inhibitors in MBC. Our findings indicate that targeting FGFR1 expression through G4 stabilization may be a potential strategy for MBC. Citation Format: Muhammad Safdar, Hang Lin, Sarah Dagher, Jonathan Dickerhoff, Mitchell Ayers, Luis Solorio, Danzhou Yang, Michael Wendt, Saeed Akhand. Targeting fibroblast growth factor receptor (FGFR1) expression through G-quadruplex stabilization inhibits metastatic breast cancer [abstract]. In: Proceedings of the 2023 San Antonio Breast Cancer Symposium; 2023 Dec 5-9; San Antonio, TX. Philadelphia (PA): AACR; Cancer Res 2024;84(9 Suppl):Abstract nr PO2-18-06.
17
Wang, Shao-Ru, Yuan-Qin Min, Jia-Qi Wang, Chao-Xing Liu, Bo-Shi Fu, Fan Wu, Ling-Yu Wu et al. « A highly conserved G-rich consensus sequence in hepatitis C virus core gene represents a new anti–hepatitis C target ». Science Advances 2, no 4 (avril 2016) : e1501535. http://dx.doi.org/10.1126/sciadv.1501535.
Texte intégralRésumé :
G-quadruplex (G4) is one of the most important secondary structures in nucleic acids. Until recently, G4 RNAs have not been reported in any ribovirus, such as the hepatitis C virus. Our bioinformatics analysis reveals highly conserved guanine-rich consensus sequences within the core gene of hepatitis C despite the high genetic variability of this ribovirus; we further show using various methods that such consensus sequences can fold into unimolecular G4 RNA structures, both in vitro and under physiological conditions. Furthermore, we provide direct evidences that small molecules specifically targeting G4 can stabilize this structure to reduce RNA replication and inhibit protein translation of intracellular hepatitis C. Ultimately, the stabilization of G4 RNA in the genome of hepatitis C represents a promising new strategy for anti–hepatitis C drug development.
18
Amato, Roberta, Martina Valenzuela, Francesco Berardinelli, Erica Salvati, Carmen Maresca, Stefano Leone, Antonio Antoccia et Antonella Sgura. « G-quadruplex Stabilization Fuels the ALT Pathway in ALT-positive Osteosarcoma Cells ». Genes 11, no 3 (13 mars 2020) : 304. http://dx.doi.org/10.3390/genes11030304.
Texte intégralRésumé :
Most human tumors maintain telomere lengths by telomerase, whereas a portion of them (10–15%) uses a mechanism named alternative lengthening of telomeres (ALT). The telomeric G-quadruplex (G4) ligand RHPS4 is known for its potent antiproliferative effect, as shown in telomerase-positive cancer models. Moreover, RHPS4 is also able to reduce cell proliferation in ALT cells, although the influence of G4 stabilization on the ALT mechanism has so far been poorly investigated. Here we show that sensitivity to RHPS4 is comparable in ALT-positive (U2OS; SAOS-2) and telomerase-positive (HOS) osteosarcoma cell lines, unlinking the telomere maintenance mechanism and RHPS4 responsiveness. To investigate the impact of G4 stabilization on ALT, the cardinal ALT hallmarks were analyzed. A significant induction of telomeric doublets, telomeric clusterized DNA damage, ALT-associated Promyelocytic Leukaemia-bodies (APBs), telomere sister chromatid exchanges (T-SCE) and c-circles was found exclusively in RHPS4-treated ALT cells. We surmise that RHPS4 affects ALT mechanisms through the induction of replicative stress that in turn is converted in DNA damage at telomeres, fueling recombination. In conclusion, our work indicates that RHPS4-induced telomeric DNA damage promotes overactivation of telomeric recombination in ALT cells, opening new questions on the therapeutic employment of G4 ligands in the treatment of ALT positive tumors.
19
Roychoudhury, Shrabasti, Suravi Pramanik, Hannah L. Harris, Mason Tarpley, Aniruddha Sarkar, Gaelle Spagnol, Paul L. Sorgen et al. « Endogenous oxidized DNA bases and APE1 regulate the formation of G-quadruplex structures in the genome ». Proceedings of the National Academy of Sciences 117, no 21 (13 mai 2020) : 11409–20. http://dx.doi.org/10.1073/pnas.1912355117.
Texte intégralRésumé :
Formation of G-quadruplex (G4) DNA structures in key regulatory regions in the genome has emerged as a secondary structure-based epigenetic mechanism for regulating multiple biological processes including transcription, replication, and telomere maintenance. G4 formation (folding), stabilization, and unfolding must be regulated to coordinate G4-mediated biological functions; however, how cells regulate the spatiotemporal formation of G4 structures in the genome is largely unknown. Here, we demonstrate that endogenous oxidized guanine bases in G4 sequences and the subsequent activation of the base excision repair (BER) pathway drive the spatiotemporal formation of G4 structures in the genome. Genome-wide mapping of occurrence of Apurinic/apyrimidinic (AP) site damage, binding of BER proteins, and G4 structures revealed that oxidized base-derived AP site damage and binding of OGG1 and APE1 are predominant in G4 sequences. Loss of APE1 abrogated G4 structure formation in cells, which suggests an essential role of APE1 in regulating the formation of G4 structures in the genome. Binding of APE1 to G4 sequences promotes G4 folding, and acetylation of APE1, which enhances its residence time, stabilizes G4 structures in cells. APE1 subsequently facilitates transcription factor loading to the promoter, providing mechanistic insight into the role of APE1 in G4-mediated gene expression. Our study unravels a role of endogenous oxidized DNA bases and APE1 in controlling the formation of higher-order DNA secondary structures to regulate transcription beyond its well-established role in safeguarding the genomic integrity.
20
Napolitano, Fabiana, Sarah Di Somma, Giuliano Castellano, Jussara Amato, Bruno Pagano, Antonio Randazzo, Giuseppe Portella et Anna Maria Malfitano. « Combination of dl922-947 Oncolytic Adenovirus and G-Quadruplex Binders Uncovers Improved Antitumor Activity in Breast Cancer ». Cells 11, no 16 (10 août 2022) : 2482. http://dx.doi.org/10.3390/cells11162482.
Texte intégralRésumé :
G-quadruplexes (G4s) are nucleic secondary structures characterized by G-tetrads. G4 motif stabilization induces DNA damage and cancer cell death; therefore, G4-targeting small molecules are the focus of clinical investigation. DNA destabilization induced by G4 ligands might potentiate the anticancer activity of agents targeting DNA or inhibiting its repair such as oncolytic viruses. This study represents the first approach combining G4 ligands, BRACO-19 (B19), pyridostatin (PDS), and the adenovirus dl922-947 in breast cancer cells. We demonstrated that G4 binders and dl922-947 induce cytotoxicity in breast cancer cells (MDA-MB-231 and MCF-7) and at higher doses in other neoplastic cell lines of thyroid (BHT-101 cells) and prostate (PC3 cells). G4 binders induce G4 motifs distributed in the S and G2/M phases in MCF-7 cells. G4 binder/dl922-947 combination increases cell cytotoxicity and the accumulation in subG0/G1. Indeed, G4 binders favor viral entry and replication with no effect on coxsackie and adenovirus receptor. Notably, dl922-947 induces G4 motifs and its combination with PDS potentiates this effect in MCF-7 cells. The agents alone or in combination similarly enhanced cell senescence. Additionally, PDS/dl922-947 combination inactivates STING signaling in MDA-MB-231 cells. Our results suggest that G4 binder/virotherapy combination may represent a novel therapeutic anticancer approach.
