Articles de revues : « 515/.14 »

1

Clemens, Lukas, et Stephan F. Ebert. « Rezension von : Ebert, Stephan F., Der Umwelt begegnen ». Zeitschrift für Württembergische Landesgeschichte 82 (11 juillet 2023) : 459–61. http://dx.doi.org/10.53458/zwlg.v82i.6767.

Texte intégral

Résumé :

Stephan F. Ebert, Der Umwelt begegnen. Extremereignisse und die Verflechtung von Natur und Kultur im Frankenreich vom 8. bis 10. Jahrhundert (Vierteljahrschrift für Sozial- und Wirtschaftsgeschichte, Beiheft 254). Stuttgart: Franz Steiner Verlag 2021. 344 S., 14 s/w Abb., 29 farb. Abb. ISBN 978-3-515-13098-1 (Print); ISBN 978-3-515-13100-1 (E-Book). Geb. € 68,–

Styles APA, Harvard, Vancouver, ISO, etc.

2

Bihrer, Andreas, et Katharina Lichtenberger. « Rezension von : Lichtenberger, Katharina, Mathias von Neuenburg und die Gegenwartschronistik des 14. Jahrhunderts im deutschen Südwesten ». Zeitschrift für Württembergische Landesgeschichte 82 (11 juillet 2023) : 444–46. http://dx.doi.org/10.53458/zwlg.v82i.6758.

Texte intégral

Résumé :

Katharina Lichtenberger, Mathias von Neuenburg und die Gegenwartschronistik des 14. Jahrhunderts im deutschen Südwesten (Historische Studien, Bd. 515). Husum: Matthiesen 2021. 468 S. ISBN 978-3-7868-1515-0. Geb. € 59,–

Styles APA, Harvard, Vancouver, ISO, etc.

3

Lindtner, Chr. « Sunyatasaptativrtti. Candrakirtis Kommentar zu den 'Siebzig Versen über die Leehrheit' des Nagarjuna [Karikas 1-14]. Einleitung, Übersetzung, textkritische Ausgabe des Tibetischen und Indizes. Felix Erb. » Buddhist Studies Review 16, n^o 1 (15 juin 1999) : 97–104. http://dx.doi.org/10.1558/bsrv.v16i1.14683.

Texte intégral

Résumé :

Sunyatasaptativrtti. Candrakirtis Kommentar zu den 'Siebzig Versen über die Leehrheit' des Nagarjuna [Karikas 1-14]. Einleitung, Übersetzung, textkritische Ausgabe des Tibetischen und Indizes. Felix Erb. (Tibetan and Indo-Tibetan Studies 6), Franz Steiner Verlag, Stuttgart 1997. xxiv, 302 pp. DM 96. ISBN 3-515-07020-6.

Styles APA, Harvard, Vancouver, ISO, etc.

4

Genet, Anaële. « ¿El artículo 515-14 del código civil francés podría comenzar a dar sus frutos ? » Derecho Animal. Forum of Animal Law Studies 8, n^o 2 (1 avril 2017) : 1. http://dx.doi.org/10.5565/rev/da.25.

Texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

5

YEARGIN, THOMAS, ANGELA FRASER, GUOHUI HUANG et XIUPING JIANG. « Recovery and Disinfection of Two Human Norovirus Surrogates, Feline Calicivirus and Murine Norovirus, from Hard Nonporous and Soft Porous Surfaces ». Journal of Food Protection 78, n^o 10 (1 octobre 2015) : 1842–50. http://dx.doi.org/10.4315/0362-028x.jfp-14-515.

Texte intégral

Résumé :

Human norovirus is a leading cause of foodborne disease and can be transmitted through many routes, including environmental exposure to fomites. In this study, both the recovery and inactivation of two human norovirus surrogates, feline calicivirus (FCV) and murine norovirus (MNV), on hard nonporous surfaces (glass) and soft porous surfaces (polyester and cotton) were evaluated by both plaque assay and reverse transcription quantitative PCR method. Two disinfectants, sodium hypochlorite (8.25%) and accelerated hydrogen peroxide (AHP, at 4.25%) were evaluated for disinfection efficacy. Five coupons per surface type were used to evaluate the recovery of FCV and MNV by sonication and stomaching and the disinfection of each surface type by using 5 ml of disinfectant for a contact time of 5 min. FCV at an initial titer of ca. 7 log PFU/ml was recovered from glass, cotton, and polyester at 6.2, 5.4, and 3.8 log PFU/ml, respectively, compared with 5.5, 5.2, and 4.1 log PFU/ml, respectively, for MNV with an initial titer of ca. 6 log PFU/ml. The use of sodium hypochlorite (5,000 ppm) was able to inactivate both FCV and MNV (3.1 to 5.5 log PFU/ml) below the limit of detection on all three surface types. AHP (2,656 ppm) inactivated FCV (3.1 to 5.5 log PFU/ml) below the limit of detection for all three surface types but achieved minimal inactivation of MNV (0.17 to 1.37 log PFU/ml). Reduction of viral RNA by sodium hypochlorite corresponded to 2.72 to 4.06 log reduction for FCV and 2.07 to 3.04 log reduction for MNV on all three surface types. Reduction of viral RNA by AHP corresponded to 1.89 to 3.4 log reduction for FCV and 0.54 to 0.85 log reduction for MNV. Our results clearly indicate that both virus and surface types significantly influence recovery efficiency and disinfection efficacy. Based on the performance of our proposed testing method, an improvement in virus recovery will be needed to effectively validate virus disinfection of soft porous surfaces.

Styles APA, Harvard, Vancouver, ISO, etc.

6

Lougheed, Bryan C., Brett Metcalfe, Ulysses S. Ninnemann et Lukas Wacker. « Moving beyond the age–depth model paradigm in deep-sea palaeoclimate archives : dual radiocarbon and stable isotope analysis on single foraminifera ». Climate of the Past 14, n^o 4 (20 avril 2018) : 515–26. http://dx.doi.org/10.5194/cp-14-515-2018.

