Articles de revues sur le sujet « Bernardo Bini »

The platelet GPIb-V-IX complex is the receptor for the initial binding of von Willebrand factor (vWF) mediating platelet adhesion. The complex is composed of four membrane-spanning glycoproteins (GP): GPIbα, GPIbβ, GPIX, and GPV. Bernard-Soulier syndrome results from a qualitative or quantitative defect in one or more components of the platelet membrane GPIb-V-IX complex. We describe the molecular basis of a novel Bernard-Soulier syndrome variant in two siblings in whom GPIbα was not detected on the platelet surface but that was present in a soluble form in plasma. DNA sequence analysis showed that the affected individuals were compound heterozygotes for two mutations. One, inherited from a maternal allele, a T777 → C point mutation in GPIbα converting Cys65 → Arg within the second leucine rich repeat, the other, a single nucleotide substitution (G2078 → A) for the tryptophan codon (TGG) causing a nonsense codon (TGA) at residue 498 within the transmembrane region of GPIbα, inherited from a mutant paternal allele. The Bernard-Soulier phenotype was observed in siblings who were compound heterozygotes for these two mutations. Although GPIbα was not detected on the surface of the patient's platelets, soluble GPIbα could be immunoprecipitated from plasma. When plasmids encoding GPIbα containing the Cys65 → Arg mutation were transiently transfected into Chinese hamster ovary (CHO) cells stably expressing the GPβ-IX complex (CHOβIX), the expression of GPIbα was similar to the wild-type (WT) GPIbα, but did not bind vWF. When plasmids encoding GPIbα containing the Trp498 → stop were transiently transfected into CHOβIX, the surface expression of GPIbα was barely detectable compared with the WT GPIbα. Thus, this newly described compound heterozygous defect produces Bernard-Soulier syndrome by a combination of synthesis of a nonfunctional protein and of a truncated protein that fails to insert into the platelet membrane and is found circulating in plasma.

Having a professional certificate in information systems and information technology fields means having the recognition for related skills and knowledge requested by the industry. Some countries and institutions have tried to bridge these needs by organizing conferences and seminars. Information systems department of Bina Nusantara University always tries to meet those needs. One effort is to introduce the Enterprise Architecture method initiated by Bernard for use in the course of information systems and information technology strategic planning. The results of this activity suggest that obtaining international certification requires the implementation of learning in a referenced standard. This approach is expected to accelerate the acquisition of professional certification for graduates majoring in information systems and technology.

Partilhamos uma leitura de um caso central da literatura juvenil portuguesa contemporânea. Supergigante (2014) é também um objeto estético que se toca, vê e lê de acordo com várias gramáticas. Pretendemos usá-las para trabalhar, intratextualmente, a personagem do adolescente que, no mesmo dia, experiencia a perda do avô e o seu primeiro beijo num violento choque de emoções; e, paratextualmente, descodificar a materialização da leitura literária que, através do texto de Ana Pessoa e da ilustração de Bernardo P. Carvalho, se faz jogando também com as dificuldades em lutar com o peso gravitacional do lugar e do tempo na adolescência. Joga-se com a intensidade, a velocidade, do tempo de ser e de dizer, tudo em excesso. Edgar, protagonista e narrador, é um corpo que adolesce abruptamente como numa explosão cósmica. Exprimi-lo é confessar logo na primeira linha: “Eu corro e não avanço.” TRANSLATE with x EnglishArabicHebrewPolishBulgarianHindiPortugueseCatalanHmong DawRomanianChinese SimplifiedHungarianRussianChinese TraditionalIndonesianSlovakCzechItalianSlovenianDanishJapaneseSpanishDutchKlingonSwedishEnglishKoreanThaiEstonianLatvianTurkishFinnishLithuanianUkrainianFrenchMalayUrduGermanMalteseVietnameseGreekNorwegianWelshHaitian CreolePersian // TRANSLATE with COPY THE URL BELOW Back EMBED THE SNIPPET BELOW IN YOUR SITE Enable collaborative features and customize widget: Bing Webmaster PortalBack//

Abstract Numerous studies have implicated bacteria in cardiovascular disease, but there is a paucity of information on the mechanism involved. In this study we show how the common oral bacteriumStreptococcus sanguis can directly interact with platelets, resulting in activation and aggregate formation. Platelet aggregation was dependent on glycoprotein IIb/IIIa (GPIIb/IIIa) and thromboxane. Platelets could also directly bind to S sanguis, but this interaction was not inhibited by GPIIb/IIIa antagonists. Antibodies to GPIb could inhibit both platelet aggregation and platelet adhesion to bacteria. This suggested a direct interaction between GPIb and S sanguis; however, this interaction did not require von Willebrand factor, the normal ligand for GPIb. By use of a range of monoclonal antibodies to GPIb and the enzyme mocharagin, which cleaves GPIb at amino acid 282, the interaction was localized to a region within the N-terminal 1-225 portion of GPIbα. Furthermore S sanguisfailed to induce aggregation of platelets from a patient with Bernard-Soulier disease, the organism bound to Chinese hamster ovary cells transfected with the GPIbα gene but did not bind to mock-transfected cells and biotin-labeled S sanguis cells bound to purified GPIb in ligand blots. It is suggested that the interaction between S sanguis and GPIb is important in the pathogenesis of infective endocarditis and may also play a contributory role in some cases of myocardial infarction.

<p>The twenty-two-year reign of Hoboken political boss Bernard N. McFeely (including seventeen as mayor) has long been under-reported in the national press and almost completely overlooked by historians. Bernard McFeely’s extensive FBI file, recently released under the Freedom of Information Act, provides an opportunity to remedy this lapse, and to consider his rule (1925-1947) alongside other post-World War I urban political machines. Unlike his over-boss, Jersey City mayor and statewide machine leader Frank Hague, or machine bosses in Boston, Memphis, and Kansas City—all of whom retained power by matching bullying with programs that gained the affection of poor and working class constituents—McFeely was stingy with public funds and mostly relied on force to secure his hold. The coercion and beatings attributed to McFeely and his cohorts in oral histories and court records are detailed in his FBI file. This article focuses on one series of documents, relating to a 1937-1938 campaign to ruin the milk business of George Harper, who was said to have displeased then-mayor McFeely by consorting with his political opponents. Harper provided the FBI with daily records of the enforced boycott of his business; they provide a blow-by-blow account of McFeely bossism in action.</p><p><span style="font-family: 'Times New Roman',serif; font-size: 10pt; mso-fareast-font-family: 'MS Mincho'; mso-fareast-theme-font: minor-fareast; mso-ansi-language: EN-US; mso-fareast-language: EN-US; mso-bidi-language: AR-SA;">A version of this talk was originally delivered at the NJ Forum Conference, Kean University, on November 22, 2014. </span></p>

Abstract Quinidine-induced thrombocytopenia has been associated with both immune complex and autoantibody binding to platelets. In the present study, serum antibody from six of six patients with quindine purpura was shown by immunoblotting to bind to a single platelet membrane protein of mol wt 80,000. This target protein was absent from Bernard-Soulier (BSS) platelets. F(ab)2 prepared from one patient's serum also bound to this protein, indicating autoantibody rather than immune complex binding to the target antigen. Antibody binding to the 80-kd protein was preserved after treatment of platelets with concentrations of trypsin or chymotrypsin that completely removed glycoprotein Ib (GPIb). Preincubation of platelet proteins with one patient's serum blocked binding of a polyclonal rabbit antibody against glycoprotein V (GPV), indicating that these antibodies recognize the same antigen. By wheat germ affinity chromatography, GPV was shown to copurify with GPIb. Quinidine-induced antibody bound to the wheat germ-purified GPV but not to GPIb. We conclude that quinidine purpura is associated with autoantibody directed against platelet GPV.

Quinidine-induced thrombocytopenia has been associated with both immune complex and autoantibody binding to platelets. In the present study, serum antibody from six of six patients with quindine purpura was shown by immunoblotting to bind to a single platelet membrane protein of mol wt 80,000. This target protein was absent from Bernard-Soulier (BSS) platelets. F(ab)2 prepared from one patient's serum also bound to this protein, indicating autoantibody rather than immune complex binding to the target antigen. Antibody binding to the 80-kd protein was preserved after treatment of platelets with concentrations of trypsin or chymotrypsin that completely removed glycoprotein Ib (GPIb). Preincubation of platelet proteins with one patient's serum blocked binding of a polyclonal rabbit antibody against glycoprotein V (GPV), indicating that these antibodies recognize the same antigen. By wheat germ affinity chromatography, GPV was shown to copurify with GPIb. Quinidine-induced antibody bound to the wheat germ-purified GPV but not to GPIb. We conclude that quinidine purpura is associated with autoantibody directed against platelet GPV.

FRIENDSHIP PUT TO THE TEST OF PRETENCES: A RHETORICAL INTERPRETATION OF AN EXCERPT FROM GIDE’S COUNTERFEITERSGide’s Counterfeiters are not only those who circulate false coins; they are also those who cannot help cheating with discourses and friendship. The fragment ‘After the exam / the bac’ III, 5 articulates those different levels in an original way, which can be described in rhetorical terms. As pupils, Bernard and Olivier are supposed to write a spontaneous essay but, at the same time, they must conform to the jury’s expectationslevel1: [pseudo] rational argumentation on values. The­refore, as soon as the youngsters escape from the teacher’s reach, they turn to their schoolfellows unashamedly boasting on their strategies to escape the double bind imposed by the school system level2: strategical meta-argumentation. But the intellectual and moral disagreement almost leads to a quarrel between friends level3: rhetoric as a negotiation on emotions and on the distance between individuals. If the two first levels can be contemplated through Perelman’s system, the third one should rely on a broader definition of rhetoric e.g. Plantin and Meyer.

Recent research has rendered untenable the glib characterisation of the Henrician Reformation as ‘Catholicism without the Pope’, but the essential nature of the motives and achievements of Henry vra and his ministers in the 1530s and 1540s remains a controversial issue. To J. K. McConica, the polity created in the 1530s was an ‘Erasmian’ one, with the views of the great humanist on such matters as vernacular Scripture, superstitious pilgrimage and religious instruction providing a consensual nexus to bind together all but the most extreme shades of religious opinion. More recently, Glyn Redworth has similarly argued that the Henrician Reform was from the first ‘an intellectually coherent and satisfying movement’, and that it had positive and distinctive religious aspirations, seeking to use the techniques of ‘Protestant’ evangelism to transmit a purged but none the less essentially Catholic doctrine. G. W. Bernard has, by contrast, characterised the direction of religious policy after the break with Rome as ‘deliberately ambiguous’, and sees Henry as a ruler who held together an unwieldy coalition of interests by employing the rhetoric of continental Protestantism while inhibiting the implementation of any fundamental change.

Cherry green ring mottle virus (CGRMV) infects several Prunus species, while Cherry necrotic rusty mottle virus (CNRMV) has been detected mainly in sweet cherry. In Chile, sweet cherry represents one of the most valuable fruit crops, and the country is the main producer of cherries in the southern hemisphere. In October 2011, leaf samples were collected from 21 trees of cv. Bing in Libertador General Bernardo O'Higgins and Maule regions. Leaves of symptomatic plants showed brown angular necrotic spots, the center of which can drop out giving a shot-hole appearance. Total RNA was extracted by the silica capture method (1). Reverse transcription (RT)-PCR was carried out to test the presence of CGRMV and CNRMV using primer pairs GRM7950/GRM8316 (1), and DetCNR-F (TCCCACCTCAAGTCCTAGCAGAGA) / DetCNR-R (TCATTGCTAATTGCAAAATCCCA). Ten and six samples were tested positive for CGRMV and CNRMV, obtaining 366- and 333-bp fragments, respectively. Mixed infections occurred in five samples. Two sets of primer pairs were designed to amplify a region of the genome which includes the entire coat protein (CP) gene: CGRM-CPF (GGCTGATGAAGAATTTGA-GAAG) and CGRM-CPR (GAGTGGAATTGCAGGGGTTT), and CNRM-CPF (GAGTGTGTGTGAGCTTTCAAGTT) and CNRM-CPR (TTCGCCCCGTGTTGTAAAAC). Amplicons of the expected size of 828 bp (CGRMV) and 892 bp (CNRMV) were obtained from infected samples. Three amplicons for each virus were cloned into pGEM-T and three colonies per cloned fragment were sequenced in both directions. For CNRMV, Chilean isolates CP9754 (GenBank Accession No. KC432619) and CP9956N (KC432621) had 98% for nucleotide identity with isolate JK10 from India (FN546178), while isolate CP9879 (KC432620) had 97% of nucleotide identity. For CGRMV, Chilean isolate CP3359 (KC432616) had 98% identity with isolate HI17 from Poland (JX468873), while isolates CP9731 (KC432617) and CP9956G (KC432618) had 98% and 99% nucleotide identity with isolate ita7 (AF533161) from Italy, respectively. Nucleotide and amino acid sequence identity between Chilean isolates of CGRMV ranged between 94.5% and 99.3%, and from 97.8% to 99.2%, respectively. For Chilean isolates of CNRMV, sequence identity ranged between 98.0% and 98.5% (nucleotide), and from 98.6% to 98.9% (amino acid). Sequence analysis indicated that CGRMV isolates found in Chile belong to group II (3). Detection was confirmed by non-isotopic molecular hybridization. Riboprobes were designed on the basis of a consensus sequence of CP gene and labeled with digoxigenin (2); are complementary to the fragments located from the nucleotide 7415 to 7576 for CGRMV (reference sequence NC 001946.1), and 7475 to 7638 for CNRMV (reference sequence NC 002468.1). The cultivar Bing manifested symptoms only when infected by CNRMV. Results suggest that CNRMV is the cause of symptoms and yield loss observed in Bing, the most important cherry variety cultivated in Chile. To our knowledge, this is the first report of CGRMV and CNRMV infecting sweet cherry in South America. References: (1) M. E. Rott and W. Jelkmann. Eur. J. Plant Pathol. 107:411, 2001. (2) J. A Sánchez-Navarro et al. Plant Pathol. 47:780, 1998. (3) Y. P. Zhang et al. J. Plant. Pathol. 82:49, 2000.

Abstract The human platelet-specific alloantigens HPA-2a and HPA-2b (= Kob and Koa) together constitute a biallelic antigen system. The HPA-2 antigens have not, to date, been located on a particular platelet membrane molecule. Here, we describe the localization of these antigens on platelet glycoprotein (GP) Ib alpha. Platelets from two patients with the Bernard-Soulier syndrome (BSS) were HPA-2(a-,b-) in the immunofluorescence test with HPA-2 alloantibodies on chloroquine- treated platelets. With monoclonal antibody (MoAb) immobilization of platelet antigen assay (MAIPA), positive reactions were obtained only when MoAbs against the platelet GPIb/IX complex were used in combination with anti-HPA-2a or -2b alloantibodies and normal donor platelets. By immunoprecipitation under nonreducing and reducing conditions a protein of 160 Kd and 145 Kd, respectively, was precipitated by the anti-HPA-2a serum. A protein migrating identically to this was precipitated by anti-GPIb MoAb. Normal donor platelets became HPA-2(a-,b-) after elastase treatment, suggesting that anti-HPA- 2 antibodies bind to the N-terminal elastase-sensitive part of GPIb alpha. Anti-HPA-2a antibodies inhibited the ristocetin-induced agglutination of HPA-2a-positive platelets but not of HPA-2a-negative platelets, indicating that the epitopes recognized by these alloantibodies are localized in the proximity of the von Willebrand- factor-binding domain. Together, these data provide evidence that the HPA-2 alloantigens are located on the N-terminal globular elastase- sensitive part of GPIb alpha. Furthermore, we show that the recently described Siba antigen is probably identical to HPA-2a.

The human platelet-specific alloantigens HPA-2a and HPA-2b (= Kob and Koa) together constitute a biallelic antigen system. The HPA-2 antigens have not, to date, been located on a particular platelet membrane molecule. Here, we describe the localization of these antigens on platelet glycoprotein (GP) Ib alpha. Platelets from two patients with the Bernard-Soulier syndrome (BSS) were HPA-2(a-,b-) in the immunofluorescence test with HPA-2 alloantibodies on chloroquine- treated platelets. With monoclonal antibody (MoAb) immobilization of platelet antigen assay (MAIPA), positive reactions were obtained only when MoAbs against the platelet GPIb/IX complex were used in combination with anti-HPA-2a or -2b alloantibodies and normal donor platelets. By immunoprecipitation under nonreducing and reducing conditions a protein of 160 Kd and 145 Kd, respectively, was precipitated by the anti-HPA-2a serum. A protein migrating identically to this was precipitated by anti-GPIb MoAb. Normal donor platelets became HPA-2(a-,b-) after elastase treatment, suggesting that anti-HPA- 2 antibodies bind to the N-terminal elastase-sensitive part of GPIb alpha. Anti-HPA-2a antibodies inhibited the ristocetin-induced agglutination of HPA-2a-positive platelets but not of HPA-2a-negative platelets, indicating that the epitopes recognized by these alloantibodies are localized in the proximity of the von Willebrand- factor-binding domain. Together, these data provide evidence that the HPA-2 alloantigens are located on the N-terminal globular elastase- sensitive part of GPIb alpha. Furthermore, we show that the recently described Siba antigen is probably identical to HPA-2a.