21
Chashchina, Galina V., Liana L. Tevonyan, Artemy D. Beniaminov et Dmitry N. Kaluzhny. « Taq-Polymerase Stop Assay to Determine Target Selectivity of G4 Ligands in Native Promoter Sequences of MYC, TERT, and KIT Oncogenes ». Pharmaceuticals 16, no 4 (5 avril 2023) : 544. http://dx.doi.org/10.3390/ph16040544.
Texte intégralRésumé :
Computational and high-throughput experimental methods predict thousands of potential quadruplex sequences (PQSs) in the human genome. Often these PQSs contain more than four G-runs, which introduce additional uncertainty into the conformational polymorphism of the G4 DNA. G4-specific ligands, which are currently being actively developed as potential anticancer agents or tools for studying G4 structures in genomes, may preferentially bind to specific G4 structures over the others that can be potentially formed in the extended G-rich genomic region. We propose a simple technique that identifies the sequences that tend to form G4 in the presence of potassium ions or a specific ligand. Thermostable DNA Taq-polymerase stop assay can detect the preferential position of the G4 –ligand binging within a long PQS-rich genomic DNA fragment. This technique was tested for four G4 binders PDS, PhenDC3, Braco-19, and TMPyP4 at three promoter sequences of MYC, KIT, and TERT that contain several PQSs each. We demonstrate that the intensity of polymerase pausing reveals the preferential binding of a ligand to particular G4 structures within the promoter. However, the strength of the polymerase stop at a specific site does not always correlate with the ligand-induced thermodynamic stabilization of the corresponding G4 structure.
22
Caporaletti, Francesca, Jenifer Rubio-Magnieto, Mamadou Lo, Jean-François Longevial, Clémence Rose, Sébastien Clément, Arie van der Lee, Mathieu Surin et Sébastien Richeter. « Design of metalloporphyrins fused to imidazolium rings for binding DNA G-quadruplexes ». Journal of Porphyrins and Phthalocyanines 24, no 01n03 (janvier 2020) : 340–49. http://dx.doi.org/10.1142/s1088424619501128.
Texte intégralRésumé :
Synthesis and characterization of nickel(II) meso-tetraarylporphyrins fused to imidazolium rings across [Formula: see text],[Formula: see text]-pyrrolic positions and X-ray structure of the porphyrin where two opposed pyrrole units are fused to an imidazolium ring are presented. The interactions between these mono-, bis-, tris- and tetrakis(imidazolium) porphyrins with human telomeric DNA G-quadruplexes (G4) were investigated using UV-vis absorption spectroscopy, Circular Dichroism (CD) spectroscopy and Fluorescence Resonance Energy Transfer (FRET) melting assay. Possible binding modes between cationic porphyrins and a selected G4 sequence (d[AG3(T2AG[Formula: see text]]), and relative stabilities of porphyrin/G4 complexes are discussed. Excepting porphyrins fused to one imidazolium ring, the other derivatives interact with G4 structures and their stabilization strongly depends on the porphyrin structure (number and localization of the imidazolium rings).
23
Bhat-Ambure, Jyotsna, Pravin Ambure, Eva Serrano-Candelas, Cristina Galiana-Roselló, Ariadna Gil-Martínez, Mario Guerrero, Margarita Martin, Jorge González-García, Enrique García-España et Rafael Gozalbes. « G4-QuadScreen : A Computational Tool for Identifying Multi-Target-Directed Anticancer Leads against G-Quadruplex DNA ». Cancers 15, no 15 (27 juillet 2023) : 3817. http://dx.doi.org/10.3390/cancers15153817.
Texte intégralRésumé :
The study presents ‘G4-QuadScreen’, a user-friendly computational tool for identifying MTDLs against G4s. Also, it offers a few hit MTDLs based on in silico and in vitro approaches. Multi-tasking QSAR models were developed using linear discriminant analysis and random forest machine learning techniques for predicting the responses of interest (G4 interaction, G4 stabilization, G4 selectivity, and cytotoxicity) considering the variations in the experimental conditions (e.g., G4 sequences, endpoints, cell lines, buffers, and assays). A virtual screening with G4-QuadScreen and molecular docking using YASARA (AutoDock-Vina) was performed. G4 activities were confirmed via FRET melting, FID, and cell viability assays. Validation metrics demonstrated the high discriminatory power and robustness of the models (the accuracy of all models is ~>90% for the training sets and ~>80% for the external sets). The experimental evaluations showed that ten screened MTDLs have the capacity to selectively stabilize multiple G4s. Three screened MTDLs induced a strong inhibitory effect on various human cancer cell lines. This pioneering computational study serves a tool to accelerate the search for new leads against G4s, reducing false positive outcomes in the early stages of drug discovery. The G4-QuadScreen tool is accessible on the ChemoPredictionSuite website.
24
Das, Rabindra Nath, Måns Andréasson, Rajendra Kumar et Erik Chorell. « Macrocyclization of bis-indole quinolines for selective stabilization of G-quadruplex DNA structures ». Chemical Science 11, no 38 (2020) : 10529–37. http://dx.doi.org/10.1039/d0sc03519j.
Texte intégral
25
Pirota, Valentina, Enrico Lunghi, Alessandra Benassi, Emmanuele Crespan, Mauro Freccero et Filippo Doria. « Selective Binding and Redox-Activity on Parallel G-Quadruplexes by Pegylated Naphthalene Diimide-Copper Complexes ». Molecules 26, no 16 (19 août 2021) : 5025. http://dx.doi.org/10.3390/molecules26165025.
Texte intégralRésumé :
G-quadruplexes (G4s) are higher-order supramolecular structures, biologically important in the regulation of many key processes. Among all, the recent discoveries relating to RNA-G4s, including their potential involvement as antiviral targets against COVID-19, have triggered the ever-increasing need to develop selective molecules able to interact with parallel G4s. Naphthalene diimides (NDIs) are widely exploited as G4 ligands, being able to induce and strongly stabilize these structures. Sometimes, a reversible NDI-G4 interaction is also associated with an irreversible one, due to the cleavage and/or modification of G4s by functional-NDIs. This is the case of NDI-Cu-DETA, a copper(II) complex able to cleave G4s in the closest proximity to the target binding site. Herein, we present two original Cu(II)-NDI complexes, inspired by NDI-Cu-DETA, differently functionalized with 2-(2-aminoethoxy)ethanol side-chains, to selectively drive redox-catalyzed activity towards parallel G4s. The selective interaction toward parallel G4 topology, controlled by the presence of 2-(2-aminoethoxy)ethanol side chains, was already firmly demonstrated by us using core-extended NDIs. In the present study, the presence of protonable moieties and the copper(II) cavity, increases the binding affinity and specificity of these two NDIs for a telomeric RNA-G4. Once defined the copper coordination relationship and binding constants by competition titrations, ability in G4 stabilization, and ROS-induced cleavage were analyzed. The propensity in the stabilization of parallel topology was highlighted for both of the new compounds HP2Cu and PE2Cu. The results obtained are particularly promising, paving the way for the development of new selective functional ligands for binding and destructuring parallel G4s.