Texte intégral

Résumé :

Abstract. Late-glacial palaeoclimate reconstructions from deep-sea sediment archives provide valuable insight into past rapid changes in ocean chemistry. Unfortunately, only a small proportion of the ocean floor with sufficiently high sediment accumulation rate (SAR) is suitable for such reconstructions using the long-standing age–depth model approach. We employ ultra-small radiocarbon (14C) dating on single microscopic foraminifera to demonstrate that the long-standing age–depth model method conceals large age uncertainties caused by post-depositional sediment mixing, meaning that existing studies may underestimate total geochronological error. We find that the age–depth distribution of our 14C-dated single foraminifera is in good agreement with existing bioturbation models only after one takes the possibility of Zoophycos burrowing into account. To overcome the problems associated with the age–depth paradigm, we use the first ever dual 14C and stable isotope (δ18O and δ13C) analysis on single microscopic foraminifera to produce a palaeoclimate time series independent of the age–depth paradigm. This new state of the art essentially decouples single foraminifera from the age–depth paradigm to provide multiple floating, temporal snapshots of ocean chemistry, thus allowing for the successful extraction of temporally accurate palaeoclimate data from low-SAR deep-sea archives. This new method can address large geographical gaps in late-glacial benthic palaeoceanographic reconstructions by opening up vast areas of previously disregarded, low-SAR deep-sea archives to research, which will lead to an improved understanding of the global interaction between oceans and climate.

Styles APA, Harvard, Vancouver, ISO, etc.

7

Sussmann, Hector J. « Lie brackets and real analyticity in control theory ». Banach Center Publications 14, n^o 1 (1985) : 515–42. http://dx.doi.org/10.4064/-14-1-515-542.

Texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

8

Petereit, Johannes, Jan Saynisch, Christopher Irrgang, Tobias Weber et Maik Thomas. « Electromagnetic characteristics of ENSO ». Ocean Science 14, n^o 3 (25 juin 2018) : 515–24. http://dx.doi.org/10.5194/os-14-515-2018.

Texte intégral

Résumé :

Abstract. The motion of electrically conducting sea water through Earth's magnetic field induces secondary electromagnetic fields. Due to its periodicity, the oceanic tidally induced magnetic field is easily distinguishable in magnetic field measurements and therefore detectable. These tidally induced signatures in the electromagnetic fields are also sensitive to changes in oceanic temperature and salinity distributions. We investigate the impact of oceanic heat and salinity changes related to the El Niño–Southern Oscillation (ENSO) on oceanic tidally induced magnetic fields. Synthetic hydrographic data containing characteristic ENSO dynamics have been derived from a coupled ocean–atmosphere simulation covering a period of 50 years. The corresponding tidally induced magnetic signals have been calculated with the 3-D induction solver x3dg. By means of the Oceanic Niño Index (ONI), based on sea surface temperature anomalies, and a corresponding Magnetic Niño Index (MaNI), based on anomalies in the oceanic tidally induced magnetic field at sea level, we demonstrate that evidence of developing ENSO events can be found in the oceanic magnetic fields statistically 4 months earlier than in sea surface temperatures. The analysis of the spatio-temporal progression of the oceanic magnetic field anomalies offers a deeper understanding on the underlying oceanic processes and is used to test and validate the initial findings.

Styles APA, Harvard, Vancouver, ISO, etc.

9

Coppola, Valentina, Mariangela Coppola, Mariapina Rocco, Maria Digilio, Chiara D’Ambrosio, Giovanni Renzone, Rosanna Martinelli et al. « Transcriptomic and proteomic analysis of a compatible tomato-aphid interaction reveals a predominant salicylic acid-dependent plant response ». BMC Genomics 14, n^o 1 (2013) : 515. http://dx.doi.org/10.1186/1471-2164-14-515.

Texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

10

Stein, R. L. « "First Contact" and Other Israeli Fictions : Tourism, Globalization, and the Middle East Peace Process ». Public Culture 14, n^o 3 (1 octobre 2002) : 515–44. http://dx.doi.org/10.1215/08992363-14-3-515.

Texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

11

Kania, Maciej, et Mateusz Szczęch. « Geometry and topology of a Polish Outer Carpathian digital-elevation-model-interpreted lineament network in the context of regional tectonics ». Solid Earth 14, n^o 5 (12 mai 2023) : 515–28. http://dx.doi.org/10.5194/se-14-515-2023.

Texte intégral

Résumé :

Abstract. The Polish part of the Western Outer Carpathian lineament network was analysed based on the Global Multi-resolution Terrain Elevation Data 2010 (GMTED2010) digital elevation model. Lineaments were identified in the visual screening of the hillshade model. To the best of our knowledge, no one has studied the geometrical properties of the network in relation to the topological ones. The NetworkGT QGIS toolbox was applied to identify the nodes and branches of the network as well as to calculate the topology parameters. Our aim was to find differences between the western and eastern parts of the Western Outer Carpathians; therefore, the analyses were carried out in six sectors chosen based on the geographical subdivision in the geological context: three in the north, mainly the Silesian unit, and three in the south, mainly the Magura unit. We found general agreement of the identified network with the photo-lineament map; however, some of the photo-lineaments are not confirmed by a digital elevation model (DEM). We found that the topological parameters of the networks change from west to east but not from north to south. There are areas of increased interconnectivity, especially the Nowy Sącz Basin, where the lineament network may reflect a complicated system of cross-cutting, deep-rooted fault zones in the basement.

Styles APA, Harvard, Vancouver, ISO, etc.

12

Matin, M. M., M. M. H. Bhuiyan, A. Afrin et D. C. Debnath. « Comparative Antimicrobial Activities of some Monosaccharide and Disaccharide Acetates ». Journal of Scientific Research 5, n^o 3 (29 août 2013) : 515–25. http://dx.doi.org/10.3329/jsr.v5i3.15695.

Texte intégral

Résumé :

A number of furanose (2,4) and pyranose (5,7,9,11,13) acetates were prepared by direct acetylation method. For comparative antimicrobial studies sucrose octaacetate (14) was also prepared. All the compounds (1-14) were screened for in vitro antibacterial activity against ten human pathogenic bacteria viz. Bacillus subtilis, Bacillus cereus, Bacillus megaterium, Staphylococcus aureus, Escherichia coli, INABA ET (Vibrio), Pseudomonas species, Salmonella paratyphi, Salmonella typhi and Shigella dysenteriae. These compounds were also screened for in vitro antifungal activity against four pathogenic fungi viz. Aspergillus niger, Alternaria alternata, Curvularia lunata and Fusarium equiseti. The study revealed that the pyranose acetate derivatives (5,7,9,11,13) are more prone towards antimicrobial functionality than those of the furanose acetates (2,4) and sucrose octaacetate (14). Keywords: Glucofuranose; Glucopyranose; Acetylation; Antimicrobial activity; Structure activity relationship (SAR). © 2013 JSR Publications. ISSN: 2070-0237 (Print); 2070-0245 (Online). All rights reserved. doi: http://dx.doi.org/10.3329/jsr.v5i3.15695 J. Sci. Res. 5 (3), 515-525 (2013)

Styles APA, Harvard, Vancouver, ISO, etc.