Abstract It is established that the interplay between von Willebrand factor (VWF) and fibrinogen is relevant for the platelet-platelet interaction in thrombus formation. Although the concentration of fibrinogen is much higher than that of VWF in blood, normally, they do not interact. In fact, VWF in plasma has a poor binding activity for fibrin(ogen)-coated surface, which exposes fibrin-specific sequences when it is immobilized. This observation suggests that 1) the site recognized by fibrin is inaccessible in plasma VWF, and 2) a conformational change in the VWF protein is a pre-requisite to bind fibrin. The latter may be supported by a previous study indicating that VWF has to bind to its platelet receptor glycoprotein (GP)Ib first in order to bind fibrin. Another line of evidence suggests that the binding of VWF to the polymerizing fibrin facilitates the interaction of platelet GPIb with the fibrin-bound VWF during the growth of the thrombus, a mechanism apparently defective in Bernard-Soulier syndrome (BSS) and von Willebrand disease (VWD). Consistent with this, fibrin monomer, like ristocetin, can induce the binding of VWF to GPIb. The C1C2 domains have been described as the fibrin-binding domain in VWF, and it is unknown whether the structures of these domains change to bind to fibrin. In contrast, conformational changes within the A1A2 domains of VWF induced by ristocetin result in the binding to GPIb and the protease ADAMTS-13. Therefore, we investigated a potential contact site for fibrin among the A1A2 domains of VWF. We characterized the interaction of each plasma (p)VWF, purified pVWF, recombinant A1A2A3 domains protein, single A1, and single A2 domains with fibrinogen, fibrin, or D-dimer. We also examined the effect of ristocetin in the VWF-fibrin binding. Both pVWF and purified pVWF bound to immobilized fibrin(ogen) in a ristocetin dependent manner. An A1A2A3 mutant expressing increased GPIb-binding activity bound to fibrin(ogen) in the absence of ristocetin. Both A1 and A2 domains, but not the A3 domain had binding activity for immobilized fibrin(ogen). Both soluble fibrin monomer and D-dimer, unlike fibrinogen in solution, had a significant binding activity for the immobilized A2 domain. Moreover, the A2 domain was capable of delaying fibrin polymerization in vitro. The use of conformation-specific monoclonal antibodies demonstrated that, like collagen, fibrin(ogen) induces a change in the structure of the A1 domain, and platelets interacted effectively with the fibrin(ogen)-bound A1 domain under high shear stress. Interestingly, in contrast to A3 or A1domain, flowing platelets did not adhere to the fibrin(ogen)-coated surface incubated with the A2 domain. In conclusion, we have demonstrated a previously unknown fibrin(ogen)-binding activity for the A1 and A2 domains in VWF. These observations reveal new mechanisms that may help to understand the pathophysiology of the bleeding in VWD, in which a number of natural occurring mutations that cause the disease are found within the A1 and A2 domains, and the poor fibrin polymerization observed in BSS. Furthermore, these outcomes may have implications for a better understanding of the high risk for thrombosis when the levels of both VWF and fibrinogen are increased. Disclosures: No relevant conflicts of interest to declare.

Abstract A peptide from the C-terminal domain of thrombospondin-1 (Arg-Phe-Tyr-Val-Val-Met-Trp-Lys; known as 4N1-1) has been reported to induce platelet aggregation and to bind to the integrin-associated protein (IAP), which is also known as CD47. In this study, it was discovered that 4N1-1 or its derivative peptide, 4N1K, induces rapid phosphorylation of the Fc receptor (FcR) γ chain, Syk, SLP-76, and phospholipase C γ2 in human platelets. A specific inhibitor of Src family kinases, 4-amino-4-(4-methylphenyl)-7-(t-butyl) pyrazola[3,4-d]pyrimidine, prevented phosphorylation of these proteins, abolished platelet secretion, and reduced aggregation by approximately 50%. A similar inhibition of aggregation to 4N1-1 was obtained in the presence of Arg-Gly-Asp-Ser in mouse platelets deficient in FcR γ chain or SLP-76 and in patients with type I Glanzmann thrombasthenia. These results show that 4N1-1 signals through a pathway similar to that used by the collagen receptor glycoprotein (GP) VI. The αIIbβ3-independent aggregation induced by 4N1-1 was also observed in fixed platelets and platelets from patients with Bernard-Soulier syndrome, which are deficient in GPIbα. Surprisingly, the ability of 4N1-1 to stimulate aggregation and tyrosine phosphorylation was not altered in platelets pretreated with anti-IAP antibodies and in IAP-deficient mice. These results show that the C-terminal peptide of thrombospondin induces platelet aggregation through the FcR γ-chain signaling pathway and through agglutination. The latter pathway is independent of signaling events and does not use GPIbα or αIIbβ3. Neither of these pathways is mediated by IAP.

In light of a growing number of trauma narratives about child death authored from a paternal perspective within the scope of contemporary French literature, this article explores the récits de deuil of four lesser-studied orphaned fathers: Alain Thiesse's Elle s'appelait Emma (2014), Philippe Delaroche's La Gloire d'Inès (2016), Michel Rostain's Le Fils (2011), and Bernard Chambaz's À tombeau ouvert (2016). This article considers the insight these texts provide into a father's experience of surviving his child and what this means for his altered identity, for his new role in life, and for the ways in which he turns to literature to voice grief. As we reflect on this changed paternal identity as articulated in these examples, we focus on each author's objective(s) in giving sorrow words as well as the choice of literary modalities of these works. A common thread running throughout these varied examples is the topos of voice: an angry scream and a cry for justice, a belated address, and imagined conversations which traverse the present and the afterlife. We discuss the discursive strategies in these grief narratives and three separate aspects of narrative construction with which they engage. First, we consider the father's cry and the strategies of citation in the témoignage Elle s'appelait Emma. Second, we survey the implications of life writing and the ethical imperative with which they coincide in a father's belated address to his deceased daughter in La Gloire d'Inès. Finally, we investigate how modes of fiction restructure and reconceptualize father-son transmission and filiation in Le Fils and À tombeau ouvert. For mothers and fathers alike, the récit de deuil confronts the paradoxical bind of mourning testimony. The crisis of meaning that losing a child sets in motion impels these fathers to make sense of the unthinkable in the process of writing.

IntroducationGlycoprotein receptors within the platelet membrane are essential for initiating platelet adhesion and aggregation on thrombogenic surfaces. As a response to vascular injury these receptors provide platelets with two essential properties i) the ability to bind adhesive substrates exposed at the site of injury (adhesion) and ii) the ability to recruit additional platelets to form a thrombus (aggregation). It is becoming increasingly evident that defined rheological conditions govern the physiological relevance of specific receptor-ligand interactions along with fundamentally distinct molecular mechanisms for individual receptors and their ligands. Among platelet receptors the glycoprotein (GP) Ib-IX-V complex is important because it initiates thrombus formation over a wide range of flow conditions through an initial interaction with the adhesive ligand, von Willebrand factor. The importance of this receptor-ligand interaction is best exemplified by congenital bleeding disorders resulting from the lack of either the receptor or the ligand, the Bernard-Soulier syndrome and von Willebrand disease, respectively. Additionally, the GP Ib component of the GP Ib-IX-V complex contains a binding site for α-thrombin and recent studies have strengthened the concept that the interaction between α-thrombin and GP Ib is of biological relevance. Unquestionably, studies dissecting the GP Ib-IX-V complex are defining essential aspects of normal hemostasis and thrombosis while providing key information on the molecular mechanisms governing the formation of pathologic platelet thrombi. This review will summarize recent advances in our understanding of the synthesis, structure and function of the platelet GP Ib-IX-V complex. Where possible, directions for future studies will be identified with an overall goal of achieving a more complete understanding on the role of the GP Ib-IX-V complex in platelet biology.

Gene-environment interactions are implicated in congenital human disorders. Accordingly, there is a pressing need to develop animal models of human disease, which are the product of defined gene-environment interactions. Previously, our laboratory demonstrated that gestational salt stress of bradykinin B2 receptor (B2R)-null mice induces renal dysgenesis and early death of the offspring (El-Dahr SS, Harrison-Bernard LM, Dipp S, Yosipiv IV, and Meleg-Smith S. Physiol Genomics 3: 121–131, 2000). In contrast, salt-stressed B2R +/+ or +/− littermates have normal development. The present study investigates the mechanisms underlying the susceptibility of B2R-null mice to renal dysgenesis. Proteomic and conventional Western blot screens identified E-cadherin among the differentially repressed proteins in B2R−/− kidneys, whereas the checkpoint kinase Chk1 and its substrate P-Ser20 p53 were induced. We tested the hypothesis that p53 mediates repression of E-cadherin gene expression and is causally linked to the renal dysgenesis. Genetic crosses between B2R −/− and p53+/− mice revealed that germline reduction of p53 gene dosage rescues B2R−/− mice from renal dysgenesis and restores kidney E-cadherin gene expression. Furthermore, γ-irradiation induces repression of E-cadherin gene expression in p53+/+ but not −/− cells. In transient transfection assays, p53 repressed human E-cadherin promoter-driven reporter activity, whereas a mutant p53, which cannot bind DNA, did not. Functional promoter analysis indicated the presence of a p53-responsive element in exon 1, which partially mediates p53-induced repression. Chromatin immunoprecipitation assays revealed that p53 inhibits histone acetylation of the E-cadherin promoter. Treatment with a histone deacetylase inhibitor reversed both p53-mediated promoter repression and deacetylation. In conclusion, this study demonstrates that gene-environment interactions cooperate to induce congenital defects through p53 activation.

Abstract Platelet glycocalicin (GC) is the extramembranous portion of GPIb alpha that can be rapidly cleaved by enzymes such as calpain, plasmin, trypsin, elastase, etc. Quantitative cleavage will ultimately result in an acquired Bernard-Soulier-like bleeding disorder, and circulating GC may act as a potential inhibitor of platelet adhesion. We have developed and standardized a new enzyme-linked immunosorbent assay (ELISA), which uses two monoclonal antibodies (mAbs), both of which bind to the amino-terminal 45-kD fragment of GC and inhibit platelet- von Willebrand interactions and the streptavidin-biotin system. First, the methodology was evaluated and standardized with special emphasis on the anticoagulant and the inhibitors (EDTA, prostaglandin E1 [PGE1], aprotinin, N-ethyl-maleimide), the mode of high-speed centrifugation (to avoid platelet microparticles), and the standards used (purified GPIb and GC). This assay was then used to analyze the GC levels of healthy subjects (2.04 +/- 0.46 micrograms/mL) and of patients with selected diseases. The results of patients with aplastic anemia and thrombocytosis confirmed that GC levels are clearly dependent on the platelet count, which was the basis for the introduction of the GC index, the standardization of GC for a platelet count of 250 x 10(9)/L. The GC index discriminates reliably patients with active immune thrombocytopenic purpura from those in remission. GC levels are elevated in patients on hemodialysis (3.62 +/- 0.75 micrograms/mL, P < .001). The high GC index (6.93 +/- 4.21, P < .001) in cirrhosis patients suggests an increased platelet turnover and/or abnormal proteolysis. In contrast to other groups, we have not found that recombinant tissue plasminogen activator (rtPA) treatment of patients with myocardial infarction increases GC levels. However, concentrations are elevated in leukemia and the highest levels found are approximately 40 micrograms/mL. These studies suggest that GC is a useful platelet marker in certain diseases, which directly reflects platelet damage and possibly platelet dysfunction.

Platelet glycocalicin (GC) is the extramembranous portion of GPIb alpha that can be rapidly cleaved by enzymes such as calpain, plasmin, trypsin, elastase, etc. Quantitative cleavage will ultimately result in an acquired Bernard-Soulier-like bleeding disorder, and circulating GC may act as a potential inhibitor of platelet adhesion. We have developed and standardized a new enzyme-linked immunosorbent assay (ELISA), which uses two monoclonal antibodies (mAbs), both of which bind to the amino-terminal 45-kD fragment of GC and inhibit platelet- von Willebrand interactions and the streptavidin-biotin system. First, the methodology was evaluated and standardized with special emphasis on the anticoagulant and the inhibitors (EDTA, prostaglandin E1 [PGE1], aprotinin, N-ethyl-maleimide), the mode of high-speed centrifugation (to avoid platelet microparticles), and the standards used (purified GPIb and GC). This assay was then used to analyze the GC levels of healthy subjects (2.04 +/- 0.46 micrograms/mL) and of patients with selected diseases. The results of patients with aplastic anemia and thrombocytosis confirmed that GC levels are clearly dependent on the platelet count, which was the basis for the introduction of the GC index, the standardization of GC for a platelet count of 250 x 10(9)/L. The GC index discriminates reliably patients with active immune thrombocytopenic purpura from those in remission. GC levels are elevated in patients on hemodialysis (3.62 +/- 0.75 micrograms/mL, P < .001). The high GC index (6.93 +/- 4.21, P < .001) in cirrhosis patients suggests an increased platelet turnover and/or abnormal proteolysis. In contrast to other groups, we have not found that recombinant tissue plasminogen activator (rtPA) treatment of patients with myocardial infarction increases GC levels. However, concentrations are elevated in leukemia and the highest levels found are approximately 40 micrograms/mL. These studies suggest that GC is a useful platelet marker in certain diseases, which directly reflects platelet damage and possibly platelet dysfunction.

Abstract We and others have shown that both high and low molecular mass kininogens are able to inhibit the thrombin-induced aggregation of gel-filtered platelets, indicating that the locus for inhibition resides in the heavy chain. The inhibitory site is present in domain 3, confined to the C-terminal portion of the region encoded by exon 7 (K270-G292), and the minimal effective sequence is a heptapeptide (L271-A277; Kunapuli et al, J Biol Chem 271:11228, 1996). Kininogens inhibit thrombin binding to platelets and thus inhibit thrombin-induced aggregation. The molecular mechanism by which kininogens inhibit thrombin-induced aggregation of platelets is unknown. Thrombin has previously been shown to bind to two receptors on the platelet surface, glycoprotein (GP) Ib-IX-V complex and the hepta-spanning transmembrane receptor coupled to G protein(s). We now show that, unlike its effect on normal platelets, kininogen (2 μmol/L) did not inhibit the thrombin-induced aggregation of Bernard-Soulier platelets, which lack the GP Ib-IX-V complex, suggesting that kininogen interacts either directly or indirectly with that complex and restricts access by thrombin to this receptor. We further show that both recombinant K270-G292 polypeptide and the synthetic peptide L271-A277 derived from high molecular mass kininogen lower thrombin binding to platelets in a manner similar to monoclonal antibodies to or ligands (von Willebrand factor and echicetin) of GP Ib-IX. The anti–GP Ib-IX-V complex antibodies, TM-60 and SZ 2, can inhibit 125I-high molecular mass kininogen binding to platelets. Conversely, kininogen could block the binding of biotinylated TM-60 or of 125I-SZ 2. Kininogen inhibited the binding of biotinylated thrombin bound to a mouse fibroblast cell line transfected with the GP Ib-IX-V complex. These results indicated that kininogen binds to the GP Ib-IX-V complex modulating thrombin binding to platelets and the consequent platelet aggregation. Kininogen can thus serve as an important regulator of the early stages of platelet stimulation by thrombin.

We and others have shown that both high and low molecular mass kininogens are able to inhibit the thrombin-induced aggregation of gel-filtered platelets, indicating that the locus for inhibition resides in the heavy chain. The inhibitory site is present in domain 3, confined to the C-terminal portion of the region encoded by exon 7 (K270-G292), and the minimal effective sequence is a heptapeptide (L271-A277; Kunapuli et al, J Biol Chem 271:11228, 1996). Kininogens inhibit thrombin binding to platelets and thus inhibit thrombin-induced aggregation. The molecular mechanism by which kininogens inhibit thrombin-induced aggregation of platelets is unknown. Thrombin has previously been shown to bind to two receptors on the platelet surface, glycoprotein (GP) Ib-IX-V complex and the hepta-spanning transmembrane receptor coupled to G protein(s). We now show that, unlike its effect on normal platelets, kininogen (2 μmol/L) did not inhibit the thrombin-induced aggregation of Bernard-Soulier platelets, which lack the GP Ib-IX-V complex, suggesting that kininogen interacts either directly or indirectly with that complex and restricts access by thrombin to this receptor. We further show that both recombinant K270-G292 polypeptide and the synthetic peptide L271-A277 derived from high molecular mass kininogen lower thrombin binding to platelets in a manner similar to monoclonal antibodies to or ligands (von Willebrand factor and echicetin) of GP Ib-IX. The anti–GP Ib-IX-V complex antibodies, TM-60 and SZ 2, can inhibit 125I-high molecular mass kininogen binding to platelets. Conversely, kininogen could block the binding of biotinylated TM-60 or of 125I-SZ 2. Kininogen inhibited the binding of biotinylated thrombin bound to a mouse fibroblast cell line transfected with the GP Ib-IX-V complex. These results indicated that kininogen binds to the GP Ib-IX-V complex modulating thrombin binding to platelets and the consequent platelet aggregation. Kininogen can thus serve as an important regulator of the early stages of platelet stimulation by thrombin.