26
Tassinari, Martina, Alberto Lena, Elena Butovskaya, Valentina Pirota, Matteo Nadai, Mauro Freccero, Filippo Doria et Sara Richter. « A Fragment-Based Approach for the Development of G-Quadruplex Ligands : Role of the Amidoxime Moiety ». Molecules 23, no 8 (27 juillet 2018) : 1874. http://dx.doi.org/10.3390/molecules23081874.
Texte intégralRésumé :
G-quadruplex (G4) nucleic acid structures have been reported to be involved in several human pathologies, including cancer, neurodegenerative disorders and infectious diseases; however, G4 targeting compounds still need implementation in terms of drug-like properties and selectivity in order to reach the clinical use. So far, G4 ligands have been mainly identified through high-throughput screening methods or design of molecules with pre-set features. Here, we describe the development of new heterocyclic ligands through a fragment-based drug discovery (FBDD) approach. The ligands were designed against the major G4 present in the long terminal repeat (LTR) promoter region of the human immunodeficiency virus-1 (HIV-1), the stabilization of which has been shown to suppress viral gene expression and replication. Our method is based on the generation of molecular fragment small libraries, screened against the target to further elaborate them into lead compounds. We screened 150 small molecules, composed by structurally and chemically different fragments, selected from commercially available and in-house compounds; synthetic elaboration yielded several G4 ligands and two final G4 binders, both embedding an amidoxime moiety; one of these two compounds showed preferential binding for the HIV-1 LTR G4. This work presents the discovery of a novel potential pharmacophore and highlights the possibility to apply a fragment-based approach to develop G4 ligands with unexpected chemical features.
27
Psaras, Alexandra Maria, Simonas Valiuska, Veronique Noe, Carlos J. Ciudad et Tracy A. Brooks. « Abstract 675 : Facilitating G-quadruplex formation in the KRAS promoter with polypurine reverse Hoogsteen oligonucleotides ». Cancer Research 82, no 12_Supplement (15 juin 2022) : 675. http://dx.doi.org/10.1158/1538-7445.am2022-675.
Texte intégralRésumé :
Abstract KRAS is a GTPase involved in the proliferation signaling of a number of growth factors, such as epidermal growth factor. The protein is mutated or upregulated in an array of cancers, including pancreatic and ovarian cancers, where it correlates with more aggressive and chemoresistant disease. Within the promoter of KRAS lies a G-rich region capable of forming the higher order non-canonical DNA structure, the G-quadruplex (G4). Stabilization of G4 formation in the mid-region of the KRAS promoter downregulates transcription and facilitates decreased growth and chemo-sensitization of pancreatic and ovarian cancer cells with aberrant KRAS signaling. Our collaborative team designed Polypurine Reverse Hoogsteen (PPRH) hairpin oligonucleotides that establish Watson Crick bonds with the pyrimidine strand within the KRAS-mid-G4-forming region to enhance G4 formation, downregulate KRAS transcription and mediate an anti-proliferative effect. In particular, two PPRHs were designed to interact with the 3’ and 5’ ends of the G4-forming region, along with two correlating W:C, and one scramble, controls. The binding of these oligonucleotides to the G4-forming region was verified by gel electrophoresis, and the cell activity was examined in vitro both by luciferase and in pancreatic and ovarian cancer cells. Using a luciferase construct driven by the KRAS promoter, only the PPRHs, and none of the control oligonucleotides, significantly decreased activity. Cytotoxicity experiments in KRAS dependent and independent cell lines demonstrated that PPRHs, but not control oligonucleotides, selectively suppressed proliferation only in the dependent pancreatic and ovarian cancer cell lines. Correlation of the cytotoxic effects of these potential therapeutic PPRHs with transcriptional downregulation is under investigation. PPRH also demonstrated synergistic activity with a KRAS promoter selective G4-stabilizing compound in KRAS-dependent pancreatic cells, and sensitization to standard chemotherapeutic regimens is also being studied. These designed PPRH oligonucleotides selectively stabilize G4 formation within the KRAS mid promoter region, and represent an innovative approach both for G4-stabilization and KRAS modulation with potential for development into novel therapeutics. Citation Format: Alexandra Maria Psaras, Simonas Valiuska, Veronique Noe, Carlos J. Ciudad, Tracy A. Brooks. Facilitating G-quadruplex formation in the KRAS promoter with polypurine reverse Hoogsteen oligonucleotides [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2022; 2022 Apr 8-13. Philadelphia (PA): AACR; Cancer Res 2022;82(12_Suppl):Abstract nr 675.
28
Wickhorst, Peter Jonas, et Heiko Ihmels. « Berberrubine Phosphate : A Selective Fluorescent Probe for Quadruplex DNA ». Molecules 26, no 9 (28 avril 2021) : 2566. http://dx.doi.org/10.3390/molecules26092566.
Texte intégralRésumé :
A phosphate-substituted, zwitterionic berberine derivative was synthesized and its binding properties with duplex DNA and G4-DNA were studied using photometric, fluorimetric and polarimetric titrations and thermal DNA denaturation experiments. The ligand binds with high affinity toward both DNA forms (Kb = 2–7 × 105 M−1) and induces a slight stabilization of G4-DNA toward thermally induced unfolding, mostly pronounced for the telomeric quadruplex 22AG. The ligand likely binds by aggregation and intercalation with ct DNA and by terminal stacking with G4-DNA. Thus, this compound represents one of the rare examples of phosphate-substituted DNA binders. In an aqueous solution, the title compound has a very weak fluorescence intensity (Φfl < 0.01) that increases significantly upon binding to G4-DNA (Φfl = 0.01). In contrast, the association with duplex DNA was not accompanied by such a strong fluorescence light-up effect (Φfl < 0.01). These different fluorimetric responses upon binding to particular DNA forms are proposed to be caused by the different binding modes and may be used for the selective fluorimetric detection of G4-DNA.
29
Moura, Nuno M. M., Sofia Guedes, Diana Salvador, Helena Oliveira, M. Graça P. M. S. Neves et Catarina I. V. Ramos. « Is Silver a Precious Metal for G-Quadruplex Stabilization Mediated by Porphyrins ? » International Journal of Molecular Sciences 25, no 24 (18 décembre 2024) : 13556. https://doi.org/10.3390/ijms252413556.