13

Balan, Anoop P., et S. Harikrishnan. « Floristic diversity of the Indian Cardamom Research Institute campus, Myladumpara, Western Ghats, India ». Journal of Threatened Taxa 9, n^o 10 (26 octobre 2017) : 10804. http://dx.doi.org/10.11609/jott.2611.9.10.10804-10822.

Texte intégral

Résumé :

A study on the flora of Indian Cardamom Research Institute campus, Myladumpara was carried out during 2012–2015 and a total of 515 taxa were collected during this study. The indigenous or naturalized flora is represented by 392 taxa in 303 genera under 94 families. Dicotyledonous plants dominate with 335 species in 251 genera under 80 families. Monocotyledons are represented by 57 species in 52 genera under 14 families. Among the families, Fabaceae dominates with 29 species followed by Asteraceae (27 spp.) and Euphorbiaceae (22 spp.) and 40 families are represented by single species each. During the study 68 species that are considered as endemic to the Western Ghats could be collected.

Styles APA, Harvard, Vancouver, ISO, etc.

14

Ødum, Lars, Julie Pildal et Jens F. Rehfeld. « Somatostatin in the boar reproductive system ». European Journal of Endocrinology 130, n^o 5 (mai 1994) : 515–21. http://dx.doi.org/10.1530/eje.0.1300515.

Texte intégral

Résumé :

Ødum L, Pildal I. Rehfeld pJF. Somatostatin in the boar reproductive system. Eur J Endocrinol 1994;130:515–21. ISSN 0804–4643 Somatostatin (SRIF) is a widely distributed regulatory peptide. Recently, it was shown that human seminal plasma contains high concentrations of SRIF. In order to find the cellular source of seminal SRIF we have examined the presence of SRIF in porcine urogenital tissues. The concentration of SRIF in male accessory reproductive tissues of 3-month-old pigs (N = 4) ranged from 1 to 17 nmol/kg. In the boar, only the prostate gland contained significant amounts of SRIF (median 7 nmol/kg, range 3–18 nmol/kg, N = 4). Testis and semen contained no SRIF. Gel chromatography of extracts of the male accessory sex glands and epididymis showed both SRIF-28 and SRIF-14, whereas urinary bladder contained mainly SRIF-14. In conclusion, the results show a considerable species, tissue and developmental variation in the expression of SRIF in the genitourinary tract. Lars Ødum, Department of Clinical Chemistry, Herlev Hospital, Herlev Ringvej 75, DK-2730, Denmark

Styles APA, Harvard, Vancouver, ISO, etc.

15

Buck, Thomas Martin. « Katharina Lichtenberger, Mathias von Neuenburg und die Gegenwartschronistik des 14. Jahrhunderts im deutschen Südwesten. (Historische Studien, Bd. 515.) Husum, Matthiesen 2021 ». Historische Zeitschrift 316, n^o 1 (1 février 2023) : 238–40. http://dx.doi.org/10.1515/hzhz-2023-1031.

Texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

16

Lee, Bin, Xue–qian Li, Yuan-shan Li, Jia-quan Zhang et Pei-ying Zhao. « Can the Hidden Phase in Δ S = 1 Weak Radiative Decays of Hyperons Be Determined »,. Communications in Theoretical Physics 14, n^o 4 (décembre 1990) : 515–20. http://dx.doi.org/10.1088/0253-6102/14/4/515.

Texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

17

Lodise, Thomas P., Susan L. Rosenkranz, Matthew Finnemeyer, Scott Evans, Matthew Sims, Marcus J. Zervos, C. Buddy Creech et al. « The Emperor’s New Clothes : PRospective Observational Evaluation of the Association Between Initial VancomycIn Exposure and Failure Rates Among ADult HospitalizEd Patients With Methicillin-resistant Staphylococcus aureus Bloodstream Infections (PROVIDE) ». Clinical Infectious Diseases 70, n^o 8 (3 juin 2019) : 1536–45. http://dx.doi.org/10.1093/cid/ciz460.

Texte intégral

Résumé :

Abstract Background Vancomycin is the most commonly administered antibiotic in hospitalized patients, but optimal exposure targets remain controversial. To clarify the therapeutic exposure range, this study evaluated the association between vancomycin exposure and outcomes in patients with methicillin-resistant Staphylococcus aureus (MRSA) bacteremia. Methods This was a prospective, multicenter (n = 14), observational study of 265 hospitalized adults with MRSA bacteremia treated with vancomycin. The primary outcome was treatment failure (TF), defined as 30-day mortality or persistent bacteremia ≥7 days. Secondary outcomes included acute kidney injury (AKI). The study was powered to compare TF between patients who achieved or did not achieve day 2 area under the curve to minimum inhibitory concentration (AUC/MIC) thresholds previously found to be associated with lower incidences of TF. The thresholds, analyzed separately as co-primary endpoints, were AUC/MIC by broth microdilution ≥650 and AUC/MIC by Etest ≥320. Results Treatment failure and AKI occurred in 18% and 26% of patients, respectively. Achievement of the prespecified day 2 AUC/MIC thresholds was not associated with less TF. Alternative day 2 AUC/MIC thresholds associated with lower TF risks were not identified. A relationship between the day 2 AUC and AKI was observed. Patients with day 2 AUC ≤515 experienced the best global outcomes (no TF and no AKI). Conclusions Higher vancomycin exposures did not confer a lower TF risk but were associated with more AKI. The findings suggest that vancomycin dosing should be guided by the AUC and day 2 AUCs should be ≤515. As few patients had day 2 AUCs <400, further study is needed to define the lower bound of the therapeutic range.

Styles APA, Harvard, Vancouver, ISO, etc.