This study, based in San Bernardino County, Southern California, collected and examined tap water samples within the area to explore the feasibility of adopting non-industrial equipment and methods to reduce water hardness and total dissolved solids(TDS). We investigated how water quality could be improved by utilizing water boiling, activated carbon and sodium bicarbonate additives, as well as electrolysis methods. The results show that heating is effective at lower temperatures rather than long boils, as none of the boiling tests were lower than the original value. Activated carbon is unable to lower TDS, because it is unable to bind to any impurities present in the water. This resulted in an overall TDS increase of 3.5%. However, adding small amounts of sodium bicarbonate(NaHCO3) will further eliminate water hardness by reacting with magnesium ions and improve taste, while increasing the pH. When added to room temperature tap water, there is a continuous increase in TDS of 24.8% at the 30 mg/L mark. The new findings presented in this study showed that electrolysis was the most successful method in eliminating TDS, showing an inverse proportion where an increasing electrical current and duration of electrical lowers more amounts of solids. This method created a maximum decrease in TDS by a maximum of 22.7%, with 3 tests resulting in 15.3–16.6% decreases. Furthermore, when water is heated to a temperature around 50°C (122°F), a decrease in TDS of around 16% was also shown. The reduction of these solids will help lower water hardness and improve the taste of tap water. These results will help direct residents to drink more tap water rather than bottled water with similar taste and health benefits for a cheaper price as well as a reduction on plastic usage.

Abstract Abstract 472 To maintain hemostasis, the human body uses more that 7,000 platelets/μl of blood a day; 3.5 billion platelets a day in a 70 kg adult male. Lack of fully functional platelets results in bleeding disorders such as Bernard-Soulier syndrome, Glanzmann thrombasthenia and platelet-type von Willebrand disease. It is becoming increasingly well appreciated that in addition to their hemostatic role, platelets play important roles in inflammation and wound healing. The initial step of platelet adhesion is mediated by the glycoprotein (GP) Ib-IX-V complex on the platelet surface, which binds von Willebrand factor (VWF). This interaction leads to activation of the integrin αIIbβ3, platelet arrest, and spreading and aggregation. The GPIb-IX-V complex also has a key role in inflammation, mediating a key interaction of platelets with leukocytes by binding the integrin Mac-1 (αMβ2, CD11b/CD18). This interaction mediates the firm adhesion of leukocytes on platelet thrombi, enabling their migration through the thrombus into the vessel wall. Interestingly, the insert domain (I-domain) of the αM subunit of Mac-1 has a similar 3-dimensional structure to the A1 domain of VWF. Our previous studies showed that the I-domain of Mac-1 binds the C-terminal flanking sequence of GPIbα (Phe201-Gly268), demonstrated by the ability of the anti-GPIbα monoclonal antibody AP1 to inhibit the interaction. The epitope of AP1 has been mapped to a 10-amino acid sequence spanning Arg218 to Tyr228. In the current investigation, we constructed a series of cell lines expressing mutants of human GPIbα, either by replacement of the human sequence with the corresponding dog sequence (dog GPIbα does not bind human Mac-1) or by targeted mutagenesis, and tested their ability to bind the recombinant αM I domain. TheGPIbα region Phe201–Asn223 was crucial for Mac-1 binding, with residues Arg218, Asp222 and Asn223 playing vital roles. In addition, a peptide containing the AP1 epitope (Leu214–Val229) bound αM I-domain specifically and saturably. Peptide binding was blocked by LPM19c, a monoclonal anti-αM I-domain antibody, and soluble GPIbα, and by the M2 peptide, which corresponds to the GPIbα–binding site in the αM I domain (Phe201–Lys217). Peptide binding was also blocked by an antibody against the M2 sequence. The AP1 peptide inhibited the attachment of GPIb-IX complex–expressing CHO cells to immobilized αM I domain, and the adhesion of THP-1 cells—a monocytic cell line expressing Mac-1—to immobilized GPIbα. In summary, we have defined the GPIbα sequence Arg218 to Ala224 as a critical binding site for Mac-1. Because a peptide corresponding to this region inhibits GPIbα binding to Mac-1 but blocks neither platelet adhesion to immobilized VWF nor thrombin-induced platelet aggregation, it has potential to guide the development of agents that will specifically inhibit leukocyte-platelet complexes that promote vascular inflammation. Disclosures: No relevant conflicts of interest to declare.

Abstract Abstract 3044 Poster Board II-1020 ADAMTS-13 cleaves high molecular weight von Willebrand factor (VWF) realeased by the endothelium in order to prevent massive intravascular platelets adhesion and aggregation as pathologically observed in thrombotic thrombocytopenic purpura. ADAMTS-13 is present at low levels in plasma. We therefore surmised that platelets are able to specifically bind the metalloprotease on their surface, hereby concentrating the enzyme where it is most required. Immunofluorescent studies were then performed to see whether or not ADAMTS-13 bound to the platelet plasma membrane using as primary antibody a murine anti-human ADAMTS-13 monoclonal antibody (13E2). A positive membrane fluorescent signal was detected using as a source of platelets either a normal donor or a patient with type III Von Willebrand disease, demonstrating that ADAMTS-13 is located on the platelet surface independently from VWF. This results were confirmed by flow cytometry analysis. In all 10 normal individuals tested 13E2 binding to not-permeabilized platelets was detected with a FITC antimurine secondary antibody. With this as background, 96 wells polystyrene NUNC plates were coated either with albumin or fibrinogen or VWF or recombinant ADAMTS-13 (each at 10 μg/ml) and then blocked with 5% albumin overnight. Washed platelets (100,000/μl), incubated with divalent cations, were then let adhere to the wells for 1 hr at 37°C. After extensive washing adherent platelets were lysed, p-nitrophenilphosphate was added and the reaction was stopped with NaOH 2M. Detection was done by assessing optical density at 405 nm. Binding of washed platelets preincubated with 2mM CaCl2 and/or 2mM MgCl2 to wells covered with immobilized recombinant ADAMTS-13 was significantly higher than binding to wells coated with albumin (p<0.001), was at the same levels of the binding to wells covered with recombinant VWF and approximately half of binding to the wells coated with fibrinogen. When washed platelets were preincubated with EDTA 2mM binding to the wells coated with fibrinogen or recombinant ADAMTS-13 decreased at the same degree of the wells covered with albumin Activation of platelets, obtained by preincubating platelets with ADP (5 μM) or collagen (10 μg/ml), significantly increased their binding to recombinant ADAMTS-13 (p<0.001) as compared to the binding of non-activated platelets. In a set of experiments platelets were preincubated with blocking antibodies against αaIIbβ3 or GpIb (10 μg/ml) or murine IgG. did not effect the levels of binding to recombinant ADAMTS-13 while the binding to fibrinogen and VWF was totally abolished. To confirm the data washed platelets obtained from a patient with Bernard-Soulier syndrome (BSS) in which GpIb/IX/V expression was below 1% were let adhere to wells covered with albumin, fibrinogen, VWF or recombinant ADAMTS-13 and platelet adhesion was detected as above: while adhesion to fibrinogen was normal, platelets not expressing Gpib/IX/V did not adhere to VWF or ADAMTS-13. In conclusion we demonstrated that platelets bind ADAMTS-13 on their surface through GpIb/IX/V; the binding is specific, activation and divalent cations dependent, inhibited by EDTA, and not mediated by VWF on the membrane of platelets. Disclosures No relevant conflicts of interest to declare.

Car Heinrich II. darovao je u Bambergu dana 16. travnja 1015. godine savinjskom grofu Wilhelmu, starijem sinu svoje nećakinje, koruške kneginje Eme od Friesacha i Zeltschacha, vilu Trakošćan i 30 kraljevskih seoskih gazdinstava te sve što on, car, posjeduje na području Wilhelmove markgrofovije između rijeka Save, Savinje, Sutle i Mirne. Wilhelmova majka Ema rođena je 983. godine na dvorcu Peilenstein (slov. Pilštanj) od oca Elgelberta von Peilensteina i majke Tute. Odrasla je na dvorcu cara (sv.) Heinricha II. i njegove žene (sv.) Kunigunde. Udala se za Wilhelma II. od Friesacha, Zeltschacha i Truxena. Nakon pogibije obojice sinova (1030.) i smrti supruga (1036.) osnovala je veliki broj crkava, podigla ženski benediktinski samostan u Gurku (Krško) te omogućila osnivanje krške biskupije. Veliki dio svojih posjeda poklonila je salzburškom biskupu Baldwinu u svrhu osnivanja benediktinskog samostana u Admontu. Pokopana je u novoj kripti krške katedrale 1174., beatificirana 1287., a kanonizirana 1938. god., iako je proces proglašenja sveticom počeo već sredinom 15. stoljeća. Među dvorcima koje je poklonila krškoj biskupiji nije naveden Trakošćan. Umrla je na Dan sv. Petra i Pavla 29.lipnja, ali joj se blagdan slavi dva dana ranije, 27.lipnja. Zaštitnica je trudnica, slijepih i nepokretnih osoba. Atributi su joj ruža i katedrala, a ponegdje i povelja koju drži u rukama. Svojom sveticom smatraju je Slovenci, Austrijanci i Nijemci. Nakon smrti njezinog supruga Wilhelma II. savinjski markgrof postaje Emin rođak grof Askuin Plain. Njega nasljeđuje sin Starhand I., a Starhanda I. sin Starhand II. koji je imao braću Ulrika, Weriganda i Bernarda. Starhand II. u ratnom pohodu gubi svoju markgrofoviju, a dobiva je Pilgrim Hohenwart. Njegov sin Ginter kratko vrijeme vlada savinjskom markgrofovijom, da bi je ponovo preuzeo Pilgrim. Nakon Pilgrimove smrti car Konrad III. tu markgrofoviju 1149. predaje Otokaru I. Štajerskom. Tim činom je Celje zvanično sjedinjeno sa Štajerskom. Godine 1341. u Münchenu car Ludwig IV. imenuje Miroslava [Friedricha] Savinjskog prvim celjskim grofom. Celjski grofovi će vladati ukupno 115 godina. Nakon pogibije posljednjeg celjskog grofa Ulrika II. 1456. god. posjedi celjskih grofova se dijele. Češki plemić Jan Vitovec postaje kapetan celjske grofovije. 1459. od cara dobiva Krapinu, a godinu dana kasnije i Zagorsku grofoviju. Udovici Ulrika II. Katarini car namjenjuje, među ostalim, i nekoliko hrvatskih mjesta, dok je ostatak „mjesta, trgova i gradova“ koji su bili u vlasništvu celjskih grofova, a nalazili se na području Hrvatske, vraćen hrvatskoj kruni. Među njima je naveden i Trakošćan (Trakenstein).

Abstract A W127X mutation in platelet glycoprotein (GP)IX is the most common genetic defect in Japanese Bernard-Soulier Syndrome (BSS). Patients having this mutation are often misdiagnosed as having immune thrombocytopenia (ITP) because of residual expression of GPIbα on the platelet surface. The purpose of the present investigation was to determine whether the residual amount of GPIbα present on the surface of GPIXW127X BSS platelets might be sufficient to support adhesive functions of the GPIb complex. Flow cytometric analysis of platelets from our GPIXW127X BSS patient revealed 7–11% of the normal level of GPIbα (3,700 receptors/platelet), although the expression of GPIbα estimated by western blot analysis was only 1% of normal. Expression levels of other receptors such as GPIIb, GPVI, and α2 integrin were 3–4 times higher per platelet than that of normal controls–probably due to the increased size of the BSS platelets. To characterize the ability of GPIXW127X BSS platelets to bind VWF, we evaluated their agglutination in the presence of various concentrations of ristocetin, and found that ristocetin-induced agglutination was absent at 1.2 and 1.5 mg of ristocetin/ml, but present at 2.0 mg/ml. We then evaluated the ability of GPIXW127X BSS platelets to adhere under conditions of flow to immobilized VWF, type 1 collagen, and type III collagen. Whereas platelets derived from a Type I BSS patient having a TGTG deletion within the GPIbα gene in which GPIbα is completely absent (Thrombosis and Haemost 77:1055,1997) were unable to adhere to immobilized VWF under conditions of high shear, GPIXW127X BSS platelets bound well, demonstrating that the residual amount of GPIbα present GPIXW127X BSS platelets is sufficient to mediate adhesion to VWF. Finally, recent studies (J Thromb Haemost 5:797,2007) have shown that platelet adhesion to Type III collagen can be mediated by either interaction of GPIbα with VWF, or by interaction of the integrin α2β1 with collagen under high shear flow. In support of this notion, adhesion of GPIbαTGTG del BSS platelets to immobilized Type III collagen could be completely inhibited by addition of the anti-α2β1 blocking mAb, Gi9, while adhesion of GPIXW127X BSS platelets to Type III collagen was only marginally affected. Taken together, we conclude that platelets having a W127X mutation in GPIX express residual amounts of functional GPIbα, and both GPIb-VWF and integrin α2β1-collagen interactions are physiologically important under conditions of high shear stress. Residual expression of GPIbα in GPIXW127X platelets, therefore, likely accounts for the relatively mild bleeding phenotype in this variant form of BSS.

Abstract The binding of platelet membrane GPIb-IX-V to extracellular matrix proteins and von Willebrand factor initiates the adhesion, spreading and activation of platelets. On the other hand, tissue factor (TF) triggers the blood coagulation by binding FVII/VIIa. In resting platelets, TF is stored mainly as a non active (“encrypted”) form, possibly through a dimer- or heterodimer complex. The encryption seems not to affect the TF capacity to bind FVII and VIIa, in such form that the membrane-based complex would be “primed” to trigger the clot formation upon platelet activation. Accordingly, the platelet adhesion and activation would be tightly interwoven with thrombin generation. Given the described localization of GPIbα in platelet lipid rafts, which appears to modulate its activity, we investigated whether TF is also present in these cholesterol-rich domains of the platelet membrane. Continuous sucrose gradients generated by ultracentrifugation at 180.000g x 18h at 4°C were used to obtain cholesterol-rich fractions from platelet lysates (1% Triton X-100 at 4°C). Western blots of each gradient fraction using a polyclonal anti-TF antibody revealed a protein of ~60kDa only in the fractions rich in cholesterol (using flotillin-1 as a marker). TF-dependent procoagulant activity (PCA), assessed by FXa generation was measured in resting and 5μM TRAP-stimulated, leukocyte-free platelets. In both cases, PCA was reduced after membrane cholesterol depletion with methyl-β-cyclo-dextrin. We also found that PCA was significantly enhanced in washed platelets treated with VWF and ristocetin, suggesting some form of functional or structural relationship between GPIb-IX-V complex and TF. GPIb-IX was immunoprecipitated (IP) from human platelet membranes by anti-GPIbα MoAbs (AP-1 or SZ2), in both resting and stimulated platelets (TRAP or VWF-ristocetin). The IP product was revealed with MoAb anti-TF (American Diagnostica, clone 4509) or polyclonal anti-TF, detecting a protein of ~47kDa. When we used MoAb anti-TF for the IP and MoAb anti-GPIX (BL-H6, anti-CD42a) to reveal the western blot, two distinct bands of ~22 and ~47kDa were disclosed, probably corresponding to GPIX and a heterodimer of GPIX and TF, respectively. These observations indicate that, at least a fraction of the platelet TF is localized in lipid rafts and that TF is also in close association with the GPIb-IX-V complex. This co-localization probably has important functional implications as demonstrated by the defective thrombin generation in patients with Bernard-Soulier syndrome. Moreover, this functional association may be relevant in both normal hemostasis and thrombus formation and growth.