Texte intégralRésumé :
Cancer is a leading cause of death, so continuous efforts into cancer therapy are imperative. In tumor cells, telomerase and oncogene activity are key points for uncontrolled cell growth. Targeting these processes with ligands that inhibit telomerase and/or reduce oncogene expression has been identified as a promising cancer therapy. This study evaluated the selectivity and affinity of the silverII complex of 5,10,15,20-tetrakis(N-methyl-4-pyridinium)porphyrin (AgTMPyP) to stabilize DNA sequences capable of forming G4 structures mimicking the telomeric and oncogene regions, using spectroscopic, biochemical methods and in vitro assays. The tetracationic silver complex was compared with the free base, H2TMPyP, and the zincII complex, ZnTMPyP. The results obtained from UV-Vis and fluorescence methods pointed to a great affinity and good selectivity of AgTMPyP to G4 structures, especially for the oncogene MYC. In general, an increase in the ability of the studied ligands for 1O2 generation when interacting with oncogenic and telomeric G4 sequences was found. The results of the PCR stop assays proved that AgTMPyP has the ability to inhibit Taq polymerase. Additionally, in vitro assays demonstrated that the silverII complex exhibits low cytotoxicity against HaCaT— an immortalized, non-tumorigenic, skin keratinocytes cell line—and, although nonexclusive, AgTMPyP shows nuclear co-localization.
30
Takahashi, Shuntaro, Sudipta Bhowmik, Shinobu Sato, Shigeori Takenaka et Naoki Sugimoto. « Replication Control of Human Telomere G-Quadruplex DNA by G-Quadruplex Ligands Dependent on Solution Environment ». Life 12, no 4 (7 avril 2022) : 553. http://dx.doi.org/10.3390/life12040553.
Texte intégralRésumé :
The human telomere region is known to contain guanine-rich repeats and form a guanine-quadruplex (G4) structure. As telomeres play a role in the regulation of cancer progression, ligands that specifically bind and stabilize G4 have potential therapeutic applications. However, as the human telomere sequence can form G4 with various topologies due to direct interaction by ligands and indirect interaction by the solution environment, it is of great interest to study the topology-dependent control of replication by ligands. In the present study, a DNA replication assay of a template with a human telomere G4 sequence in the presence of various ligands was performed. Cyclic naphthalene diimides (cNDI1 and cNDI2) efficiently increased the replication stall of the template DNA at G4 with an anti-parallel topology. This inhibition was stability-dependent and topology-selective, as the replication of templates with hybrid or parallel G4 structures was not affected by the cNDI and cNDI2. Moreover, the G4 ligand fisetin repressed replication with selectivity for anti-parallel and hybrid G4 structures without stabilization. Finally, the method used, referred to as quantitative study of topology-dependent replication (QSTR), was adopted to evaluate the correlation between the replication kinetics and the stability of G4. Compared to previous results obtained using a modified human telomere sequence, the relationship between the stability of G4 and the effect on the topology-dependent replication varied. Our results suggest that native human telomere G4 is more flexible than the modified sequence for interacting with ligands. These findings indicate that the modification of the human telomeric sequence forces G4 to rigidly form a specific structure of G4, which can restrict the change in topology-dependent replication by some ligands.
31
Kaur, Sarvpreet, Nikita Kundu, Taniya Sharma, J. Shankaraswamy, Sweta Singh et Sarika Saxena. « Structural analysis of peptide identified from the 2KRR domain of the nucleolin protein with a c-Myc G4 structure using biophysical and biochemical methods ». RSC Advances 14, no 32 (2024) : 22801–8. http://dx.doi.org/10.1039/d4ra02785j.
Texte intégralRésumé :
The stabilization of c-Myc G4 structure is reported by binding of the peptide (derived from the 2KRR domain of the nucleolin protein called the Nu peptide) in the loop region of the G-quadruplex structure by stacking interactions.
32
Libera, Valeria, Francesca Ripanti, Caterina Petrillo, Francesco Sacchetti, Javier Ramos-Soriano, Maria Carmen Galan, Giorgio Schirò, Alessandro Paciaroni et Lucia Comez. « Stability of Human Telomeric G-Quadruplexes Complexed with Photosensitive Ligands and Irradiated with Visible Light ». International Journal of Molecular Sciences 24, no 10 (22 mai 2023) : 9090. http://dx.doi.org/10.3390/ijms24109090.
Texte intégralRésumé :
Guanine-rich DNA sequences can fold into non-canonical nucleic acid structures called G-quadruplexes (G4s). These nanostructures have strong implications in many fields, from medical science to bottom-up nanotechnologies. As a result, ligands interacting with G4s have attracted great attention as candidates in medical therapies, molecular probe applications, and biosensing. In recent years, the use of G4-ligand complexes as photopharmacological targets has shown significant promise for developing novel therapeutic strategies and nanodevices. Here, we studied the possibility of manipulating the secondary structure of a human telomeric G4 sequence through the interaction with two photosensitive ligands, DTE and TMPyP4, whose response to visible light is different. The effect of these two ligands on G4 thermal unfolding was also considered, revealing the occurrence of peculiar multi-step melting pathways and the different attitudes of the two molecules on the quadruplex stabilization.
33
Dey, Arpita, Kushi Anand, Amit Singh, Ramasare Prasad et Ritu Barthwal. « MOSR and NDHA Genes Comprising G-Quadruplex as Promising Therapeutic Targets against Mycobacterium tuberculosis : Molecular Recognition by Mitoxantrone Suppresses Replication and Gene Regulation ». Genes 14, no 5 (26 avril 2023) : 978. http://dx.doi.org/10.3390/genes14050978.
Texte intégralRésumé :
Occurrence of non-canonical G-quadruplex (G4) DNA structures in the genome have been recognized as key factors in gene regulation and several other cellular processes. The mosR and ndhA genes involved in pathways of oxidation sensing regulation and ATP generation, respectively, make Mycobacterium tuberculosis (Mtb) bacteria responsible for oxidative stress inside host macrophage cells. Circular Dichroism spectra demonstrate stable hybrid G4 DNA conformations of mosR/ndhA DNA sequences. Real-time binding of mitoxantrone to G4 DNA with an affinity constant ~105–107 M−1, leads to hypochromism with a red shift of ~18 nm, followed by hyperchromism in the absorption spectra. The corresponding fluorescence is quenched with a red shift ~15 nm followed by an increase in intensity. A change in conformation of the G4 DNA accompanies the formation of multiple stoichiometric complexes with a dual binding mode. The external binding of mitoxantrone with a partial stacking with G-quartets and/or groove binding induces significant thermal stabilization, ~20–29 °C in ndhA/mosR G4 DNA. The interaction leads to a two/four-fold downregulation of transcriptomes of mosR/ndhA genes apart from the suppression of DNA replication by Taq polymerase enzyme, establishing the role of mitoxantrone in targeting G4 DNA, as an alternate strategy for effective anti-tuberculosis action in view of deadly multi-drug resistant tuberculosis disease causing bacterial strains t that arise from existing therapeutic treatments.
34
Tokan, Viktor, Jose Luis Rodriguez Rodriguez Lorenzo, Pavel Jedlicka, Iva Kejnovska, Roman Hobza et Eduard Kejnovsky. « Quadruplex-Forming Motif Inserted into 3′UTR of Ty1his3-AI Retrotransposon Inhibits Retrotransposition in Yeast ». Biology 10, no 4 (20 avril 2021) : 347. http://dx.doi.org/10.3390/biology10040347.