18

Mun, Yeung-Chul, Jee-Young Ahn, Kyung-Eun Lee, Eun-Sun Yoo, Sang min Lee, Yun-Kyung Bae, Seung-Eun Lee, Min Kyoung Kim, Myung Soo Hyun et Chu-Myong Seong. « Hyaluronic Acid Enhances To Differentiate into Myelo-Megakaryocytic Lineages during Ex-Vivo Expansion of Human Cord Blood(HCB) Using TPO, SCF and FL. » Blood 106, n^o 11 (16 novembre 2005) : 5270. http://dx.doi.org/10.1182/blood.v106.11.5270.5270.

Texte intégral

Résumé :

Abstract Hyaluronic acid(HA) is the major glycosaminoglycan component of extracellular matrices. CD44 is a ligand for HA and expresses on a wide variety of cell types. CD44 has been implicated in many cell-cell and cell-matrix interactions. In the present study, we studied the effects of HA on proliferation, differentiation and apoptosis of CD34+ cells during HCB ex vivo expansion using TPO, SCF and FL. CD34+ cells from cord blood MNC were cultured for 4 weeks in the combination of TPO, SCF and FL on HA-coated well and CD34+cells were cultured in identical conditions except HA-coated well. At day 4, 7, 14, 21, 18, we counted the number of expanded cells and analyzed the cell surface markers (CD3, CD14, CD19, CD34, CD44, CD61, CD66b) and apoptosis using 7-AAD staining. To analyze the effects of HA on CD34+ cell differentiation, anti-CD44 antibodies (clone A3D8 and 515) were used. The morphology on the expanded cells was examined using wright’s staining. In results, cell counts were increased in HA-coated well compared with the control group until D7, but proliferation rate was decreased after D7. Apoptosis portion of CD34+ using 7-AAD staining was increased in HA-coated well and % of CD34+ cells was decreased in HA-coated wells compared with that of the control groups. The expanded cells in HA-coated well were negative for CD3 (pan T cell), CD19 (B cell) but CD14 (monocyte), CD61 (megakaryocyte) and CD66b (neutrophil) were highly expressed than those of control groups. Apoptotic portion was also increased in the HA-coated group. CD66b (neutrophil) expression in HA-coated well was significantly higher than those of control groups at D14 and above findings were confirmed by wright’s stain. CD66 expression was reduced by the anti-CD44 antibody clone, A3D8 and however CD66 expression was increased by the clone, 515. Therefore, it might be possible that A3D8 and clone 515 recognize each different epitopes of CD44. In conclusion, CD34+ cell differentiation from HCB into CD66, CD14 and CD61 positive cells was enhanced by the contact of HA during ex vivo expansion using TPO, SCF and FL. This result suggests that the expanded human cord blood graft with HA might be useful as the “post-progenitor” to shorten the severe cytopenia period after myeloablative conditioning for HCB transplantation.

Styles APA, Harvard, Vancouver, ISO, etc.

19

Peltzer, Karl. « Predictors of Positive Health among a Sample of South African Adolescents ». Psychological Reports 100, n^o 3_suppl (juin 2007) : 1186–88. http://dx.doi.org/10.2466/pr0.100.4.1186-1188.

Texte intégral

Résumé :

Many studies that address adolescent health focus on risk behaviours, their predictors and outcomes, but few focus on positive health and its predictors. The aim of this study was to investigate aspects of adolescents' positive health (lack of emotional and somatic symptoms, positive subjective health and self-reported happiness), as predicted by adolescents' relationships with their parents and peers, and their perceptions of their school. The measure used was part of the Health Behaviour in School-age Children questionnaire. The sample included 515 South African Grade 8 secondary school students (51.8% Black, 48.2% White; 40.8% boys and 59.2% girls; M age 15.5 yr., SD=1.6, range 14–18) chosen at random from three urban schools in Polokwane, Limpopo Province. Analysis indicated that positive perceptions of the school and parental relations were identified as significant and positive peer and siblings relationships as nonsignificant predictors for indicators of positive health.

Styles APA, Harvard, Vancouver, ISO, etc.

20

Naeem, Asif, Muhammad Aslam, Mumtaz Ahmad, Muhammad Asif, Mustafa Atilla Yazici, Ismail Cakmak et Abdul Rashid. « Biofortification of Diverse Basmati Rice Cultivars with Iodine, Selenium, and Zinc by Individual and Cocktail Spray of Micronutrients ». Agronomy 12, n^o 1 (27 décembre 2021) : 49. http://dx.doi.org/10.3390/agronomy12010049.

Texte intégral

Résumé :

Given that an effective combined foliar application of iodine (I), selenium (Se), and zinc (Zn) would be farmer friendly, compared to a separate spray of each micronutrient, for the simultaneous biofortification of grain crops, we compared effectiveness of foliar-applied potassium iodate (KIO3, 0.05%), sodium selenate (Na2SeO4, 0.0024%), and zinc sulfate (ZnSO4∙7H2O, 0.5%), separately and in their combination (as cocktail) for the micronutrient biofortification of four Basmati cultivars of rice (Oryza sativa L.). Foliar-applied, each micronutrient or their cocktail did not affect rice grain yield, but grain yield varied significantly among rice cultivars. Irrespective of foliar treatments, the brown rice of cv. Super Basmati and cv. Kisan Basmati had substantially higher concentration of micronutrients than cv. Basmati-515 and cv. Chenab Basmati. With foliar-applied KIO3, alone or in cocktail, the I concentration in brown rice increased from 12 to 186 µg kg−1. The average I concentration in brown rice with foliar-applied KIO3 or cocktail was 126 μg kg−1 in cv. Basmati-515, 160 μg kg−1 in cv. Chenab Basmati, 153 μg kg−1 in cv. Kisan Basmati, and 306 μg kg−1 in cv. Super Basmati. Selenium concentration in brown rice increased from 54 to 760 µg kg−1, with foliar-applied Na2SeO4 individually and in cocktail, respectively. The inherent Zn concentration in rice cultivars ranged between 14 and 19 mg kg−1 and increased by 5–6 mg Zn per kg grains by foliar application of ZnSO4∙7H2O and cocktail. The results also showed the existence of genotypic variation in response to foliar spray of micronutrients and demonstrated that a foliar-applied cocktail of I, Se, and Zn could be an effective strategy for the simultaneous biofortification of rice grains with these micronutrients to address the hidden hunger problem in human populations.

Styles APA, Harvard, Vancouver, ISO, etc.