Abstract HIb-1 is a single chain antibody (ScFv) originally obtained from the Griffin.1 library. ScFv from this library are derived from the in vitro recombination of germline human immunoglobulin VH and VL chain segments whose diversity has been greatly increased by mutagenesis directed at the CDR3 regions. HIb-1 was selected from the library by sequential biopanning first against CHO cells surface-expressing human GPIbα, and then against human platelets. Previous studies using Western blot analysis have shown that HIb-1 binds to an epitope within the 45 kDa amino-terminal portion of GPIbα (Lapan, Lyle, and Miller, 1999, Thromb. Haemost. 82S:393). HIb-1 displays inhibitory activity against both ristocetin-induced and shear-induced platelet aggregation. Biacore surface plasmon resonance analysis was used to establish dissociation constants between HIb-1and either the extracellular domain of GPIbα (i.e., “glycocalicin” or GC) derived from normal human platelets or the CHO-cell secreted GPIbα1–483 recombinant extracellular protein. With native GC immobilized on dextran sulfate, the KD for binding by analyte HIb-1 was ~600nM. With the wild-type recombinant GPIbα1–483 bound to dextran sulfate, the KD was only slightly higher at ~900 nM. We additionally studied a double mutant increase-of-function GPIbα1-483 containing the Gly233→Val233 and Met239→Val239 substitituions. The KD of HIb-1 binding to the double mutant was virtually identical to that of the wild-type, at ~900 nM. Binding of HIb-1 to native GC immobilized in an ELISA assay format was also performed. HIb-1 showed saturable binding, with a half-maximal binding concentration of approximately 170 nM. Flow cytometric analysis was also performed on platelets from murine GPIbα-null (i.e., “Bernard-Soulier”) mice that had been rescued with the human GPIbα transgene (Ware, Russell, and Ruggeri, 2000, PNAS, 97:2803), as well as upon normal mice. Murine platelets were gated using a rat anti-murine GPIIb/IIIa antibody. HIb-1 did not bind to normal murine platelets, but showed strong binding to platelets from the transgenic animals, comparable in intensity to that seen with the GPIbα mab SZ-2 (for which quantitative bead analysis indicated approximately 8,000 GPIbα receptors per platelet). It should be noted that the binding capabilities of HIb-1 to human GPIbα are those of a monovalent ScFv molecule of approximately 30 kDa, and may be sufficient for studies of in vivo GPIbα inhibition either in the case of acute injury model or of longer-term models involving repeated dosing. Model systems of more chronic inhibition, however, may require conversion of the ScFv into IgG molecules, in order to achieve greater avidity.

Abstract We have recently documented the existence of a cross-talk between platelet integrins α2β1 and αIIbβ3 involving phospholipase C (PLC)-mediated activation of the small GTPase Rap1b (Bernardi B et al, Blood2006; 107:2728–35). Here we report that integrin α2β1-mediated platelet adhesion to monomeric collagen and to other specific ligands, such as decorin and collagen-derived peptides, actually induced a robust activation of PLC, evaluated as phosphorylation of pleckstrin, the main platelet substrate for protein kinase C. This was paralleled by a robust tyrosine phosphorylation of the PLCγ2. We found that inhibition of Src kinases by PP2 completely abolished integrin α2β1-promoted PLCγ2 tyrosine phosphorylation, but did not affect either Rap1b stimulation or integrin αIIbβ3 activation in adherent platelets. Surprisingly, phosphorylation of pleckstrin occurred normally under conditions in which tyrosine phosphorylation of PLCγ2 was totally suppressed. The Src-kinase-independent PLC activity in integrin α2β1-adherent cells was not inhibited by pretreatment of platelets with aspirin and apyrase, excluding any possible contribution of Gq-regulated PLCβ isoforms stimulated by released thromboxane A2 or secreted ADP. In addition, PLC-dependent activation of Rap1b and integrin αIIbβ3 were not affected by aspirin and apyrase. Phosphorylation of pleckstrin induced by adhesion to monomeric collagen was not detected in platelets from PLCγ2 knockout mice, confirming that this was the only isoform activated downstream of integrin α2β1. In addition, mouse platelets lacking PLCγ2 showed impaired integrin α2β1-mediated outside-in signaling, and were unable to promote both GTP binding to Rap1b and integrin αIIbβ3 activation. These results indicate that although PLCγ2 is the only PLC isoform stimulated downstream integrin α2β1 and is responsible for the cross-talk to integrin αIIbβ3 through the small GTPase Rap1b, its activation in adherent platelets can occur independently of Src-mediated tyrosine phosphorylation. A recent work has reported that, in vitro, the activity of PLCγ2, but not that of PLCγ1, can be stimulated by the active, GTP-bound form of the small GTPase Rac, with a mechanism independent of phosphorylation on tyrosine residues (Piechlek T el al, J Biol Chem2005; 208:38923–31). In platelets adherent through integrin α2β1, Rac was found to be activated upstream PLC. Activation of Rac was efficiently prevented by the inhibitor NSC23766, which is able to bind and block Rac-specific GEFs. In integrin α2β1-adherent platelets, inhibition of Rac by NSC23766 did not affect PLCγ2 tyrosine phosphorylation and activation of PLC and Rap1b. However, upon inhibition of Src kinases by PP2 and consequent prevention of PLCγ2 tyrosine phosphorylation, NSC23766 almost completely abolished PLC activation, GTP binding to Rap1b and integrin αIIbβ3 stimulation. These results demonstrate that PLCγ2 is the main PLC isoform involved in integrin α2β1-mediated activation of Rap1b and integrin αIIbβ3, and that its activation can occur through two alternative mechanisms involving either tyrosine phosphorylation or stimulation by Rac GTPase.

Abstract Abstract 3886 Introduction: As previously published by Di Bernado et al. (2008) the single nucleotide polymorphism (SNP) RS872071 located in the 3'UTR of IRF4 (Interleukin Regulatory Factor 4) has influence on the risk for developing chronic lymphocytic leukemia (CLL). IRF4 is a key player in the development of B lymphocytes and multiple myelomas. The SNP is either expressed as Adenine (A) or Guanine (G). Expression of G/G increases the risk to develop CLL. MicroRNAs (miRNAs) adhere posttranscriptional to the 3'untranslated region (UTR) of mRNAs and can influence the expression of mRNA and proteins. The SNP lies within the 3'UTR of IRF4 and offers some putative binding sites for miRNAs. The aim of this project is to proof that this SNP has influence on the binding behavior of miRNAs, which are influencing the IRF4 expression. Methods and results: To identify miRNAs binding to this region we cloned the neighboring region of the SNP into a luciferase expressing vector and generated the SNP by mutagenesis. In luciferase assays 15 miRNAs were checked for differences in binding affinity dependent on SNP expression. Three of them showed significant SNP dependent binding behavior. In all cases expression of SNP G leads to reduced luciferase expression, indicating suppression of IRF4. To elucidate the consequences on SNP expression on cellular level in CLL we collected DNA derived from B cells of CLL patients (n=104) and sequenced the SNP region. All together our pool of patients expressed 25% A/A, 31% A/G and 44% G/G. MRNA and protein expression of IRF4 was considered SNP-dependently and compared to healthy B cells. On mRNA and protein level CLL cells have a significant higher IRF4 expression compared to healthy B cells. SNP-dependent comparison between CLL cells on mRNA-level shows a tendency of less IRF4 expression in B cells of patients expressing the G/G SNP compared to patients expressing A/A SNP. However on protein level this tendency was not detected. As IRF4 is known as a key regulator for extracellular stimuli, we focused on SNP dependent IRF4 regulation after different stimuli. Whereas CD40 and IL-4 stimulation did not show SNP dependent regulation, stimulation of the B cell receptor (BCR) leads to a higher IRF4 induction in patients carrying A/A (n=6) compared to patients carrying G/G (n=5) and A/G (n=8) (p<0.05). Conclusion: For the first time connections between the SNP RS872071 and molecular mechanisms explaining his influence on the pathogenesis on CLL were drawn. Dependent on expressed SNP miRNAs bind with different affinities to the 3'UTR. In further experiments the connection between IgM stimulation and miRNA expression has to be tightened. Disclosures: No relevant conflicts of interest to declare.

Dette nummer handler om det moderne arbejdslivs belastninger. De seneste år har en række analyser og rapporter peget på problemer i det psykiske arbejdsmiljø med udbrændthed og stress til følge. De tegner billedet af et moderne arbejde, som kræver ansvarlighed, fleksibilitet, selvstændighed og engagement. Ja, det ikke blot kræver, det tilbyder, udfordrer og lokker. arbejdet er forførende og kalder på personligheden. Men som det hedder i en undersøgelse af FTF'ernes psykiske arbejdsmiljø: 'Det slider på sjælen'. Ved siden af de konkrete undersøgelser har flere generelle diagnoser på det fleksible arbejdsliv vundet stor genklang også i Danmark. Det er blandt andet Richard Sennetts bog 'The corrosion of character' og Arlie Hochschilds 'The time bind', som begge beskriver, hvordan arbejdslivet invaderer andre livsområder og undergraver personligheden. Vi ønsker med dette nummer at se nærmere på, om det moderne arbejde, det såkaldt 'fleksible arbejde' adskiller sig fra det traditionelle arbejde-ikke blot ved dets større frihedsgrader, åbenhed og alsidighed, men også ved dets belastninger. Det traditionelle arbejde var styret i detaljer fra oven via en hierarkisk og bureaukratisk organisation. Taylorismen betragtede medarbejderne som anonyme arbejdsmaskiner og drev rovdrift på dem ved en stærkt ensidig udnyttelse af deres arbejdsevner. Mennesket var et upersonligt led i en rationel produktionsmaskine. Det var rationelt, men 'et rationelt vanvid' ifølge Bernard Dorays' (1988) analyse af taylorismen og fordismen. Det fremmedbestemte arbejde gav kun få muligheder for autonomi, personlig indlevelse eller oplevelse af mening. Produktionen købte menneskers arbejdskraft, ikke deres person. I det traditionelle arbejde var subjektiviteten uønsket, det var et forstyrrende element, der skulle fjernes gennem detaljerede forskrifter for arbejdets udførelse. Hvad arbejderen mente og tænkte og følte, var i princippet ligegyldigt, hvis hun bare kom til tiden og gjorde, som der blev sagt. Sådan som det stadig kan gælde visse steder i dag på danske slagterier og andre samlebåndsfabrikker. Den tilsyneladende fremmedgørelse og instrumentalisering af arbejdet viste imidlertid kun en side af historien. For det første fordi produktionen aldrig i praksis kunne køre efter den 'videnskabelige ledelses' rationelle principper. Der var altid brug for menneskelig indgriben og omtanke, også fra manden på gulvet. For det andet fordi medarbejderne selv i det underordnede og rutineprægede arbejde søger mening, udfoldelse og bekræftelse. De forsøger at identificere sig med arbejdets indhold og at opleve arbejdet meningsfuldt-ofte på trods af dårlige vilkår. Og endelig fik den rationelt organiserede industriproduktion sit eget modstykke i den organiserede arbejderbevægelse. Den sikrede den sociale integration af arbejderne både i et stærkt socialt fællesskab på arbejdspladsen og i velfærdsstaten. Den kollektive organisering og det organiserede arbejdsmarked bidrog til at afbøde en del af det traditionelle arbejdes belastninger-både meningsløsheden og nedslidningen. Faktisk er det sådan, at industrisamfundet i dag er kommet til at fremstå som den meningsfulde, trygge og stabile orden over-for det moderne, fleksible arbejdssamfunds opløsende kræfter. Det gælder for eksempel i den nævnte bog af Richard Sennetts, som

<p class="MsoNormal" style="margin: 0cm 0cm 0pt; line-height: 150%;"><span style="line-height: 150%; font-size: 12pt; mso-ansi-language: ES-AR;"><span style="font-family: Times New Roman;">RESUMEN</span></span></p><p class="MsoNormal" style="margin: 0cm 0cm 0pt; line-height: 150%;"><span style="line-height: 150%; font-size: 12pt; mso-ansi-language: ES-AR;"><span style="font-family: Times New Roman;">Introducción: La luxo-fractura de la columna cervical asociada a lesión neurológica durante el nacimiento es infrecuente, y solo se diagnostican el 10% de estas lesiones. En su gran mayoría se asocian a mecanismos de hiperextensión cefálica intrauterina o tracción axial durante el parto distócico.</span></span></p><p class="MsoNormal" style="margin: 0cm 0cm 0pt; line-height: 150%;"><span style="font-family: Times New Roman;"><span style="line-height: 150%; font-size: 12pt; mso-ansi-language: ES-AR;">Material y método<strong style="mso-bidi-font-weight: normal;"><span style="text-decoration: underline;">:</span> </strong></span><span style="color: black; line-height: 150%; font-size: 12pt;" lang="ES">Se presentaron 4 casos de pacientes recién nacidos a término con antecedentes de parto vaginal distócico de hombros, derivados a nuestra institución de Maternidades locales entre los años 2006 y 2011. Tres pacientes presentaron cuadriplejia fláccida </span><span style="line-height: 150%; font-size: 12pt; mso-ansi-language: ES-AR;">y ausencia de respiración espontánea. Las radiografías mostraron luxación traumática de columna cervical subaxial y en la Resonancia Magnética edema y hemorragia medular en el nivel comprometido. Los potenciales evocados somatosensitivos patológicos mostraron interrupción completa de la conducción y la Electromiografía evidencio la deferentación completa de ambos nervios frénicos. En el cuarto caso la luxo-fractura cervical se asocio a una lesión completa del Plexo Braquial derecho, con indemnidad medular, presentándose clínicamente con una monoplejia fláccida de Miembro Superior derecho, Eupneico y con Síndrome de Claude Bernard Horner asociado. </span></span></p><p class="MsoNormal" style="margin: 0cm 0cm 0pt; line-height: 150%;"><span style="line-height: 150%; font-size: 12pt; mso-ansi-language: ES-AR;"><span style="font-family: Times New Roman;">Todos los pacientes fueron inmovilizados con collar blando en el Servicio de Neonatología; en 2 pacientes se realizo estabilización quirúrgica de la lesión dentro de los primeros días de vida, logrando una reducción y consolidación satisfactoria, uno de ellos evidencio franca y progresiva recuperación neurológica en el postoperatorio.</span></span></p><p class="MsoNormal" style="margin: 0cm 0cm 0pt; line-height: 150%;"><span style="font-family: Times New Roman;"><span style="color: black; line-height: 150%; font-size: 12pt;" lang="ES">Conclusión<strong style="mso-bidi-font-weight: normal;">: </strong></span><span style="line-height: 150%; font-size: 12pt; mso-ansi-language: ES-AR;">La estabilización y descompresión quirúrgica es la mejor alternativa de tratamiento en pacientes con luxo-fractura cervical, a fin de conservar e incluso mejorar la recuperación neurológica. Además permite un mejor manejo de las co-morbilidades que acompañan al recién nacido con déficit neurológico severo.</span></span></p><p class="MsoNormal" style="margin: 0cm 0cm 0pt; line-height: 150%;"><span style="line-height: 150%; font-size: 12pt; mso-ansi-language: ES-AR;"><span style="font-family: Times New Roman;">PALABRAS CLAVES</span></span></p><p class="MsoNormal" style="margin: 0cm 0cm 0pt; line-height: 150%;"><span style="line-height: 150%; font-size: 12pt; mso-ansi-language: ES-AR;"><span style="font-family: Times New Roman;">Luxación traumática. Columna cervical. Recién nacidos. Parto vaginal distócico.</span></span></p>

Little cherry virus 2 (LChV2; genus Ampelovirus, family Closteroviridae) is associated with Little Cherry Disease (LCD), one of the most economically destructive diseases of sweet cherry (Prunus avium (L.)) in North America (1). Since 2010, incidence of LCD associated with LChV2 confirmed by reverse transcription (RT)-PCR assays has increased in orchards of Washington State. LChV2 was known to be transmitted by the apple mealybug (Phenacoccus aceris (Signoret)) (3). However, the introduction of Allotropus utilis, a parasitoid platygastrid wasp (2) for biological control, contributed to keeping insect populations below the economic threshhold. In recent years, the population of grape mealybug (Pseudococcus maritimus (Ehrhorn)) increased in cherry orchards of Washington State (Beers, personal observation). Since grape mealybug is reported to transmit Grapevine leafroll associated virus 3 (Ampelovirus) in grapevine (4), this study investigated whether this insect would also transmit LChV2. A colony of grape mealybugs on Myrobalan plum (Prunus cerasifera Ehrh.) trees was identified visually and morphologically from slide mounts. In a growth chamber, first and second instar crawlers were fed on fresh cut shoots of sweet cherry infected with a North American strain (LC5) of LChV2. After an acquisition period of 7 days, 50 crawlers were transferred to each young potted sweet cherry trees, cv. Bing, confirmed free from LChV2 by RT-PCR. This process was repeated in two trials to yield a total of 21 potted trees exposed to grape mealybug. One additional tree was left uninfested as a negative control. After 1 week, the trees were treated with pesticide to eliminate the mealybugs. Two to four months after the inoculation period, leaves were collected from each of the recipient trees and tested by RT-PCR for the presence of LChV2. To reduce the possibility of virus contamination from residual mealybug debris on leaf surfaces, the trees were allowed to defoliate naturally. After a 3-month dormant period, the new foliage that emerged was then tested. Two sets of primers: LC26L (GCAGTACGTTCGATAAGAG) and LC26R (AACCACTTGATAGTGTCCT) (1); and LC2.13007F (GTTCGAAAGTGTTTCTTGA) and LC2.14545R (CATTATYTTACTAATGGTATGAC) (this study) were used to amplify a partial segment of the replicase gene (409 bp) and the complete (1,080 bp) coat protein gene of LChV2, respectively. Of 21 trees tested, 18 yielded positive results for LChV2. The reaction products from six randomly selected trees were cloned and the virus identity was verified by sequencing. The sequences of RT-PCR amplicons from both primer pairs showed ≥99% identity to LChV2, strain LC5 (GenBank Accession No. AF416335). The result confirmed that P. maritimus transmits LChV2, a significant finding for this cherry production region. Grape mealybug is of increasing concern in the tree fruit industry because it is difficult to control in established orchards. The presence of infested orchards that serve as reservoirs of both LCD and this insect vector present a challenge for management. To the best of our knowledge this is the first report to show transmission of LChV2 by grape mealybug. References: (1) K. C. Eastwell and M. G. Bernardy. Phytopathology 91:268, 2001. (2) C. F. W. Muesbeck. Can Entomol. 71:158, 1939. (3) J. R. D. Raine et al. Can. J. Plant Pathol. 8:6, 1986. (4) R. Sforza et al. Eur. J. Plant Pathol. 109:975, 2003.