Texte intégralRésumé :
Guanine quadruplexes (G4s) serve as regulators of replication, recombination and gene expression. G4 motifs have been recently identified in LTR retrotransposons, but their role in the retrotransposon life-cycle is yet to be understood. Therefore, we inserted G4s into the 3′UTR of Ty1his3-AI retrotransposon and measured the frequency of retrotransposition in yeast strains BY4741, Y00509 (without Pif1 helicase) and with G4-stabilization by N-methyl mesoporphyrin IX (NMM) treatment. We evaluated the impact of G4s on mRNA levels by RT-qPCR and products of reverse transcription by Southern blot analysis. We found that the presence of G4 inhibited Ty1his3-AI retrotransposition. The effect was stronger when G4s were on a transcription template strand which leads to reverse transcription interruption. Both NMM and Pif1p deficiency reduced the retrotransposition irrespective of the presence of a G4 motif in the Ty1his3-AI element. Quantity of mRNA and products of reverse transcription did not fully explain the impact of G4s on Ty1his3-AI retrotransposition indicating that G4s probably affect some other steps of the retrotransposon life-cycle (e.g., translation, VLP formation, integration). Our results suggest that G4 DNA conformation can tune the activity of mobile genetic elements that in turn contribute to shaping the eukaryotic genomes.
35
Valiuska, Simonas, Alexandra Maria Psaras, Véronique Noé, Tracy A. Brooks et Carlos J. Ciudad. « Targeting MYC Regulation with Polypurine Reverse Hoogsteen Oligonucleotides ». International Journal of Molecular Sciences 24, no 1 (26 décembre 2022) : 378. http://dx.doi.org/10.3390/ijms24010378.
Texte intégralRésumé :
The oncogene MYC has key roles in transcription, proliferation, deregulating cellular energetics, and more. Modulating the expression or function of the MYC protein is a viable therapeutic goal in an array of cancer types, and potential inhibitors of MYC with high specificity and selectivity are of great interest. In cancer cells addicted to their aberrant MYC function, suppression can lead to apoptosis, with minimal effects on non-addicted, non-oncogenic cells, providing a wide therapeutic window for specific and efficacious anti-tumor treatment. Within the promoter of MYC lies a GC-rich, G-quadruplex (G4)-forming region, wherein G4 formation is capable of mediating transcriptional downregulation of MYC. Such GC-rich regions of DNA are prime targets for regulation with Polypurine Reverse Hoogsteen hairpins (PPRHs). The current study designed and examined PPRHs targeting the G4-forming and four other GC-rich regions of DNA within the promoter or intronic regions. Six total PPRHs were designed, examined in cell-free conditions for target engagement and in cells for transcriptional modulation, and correlating cytotoxic activity in pancreatic, prostate, neuroblastoma, colorectal, ovarian, and breast cancer cells. Two lead PPRHs, one targeting the promoter G4 and one targeting Intron 1, were identified with high potential for further development as an innovative approach to both G4 stabilization and MYC modulation.
36
Ajoge, Hannah O., Hinissan P. Kohio, Ermela Paparisto, Macon D. Coleman, Kemen Wong, Sean K. Tom, Katie L. Bain, Charles C. Berry, Eric J. Arts et Stephen D. Barr. « G-Quadruplex DNA and Other Non-Canonical B-Form DNA Motifs Influence Productive and Latent HIV-1 Integration and Reactivation Potential ». Viruses 14, no 11 (11 novembre 2022) : 2494. http://dx.doi.org/10.3390/v14112494.
Texte intégralRésumé :
The integration of the HIV-1 genome into the host genome is an essential step in the life cycle of the virus and it plays a critical role in the expression, long-term persistence, and reactivation of HIV expression. To better understand the local genomic environment surrounding HIV-1 proviruses, we assessed the influence of non-canonical B-form DNA (non-B DNA) on the HIV-1 integration site selection. We showed that productively and latently infected cells exhibit different integration site biases towards non-B DNA motifs. We identified a correlation between the integration sites of the latent proviruses and non-B DNA features known to potently influence gene expression (e.g., cruciform, guanine-quadruplex (G4), triplex, and Z-DNA). The reactivation potential of latent proviruses with latency reversal agents also correlated with their proximity to specific non-B DNA motifs. The perturbation of G4 structures in vitro using G4 structure-destabilizing or -stabilizing ligands resulted in a significant reduction in integration within 100 base pairs of G4 motifs. The stabilization of G4 structures increased the integration within 300–500 base pairs from G4 motifs, increased integration near transcription start sites, and increased the proportion of latently infected cells. Moreover, we showed that host lens epithelium-derived growth factor (LEDGF)/p75 and cleavage and polyadenylation specificity factor 6 (CPSF6) influenced the distribution of integration sites near several non-B DNA motifs, especially G4 DNA. Our findings identify non-B DNA motifs as important factors that influence productive and latent HIV-1 integration and the reactivation potential of latent proviruses.
37
Cao, Sen, Qian Su, Yong-Hao Chen, Meng-Lu Wang, Yi Xu, Li-Hui Wang, Yan-Hua Lu et al. « Molecular Insights into the Specific Targeting of c-MYC G-Quadruplex by Thiazole Peptides ». International Journal of Molecular Sciences 25, no 1 (3 janvier 2024) : 623. http://dx.doi.org/10.3390/ijms25010623.
Texte intégralRésumé :
Stabilization of a G-quadruplex (G4) in the promotor of the c-MYC proto-oncogene leads to inhibition of gene expression, and it thus represents a potentially attractive new strategy for cancer treatment. However, most G4 stabilizers show little selectivity among the many G4s present in the cellular complement of DNA and RNA. Intriguingly, a crescent-shaped cell-penetrating thiazole peptide, TH3, preferentially stabilizes the c-MYC G4 over other promotor G4s, but the mechanisms leading to this selective binding remain obscure. To investigate these mechanisms at the atomic level, we performed an in silico comparative investigation of the binding of TH3 and its analogue TH1 to the G4s from the promotors of c-MYC, c-KIT1, c-KIT2, and BCL2. Molecular docking and molecular dynamics simulations, combined with in-depth analyses of non-covalent interactions and bulk and per-nucleotide binding free energies, revealed that both TH3 and TH1 can induce the formation of a sandwich-like framework through stacking with both the top and bottom G-tetrads of the c-MYC G4 and the adjacent terminal capping nucleotides. This framework produces enhanced binding affinities for c-MYC G4 relative to other promotor G4s, with TH3 exhibiting an outstanding binding priority. Van der Waals interactions were identified to be the key factor in complex formation in all cases. Collectively, our findings fully agree with available experimental data. Therefore, the identified mechanisms leading to specific binding of TH3 towards c-MYC G4 provide valuable information to guide the development of new selective G4 stabilizers.