21

Preda, Anda, Lucas C. Van Dijk, Jacques A. Van Oostaijen et Peter M. Pattynama. « Complication rate and diagnostic yield of 515 consecutive ultrasound-guided biopsies of renal allografts and native kidneys using a 14-gauge Biopty gun ». European Radiology 13, n^o 3 (mars 2003) : 527–30. http://dx.doi.org/10.1007/s00330-002-1482-3.

Texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

22

Palacios Delgado, Jorge Raúl. « Influencia de los estilos parentales en adolescentes que han intentado suicidarse ». Revista de Psicoterapia 21, n^o 84 (1 novembre 2010) : 85–93. http://dx.doi.org/10.33898/rdp.v21i84.613.

Texte intégral

Résumé :

El objetivo de esta investigación fue conocer las diferencias en los estilos parentales de los adolescentes que han intentado suicidarse, así como identificar el efecto que tienen las prácticas parentales sobre el intento suicida. Se utilizó una muestra de 1000 jóvenes de los cuales 485 eran hombres y 515 eran mujeres, con un rango de edad entre 14 y 22 años. Para medir los estilos parentales se utilizó el instrumento multidimensional de Palacios y Andrade (2006) el cual mide cuatro estilos parentales, con base en siete prácticas parentales. Para medir el intento suicida se integro una sección con preguntas relativas al intento de suicidio. Los resultados mostraron diferencias en los estilos parentales, específicamente los estilos autoritario y negligente se vinculan con este comportamiento. Por otro lado, una menor autonomía materna, la imposición por parte la madre y una menor supervisión del papá influyen en la presencia de intentar suicidarse un mayor número de veces en los adolescentes.

Styles APA, Harvard, Vancouver, ISO, etc.

23

Oktaviani, Nur, et Anisatun Ramadhan. « Profil Penggunaan Obat Antibiotik di Puskesmas Cakranegara Periode Januari – Juni 2021. » Jurnal Ilmu Kesehatan dan Farmasi 9, n^o 2 (2 septembre 2021) : 43–46. http://dx.doi.org/10.51673/jikf.v9i2.880.

Texte intégral

Résumé :

Intensitas penggunaan antibiotik yang relatif tinggi menimbulkan berbagai permasalahan dan merupakan ancaman global bagi kesehatan terutama resistensi bakteri terhadap antibiotik. Tujuan penelitian ini adalah untuk mengetahui gambaran penggunaan obat antibiotik di Puskesmas Cakranegara. Penelitian ini dilaksanakan pada bulan Juli 2021 yang berlokasi di Puskesmas Cakranegara. Metode penelitian yang digunakan adalah metode penelitian deskriptif. Metode penelitian deskriptif berarti data yang telah di dapatkan di deskripsikan secara objektif dengan memaparkan fenomena dengan bantuan tabel atau gambar. Berdasarkan hasil penelitian yang telah dilakukan menunjukan bahwa jumlah antibiotik yang digunakan di Puskesmas Cakranegara periode Januari – Juni 2021 sebanyak 56.785. Dan dengan Penggunaan Antibiotik meliputi Amoxicillin tablet sebanyak 47.209, Kotrimoxazole tablet sebanyak 4.161, Ciprofloxacin sebanyak 2.695, Amoxicillin sirup kering sebanyak 850, Metronidazole sebanyak 515, Kotrimoxazole sirup sebanyak 436, Kloramfenikol kapsul sebanyak 325, Oxytetrasiklin sebanyak 269, Gentamisin Sk sebanyak 142, Kloramfenikol tetes telinga sebanyak 106, Ampicillin sebanyak 80 dan Azitromicin sebanyak 14. Dengan penggunaan antibiotik terbanyak yaitu Amoxicillin tablet sebanyak 47.209.

Styles APA, Harvard, Vancouver, ISO, etc.

24

Nizamani, MM, Q. Zhang, HL Zhang et Y. Wang. « Checklist of the fungi associated with the rubber tree (Hevea brasiliensis) ». Current Research in Environmental & ; Applied Mycology 13, n^o 1 (2023) : 439–88. http://dx.doi.org/10.5943/cream/13/1/17.

Texte intégral

Résumé :

This publication offers a comprehensive and up-to-date checklist of fungi found on the Rubber tree (Hevea brasiliensis). This is a compilation of information regarding the life modes and distribution of fungi that have been recorded on Rubber trees. The overall checklist includes 788 species and 179 taxa from 57 countries identified to the genus level. The taxa included in the checklist are classified into 515 genera, 180 families, and 68 orders. These species are classified into four phyla. A total of 679 species and 161 taxa are classified into 439 genera, 138 families, and 47 orders from 54 countries belonging to the Ascomycota. A total of 97 species and 13 taxa are classified into 21 orders, 40 families, and 71 genera from 31 countries belonging to the Basidiomycota. A total of 14 species and two taxa are classified into one order, two families, and four genera from 27 countries belonging to the Oomycota.

Styles APA, Harvard, Vancouver, ISO, etc.

25

Jaffar, Azhar A., et Ali A. Abdulkareem. « Genetic Diversity and Identification of MC1R SNPs Association with Colors in Iraqi Local Ducks ». IOP Conference Series : Earth and Environmental Science 1060, n^o 1 (1 juillet 2022) : 012066. http://dx.doi.org/10.1088/1755-1315/1060/1/012066.

Texte intégral

Résumé :