Resumo: O presente artigo, em forma ensaística, não pretende expor nenhuma teoria kierkegaardiana da educação. Antes se esforça por remover alguns mitos a respeito da própria educação de Kierkegaard, e para tanto busca basicamente enfatizar o lado saudável de uma figura materna – em geral ignorada ou menosprezada pelos comentadores. Além disso, denuncia preconceitos de interpretações dinamarquesas, alemãs, francesas e brasileiras.Palavras-chave: Søren Kierkegaard. Ane Sørensdatter Kierkegaard. Georg Brandes. Casamento e procriação. Relações mãe/filho. Psicólogos e problemas psicológicos. Abstract: The present article, in essayistic form, does not intend to expose any kierkegaardian theory of education. It rather makes an effort to remove some myths about Kierkegaard’s own education, in order to which it tries basically to emphasize the sound, wealthy side of a maternal-figure – generally ignored or disdained by several commentators. Beyond, it denounces some prejudices of Danish, German, French and Brazilian interpretations.Keywords: Søren Kierkegaard. Ane Sørensdatter Kierkegaard. Georg Brandes. Marriage and procreation. Mother/son relations. Psychologists and psychological problems. REFERÊNCIASBRANDES, Georg. Nietzsche: Un ensayo sobre el radicalismo aristocrático. Traducción de José Liebermann. México: Sexto piso, 2004.GARFF, Joakim. SAK. Søren Aabye Kierkegaard: En Biografi. København: Gads Forlag, 2000.HIMMELSTRUP, Jens (Udg.). Søren Kierkegaard: International Bibliografi. København: Nyt Nordisk Forlag – Arnold Busk, 1962.HIRSCH, Emanuel. Kierkegaard-Studien, Band 1. (Gesammelte Werke 11.) Waltrop: Spenner, 2006. (Neu herausgegeben und eingeleitet von H. M. Müller. – Reprodução dos originais de 1930-33).JASPERS, Karl. Psicopatología General. Traducción de la 5a. ed. alemana por Roberto Saubinet y Diego Santillan. Buenos Aires: Bini, 1950._______. Psychologie der Weltanschauungen: Fünfte, unveränderte Auflage. Berlin-Göttingen-Heidelberg: Springer 1960. (1919)KIERKEGAARD, Søren A. O Conceito de Ironia constantemente referido a Sócrates. Tradução de Álvaro Valls. Petrópolis: Vozes, 1991._______. Migalhas Filosóficas: ou um bocadinho de filosofia de João Clímacus. Tradução de Álvaro Valls. Petrópolis: Vozes, 1995. (Ou: Tradução de José Miranda Justo. Lisboa: Relógio D’Água, 2012.)_______. In Vino Veritas. Tradução de José Miranda Justo. Lisboa: Antígona, 2005.KIERKEGAARD, Søren A. Ou – Ou: Um Fragmento de Vida (Primeira Parte). Tradução de Elisabete M. de Sousa. Lisboa: Relógio D’Água, 2013._______. Ou – Ou: Um Fragmento de Vida (Segunda Parte) Tradução de Elisabete M. de Sousa. Lisboa: Relógio D’Água, 2017._______. As Obras do Amor: Algumas considerações cristãs em forma de discursos. Tradução de Álvaro Valls. Petrópolis: Vozes; Bragança Paulista: Ed. Univ. São Francisco, 2005._______. Diapsalmata. Tradução, Notas e Posfácio de Nuno Ferro e M. J. de Carvalho et al.. Lisboa: Assírio & Alvim, 2011._______. Do Desespero Silencioso ao Elogio do Amor Desinteressado: Aforismos, novelas e discursos de Søren Kierkegaard. Tradução de Álvaro Valls. Porto Alegre: Escritos, 2004.KIRMMSE, Bruce. Kierkegaard In Golden Age Denmark: Bloomington & Indianapolis: Indiana University Press, 1990.KIRMMSE, Bruce (Org.). Encounters With Kierkegaard: A Life as Seen by His Contemporaries. Princeton, NJ: Princeton University Press, 1996.KJÆR, Grette. Den Gådefulde Familie: Historien bag det Kierkegaardske Familiegravsted. København: Reitzels Boghandel, 1981.MALIK, Habib C. Receiving Søren Kierkegaard: The Early Impact and Transmission of His Thought. Washington D.C.: The Catolic University of America Press, 1997.MESNARD, Pierre. Le Vrai Visage de Kierkegaard. Paris: Beauchesne, 1948.ODEN, Thomas (Org.) The Humour of Kierkegaard: An Anthology. Princeton and Oxford: Princeton University Press, 2004.POOLE, Roger & STANGERUP, Henrik (Org.). The Laughter Is on My Side: An Imaginative Introduction to Kierkegaard. Princeton, NJ: Princeton University Press,1989.STEWART, Jon. A History of Hegelianism in Golden Age Denmark. Tome I. The Heiberg Period: 1824-1836. Copenhagen: SKRC/Reitzel, 2007.THEUNISSEN, Michael. Der Begriff Ernst bei Sören Kierkegaard. Freiburg/München: Alber, 1978. (Com a dedicatória: “Meiner Mutter”!)VERGOTE, Henri–Bernard. Sens et repetition: Essai sur l’ironie kierkegaardienne. Tomes I et II. Paris: Cerf/Orante, 1982.WAHL, Jean. Études Kierkegaardiennes. 4e. édition. Paris: Vrin, 1974.

IntroductionThe study of genetic bleeding disorders provided the first link between platelet functions and specific membrane glycoproteins. Two examples are well known and have been the subject of numerous reviews. First, Glanzmann’s thrombasthenia is a bleeding disorder caused by a defect of platelet aggregation in which the glycoprotein αIIbβ3 (GP IIb-IIIa) is either lacking or is expressed but is defective.1 We now know that αIIbβ3 exists on the surface of unstimulated platelets in an inactive form but, through a process known as “inside-out” signaling, responds to platelet stimulation to become a receptor for soluble fibrinogen and von Willebrand factor (vWF) to mediate platelet aggregation. αIIbβ3 is also known to bind immobilized fibrinogen and, through a process known as “outside-in” signaling, to induce platelet stimulation.2 A second example is Bernard-Soulier syndrome, a bleeding disorder caused by the failure of platelets to bind to subendothelial matrices due to the lack of or defective GP Ib-IX-V.3 It is now known that GP Ib-IX-V binds to vWF to mediate the adhesion of unstimulated platelets to injured blood vessel walls.4,5 GP Ib-IX-V interactions also induce platelet stimulation, a process mediated by signaling through GP Ib-IX-V.6 The mechanisms responsible for the binding of adhesive proteins to αIIbβ3 and GP Ib-IX-V are beginning to be understood and, as such, targets for therapeutic intervention have been identified. Three parenteral αIIbβ3 antagonists have demonstrated a therapeutic benefit in large-scale clinical trials of acute coronary syndromes, including unstable angina, non Q-wave myocardial infarction, and percutaneous intervention, and are now commercially available.7 Many orally available αIIbβ3 antagonists are presently in clinical trials. Although GP Ib antagonists have not been pursued as aggressively, animal studies have shown that they do have a proven antithrombotic benefit.8 Despite these advances in the understanding of glycoprotein ligand binding and development of therapeutic antagonists of adhesive protein receptors, the mechanisms responsible for transducing signals through these receptors have remained elusive.It is now established that signal transduction reactions through αIIbβ3 and GP Ib-IX-V are not only involved in platelet aggregation to cause vessel occlusions, but also that glycoprotein signaling affects thrombus growth and stability, as well as the biology and perhaps the pathology of the vessels in which aggregates occur. In one example, platelet-derived growth factor (PDGF), secreted in response to αIIbβ3 signaling from the α-granules of aggregated platelets, is a primary smooth muscle cell mitogen and is believed to be involved not only in the response to vascular injury but also in atherosclerotic lesion progression.9,10 In another example, CD 154 (previously termed CD40 ligand) redistributes from α-granule membranes to the surface of aggregated platelets in response to αIIbβ3 signaling.11 CD 154 is an important inflammatory mediator that induces the release of cytokines from endothelial and smooth muscle cells, initiates vascular inflammation, and participates in atherosclerotic lesion progression.12 A third example involves the assembly of prothrombinase and factor Xase on the surface of aggregated platelets, enabling platelet thrombi to be procoagulant and accounting for the apparent anticoagulant activity of αIIbβ3 antagonists.13,14 In addition, platelet aggregates also display fibrinogen and vWF bound to platelet membrane glycoproteins that function to recruit additional platelets and, therefore, enhance thrombus growth.15 More recent data also indicate that platelet aggregation induces de novo protein synthesis.16,17 These and other events are secondary to the initial adhesion and aggregation reactions of platelets and are consequences of signaling reactions induced by the adhesion and aggregation receptors. Thus, characterization of the membrane glycoprotein signal transduction pathways has become essential, not only to understand platelet function, but also to determine whether there are additional ways by which platelet-mediated pathologies can be regulated.Platelet membrane glycoprotein signaling reactions either do not occur in nucleated cells normally used for transfection studies or are insufficiently characterized. Accordingly, the use of genetics to study mechanisms of platelet adhesive protein receptor signaling has been limited. The advent of technologies that facilitate genetic manipulations in the mouse genome has produced new ways to define protein function and determine the structure-function relationships of individual proteins and is proving of value in unraveling signal transduction pathways in platelets. Although one should always be cautious in extrapolating data from mouse to human platelets (as demonstrated by the PAR receptors, see below), it is impressive that much of what has been learned about platelets appears to apply to both mouse and human. Indeed, this review summarizes the status of genetic manipulations of the mouse genome that have contributed to our understanding of platelet membrane adhesion receptor signaling in platelets.

Abstract In an effort to map the selectivity and understand the mode of action of a CDK9 inhibitor (compound 1), we employed several orthogonal proteomics methods. Our results show a clear selectivity against the CDK family of kinases, with the highest specific affinity towards CDK9. In addition, our multi-method approach allows us to also map the protein binding sites of the inhibitor, identify non-kinase (off-) targets as well as detect the cellular molecular responses to the added inhibitor. Here we describe the methods used, their strengths and weaknesses, how they can be used in the drug discovery pipeline and how they synergize to provide mechanistic insights of compounds of interest. We have used chemoproteomics, kinase affinity tools (kinobeads), Cellular Thermal Shift Assay (CETSA) and Limited Proteolysis (LiP). The results obtained clearly show that CDK9 is the primary target of Compound 1, with affinity curves highly correlated between the different target deconvolution techniques. The chemoproteomic approach rely on a compound derivate, able to bind to a sepharose bead. Subsequently, the binding competition assays are performed on lysed cell material. The choice of a mild lysis buffer allowed us to identify, not only CDK9, but also it’s molecular partners in the p-Tefb complex (Cyclin T1, Cyclin T2 and Aff4) with similar concentration response behavior. The results for the kinases identified in the study were strikingly similar when also profiling the compound without the chemical modification using the kinobeads assay. In the CETSA experiments, where both lysed cells and intact cells were profiled, the lysate experiment most closely resembles that of the previous pull-downs. Here, only direct binders of Compound 1 show a thermal shift, for example several of the pulled down kinases but not the p-Tefb complex partners that were co-competed previously. In the intact cell version of CETSA, not only the direct binders of the compound show stability shifts, but also downstream events and other secondary modulatory effects leave thermal traces in the cell. For example, Compound 1 also binds to GSK3A/B, causing their melting temperature to increase. Inhibition of GSK3 further affects the phosphorylation state and cellular location of FOXK1, which in turn is identified as a destabilized protein. Finally, Limited Proteolysis was used to identify target protein and using the LiP-Quant approach their LiP scores were assigned. Further, out of the identified CDK targets, mapping of peptide cleavage pattern was performed for the members of the CDK family for which structural data is published. The result identified the peptides to be directly adjacent to the ATP binding pocket of CDK9 or regions of high homology. The use of complementary techniques, based on unique biological and biochemical processes, allow robust and confident characterization of inhibitor compounds. Citation Format: Adam Hendricks, Nigel Beaton, Alexey Chernobrovkin, Eric Miele, Ghaith Hamza, Piero Ricchiuto, Ronald Tomlinson, Tomas Friman, Cassandra Borenstein, Bernard Barlaam, Sudhir Hande, Chris De Savi, Rick Davies, Martin Main, Joakim Hellner, Kristina Beeler, Yuehan Feng, Roland Bruderer, Lukas Reiter, Daniel Martinez Molina, Maria Paola Castaldi. Target identification, selectivity profiling and mechanistic insights of a Cdk9 inhibitor using complementary proteomics methods [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2022; 2022 Apr 8-13. Philadelphia (PA): AACR; Cancer Res 2022;82(12_Suppl):Abstract nr 2924.

Abstract Attachment of platelets from the circulation onto a growing thrombus is a process involving multiple platelet receptors, endothelial matrix components and coagulation factors. It has been indicated that VWF crosslinks to polymerizing fibrin. Bound VWF further recruits and activates platelets via interactions with the platelet receptor complex glycoprotein Ib (GPIb). The aim of our study was to investigate the mechanism of VWF incorporation into a fibrin network and thereby characterize the role of VWF in arterial thrombus growth. We monitored the interactions of von Willebrand factor with fibrin(ogen) using different techniques and enzymes in purified test system at high shear stress. Applying surface techniques, ellipsometry and surface plasmon resonance, we real-time observed that VWF does not bind to either a fibrinogen monolayer or to a polymerized fibrin layer formed on the solid surface. However, we found proof for binding of VWF to a fibrin monomer layer during the process of fibrinogen-to-fibrin conversion in the presence of thrombin. Using either Arvin (cleaves FpA but not FpB) or protease III from snake venom Crotalus atrox (cleaves 42 amino acids, where FpB is located) we were able to show that VWF interacts with fibrin monomers. Furthermore, using transmittance measurements we observed that in the presence of VWF the density of the fibrin clot increases suggesting that VWF incorporates into fibrin network in solution. These findings indicate that incorporation of VWF into a fibrin network occurs via the E domain of fibrinogen where FpA and/or FpB were situated. Using a domain deletion mutant deltaC1C2-VWF we demonstrated the involvement of the C1C2 domain of VWF in the binding to fibrin monomers. Our results did not show any interaction of deltaC1C2-VWF with fibrin monolayer in the presence of thrombin. Application of the inhibitor K9-DON against factor XIIIa in the presence of calcium and thrombin slightly decreased the amount of VWF adsorbed on fibrin monolayer but not completely abolished it, illustrating that cross linking via factor XIII is not essential for this phenomenon and suggesting the identification of a second mechanism through which VWF multimers incorporate into a fibrin network. Additionally, under high shear conditions, we were able to show that platelets adhere to fibrin only if VWF had been incorporated. Addition of a GPIb blocking antibody almost completely abolished the adhesion of platelets to the fibrin monomers surface with bound VWF. These data provided evidence that the binding of platelets to a fibrin monomer layer under high shear rate is completely dependent on the VWF-GPIb interaction. All experiments were performed in the presence of abciximab suggesting that the GPIIb/IIIa receptor is not involved in this binding. In conclusion, our experiments show that the C1C2 domain of VWF and the E domain of fibrin monomers are involved in the incorporation of VWF during the polymerization of fibrin and that this incorporation fosters binding and activation of platelets. Fibrin thus is not an inert end product but partakes in further thrombus growth. Our findings help to elucidate the mechanism of thrombus growth and platelet adhesion under conditions of arterial shear rate. Additionally it may help to explain the observed phenotype in types I and III of von Willebrand Disease and the Bernard-Soulier Syndrome. Low amount of (functional) VWF or deficiency in GPIb-IX-V, here lead to disruption in thrombus formation and wound healing. Disclosures No relevant conflicts of interest to declare.