38
Razzaq, Maria, Subramaniyam Ravichandran, Nazia Parveen et Kyeong Kyu Kim. « Abstract LB430 : Identification of therapeutic target in breast cancer using G-quadruplex binding ligands ». Cancer Research 84, no 7_Supplement (5 avril 2024) : LB430. http://dx.doi.org/10.1158/1538-7445.am2024-lb430.
Texte intégralRésumé :
Abstract G-quadruplex (G4) motifs are noncanonical nucleic acid structures formed from staked guanine rich tetrads. G4 motifs have been shown to play significant effects on gene expression in all domains of life and are predominantly enriched in the regulatory regions such as promoters and enhancers of the human genome. G4-ligand mediated stabilization or destabilization of G4 structures has been discussed as a potential therapeutic strategy against tumor cells. However, the structure-specificity of G4-binding ligands remains a considerable challenge in determining the target-specificity. Therefore, it is necessary to understand the global effects of such G4-binding ligands at the transcriptome level to identify novel target(s) based on molecular structures and binding modes of both G4 motifs and ligands. In this study, we reported a top-down approach to extrapolate transcriptome-wide effects of two eminent G4-binding ligands Quarfloxin and Pyridostatin in human breast adenocarcinoma (MCF7) cell lines by RNA-seq analysis. Quadparser analysis was performed to analyze putative G4 forming sequences in protein coding breast cancer genes promoters. RNA-seq data was combined with Quadparser analysis to reveal that over 85% of the differentially expressed genes in both Pyridostatin and Quarfloxin contained G4 forming sequences in promoter region. Gene ontology analysis showed that both ligands affected key genes involved in extracellular matrix (ECM), architecture and cellular functions. A notable tumor suppressor deubiquitinase (DUBs) Cylindromatosis (CYLD) gene expression was particularly increased with Pyridostatin compared to Quarfloxin. In vitro assays also confirmed an increase in CYLD expression by qRT-PCR and Western blot. The detailed molecular mechanism of G4-mediated increase in CYLD expression is under study. Collectively, the current results present a new approach to identify G4-ligands binding target in breast cancer cells and provide insights into designing G4-ligands as an anti-cancer therapeutics. Citation Format: Maria Razzaq, Subramaniyam Ravichandran, Nazia Parveen, Kyeong Kyu Kim. Identification of therapeutic target in breast cancer using G-quadruplex binding ligands [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 2 (Late-Breaking, Clinical Trial, and Invited Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(7_Suppl):Abstract nr LB430.
39
Figueiredo, Joana, Tiago Santos, André Miranda, Daniela Alexandre, Bernardo Teixeira, Pedro Simões, Jéssica Lopes-Nunes et Carla Cruz. « Ligands as Stabilizers of G-Quadruplexes in Non-Coding RNAs ». Molecules 26, no 20 (13 octobre 2021) : 6164. http://dx.doi.org/10.3390/molecules26206164.
Texte intégralRésumé :
The non-coding RNAs (ncRNA) are RNA transcripts with different sizes, structures and biological functions that do not encode functional proteins. RNA G-quadruplexes (rG4s) have been found in small and long ncRNAs. The existence of an equilibrium between rG4 and stem−loop structures in ncRNAs and its effect on biological processes remains unexplored. For example, deviation from the stem−loop leads to deregulated mature miRNA levels, demonstrating that miRNA biogenesis can be modulated by ions or small molecules. In light of this, we report several examples of rG4s in certain types of ncRNAs, and the implications of G4 stabilization using small molecules, also known as G4 ligands, in the regulation of gene expression, miRNA biogenesis, and miRNA−mRNA interactions. Until now, different G4 ligands scaffolds were synthesized for these targets. The regulatory role of the above-mentioned rG4s in ncRNAs can be used as novel therapeutic approaches for adjusting miRNA levels.
40
Markowicz-Piasecka, Magdalena, Joanna Sikora, Paweł Szymański, Oliwia Kozak, Michał Studniarek et Elżbieta Mikiciuk-Olasik. « PAMAM Dendrimers as Potential Carriers of Gadolinium Complexes of Iminodiacetic Acid Derivatives for Magnetic Resonance Imaging ». Journal of Nanomaterials 2015 (2015) : 1–11. http://dx.doi.org/10.1155/2015/394827.
Texte intégralRésumé :
This is the first study describing the utilization of PAMAM dendrimers as delivery vehicles of novel magnetic resonance imaging (MRI) contrast agents. The purpose of this paper was to establish the potential of G4 PAMAM dendrimers as carriers of gadolinium complexes of iminodiacetic acid derivatives and determine imaging properties of synthesized compounds inin vivostudies. Furthermore, we examined the influence of four synthesized complexes on the process of clot formation, stabilization, and lysis and on amidolytic activity of thrombin. Biodistribution studies have shown that the compounds composed of PAMAM G4 dendrimers and gadolinium complexes of iminodiacetic acid derivatives increase signal intensity preferably in liver in range of 59–116% in MRI studies which corresponds with the greatest accumulation of gadolinium after administration of the compounds. Synthesized compounds affect kinetic parameters of the proces of clot formation, its stabilization, and lysis. However, only one synthesized compound at concentration 10-fold higher than potential plasma concentrations contributed to the increase of general parameters such as the overall potential of clot formation and lysis (↑CLAUC) and total time of the process (↑T). Results of described studies provide additional insight into delivery properties of PAMAM dendrimers but simultaneously underscore the necessity for further research.
41
Greco, Francesca, Domenica Musumeci, Nicola Borbone, Andrea Patrizia Falanga, Stefano D’Errico, Monica Terracciano, Ilaria Piccialli, Giovanni Nicola Roviello et Giorgia Oliviero. « Exploring the Parallel G-Quadruplex Nucleic Acid World : A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin ». Molecules 27, no 9 (7 mai 2022) : 2997. http://dx.doi.org/10.3390/molecules27092997.
Texte intégralRésumé :
Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.
42
Zhang, Yan, Zhidong Qiu, Ming Zhu et Ye Teng. « Ginsenoside Compound K Assisted G-Quadruplex Folding and Regulated G-Quadruplex-Containing Transcription ». Molecules 26, no 23 (3 décembre 2021) : 7339. http://dx.doi.org/10.3390/molecules26237339.
Texte intégralRésumé :
Ginsenoside compound K (CK) is one of the major metabolites of the bioactive ingredients in Panax ginseng, which presents excellent bioactivity and regulates the expression of important proteins. In this work, the effects of CK on G-quadruplexes (G4s) were quantitatively analyzed in the presence and absence of their complementary sequences. CK was demonstrated to facilitate the formation of G4s, and increase the quantity of G4s in the competition with duplex. Thermodynamic experiments suggested that the electrostatic interactions were important for G4 stabilization by CK. CK was further found to regulate the transcription of G4-containing templates, reduce full-length transcripts, and decrease the transcription efficiency. Our results provide new evidence for the pharmacological study of ginsenosides at the gene level.
43
Schwab, Rebekka A., Jadwiga Nieminuszczy, Kazuo Shin-ya et Wojciech Niedzwiedz. « FANCJ couples replication past natural fork barriers with maintenance of chromatin structure ». Journal of Cell Biology 201, no 1 (25 mars 2013) : 33–48. http://dx.doi.org/10.1083/jcb.201208009.