Abstract The aim of the study was to reveal the variation in the polymorphisms of Melancortin 1 receptor (MC1R) gene and relationship of SNP with colors in Iraqi local duck, in addition to identifying some of molecular characteristics of this gene and identifying the differences in the amino acids of MC1R gene and their differences between the white and gray local duck lines, two local duck lines were selected with 14 white and 14 gray birds, was chosen a region with size 515 bp MC1R gene, where designed the primer of; (Forward primer 5’-, GCTCTTCATGCTGCTGATGG -3, and Reverse primer 5’-, GGCAGGTGACGATGAGGATG -3) by relying on the reference copy under the accession number KU234624.1, the results with PCR technique and electrophoresis proved success of amplification process and fragment was 515 bp. After analyzing sequence of nitrogenous bases for the studied fragment for MC1R gene, two changes were observed in nitrogenous bases, which is known as single nucleotide formation (SNP). The two sites for studied fragment recorded with accession numbers for our study are LC480442.55G> A and LC480443.328C> T. It was observed that the first change site did not lead to any change in the amino acid (valine) at the 126th site of peptide chain of MC1R gene, while the second site resulted in an occurrence change in the amino acid arginine to cysteine at position 217 of peptide chain of the gene. The results showed, it was found that sites of changes in nitrogenous bases were found in both white and gray lines of local ducks, while the study did not show any correlation between these sites with the color of ducks. The results of some molecular tests of the MC1R gene showed that rate of change of nitrogenous bases and the genetic variation for studied frgament is very small when comparing the haplotypes and phylogenetic tree of the animals in this study, and the animals from other countries such as China, it was observed that local ducks possess same nucleotide sequence, which means possibility of dependence origin of local duck of Chinese ducks. The fragments obtained in this study for MC1R gene were recorded at global gene bank sites in NCBI, EMBL and DDBJ under independent accession numbers for our Iraqi local animals which LC480442, LC480443, LC480444, and LC480445.

Styles APA, Harvard, Vancouver, ISO, etc.

26

Altaras-Dimitrijevic, Ana. « A faceted eye on intellectual giftedness : Examining the personality of gifted students using FFM domains and facets ». Psihologija 45, n^o 3 (2012) : 231–56. http://dx.doi.org/10.2298/psi1203231a.

Texte intégral

Résumé :

The study examines the personality profile of gifted vs. average-ability students from the perspective of the FFM. The issue was approached by (1) reviewing the literature for well-established personality characteristics of the gifted, (2) establishing correspondences between these traits and FFM domains/facets, and (3) formulating a domain and a facet-level model which were hypothesized to discriminate significantly between gifted and nongifted students. The domain-level model consisted of Openness and Agreeableness. The facet-level model included 14 traits: Anxiety, Impulsiveness, Gregariousness, Assertiveness, Fantasy, Feelings, Aesthetics, Ideas, Compliance, Modesty, Tendermindedness, Order, Achievement, and Deliberation. The models were tested on three samples (N1=515 high-school students, 155 gifted; N2=132 psychology students, 28 gifted; N3=443 psychology students, 91 gifted). Results indicate that the domain-level model does not discriminate significantly between gifted and nongifted students in each sample, whereas the proposed 14-facet model yields a significant discrimination across all samples. The latter model may be further adjusted by removing facets which proved inconsistent or unsubstantial in distinguishing between the two groups. This yields a 7-facet discriminant function, which is also significant across samples, indicating that gifted students are consistently distinguished by a combination of high Ideas, Fantasy, Aesthetics, and Assertiveness, but low Gregariuosness, Modesty, and Tendermindeness. Educational implications and limitations are discussed.

Styles APA, Harvard, Vancouver, ISO, etc.

27

Nasonov, E., T. Beketova, L. P. Ananyeva, S. Solovyev, V. Vasiliev, O. Koneva, O. Desinova, S. Palshina, E. Sokol et E. Nikollaeva. « SAT0171 RITUXIMAB IN SYSTEMIC AUTOIMMUNE RHEUMATIC DISEASES : ONE CENTER EXPERIENCE OF TREATMENT 515 PATIENTS ». Annals of the Rheumatic Diseases 79, Suppl 1 (juin 2020) : 1027.1–1027. http://dx.doi.org/10.1136/annrheumdis-2020-eular.2142.

Texte intégral

Résumé :

Background:B cells have important functions in the pathogenesis of systemic autoimmune rheumatic diseases (SARDs).Objectives:The purpose of the research was to study the therapeutic option of Rituximab (RTM), a chimeric anti-CD20 antibody, in SARDs such as ANCA-associated systemic vasculitis (AAV), cryoglobulinemic vasculitis (СV), systemic lupus erythematosus (SLE), systemic sclerosis (SS), primary Sjögren syndrome (pSS) and IgG4-related disease (IgG4-RD).Methods:We present data on efficacy and safety of RTM in 515 patients (pts) with SARDs. 103 pts had AAV (58- granulomatosis with polyangiitis, GPA; 35- microscopic polyangiitis, MPA and 10- eosinophilic granulomatosis with polyangiitis, EGPA), 21 pts had CV, 167- SLE, 90- SS, 100- pSS, 34- IgG4-RD. Characteristics of pts and results of RTM treatment are present in Table. Mean follow-up duration after initiation of RTM was 25- 58 months.Results:The average cumulative RTM dose in all groups exceeded 2.4 g, 71% of pts received repeated RTM courses (0.5-1.0 g) every 4 – 12 months. Complete (good) clinical response was achieved in 70-93% pts, except for the SLE (49%- complete response, 32- incomplete and 19%- no response). Usage of repeated RTM courses increased the clinical efficacy and reduced the risk of recurrence. Despite the fact that the study population included a high percentage of pts with severe or refractory SARDs, total mortality rate was about 6% during the follow-up period, highest in CV and AAV (14-11%). In AAV and SLE infections constitute a significant proportion of serious adverse reactions (10-11%). Late-onset neutropenia was only in pts with AAV (12%) and SLE (3%).Conclusion:Treatment with RTM was highly effective in SARDs. In certain SARDs RTM safety profile of should be considered during treatment planning. Further studies of the targeted anti-B-cell therapy, including RTM efficacy and safety in SARDs, clarification of the indications and optimal RTM regimens are needed.Table.ParametersАAVCVSLESSpSSIgG4-RDGPA, MPAEGPAN pts9310211679010034Age, years41(16-67)50(24-71)53,6 + 2941(18-52)47(17-71)42 + 12,247,4 + 15,9Percentage of females56%90%52%92%75%97%60%Duration of disease, months*14(1-288)11(1-180)72(3-96)18(2-47)70(7-264)90(36-168)24(6-60)Cumulative RTM dose, g*3 (0,5-8)3 (1,5-5,5)4,7 + 3,82,4 (1,8±0,8)2,9(0,5-6)5,5 + 1,54 + 1,5Follow-up duration after the first RTM course, month*37(1–96)36(14-94)52(6-108)38(12-67)27(12-42)58(24-96)25(3-60)Clinical response, %Complete (good)93%90%71%49%70%92,5%77%Incomplete response6%10%29%32%24%6,5%23%No response1%0%-19%6%1%-Relapse8%30%--nd--Glucocorticoids dose, mg/day*:Before RTMAfter RTM30(5–60)5(0-10)20(7,5-50)7,5(5-10)4,4(0-24)1,5(0-4)28(15-40)7,5(5-15)12(0-25)9(0-15)7,5(0-40)1,2510(2,5-40)0,5Immunosuppressants% pts before RTM72%90%38%65%43%44%40%% pts after RTM43%70%5%46%50%8%10%Infusion-related reactions,9%20%24%4%2%10%3%including severe-10%-0,6%1%1%-Pts with serious adverse reactions,26%40%5%14%2%5%3%including: infections,11%10%-10%2%5%3%neutropenia10%20%-3%---Deceased pts during the follow-up11%-14%5%6%2%-*Data are provided in the following format: median & min-max range in the bracketsDisclosure of Interests:None declared

Styles APA, Harvard, Vancouver, ISO, etc.