RETHINKING HISTORY, SCIENCE, AND RELIGION: An Exploration of Conflict and the Complexity Principle by Bernard Lightman, ed. Pittsburgh, PA: University of Pittsburgh Press, 2019. ix-307 pages, with notes, selected bibliography, and index. Hardcover; $50.00. ISBN: 9780822945741. *First some background to the making of Rethinking History, Science, and Religion. This edited collection by Bernard Lightman, Professor of Humanities at York University, Toronto, Canada, and past president of the History of Science Society, is the product of a two-day symposium on "Science and Religion: Exploring the Complexity Thesis," during the International Congress of History of Science and Technology in Rio de Janeiro in 2017. One can consider this to be a companion volume to The Warfare between Science and Religion: The Idea That Wouldn't Die, edited by Jeff Hardin, Ronald L. Numbers, and Ronald A. Binzley (Johns Hopkins University Press, 2018).1 *In one way, Rethinking History, Science, and Religion is a focused and daring work. It asks a fundamental question directed at much of contemporary historiography in the field of science-religion relations: if science and religion are not perpetually in conflict, as ever so many historians have claimed over the past fifty years, is complexity a better, if not the best, way to recount the relationship between science and religion? Complexity is the solution first proposed by John H. Brooke in his now classic 1991 text, Science and Religion: Some Historical Perspectives (Cambridge University Press).2 In fact, Lightman dedicates his edited book to John H. Brooke, the leading proponent of complexity. *But what does the "complexity thesis" add to our discussion? Is it really a thesis? Is it a principle? Does it explain or does it rather describe the situatedness and contingency of the science-religion relationship, its cartography, as David Livingstone might say? Is its sole positive feature to discourage us from making facile assumptions about the relationship between science and religion? Or does it simply add another c-word to our vocabulary: complexity instead of contrast, concordance, compatibility, conflict, conversion, complementarity (or harmony)? Brooke has famously said, "There is no such thing as the relationship between science and religion. It is what different individuals and communities have made of it in a plethora of different contexts" (p. 321, italics original, Science and Religion). That statement certainly invites one to consider a complexity thesis. *Although the role of complexity has been a conversation topic for several years,3 Lightman wants to gauge the current "pulse of the field." He wishes contributors to test the "complexity principle" in scholarly contexts other than the usual Christian West (often seen as Europe and the USA/Canada), as well as in public spaces. This move invites an additional question: will the complexity thesis be able to provide a coherent narrative, or will it merely give us one contextualized example after another with no perceptible trend to bind them together? If there are many complex stories to tell, then it seems that a master-narrative or pattern would be a pipedream at best. *After an introduction by Bernard Lightman, the book is divided into three sections: Part I: The Local and the Global; Part II: The Media and the Public; and Part III: Historiographies and Theories. The book concludes with "Afterword: The Instantiation of Historical Complexity," written by John Hedley Brooke. *Part I contains four chapters ranging from a local context (chap. 1, "The Stigmata of Ancestry: Reinvigorating the Conflict Thesis in the American 1970s," by Erika Lorraine Milam), to more global ones (chap. 2, "Three Centuries of Scientific Culture and Catholicism in Argentina: A Case Study of Long-Term Trends," by Miguel de Asúa; chap. 3, "Reexamining Complexity: Sayyid Ahmad Khan's Interpretation of 'Science' in Islam," by Sarah A. Qidwai; and chap. 4, "Christian Missionaries, Science, and the Complexity Thesis in the Nineteenth-Century World," by John Stenhouse). *Each of these chapters addresses the complexity thesis with a different focus. Erika Milam argues that the supposed conflicts between science and religion "gained rhetorical traction" by both scientific creationists and die-hard evolutionists because they both denied the complexity of their own origins. Irven DeVore's studies of primate behavior is used as a template to test that thesis. Miguel de Asúa identifies three trends in Argentinean scientific culture: (1) colonial period harmony, (2) nineteenth-century conflict, and (3) twentieth-century indifference. Sarah A. Qidwai calls us to carefully consider the interpretation of science in Islam rather than by Islam in the 1865 self-published commentary by Sayyid Ahmad Khan (1817-1898). John Stenhouse examines whether Ronald Numbers's suggestion that we introduce some mid-scale patterns (or generalizations) such as "naturalization, privatization, secularization, globalization and radicalization," aids us in understanding the complexity of science/religion relationships in the nineteenth century. Stenhouse concludes that a study of missionary science outside the West complicates Numbers's attempt to "simplify complexity," and does not do justice to missionary practices well into the twentieth century. *Part II contains five chapters examining the role of the media and public response to science/religion discussions and events: chap. 5, "Creating a New Space for Debate: The Monthlies, Science, and Religion," by Bernard Lightman; chap. 6, "Darwin's Publisher: John Murray III at the Intersection of Science and Religion," by Sylvia Nickerson; chap. 7, "The 'Harmony Thesis' in the Turkish Media, 1950-1970," by M. Alper Yalçinkaya; chap. 8, "A Humanist Blockbuster: Jacob Bronowski and the Ascent of Man," by Alexander Hall; and chap. 9, "Teaching Warfare: Conflict and Complexity in Contemporary University Textbooks," by Thomas H. Aechtner. *In summary, these chapters illustrate how insights from the study of print culture, communications studies, and visual studies have broadened our more "familiar grooves" of explanation and deepened our understanding of science and religion. *Part III is to my mind the most stimulating section, one in which some of the leading historians of science and religion present (their) historiographies and theories. It contains four chapters: chap. 10, "Revisiting the Battlefields of Science and Religion: The Warfare Thesis Today," by Ronald Numbers; chap. 11, "From Copernicus to Darwin to You: History and the Meaning(s) of Evolution," by Ian Hesketh; chap. 12, "Scale, Territory, and Complexity: Historical Geographies of Science and Religion," by Diarmid A. Finnegan; and chap. 13, "Conflict, Complexity, and Secularization in the History of Science and Religion," by Peter Harrison.4 *Focusing on two of the chapters: In a relatively short chapter (a "brisk survey" of eight pages), Numbers explores the factors that contribute to the continued support of the warfare thesis and the "growth of the opposing neo-harmonist point of view" (p. 183). Contemporaries such as Carl Sagan, Francis Crick, Stephen Hawking, William Provine, the New Atheists, and Christian and Muslim fundamentalists such as Ken Ham and Adnan Oktar are considered. Numbers chides scholars who legitimately question the warfare thesis but often do not address popular audiences. *Peter Harrison argues that we need to make complexity intelligible. Although historians are often averse to meta-narratives, he considers them to be both "unavoidable and indispensable." Harrison defends the utility of a master-narrative, at least something that rises above mid-scale patterns (such as those suggested by Ronald Numbers). He appeals to Charles Taylor's view of secularization as one way to begin to address the relation between science and religion. Taylor, for instance, distinguishes between science as cause of religious disbelief and science as a retrospective justification for it. Secularization involves a change in the conditions of belief which Taylor contributes to transformations within Western Christianity.5 *In "Afterword: The Instantiations of Historical Complexity," John Hedley Brooke reflects on each of the contributed chapters. He provides a concise judgement about complexity: "Understood neither as a thesis competing with other theses nor as a prescription to seek out complexity for its own sake, but as a heuristic guiding principle for a critical research methodology, it ceases to be trivial and has proven fertile" (pp. 239-40). *Brooke once again restates his earlier view on complexity: it is a "corrective to essentialist and reductionist narratives of conflict," and complexity's primary function is to critique conflict narratives as well as facile harmonizing ones. *For anyone interested in exploring the latest in the historiography of science and religion, read this stimulating and informative book. You will be challenged. Whether the contributors do justice to the central role and character of religion one will have to judge. I for one have my doubts. If we consider our lives as lived to be religion, then religion is not irrelevant to, or in conflict with, or an influential factor on, but rather the very ground for scientific practice. *Notes *1See my review in PSCF 71, no. 3 (2019): 183-84. *2See my essay review, "Telling the Story of Science and Religion: A Nuanced Account," British Journal for the History of Science 29, no. 3 (1996): 357-59. *3See Part 2, "Complexity and the History of Science and Religion," in Recent Themes in the History of Science and Religion, ed. Donald A. Yerxa (Columbia, SC: University of South Carolina Press, 2009). *4Peter Harrison's book The Territories of Science and Religion (Chicago, IL: University of Chicago Press, 2015) has been described by Ronald L. Numbers as "the most significant contribution to the history of science and religion since the appearance of John Hedley Brooke's landmark study, Science and Religion: Some Historical Perspectives." [See Matthew Walhout's review in PSCF 67, no. 4 (2015): 281-84.] *5For a more extensive discussion of "science causes secularization," see Peter Harrison's article "Science and Secularization," Intellectual History Review 27, no. 1 (2017): 47-70. *Reviewed by Arie Leegwater, Department of Chemistry and Biochemistry, Calvin University, Grand Rapids, MI 49546.

IntroductionThe extracellular matrix protein, collagen, plays a primary role in hemostasis. Collagen fibers provide an important site for adhesion of platelets to the exposed subendothelium, trapping them at the site of vascular damage and enabling the formation of a monolayer of cells over the damaged area. Collagen fibers also stimulate platelet activation, leading to inside-out regulation of the integrin glycoprotein (GP) IIb-IIIa (also known as αIIbβ3), secretion from dense and α granules, generation of thromboxanes, and expression of procoagulant activity, all of which support the hemostatic process. The role of collagen in supporting platelet adhesion to the subendothelium is mediated through indirect and direct interactions. The indirect interaction is mediated through von Willebrand factor (vWF), which binds to the GP Ib-IX-V complex on the platelet surface.1-3 The interaction with vWF is critical for platelet adhesion at medium to high rates of flow because of the fast rate of association between vWF and GP Ib-IX. The importance of this interaction is demonstrated by the severe bleeding problems experienced by individuals with functional impairment of vWF (von Willebrand disease) or GP Ib-IX (Bernard-Soulier syndrome). At low rates of flow, collagen fibers are able to support adhesion in the absence of vWF through a direct interaction with a number of platelet surface glycoproteins i.e. collagen receptors,4,5 this also serves to support vWF-dependent adhesion at higher rates of flow by preventing dissociation. Crosslinking of platelet surface glycoproteins by collagen also generates intracellular signals, leading to platelet activation.The number of proteins on the platelet surface proposed to be collagen receptors is approaching double figures, but it is generally accepted that the integrin GP Ia-IIa (also known as α2β1) and glycoprotein VI (GP VI) are among the most important of these, playing critical roles in adhesion and activation, respectively6 (Fig. 1). This is illustrated by the mild bleeding problems of patients with a low level of expression or the presence of autoantibodies to GP Ia-IIa and the spontaneous, severe bleeding episodes that are occasionally seen in patients whose platelets are deficient in GP VI.6 There is evidence, however, that other collagen receptors have supporting roles in adhesion and activation. For example, GP VI supports platelet adhesion to collagen7 and GP IV, also known as CD36, may also play a similar role.8 The role of the recently cloned collagen receptor p65 in adhesion is not known. Evidence that the interaction of collagen with receptors, such as GPIV and p65, is of less importance than for interactions with GP Ia-IIa, and GP VI is provided by the absence of individuals with bleeding problems caused by deficiencies in these proteins. This is illustrated most clearly for GP IV, which is absent in 3% to 5 % of the Japanese population, and yet such individuals display no major vascular problems.Due to the large number of glycoproteins that bind collagen on the platelet surface, it has been difficult to gain a full understanding of the role of individual collagen receptors in adhesion and activation responses. This is complicated further by the interactions between vWF and GP Ib-IX-V, vWF or fibrinogen to activated GP IIb-IIIa especially as both glycoprotein receptors generate intracellular signals. The relative importance of individual collagen receptors in adhesion also varies with the rate of flow and between collagen types. A full discussion of platelet adhesion to collagen is beyond the scope of this article, and the reader is referred to a number of excellent recent reviews for further information.4-6,9,10 The present chapter focuses on the signaling events generated by the activation (or more correctly crosslinking) of platelet surface glycoproteins by collagen and the implications that this has for platelet activation under normal and diseased conditions.

Tematski sklop z naslovom »Podsaharska Afrika« letošnje dvojne številke revije Ars et Humanitas je nastal v obdobju, v katerem opažamo, da se je zanimanje slovenskih raziskovalcev različnih humanističnih področij za ta del sveta močno povečalo. O tem pričajo v prvi vrsti številne znanstvene objave, ki so vsaj deloma posvečene podsaharski Afriki, in vedno večje zanimanje študentov slovenskih univerz za t. i. postkolonialne študije (kar se odraža med drugim v večjem številu diplom o postkolonialnih vprašanjih, zlasti o podsaharski Afriki). Na Filozofski fakulteti Univerze v Ljubljani, kjer potekajo prizadevanja za okrepitev afrikanistike v okviru novih univerzitetnih programov, pa so afriške književnosti v angleščini in francoščini zdaj močneje zastopane na študijskih smereh, ki so se doslej ukvarjale predvsem z evropskimi in severnoameriškimi literarnimi deli. To zanimanje za podsaharsko Afriko lahko pripisujemo večji pozornosti, ki se afriškim študijam namenja v Evropi in svetu nasploh, vse večji odprtosti slovenske družbe do oddaljenih dežel in kultur ter prizadevanjem slovenskih afrikanistov, ki so zadnja leta bolj številni in zelo dejavni. Med njimi naj omenim vsaj pokojnega etnologa in antropologa profesorja Boruta Brumna, ki je Afriko vrsto let približeval študentom ljubljanske univerze. Dodamo naj, da prav tako narašča število afriških literarnih del, ki jih lahko slovenski bralec bere v svoji materinščini, kar je znak, da se za ta del sveta vse bolj zanima tudi širša slovenska javnost. Pogled v bližnjo zgodovino nam pokaže, da se je zanimanje slovenske javnosti za Afriko v resnici krepilo že med šestdesetimi in osemdesetimi leti, ko je Slovenija kot jugoslovanska republika sodelovala pri gibanju t. i.»neuvrščenih«. To gibanje je med drugim ustvarilo družbenopolitično klimo, ki je nedvomno ugodno vplivala na boljše poznavanje »tretjega« sveta v Sloveniji, vključno s podsaharskimi deželami. Tako so se nizali obiski afriških politikov in izmenjave študentov, ki so včasih po študiju v Sloveniji ostali in postali del slovenske družbe. Tako je prišlo do živih, osebnih stikov med Slovenci in Afričani, ki so podlaga za resne, iskrene stike med narodi. Ta ugodna politična klima je privedla tudi do povečanja zanimanja pri slovenskih založnikih, saj so prevodi iz afriških književnosti začeli izhajati pogosteje: med letoma 1960 in 1990 je izšlo okrog 40 knjižnih izdaj, najbolj plodno pa je bilo leto 1980, ko je izšlo kar 8 afriških romanov v slovenskem prevodu. Omembe vredna je zbirka »Mostovi«, ki jo je leta 1976 ustanovila Pomurska založba in v kateri je izšlo dvanajst pomembnih romanov iz afriških književnosti (od Achebejevega romana Božja puščica leta 1977 do Marianinega izdajstva kamerunskega pisatelja Bernarda Nange leta 1987). V tem času bili so nekateri afriški grafiki (zlasti iz Južnoafriške unije) predstavljeni na ljubljanskih mednarodnih grafičnih bienalih (v letih 1955-1961 in 1977), prav tako so jugoslovanski grafiki nekajkrat gostovali po Afriki (npr. v letih 1980-1981 je bila razstava Contemporary Yugoslav Prints predstavljena v več afriških državah). Poleg tega številni potopisi, ki so izšli v zadnjih desetletjih, pričajo o tem, kako so se nekateri Slovenci poglobili v afriško resničnost in tradicijo. Pričujoči tematski sklop je sestavljen iz osmih razprav, v katerih raziskovalci predstavljajo bodisi s podsaharsko Afriko povezana vprašanja, pomembna s stališča posameznih strok, bodisi posebne vidike afriško-slovenskih odnosov. Prvi dve razpravi obravnavata posebna vidika sodobne afriške realnosti: vprašanje razvoja ob začetku 21. stoletja in vprašanje postkolonialnega nasilja. V članku »Razvojno zaostajanje podsaharske Afrike« Katja Vintar Mally s stališča regionalne geografije sooča razvojne težave podsaharske Afrike ob prelomu stoletij s t. i. razvojnimi cilji tisočletja, ki jih je OZN določila na podlagi Milenijske deklaracije iz leta 2000. Na podlagi novejših zgodovinskih dognanj in analize imperializma pri Hannah Arendt se Vlasta Jalušič v razpravi »Evropska zapuščina Afriki, afriška zapuščina Evropi: postkolonialno nasilje in pošast genocida« ukvarja z elementi zahodne zapuščine, katerih vpliv je bil odločilen pri zločinih, ki so zaznamovali podsaharsko Afriko ob prelomu med 20. in 21. stoletjem (zlasti pri genocidi v Ruandi). Proti koncu članka se avtorica sprašuje, kaj bi se lahko zahodni svet naučil iz situacije v Afriki, do kakšnih razmišljanj – zlasti v zvezi z rasizmom – bi ga morale pripeljati afriške postkolonialne izkušnje. Naslednji trije članki zadevajo preučevanje afriških književnosti s treh različnih perspektiv. V članku z naslovom »De l’oralité à l’écriture ou de l’africanité à la transculturalité« (»Od ustnosti do pisave ali od afriškosti do transkulturnosti«) senegalski profesor in raziskovalec Mwamba Cabakulu opredeli različne oblike ustne literature, ki so igrale pomembno vlogo v izoblikovanju afriških književnostih. Tako nazorno predstavi razmerje med ustno in pisno literaturo v afriških kulturah. V kolonialne čase se vrača Gabriela Babnik, ki prikazuje roman Chinua Achebeja z naslovom Razpad iz leta 1952 kot odgovor na negativno podobo Afričanov v Evropi, zlasti v Conradovem romanu The Heart of Darkness. Pisanje romana je pri nigerijskem pisatelju dejanje upora, ki bo zgled za številne druge afriške pisatelje. V članku »Zahod v Afriki in Afričanke na Zahodu« Nataša Hrastnik preučuje tematiko, značilno za žensko pisanje v sodobnih afriških književnostih s poudarkom na iskanju identitete, ki ga lahko imamo za vodilno temo pri afriških pisateljicah. Zadnji trije članki predstavljajo tri različne vidike slovensko-afriških odnosov. V članku z naslovom »Črno sonce v beli glavi« Marko Frelih predstavlja sudansko misijo, ki jo je sredi 19. stoletja vodil slovenski krščanski misijonar dr. Ignancij Knoblehar in ki jo lahko imamo za prvo temeljitejšo neposredno srečanje Slovencev s podsaharsko Afriko. Kot prevajalka afriških literarnih del se Katja Zakrajšek v članku »K problematiki prevajanja afriškega evrofonskega romana v slovenščino« ukvarja s posebnostmi afriških književnosti v »evropskih« jezikih in razmišlja o implikacijah teh posebnosti pri prevajanju v slovenski jezik. S prevajanjem se iz literarno-zgodovinske prespektive ukvarja tudi Tone Smolej v članku »Léopold Sédar Senghor pri Slovencih«, v katerem posveča pozornost izboru pesmi velikega senegalskega pesnika, ki je leta 1975 izšel v slovenskem jeziku. Slovenski raziskovalni prostor seveda premore veliko več zanimivih raziskav v zvezi z Afriko, zato lahko samo obžalujemo, da nekateri raziskovalci pri tej publikaciji niso mogli sodelovati in da zato njihova stroka tukaj ni zastopana. Ob tej priložnosti se iskreno zahvaljujem vsem, ki so sodelovali pri projektu s kakovostnimi in raznovrstnimi razpravami.