Texte intégralRésumé :
Defective DNA repair causes Fanconi anemia (FA), a rare childhood cancer–predisposing syndrome. At least 15 genes are known to be mutated in FA; however, their role in DNA repair remains unclear. Here, we show that the FANCJ helicase promotes DNA replication in trans by counteracting fork stalling on replication barriers, such as G4 quadruplex structures. Accordingly, stabilization of G4 quadruplexes in ΔFANCJ cells restricts fork movements, uncouples leading- and lagging-strand synthesis and generates small single-stranded DNA gaps behind the fork. Unexpectedly, we also discovered that FANCJ suppresses heterochromatin spreading by coupling fork movement through replication barriers with maintenance of chromatin structure. We propose that FANCJ plays an essential role in counteracting chromatin compaction associated with unscheduled replication fork stalling and restart, and suppresses tumorigenesis, at least partially, in this replication-specific manner.
44
De Lima, Dieila Giomo, Gustavo Narvaes Guimarães, Bianca Caroline Bianco, Ana Paula De Souza et Aline Cristiane Planello. « Abstract 4723 : DNA G-quadruplex facilitates MYC enhancer-promotor interaction ». Cancer Research 83, no 7_Supplement (4 avril 2023) : 4723. http://dx.doi.org/10.1158/1538-7445.am2023-4723.
Texte intégralRésumé :
Abstract Background: G-quadruplexes (G4) are nucleic acid secondary structures formed in guanine-rich regions of DNA or RNA. The biological significance of G4 has been attributed to the regulation of gene expression, and more recently, to the stabilization and generation of enhancer-promotor interaction. Since G4 are enriched in the promoter region of the proto-oncogene MYC, we sought to investigate the role of G4 in stabilizing the enhancer-promoter loop using the locus 8q24 (hg38) 127,700,000-128,500,000 that contains the MYC gene as a model. Methods: Two different cell lines were used, the spontaneously immortalized, non-oncogenic human epidermal keratinocyte (HaCaT), in which the enrichment of G4 in the MYC promoter was demonstrated, and the primary normal human epidermal keratinocyte (nHEK) that is depleted of G4 in MYC promoter. Both cell lines were exposed to the G4 selective stabilizer 360-A drug and the half-maximal inhibitory concentration (IC50) could be calculated. Gene expression was accessed by RT-qPCR and DNA methylation by Methylation-Sensitive High Resolution Melting (MS-HRM). Chromatin Conformation Capture (3C-qPCR) technique was performed interrogating the MYC gene (chr8:127,733,798-127,744,729) and the putative enhancer in the lncRNA PVT1 gene (chr8:127,914,509-127,922,393) to compare the frequency of promoter-enhancer interaction between the two cell lines. Results: The HaCaT cells showed interaction between the MYC promoter and the distal region. The nHEK cells that are not enriched for G4 showed no promoter interaction with the distal region. The use of 360-A in IC50 did not change the results. The gene expression analysis of the MYC showed higher expression in HaCaT cells compared to nHEK. There was no difference in DNA methylation in the MYC promoter between the two cell lines. Conclusions: The data suggest an important role of G4 for the interaction of the MYC promoter and downstream enhancer. Additional analyzes of other genomic regions enriched for G4 should be performed to confirm the mechanism. Citation Format: Dieila Giomo De Lima, Gustavo Narvaes Guimarães, Bianca Caroline Bianco, Ana Paula De Souza, Aline Cristiane Planello. DNA G-quadruplex facilitates MYC enhancer-promotor interaction. [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2023; Part 1 (Regular and Invited Abstracts); 2023 Apr 14-19; Orlando, FL. Philadelphia (PA): AACR; Cancer Res 2023;83(7_Suppl):Abstract nr 4723.
45
Ou, Arnold, Jason W. Schmidberger, Katie A. Wilson, Cameron W. Evans, Jessica A. Hargreaves, Melanie Grigg, Megan L. O’Mara, K. Swaminathan Iyer, Charles S. Bond et Nicole M. Smith. « High resolution crystal structure of a KRAS promoter G-quadruplex reveals a dimer with extensive poly-A π-stacking interactions for small-molecule recognition ». Nucleic Acids Research 48, no 10 (20 avril 2020) : 5766–76. http://dx.doi.org/10.1093/nar/gkaa262.
Texte intégralRésumé :
Abstract Aberrant KRAS signaling is a driver of many cancers and yet remains an elusive target for drug therapy. The nuclease hypersensitive element of the KRAS promoter has been reported to form secondary DNA structures called G-quadruplexes (G4s) which may play important roles in regulating KRAS expression, and has spurred interest in structural elucidation studies of the KRAS G-quadruplexes. Here, we report the first high-resolution crystal structure (1.6 Å) of a KRAS G-quadruplex as a 5′-head-to-head dimer with extensive poly-A π-stacking interactions observed across the dimer. Molecular dynamics simulations confirmed that the poly-A π-stacking interactions are also maintained in the G4 monomers. Docking and molecular dynamics simulations with two G4 ligands that display high stabilization of the KRAS G4 indicated the poly-A loop was a binding site for these ligands in addition to the 5′-G-tetrad. Given sequence and structural variability in the loop regions provide the opportunity for small-molecule targeting of specific G4s, we envisage this high-resolution crystal structure for the KRAS G-quadruplex will aid in the rational design of ligands to selectively target KRAS.
46
Satta, Giuseppe, Silvia Gaspa, Luisa Pisano, Lidia De Luca et Massimo Carraro. « 5,10,15,20-Tetrakis-(4-(3-carbamoyl-pyridyl)-methylphenyl)porphyrin Bromide ». Molbank 2024, no 2 (13 juin 2024) : M1836. http://dx.doi.org/10.3390/m1836.
Texte intégralRésumé :
The synthesis of a new tetracationic porphyrin derivative is described. Contrary to the best known derivatives in the literature, which are derived from 5,10,15,20-tetrakis-4-pyridylporphyrin (TPyP), in this procedure we start from 5,10,15,20-tetrakis-(4-carboxymethoxyphenyl)porphyrin (TPPCOOMe), obtained by the condensation reaction between pyrrole and 4-formylbenzoate. The reaction is carried out in refluxed xylene, avoiding the use of halogenated solvents. The final product, 5,10,15,20-tetrakis-(4-(3-carbamoyl-pyridyl)-methylphenyl)porphyrin bromide (P15p), exhibits four cationic portions that make it soluble in water and suitable for G4 stabilization. The choice to synthesize a derivative of TPPCOOMe is based on the idea of having a possible stabilizer that, unlike those obtained from TPyP, shows the cationic moieties farther from the porphyrin core and thus closer to the phosphate groups present on the G4 loops.
47
Stein, Thomas, Ralf Dieter Linke, Johannes Buckup, Turgay Efe, Rudiger von Eisenhart-Rothe, Reinhard Hoffmann, Alwin Jäger et Frederic Welsch. « Shoulder Sport-Specific Impairments After Arthroscopic Bankart Repair ». American Journal of Sports Medicine 39, no 11 (31 août 2011) : 2404–14. http://dx.doi.org/10.1177/0363546511417407.