28

McGarvey, Cliona, Karina Hamilton, Jean Donnelly et Alf J. Nicholson. « Trends in road transport collision deaths in the Irish paediatric population : a retrospective review of mortality data, 1991–2015 ». BMJ Paediatrics Open 3, n^o 1 (janvier 2019) : e000361. http://dx.doi.org/10.1136/bmjpo-2018-000361.

Texte intégral

Résumé :

ObjectiveTo establish the incidence of road transport collision (RTC) fatalities in the Irish paediatric population, examining trends in fatality rates over a period of 25 years, during which several national road safety interventions were implemented.Study designRetrospective review of death registration details of children 0–19 years in Ireland between January 1991 and December 2015. Trends in mortality rates were investigated using average annual per cent change and Poisson regression analysis.ResultsProportionate RTC mortality, the majority of which occurred on public roads (94.1%, n=1432) increased with age; <0.3% (<1 year), 8.3% (1–14 years) and 18.4% (15–19 years) (2011–2015 average). Over time, rates declined significantly in all age groups; reductions of 79.0% (4.0 to 0.84/100 000, 1–14 years) and 68.4% (15.5 to 4.9/100 000, 15–19 years) resulted in 537 (95% CI 515 to 566) fewer child deaths (1–19 years) over the period 1996–2015. This reduction was evident for both road user types, the greatest decline (84.8%) among pedestrians 1–14 years (2.1 to 0.32/100 000) and the lowest (66.5%) among occupants 15–19 years, the majority of whom were male (12.4 to 4.2/100 000). The rate of decline was greatest during periods coinciding with introduction of targeted interventions. Risk of death in children 1–14 years was halved in the period after 2002 (incidence rate ratio (IRR) 0.52) while in children 15–19 years old, a significantly lower RTC fatality risk was evident after 2006 and 2010 (IRR 0.68 and IRR 0.50).ConclusionChild and adolescent mortality from RTCs has declined dramatically in Ireland, in excess of reductions in overall paediatric mortality. However, rates remain higher than in other EU countries and further effort is required to reduce the number of deaths further, particularly among adolescent males.

Styles APA, Harvard, Vancouver, ISO, etc.

29

Trevisan, Rafael Obata, Malú Mateus Santos, Chamberttan Souza Desidério, Leandro Gomes Alves, Thiago de Jesus Sousa, Letícia de Castro Oliveira, Arun Kumar Jaiswal et al. « In Silico Identification of New Targets for Diagnosis, Vaccine, and Drug Candidates against Trypanosoma cruzi ». Disease Markers 2020 (9 décembre 2020) : 1–15. http://dx.doi.org/10.1155/2020/9130719.

Texte intégral

Résumé :

Chagas disease is a neglected tropical disease caused by the parasite Trypanosoma cruzi. Despite the efforts and distinct methodologies, the search of antigens for diagnosis, vaccine, and drug targets for the disease is still needed. The present study is aimed at identifying possible antigens that could be used for diagnosis, vaccine, and drugs targets against T. cruzi using reverse vaccinology and molecular docking. The genomes of 28 T. cruzi strains available in GenBank (NCBI) were used to obtain the genomic core. Then, subtractive genomics was carried out to identify nonhomologous genes to the host in the core. A total of 2630 conserved proteins in 28 strains of T. cruzi were predicted using OrthoFinder and Diamond software, in which 515 showed no homology to the human host. These proteins were evaluated for their subcellular localization, from which 214 are cytoplasmic and 117 are secreted or present in the plasma membrane. To identify the antigens for diagnosis and vaccine targets, we used the VaxiJen software, and 14 nonhomologous proteins were selected showing high binding efficiency with MHC I and MHC II with potential for in vitro and in vivo tests. When these 14 nonhomologous molecules were compared against other trypanosomatids, it was found that the retrotransposon hot spot (RHS) protein is specific only for T. cruzi parasite suggesting that it could be used for Chagas diagnosis. Such 14 proteins were analyzed using the IEDB software to predict their epitopes in both B and T lymphocytes. Furthermore, molecular docking analysis was performed using the software MHOLline. As a result, we identified 6 possible T. cruzi drug targets that could interact with 4 compounds already known as antiparasitic activities. These 14 protein targets, along with 6 potential drug candidates, can be further validated in future studies, in vivo, regarding Chagas disease.

Styles APA, Harvard, Vancouver, ISO, etc.

30

Marín-León, Letícia, Helenice Bosco de Oliveira, Marilisa Berti de Azevedo Barros, Paulo Dalgalarrondo et Neury José Botega. « Social inequality and common mental disorders ». Revista Brasileira de Psiquiatria 29, n^o 3 (21 août 2007) : 250–53. http://dx.doi.org/10.1590/s1516-44462006005000060.

Texte intégral

Résumé :

OBJECTIVE: To analyze the association between the socioeconomic characteristics of individuals and common mental disorders. METHOD: A cross-sectional survey of a representative sample of the urban population, 14 years and older, in Campinas (Brazil) (n = 515) was conducted using a multipurpose instrument that included the Self-Reporting Questionnaire (SRQ-20) to assess common mental disorders in the previous 3 months. Weighted prevalence of common mental disorders was calculated for each independent variable. Crude and adjusted prevalence ratios were estimated using Poisson regression. RESULTS: The overall prevalence was 17% (95% CI 12.8-22.3), 8.9% in males and 24.4% in females. An inverse association was found between common mental disorders and the socioeconomic characteristics (schooling and employment) even after controlling for all the other variables. Higher common mental disorders prevalence was observed in those with less than 5 years of schooling (PR = 5.5) and unemployed or underemployed (PR = 2.0). CONCLUSIONS: As in other studies, common mental disorders were unevenly distributed; it was significantly more frequent in socially disadvantaged individuals. Specific actions to reduce inequalities in the general and mental health system should be studied.