Tematski sklop z naslovom »Podsaharska Afrika« letošnje dvojne številke revije Ars et Humanitas je nastal v obdobju, v katerem opažamo, da se je zanimanje slovenskih raziskovalcev različnih humanističnih področij za ta del sveta močno povečalo. O tem pričajo v prvi vrsti številne znanstvene objave, ki so vsaj deloma posvečene podsaharski Afriki, in vedno večje zanimanje študentov slovenskih univerz za t. i. postkolonialne študije (kar se odraža med drugim v večjem številu diplom o postkolonialnih vprašanjih, zlasti o podsaharski Afriki). Na Filozofski fakulteti Univerze v Ljubljani, kjer potekajo prizadevanja za okrepitev afrikanistike v okviru novih univerzitetnih programov, pa so afriške književnosti v angleščini in francoščini zdaj močneje zastopane na študijskih smereh, ki so se doslej ukvarjale predvsem z evropskimi in severnoameriškimi literarnimi deli. To zanimanje za podsaharsko Afriko lahko pripisujemo večji pozornosti, ki se afriškim študijam namenja v Evropi in svetu nasploh, vse večji odprtosti slovenske družbe do oddaljenih dežel in kultur ter prizadevanjem slovenskih afrikanistov, ki so zadnja leta bolj številni in zelo dejavni. Med njimi naj omenim vsaj pokojnega etnologa in antropologa profesorja Boruta Brumna, ki je Afriko vrsto let približeval študentom ljubljanske univerze. Dodamo naj, da prav tako narašča število afriških literarnih del, ki jih lahko slovenski bralec bere v svoji materinščini, kar je znak, da se za ta del sveta vse bolj zanima tudi širša slovenska javnost. Pogled v bližnjo zgodovino nam pokaže, da se je zanimanje slovenske javnosti za Afriko v resnici krepilo že med šestdesetimi in osemdesetimi leti, ko je Slovenija kot jugoslovanska republika sodelovala pri gibanju t. i.»neuvrščenih«. To gibanje je med drugim ustvarilo družbenopolitično klimo, ki je nedvomno ugodno vplivala na boljše poznavanje »tretjega« sveta v Sloveniji, vključno s podsaharskimi deželami. Tako so se nizali obiski afriških politikov in izmenjave študentov, ki so včasih po študiju v Sloveniji ostali in postali del slovenske družbe. Tako je prišlo do živih, osebnih stikov med Slovenci in Afričani, ki so podlaga za resne, iskrene stike med narodi. Ta ugodna politična klima je privedla tudi do povečanja zanimanja pri slovenskih založnikih, saj so prevodi iz afriških književnosti začeli izhajati pogosteje: med letoma 1960 in 1990 je izšlo okrog 40 knjižnih izdaj, najbolj plodno pa je bilo leto 1980, ko je izšlo kar 8 afriških romanov v slovenskem prevodu. Omembe vredna je zbirka »Mostovi«, ki jo je leta 1976 ustanovila Pomurska založba in v kateri je izšlo dvanajst pomembnih romanov iz afriških književnosti (od Achebejevega romana Božja puščica leta 1977 do Marianinega izdajstva kamerunskega pisatelja Bernarda Nange leta 1987). V tem času bili so nekateri afriški grafiki (zlasti iz Južnoafriške unije) predstavljeni na ljubljanskih mednarodnih grafičnih bienalih (v letih 1955-1961 in 1977), prav tako so jugoslovanski grafiki nekajkrat gostovali po Afriki (npr. v letih 1980-1981 je bila razstava Contemporary Yugoslav Prints predstavljena v več afriških državah). Poleg tega številni potopisi, ki so izšli v zadnjih desetletjih, pričajo o tem, kako so se nekateri Slovenci poglobili v afriško resničnost in tradicijo. Pričujoči tematski sklop je sestavljen iz osmih razprav, v katerih raziskovalci predstavljajo bodisi s podsaharsko Afriko povezana vprašanja, pomembna s stališča posameznih strok, bodisi posebne vidike afriško-slovenskih odnosov. Prvi dve razpravi obravnavata posebna vidika sodobne afriške realnosti: vprašanje razvoja ob začetku 21. stoletja in vprašanje postkolonialnega nasilja. V članku »Razvojno zaostajanje podsaharske Afrike« Katja Vintar Mally s stališča regionalne geografije sooča razvojne težave podsaharske Afrike ob prelomu stoletij s t. i. razvojnimi cilji tisočletja, ki jih je OZN določila na podlagi Milenijske deklaracije iz leta 2000. Na podlagi novejših zgodovinskih dognanj in analize imperializma pri Hannah Arendt se Vlasta Jalušič v razpravi »Evropska zapuščina Afriki, afriška zapuščina Evropi: postkolonialno nasilje in pošast genocida« ukvarja z elementi zahodne zapuščine, katerih vpliv je bil odločilen pri zločinih, ki so zaznamovali podsaharsko Afriko ob prelomu med 20. in 21. stoletjem (zlasti pri genocidi v Ruandi). Proti koncu članka se avtorica sprašuje, kaj bi se lahko zahodni svet naučil iz situacije v Afriki, do kakšnih razmišljanj – zlasti v zvezi z rasizmom – bi ga morale pripeljati afriške postkolonialne izkušnje. Naslednji trije članki zadevajo preučevanje afriških književnosti s treh različnih perspektiv. V članku z naslovom »De l’oralité à l’écriture ou de l’africanité à la transculturalité« (»Od ustnosti do pisave ali od afriškosti do transkulturnosti«) senegalski profesor in raziskovalec Mwamba Cabakulu opredeli različne oblike ustne literature, ki so igrale pomembno vlogo v izoblikovanju afriških književnostih. Tako nazorno predstavi razmerje med ustno in pisno literaturo v afriških kulturah. V kolonialne čase se vrača Gabriela Babnik, ki prikazuje roman Chinua Achebeja z naslovom Razpad iz leta 1952 kot odgovor na negativno podobo Afričanov v Evropi, zlasti v Conradovem romanu The Heart of Darkness. Pisanje romana je pri nigerijskem pisatelju dejanje upora, ki bo zgled za številne druge afriške pisatelje. V članku »Zahod v Afriki in Afričanke na Zahodu« Nataša Hrastnik preučuje tematiko, značilno za žensko pisanje v sodobnih afriških književnostih s poudarkom na iskanju identitete, ki ga lahko imamo za vodilno temo pri afriških pisateljicah. Zadnji trije članki predstavljajo tri različne vidike slovensko-afriških odnosov. V članku z naslovom »Črno sonce v beli glavi« Marko Frelih predstavlja sudansko misijo, ki jo je sredi 19. stoletja vodil slovenski krščanski misijonar dr. Ignancij Knoblehar in ki jo lahko imamo za prvo temeljitejšo neposredno srečanje Slovencev s podsaharsko Afriko. Kot prevajalka afriških literarnih del se Katja Zakrajšek v članku »K problematiki prevajanja afriškega evrofonskega romana v slovenščino« ukvarja s posebnostmi afriških književnosti v »evropskih« jezikih in razmišlja o implikacijah teh posebnosti pri prevajanju v slovenski jezik. S prevajanjem se iz literarno-zgodovinske prespektive ukvarja tudi Tone Smolej v članku »Léopold Sédar Senghor pri Slovencih«, v katerem posveča pozornost izboru pesmi velikega senegalskega pesnika, ki je leta 1975 izšel v slovenskem jeziku. Slovenski raziskovalni prostor seveda premore veliko več zanimivih raziskav v zvezi z Afriko, zato lahko samo obžalujemo, da nekateri raziskovalci pri tej publikaciji niso mogli sodelovati in da zato njihova stroka tukaj ni zastopana. Ob tej priložnosti se iskreno zahvaljujem vsem, ki so sodelovali pri projektu s kakovostnimi in raznovrstnimi razpravami.