Texte intégralRésumé :
Background: Reports of return to shoulder-dependent sport after surgical stabilization previously underestimated impairments, which were not reflected in the score systems used. Hypothesis: Return to shoulder-dependent sport depends on the type of sport performed. Study Design: Case series; Level of evidence, 4. Methods: Forty-seven athletes (26.9 years of age at surgery) who underwent isolated arthroscopic Bankart repair were longitudinally monitored by shoulder-dependent sport-specific activity (Shoulder Sport Activity Score [SSAS]) and ability (Athletic Shoulder Outcome Scoring System [ASOSS]) scores and visual analog scales for reachieved proficiency level, sport-specific shoulder pain, and functional deficits. Data were assessed at 4 points of treatment: preoperatively, and postoperatively after 6, 16, and 32 months (P0-P3). Athletes were analyzed separately according to shoulder sport: noncollision/nonoverhead (G1), collision (G2), overhead (G3), and martial arts (G4). Results: The G1 and G2 athletes had reachieved the preinjury sport activity and sport proficiency status and excellent ASOSS scores after 32 months (SSASG1 = 7.2, SSASG2 = 8.1, ASOSSG1 = 94.4, ASOSSG2 = 95.2), whereas G3 and G4 athletes remained at an inferior activity level (SSASG3 = 8.0, SSASG4 = 8.3) and proficiency level. The ASOSS documented a prolonged period of shoulder rehabilitation for G3 and G4 athletes to reach a good shoulder-dependent sport ability outcome after 32 months (ASOSSG3 = 89.0, ASOSSG4 = 93.1). All groups recorded persisting limitations in visual analog scales for sport-specific shoulder function and pain. The established scores (Rowe = 95.9, Walch-Duplay = 93.3, Constant = 94.0) did not reflect these sport-specific impairments. Athletes with 5 or more preoperative dislocations had significantly longer surgery-to-sport resumption intervals with a prolonged proficiency recovery. Conclusion: The athletes’ shoulder stabilization resulted in a prolonged rehabilitation depending on the functional demand of the performed shoulder-dependent sport, as shown by the specific shoulder sport score systems.
48
Bazzicalupi, Carla, Alessandro Bonardi, Tarita Biver, Marta Ferraroni, Francesco Papi, Matteo Savastano, Paolo Lombardi et Paola Gratteri. « Probing the Efficiency of 13-Pyridylalkyl Berberine Derivatives to Human Telomeric G-Quadruplexes Binding : Spectroscopic, Solid State and In Silico Analysis ». International Journal of Molecular Sciences 23, no 22 (14 novembre 2022) : 14061. http://dx.doi.org/10.3390/ijms232214061.
Texte intégralRésumé :
The interaction between the series of berberine derivatives 1–5 (NAX071, NAX120, NAX075, NAX077 and NAX079) and human telomeric G-quadruplexes (G4), which are able to inhibit the Telomerase enzyme’s activity in malignant cells, was investigated. The derivatives bear a pyridine moiety connected by a hydrocarbon linker of varying length (n = 1–5, with n number of aliphatic carbon atoms) to the C13 position of the parent berberine. As for the G4s, both bimolecular 5′-TAGGGTTAGGGT-3′ (Tel12) and monomolecular 5′-TAGGGTTAGGGTTAGGGTTAGGG-3′ (Tel23) DNA oligonucleotides were considered. Spectrophotometric titrations, melting tests, X-ray diffraction solid state analysis and in silico molecular dynamics (MD) simulations were used to describe the different systems. The results were compared in search of structure–activity relationships. The analysis pointed out the formation of 1:1 complexes between Tel12 and all ligands, whereas both 1:1 and 2:1 ligand/G4 stoichiometries were found for the adduct formed by NAX071 (n = 1). Tel12, with tetrads free from the hindrance by the loop, showed a higher affinity. The details of the different binding geometries were discussed, highlighting the importance of H-bonds given by the berberine benzodioxole group and a correlation between the strength of binding and the hydrocarbon linker length. Theoretical (MD) and experimental (X-ray) structural studies evidence the possibility for the berberine core to interact with one or both G4 strands, depending on the constraints given by the linker length, thus affecting the G4 stabilization effect.
49
Cadoni, Enrico, Lessandro De Paepe, Alex Manicardi et Annemieke Madder. « Beyond small molecules : targeting G-quadruplex structures with oligonucleotides and their analogues ». Nucleic Acids Research 49, no 12 (12 mai 2021) : 6638–59. http://dx.doi.org/10.1093/nar/gkab334.
Texte intégralRésumé :
Abstract G-Quadruplexes (G4s) are widely studied secondary DNA/RNA structures, naturally occurring when G-rich sequences are present. The strategic localization of G4s in genome areas of crucial importance, such as proto-oncogenes and telomeres, entails fundamental implications in terms of gene expression regulation and other important biological processes. Although thousands of small molecules capable to induce G4 stabilization have been reported over the past 20 years, approaches based on the hybridization of a synthetic probe, allowing sequence-specific G4-recognition and targeting are still rather limited. In this review, after introducing important general notions about G4s, we aim to list, explain and critically analyse in more detail the principal approaches available to target G4s by using oligonucleotides and synthetic analogues such as Locked Nucleic Acids (LNAs) and Peptide Nucleic Acids (PNAs), reporting on the most relevant examples described in literature to date.
50
Kim, Sanghyun, et Sohyun Hwang. « G-Quadruplex Matters in Tissue-Specific Tumorigenesis by BRCA1 Deficiency ». Genes 13, no 3 (22 février 2022) : 391. http://dx.doi.org/10.3390/genes13030391.
Texte intégralRésumé :
How and why distinct genetic alterations, such as BRCA1 mutation, promote tumorigenesis in certain tissues, but not others, remain an important issue in cancer research. The underlying mechanisms may reveal tissue-specific therapeutic vulnerabilities. Although the roles of BRCA1, such as DNA damage repair and stalled fork stabilization, obviously contribute to tumor suppression, these ubiquitously important functions cannot explain tissue-specific tumorigenesis by BRCA1 mutations. Recent advances in our understanding of the cancer genome and fundamental cellular processes on DNA, such as transcription and DNA replication, have provided new insights regarding BRCA1-associated tumorigenesis, suggesting that G-quadruplex (G4) plays a critical role. In this review, we summarize the importance of G4 structures in mutagenesis of the cancer genome and cell type-specific gene regulation, and discuss a recently revealed molecular mechanism of G4/base excision repair (BER)-mediated transcriptional activation. The latter adequately explains the correlation between the accumulation of unresolved transcriptional regulatory G4s and multi-level genomic alterations observed in BRCA1-associated tumors. In summary, tissue-specific tumorigenesis by BRCA1 deficiency can be explained by cell type-specific levels of transcriptional regulatory G4s and the role of BRCA1 in resolving it. This mechanism would provide an integrated understanding of the initiation and development of BRCA1-associated tumors.