To date, discrete event stochastic simulations of large scale biological reaction systems are extremely compute-intensive and time-consuming. Besides, it has been widely accepted that spatial factor plays a critical role in the dynamics of most biological reaction systems. The NSM (the Next Sub-Volume Method), a spatial variation of the Gillespie’s stochastic simulation algorithm (SSA), has been proposed for spatially stochastic simulation of those systems. While being able to explore high degree of parallelism in systems, NSM is inherently sequential, which still suffers from the problem of low simulation speed. Fine-grained parallel execution is an elegant way to speed up sequential simulations. Thus, based on the discrete event simulation framework JAMES II, we design and implement a PDES (Parallel Discrete Event Simulation) TW (time warp) simulator to enable the fine-grained parallel execution of spatial stochastic simulations of biological reaction systems using the ANSM (the Abstract NSM), a parallel variation of the NSM. The simulation results of classical Lotka-Volterra biological reaction system show that our time warp simulator obtains remarkable parallel speed-up against sequential execution of the NSM.I.IntroductionThe goal of Systems biology is to obtain system-level investigations of the structure and behavior of biological reaction systems by integrating biology with system theory, mathematics and computer science [1][3], since the isolated knowledge of parts can not explain the dynamics of a whole system. As the complement of “wet-lab” experiments, stochastic simulation, being called the “dry-computational” experiment, plays a more and more important role in computing systems biology [2]. Among many methods explored in systems biology, discrete event stochastic simulation is of greatly importance [4][5][6], since a great number of researches have present that stochasticity or “noise” have a crucial effect on the dynamics of small population biological reaction systems [4][7]. Furthermore, recent research shows that the stochasticity is not only important in biological reaction systems with small population but also in some moderate/large population systems [7].To date, Gillespie’s SSA [8] is widely considered to be the most accurate way to capture the dynamics of biological reaction systems instead of traditional mathematical method [5][9]. However, SSA-based stochastic simulation is confronted with two main challenges: Firstly, this type of simulation is extremely time-consuming, since when the types of species and the number of reactions in the biological system are large, SSA requires a huge amount of steps to sample these reactions; Secondly, the assumption that the systems are spatially homogeneous or well-stirred is hardly met in most real biological systems and spatial factors play a key role in the behaviors of most real biological systems [19][20][21][22][23][24]. The next sub-volume method (NSM) [18], presents us an elegant way to access the special problem via domain partition. To our disappointment, sequential stochastic simulation with the NSM is still very time-consuming, and additionally introduced diffusion among neighbor sub-volumes makes things worse. Whereas, the NSM explores a very high degree of parallelism among sub-volumes, and parallelization has been widely accepted as the most meaningful way to tackle the performance bottleneck of sequential simulations [26][27]. Thus, adapting parallel discrete event simulation (PDES) techniques to discrete event stochastic simulation would be particularly promising. Although there are a few attempts have been conducted [29][30][31], research in this filed is still in its infancy and many issues are in need of further discussion. The next section of the paper presents the background and related work in this domain. In section III, we give the details of design and implementation of model interfaces of LP paradigm and the time warp simulator based on the discrete event simulation framework JAMES II; the benchmark model and experiment results are shown in Section IV; in the last section, we conclude the paper with some future work.II. Background and Related WorkA. Parallel Discrete Event Simulation (PDES)The notion Logical Process (LP) is introduced to PDES as the abstract of the physical process [26], where a system consisting of many physical processes is usually modeled by a set of LP. LP is regarded as the smallest unit that can be executed in PDES and each LP holds a sub-partition of the whole system’s state variables as its private ones. When a LP processes an event, it can only modify the state variables of its own. If one LP needs to modify one of its neighbors’ state variables, it has to schedule an event to the target neighbor. That is to say event message exchanging is the only way that LPs interact with each other. Because of the data dependences or interactions among LPs, synchronization protocols have to be introduced to PDES to guarantee the so-called local causality constraint (LCC) [26]. By now, there are a larger number of synchronization algorithms have been proposed, e.g. the null-message [26], the time warp (TW) [32], breath time warp (BTW) [33] and etc. According to whether can events of LPs be processed optimistically, they are generally divided into two types: conservative algorithms and optimistic algorithms. However, Dematté and Mazza have theoretically pointed out the disadvantages of pure conservative parallel simulation for biochemical reaction systems [31]. B. NSM and ANSM The NSM is a spatial variation of Gillespie’ SSA, which integrates the direct method (DM) [8] with the next reaction method (NRM) [25]. The NSM presents us a pretty good way to tackle the aspect of space in biological systems by partitioning a spatially inhomogeneous system into many much more smaller “homogeneous” ones, which can be simulated by SSA separately. However, the NSM is inherently combined with the sequential semantics, and all sub-volumes share one common data structure for events or messages. Thus, directly parallelization of the NSM may be confronted with the so-called boundary problem and high costs of synchronously accessing the common data structure [29]. In order to obtain higher efficiency of parallel simulation, parallelization of NSM has to firstly free the NSM from the sequential semantics and secondly partition the shared data structure into many “parallel” ones. One of these is the abstract next sub-volume method (ANSM) [30]. In the ANSM, each sub-volume is modeled by a logical process (LP) based on the LP paradigm of PDES, where each LP held its own event queue and state variables (see Fig. 1). In addition, the so-called retraction mechanism was introduced in the ANSM too (see algorithm 1). Besides, based on the ANSM, Wang etc. [30] have experimentally tested the performance of several PDES algorithms in the platform called YH-SUPE [27]. However, their platform is designed for general simulation applications, thus it would sacrifice some performance for being not able to take into account the characteristics of biological reaction systems. Using the similar ideas of the ANSM, Dematté and Mazza have designed and realized an optimistic simulator. However, they processed events in time-stepped manner, which would lose a specific degree of precisions compared with the discrete event manner, and it is very hard to transfer a time-stepped simulation to a discrete event one. In addition, Jeschke etc.[29] have designed and implemented a dynamic time-window simulator to execution the NSM in parallel on the grid computing environment, however, they paid main attention on the analysis of communication costs and determining a better size of the time-window.Fig. 1: the variations from SSA to NSM and from NSM to ANSMC. JAMES II JAMES II is an open source discrete event simulation experiment framework developed by the University of Rostock in Germany. It focuses on high flexibility and scalability [11][13]. Based on the plug-in scheme [12], each function of JAMES II is defined as a specific plug-in type, and all plug-in types and plug-ins are declared in XML-files [13]. Combined with the factory method pattern JAMES II innovatively split up the model and simulator, which makes JAMES II is very flexible to add and reuse both of models and simulators. In addition, JAMES II supports various types of modelling formalisms, e.g. cellular automata, discrete event system specification (DEVS), SpacePi, StochasticPi and etc.[14]. Besides, a well-defined simulator selection mechanism is designed and developed in JAMES II, which can not only automatically choose the proper simulators according to the modeling formalism but also pick out a specific simulator from a serious of simulators supporting the same modeling formalism according to the user settings [15].III. The Model Interface and SimulatorAs we have mentioned in section II (part C), model and simulator are split up into two separate parts. Thus, in this section, we introduce the designation and implementation of model interface of LP paradigm and more importantly the time warp simulator.A. The Mod Interface of LP ParadigmJAMES II provides abstract model interfaces for different modeling formalism, based on which Wang etc. have designed and implemented model interface of LP paradigm[16]. However, this interface is not scalable well for parallel and distributed simulation of larger scale systems. In our implementation, we accommodate the interface to the situation of parallel and distributed situations. Firstly, the neighbor LP’s reference is replaced by its name in LP’s neighbor queue, because it is improper even dangerous that a local LP hold the references of other LPs in remote memory space. In addition, (pseudo-)random number plays a crucial role to obtain valid and meaningful results in stochastic simulations. However, it is still a very challenge work to find a good random number generator (RNG) [34]. Thus, in order to focus on our problems, we introduce one of the uniform RNGs of JAMES II to this model interface, where each LP holds a private RNG so that random number streams of different LPs can be independent stochastically. B. The Time Warp SimulatorBased on the simulator interface provided by JAMES II, we design and implement the time warp simulator, which contains the (master-)simulator, (LP-)simulator. The simulator works strictly as master/worker(s) paradigm for fine-grained parallel and distributed stochastic simulations. Communication costs are crucial to the performance of a fine-grained parallel and distributed simulation. Based on the Java remote method invocation (RMI) mechanism, P2P (peer-to-peer) communication is implemented among all (master-and LP-)simulators, where a simulator holds all the proxies of targeted ones that work on remote workers. One of the advantages of this communication approach is that PDES codes can be transferred to various hardwire environment, such as Clusters, Grids and distributed computing environment, with only a little modification; The other is that RMI mechanism is easy to realized and independent to any other non-Java libraries. Since the straggler event problem, states have to be saved to rollback events that are pre-processed optimistically. Each time being modified, the state is cloned to a queue by Java clone mechanism. Problem of this copy state saving approach is that it would cause loads of memory space. However, the problem can be made up by a condign GVT calculating mechanism. GVT reduction scheme also has a significant impact on the performance of parallel simulators, since it marks the highest time boundary of events that can be committed so that memories of fossils (processed events and states) less than GVT can be reallocated. GVT calculating is a very knotty for the notorious simultaneous reporting problem and transient messages problem. According to our problem, another GVT algorithm, called Twice Notification (TN-GVT) (see algorithm 2), is contributed to this already rich repository instead of implementing one of GVT algorithms in reference [26] and [28].This algorithm looks like the synchronous algorithm described in reference [26] (pp. 114), however, they are essentially different from each other. This algorithm has never stopped the simulators from processing events when GVT reduction, while algorithm in reference [26] blocks all simulators for GVT calculating. As for the transient message problem, it can be neglect in our implementation, because RMI based remote communication approach is synchronized, that means a simulator will not go on its processing until the remote the massage get to its destination. And because of this, the high-costs message acknowledgement, prevalent over many classical asynchronous GVT algorithms, is not needed anymore too, which should be constructive to the whole performance of the time warp simulator.IV. Benchmark Model and Experiment ResultsA. The Lotka-Volterra Predator-prey SystemIn our experiment, the spatial version of Lotka-Volterra predator-prey system is introduced as the benchmark model (see Fig. 2). We choose the system for two considerations: 1) this system is a classical experimental model that has been used in many related researches [8][30][31], so it is credible and the simulation results are comparable; 2) it is simple but helpful enough to test the issues we are interested in. The space of predator-prey System is partitioned into a2D NXNgrid, whereNdenotes the edge size of the grid. Initially the population of the Grass, Preys and Predators are set to 1000 in each single sub-volume (LP). In Fig. 2,r1,r2,r3stand for the reaction constants of the reaction 1, 2 and 3 respectively. We usedGrass,dPreyanddPredatorto stand for the diffusion rate of Grass, Prey and Predator separately. Being similar to reference [8], we also take the assumption that the population of the grass remains stable, and thusdGrassis set to zero.R1:Grass + Prey ->2Prey(1)R2:Predator +Prey -> 2Predator(2)R3:Predator -> NULL(3)r1=0.01; r2=0.01; r3=10(4)dGrass=0.0;dPrey=2.5;dPredato=5.0(5)Fig. 2: predator-prey systemB. Experiment ResultsThe simulation runs have been executed on a Linux Cluster with 40 computing nodes. Each computing node is equipped with two 64bit 2.53 GHz Intel Xeon QuadCore Processors with 24GB RAM, and nodes are interconnected with Gigabit Ethernet connection. The operating system is Kylin Server 3.5, with kernel 2.6.18. Experiments have been conducted on the benchmark model of different size of mode to investigate the execution time and speedup of the time warp simulator. As shown in Fig. 3, the execution time of simulation on single processor with 8 cores is compared. The result shows that it will take more wall clock time to simulate much larger scale systems for the same simulation time. This testifies the fact that larger scale systems will leads to more events in the same time interval. More importantly, the blue line shows that the sequential simulation performance declines very fast when the mode scale becomes large. The bottleneck of sequential simulator is due to the costs of accessing a long event queue to choose the next events. Besides, from the comparison between group 1 and group 2 in this experiment, we could also conclude that high diffusion rate increased the simulation time greatly both in sequential and parallel simulations. This is because LP paradigm has to split diffusion into two processes (diffusion (in) and diffusion (out) event) for two interactive LPs involved in diffusion and high diffusion rate will lead to high proportional of diffusion to reaction. In the second step shown in Fig. 4, the relationship between the speedups from time warp of two different model sizes and the number of work cores involved are demonstrated. The speedup is calculated against the sequential execution of the spatial reaction-diffusion systems model with the same model size and parameters using NSM.Fig. 4 shows the comparison of speedup of time warp on a64X64grid and a100X100grid. In the case of a64X64grid, under the condition that only one node is used, the lowest speedup (a little bigger than 1) is achieved when two cores involved, and the highest speedup (about 6) is achieved when 8 cores involved. The influence of the number of cores used in parallel simulation is investigated. In most cases, large number of cores could bring in considerable improvements in the performance of parallel simulation. Also, compared with the two results in Fig. 4, the simulation of larger model achieves better speedup. Combined with time tests (Fig. 3), we find that sequential simulator’s performance declines sharply when the model scale becomes very large, which makes the time warp simulator get better speed-up correspondingly.Fig. 3: Execution time (wall clock time) of Seq. and time warp with respect to different model sizes (N=32, 64, 100, and 128) and model parameters based on single computing node with 8 cores. Results of the test are grouped by the diffusion rates (Group 1: Sequential 1 and Time Warp 1. dPrey=2.5, dPredator=5.0; Group 2: dPrey=0.25, dPredator=0.5, Sequential 2 and Time Warp 2).Fig. 4: Speedup of time warp with respect to the number of work cores and the model size (N=64 and 100). Work cores are chose from one computing node. Diffusion rates are dPrey=2.5, dPredator=5.0 and dGrass=0.0.V. Conclusion and Future WorkIn this paper, a time warp simulator based on the discrete event simulation framework JAMES II is designed and implemented for fine-grained parallel and distributed discrete event spatial stochastic simulation of biological reaction systems. Several challenges have been overcome, such as state saving, roll back and especially GVT reduction in parallel execution of simulations. The Lotka-Volterra Predator-Prey system is chosen as the benchmark model to test the performance of our time warp simulator and the best experiment results show that it can obtain about 6 times of speed-up against the sequential simulation. The domain this paper concerns with is in the infancy, many interesting issues are worthy of further investigated, e.g. there are many excellent PDES optimistic synchronization algorithms (e.g. the BTW) as well. Next step, we would like to fill some of them into JAMES II. In addition, Gillespie approximation methods (tau-leap[10] etc.) sacrifice some degree of precision for higher simulation speed, but still could not address the aspect of space of biological reaction systems. The combination of spatial element and approximation methods would be very interesting and promising; however, the parallel execution of tau-leap methods should have to overcome many obstacles on the road ahead.AcknowledgmentThis work is supported by the National Natural Science Foundation of China (NSF) Grant (No.60773019) and the Ph.D. Programs Foundation of Ministry of Education of China (No. 200899980004). The authors would like to show their great gratitude to Dr. Jan Himmelspach and Dr. Roland Ewald at the University of Rostock, Germany for their invaluable advice and kindly help with JAMES II.ReferencesH. Kitano, "Computational systems biology." Nature, vol. 420, no. 6912, pp. 206-210, November 2002.H. Kitano, "Systems biology: a brief overview." Science (New York, N.Y.), vol. 295, no. 5560, pp. 1662-1664, March 2002.A. Aderem, "Systems biology: Its practice and challenges," Cell, vol. 121, no. 4, pp. 511-513, May 2005. [Online]. Available: http://dx.doi.org/10.1016/j.cell.2005.04.020.H. de Jong, "Modeling and simulation of genetic regulatory systems: A literature review," Journal of Computational Biology, vol. 9, no. 1, pp. 67-103, January 2002.C. W. Gardiner, Handbook of Stochastic Methods: for Physics, Chemistry and the Natural Sciences (Springer Series in Synergetics), 3rd ed. Springer, April 2004.D. T. Gillespie, "Simulation methods in systems biology," in Formal Methods for Computational Systems Biology, ser. Lecture Notes in Computer Science, M. Bernardo, P. Degano, and G. Zavattaro, Eds. Berlin, Heidelberg: Springer Berlin Heidelberg, 2008, vol. 5016, ch. 5, pp. 125-167.Y. Tao, Y. Jia, and G. T. Dewey, "Stochastic fluctuations in gene expression far from equilibrium: Omega expansion and linear noise approximation," The Journal of Chemical Physics, vol. 122, no. 12, 2005.D. T. Gillespie, "Exact stochastic simulation of coupled chemical reactions," Journal of Physical Chemistry, vol. 81, no. 25, pp. 2340-2361, December 1977.D. T. Gillespie, "Stochastic simulation of chemical kinetics," Annual Review of Physical Chemistry, vol. 58, no. 1, pp. 35-55, 2007.D. T. Gillespie, "Approximate accelerated stochastic simulation of chemically reacting systems," The Journal of Chemical Physics, vol. 115, no. 4, pp. 1716-1733, 2001.J. Himmelspach, R. Ewald, and A. M. Uhrmacher, "A flexible and scalable experimentation layer," in WSC '08: Proceedings of the 40th Conference on Winter Simulation. Winter Simulation Conference, 2008, pp. 827-835.J. Himmelspach and A. M. Uhrmacher, "Plug'n simulate," in 40th Annual Simulation Symposium (ANSS'07). Washington, DC, USA: IEEE, March 2007, pp. 137-143.R. Ewald, J. Himmelspach, M. Jeschke, S. Leye, and A. M. Uhrmacher, "Flexible experimentation in the modeling and simulation framework james ii-implications for computational systems biology," Brief Bioinform, vol. 11, no. 3, pp. bbp067-300, January 2010.A. Uhrmacher, J. Himmelspach, M. Jeschke, M. John, S. Leye, C. Maus, M. Röhl, and R. Ewald, "One modelling formalism & simulator is not enough! a perspective for computational biology based on james ii," in Formal Methods in Systems Biology, ser. Lecture Notes in Computer Science, J. Fisher, Ed. Berlin, Heidelberg: Springer Berlin Heidelberg, 2008, vol. 5054, ch. 9, pp. 123-138. [Online]. Available: http://dx.doi.org/10.1007/978-3-540-68413-8_9.R. Ewald, J. Himmelspach, and A. M. Uhrmacher, "An algorithm selection approach for simulation systems," pads, vol. 0, pp. 91-98, 2008.Bing Wang, Jan Himmelspach, Roland Ewald, Yiping Yao, and Adelinde M Uhrmacher. Experimental analysis of logical process simulation algorithms in james ii[C]// In M. D. Rossetti, R. R. Hill, B. Johansson, A. Dunkin, and R. G. Ingalls, editors, Proceedings of the Winter Simulation Conference, IEEE Computer Science, 2009. 1167-1179.Ewald, J. Rössel, J. Himmelspach, and A. M. Uhrmacher, "A plug-in-based architecture for random number generation in simulation systems," in WSC '08: Proceedings of the 40th Conference on Winter Simulation. Winter Simulation Conference, 2008, pp. 836-844.J. Elf and M. Ehrenberg, "Spontaneous separation of bi-stable biochemical systems into spatial domains of opposite phases." Systems biology, vol. 1, no. 2, pp. 230-236, December 2004.K. Takahashi, S. Arjunan, and M. Tomita, "Space in systems biology of signaling pathways? Towards intracellular molecular crowding in silico," FEBS Letters, vol. 579, no. 8, pp. 1783-1788, March 2005.J. V. Rodriguez, J. A. Kaandorp, M. Dobrzynski, and J. G. Blom, "Spatial stochastic modelling of the phosphoenolpyruvate-dependent phosphotransferase (pts) pathway in escherichia coli," Bioinformatics, vol. 22, no. 15, pp. 1895-1901, August 2006.D. Ridgway, G. Broderick, and M. Ellison, "Accommodating space, time and randomness in network simulation," Current Opinion in Biotechnology, vol. 17, no. 5, pp. 493-498, October 2006.J. V. Rodriguez, J. A. Kaandorp, M. Dobrzynski, and J. G. Blom, "Spatial stochastic modelling of the phosphoenolpyruvate-dependent phosphotransferase (pts) pathway in escherichia coli," Bioinformatics, vol. 22, no. 15, pp. 1895-1901, August 2006.W. G. Wilson, A. M. Deroos, and E. Mccauley, "Spatial instabilities within the diffusive lotka-volterra system: Individual-based simulation results," Theoretical Population Biology, vol. 43, no. 1, pp. 91-127, February 1993.K. Kruse and J. Elf. Kinetics in spatially extended systems. In Z. Szallasi, J. Stelling, and V. Periwal, editors, System Modeling in Cellular Biology. From Concepts to Nuts and Bolts, pages 177–198. MIT Press, Cambridge, MA, 2006.M. A. Gibson and J. Bruck, "Efficient exact stochastic simulation of chemical systems with many species and many channels," The Journal of Physical Chemistry A, vol. 104, no. 9, pp. 1876-1889, March 2000.R. M. Fujimoto, Parallel and Distributed Simulation Systems (Wiley Series on Parallel and Distributed Computing). Wiley-Interscience, January 2000.Y. Yao and Y. Zhang, “Solution for analytic simulation based on parallel processing,” Journal of System Simulation, vol. 20, No.24, pp. 6617–6621, 2008.G. Chen and B. K. Szymanski, "Dsim: scaling time warp to 1,033 processors," in WSC '05: Proceedings of the 37th conference on Winter simulation. Winter Simulation Conference, 2005, pp. 346-355.M. Jeschke, A. Park, R. Ewald, R. Fujimoto, and A. M. Uhrmacher, "Parallel and distributed spatial simulation of chemical reactions," in 2008 22nd Workshop on Principles of Advanced and Distributed Simulation. Washington, DC, USA: IEEE, June 2008, pp. 51-59.B. Wang, Y. Yao, Y. Zhao, B. Hou, and S. Peng, "Experimental analysis of optimistic synchronization algorithms for parallel simulation of reaction-diffusion systems," High Performance Computational Systems Biology, International Workshop on, vol. 0, pp. 91-100, October 2009.L. Dematté and T. Mazza, "On parallel stochastic simulation of diffusive systems," in Computational Methods in Systems Biology, M. Heiner and A. M. Uhrmacher, Eds. Berlin, Heidelberg: Springer Berlin Heidelberg, 2008, vol. 5307, ch. 16, pp. 191-210.D. R. Jefferson, "Virtual time," ACM Trans. Program. Lang. Syst., vol. 7, no. 3, pp. 404-425, July 1985.J. S. Steinman, "Breathing time warp," SIGSIM Simul. Dig., vol. 23, no. 1, pp. 109-118, July 1993. [Online]. Available: http://dx.doi.org/10.1145/174134.158473 S. K. Park and K. W. Miller, "Random number generators: good ones are hard to find," Commun. ACM, vol. 31, no. 10, pp. 1192-1201, October 1988.