Styles APA, Harvard, Vancouver, ISO, etc.

31

Carvalho, Walter Marcelo Oliveira de, Rute Nascimento da Silva, Marcela Beatriz Feitosa de Carvalho, Thaynara Ferreira Batista, Renata Isabela Feitosa de Carvalho Nascimento, Marcos Vinicius Ribeiro Nascimento, Carla Viviane Freitas de Jesus et Verônica de Lourdes Sierpe Jeraldo. « Aspectos epidemiológicos do câncer infantojuvenil em uma capital do nordeste brasileiro ». Revista Eletrônica Acervo Saúde 12, n^o 11 (27 août 2020) : e4045. http://dx.doi.org/10.25248/reas.e4045.2020.

Texte intégral

Résumé :

Objetivo: Objetivou-se caracterizar os aspectos epidemiológicos e analisar a curva de sobrevivência e razãode risco do câncer infantojuvenil em uma capital do nordeste brasileiro. Métodos: Constitui-se em estudotransversal, exploratório, retrospectivo, de abordagem quantitativa, realizado no Registro de Câncer de BasePopulacional (RCBP), abrangendo crianças e adolescentes, entre 0 a 19 anos, portadoras de neoplasiasmalignas, selecionaram-se 515 casos. Resultados: Os grupos de neoplasias malignas mais incidentes foramrespectivamente: o grupo XI (outras neoplasias malignas), o grupo I (leucemias); o grupo II (linfomas) e ogrupo III (tumores do SNC). O sexo feminino obteve maiores percentuais dentre os acometidos, notadamente nos grupos XI (Outras neoplasias malignas epiteliais), I (Leucemias), II (Linfomas) e III (Tumores do SNC). No masculino, destacaram-se os grupos I, II, III e XI. Conclusão: Observou-se que o exame diagnóstico mais utilizado foi a histologia do tumor primário. Ao analisar a curva de sobrevida se constatou que é menor no sexo feminino e nas faixas etárias de <1 ano, 1 a 4, 5 a 9, e 10 a 14 anos do que a faixa de 15 a 19 anos.

Styles APA, Harvard, Vancouver, ISO, etc.

32

Jaziri, Sayda, Hatem Cheikh M’hamed, Mohsen Rezgui, Sonia Labidi, Amir Souissi, Mounir Rezgui, Mariem Barbouchi, Mohamed Annabi et Haithem Bahri. « Long Term Effects of Tillage–Crop Rotation Interaction on Soil Organic Carbon Pools and Microbial Activity on Wheat-Based System in Mediterranean Semi-Arid Region ». Agronomy 12, n^o 4 (15 avril 2022) : 953. http://dx.doi.org/10.3390/agronomy12040953.

Texte intégral

Résumé :

Conservation agriculture based on no-tillage (NT) and crop rotation allows to enhance soil health. Based on data collected from long-term trials in a semi-arid region of Tunisia, results showed that NT increased significantly soil organic carbon stock (SOCS), soil microbial biomass carbon (SMBC), arbuscular mycorrhizal fungal (AMF) root colonization, and soil microbial respiration (CO2) at 0–20 cm topsoil layer compared to conventional tillage (CT). Moreover, triennial rotation (TRI), based on annual succession of Faba bean-Durum wheat-Barley, and biennial rotation (BI), based on annual succession of Faba bean-Durum wheat, increased significatively SMBC, AMF, and CO2. Likewise, a significant benefit of the two-way interactions Tillage × Rotation was observed. Furthermore, NT combined with TRI recorded the highest SOCS (2181 g C m−2), SMBC (515 mg C kg−1 soil), AMF (14%), and CO2 which is an indicator of soil microbial respiration (1071 mg CO2 kg−1 soil). The current results highlight the benefit adoption of minimum or (NT)combined with crop diversification on soil health.

Styles APA, Harvard, Vancouver, ISO, etc.

33

Pais-Ribeiro, José, et Marisa Sousa. « Vinculação e comportamentos de saúde : Estudo exploratório de uma escala de avaliação da vinculação em adolescentes ». Análise Psicológica 20, n^o 1 (6 décembre 2012) : 67–75. http://dx.doi.org/10.14417/ap.283.

Texte intégral

Résumé :

Os objectivos da presente investigação são: estudar as propriedades psicométricas do Questionário de Vinculação para Adolescentes e a relação entre dimensões de vinculação e comportamentos de saúde. Procedeu-se à adaptação para português (lexical, cultural, conceptual, operacional, e de medida) da versão em língua inglesa que se passou-se a uma amostra de 515 participantes de uma população de estudantes do ensino secundário, dos 9.º e 12.º anos de escolaridade, de ambos os sexos (60,7% sexo feminino), com idades entre os 14 e os 20 anos. Utilizou-se também um questionário de avaliação de comportamentos de saúde com 28 itens distribuídos por 10 dimensões.A exploração das características métricas do questionário mostra que a versão portuguesa exibe características semelhantes à escala original, pelo que os pressupostos associados à escala original se podem generalizar à versão portuguesa. Os resultados mostram ainda que melhor vinculação está associada a melhores comportamentos de saúde, sugerindo-se que esta variável deve ser considerada em programas de promoção de comportamentos de saúde em adolescentes.

Styles APA, Harvard, Vancouver, ISO, etc.

34

Tupan et Rulina Rachmawati. « Roles of Library Research Institutions in Disseminating Research Publications : A Bibliometric Study ». Khizanah al-Hikmah : Jurnal Ilmu Perpustakaan, Informasi, dan Kearsipan 10, n^o 2 (10 novembre 2022) : 162–75. http://dx.doi.org/10.24252/kah/v10i2a6.

Texte intégral

Résumé :

This study seeks to ascertain the distribution of research publications concerning the roles of libraries and librarians in research institutions listed in the Scopus database. A literature search uncovered 1637 articles on the subject. R-Bibliometrix (Biblioshiny) software was used to evaluate these publications in considerable detail. The findings indicated that Library Philosophy and Practice was the publication that published the most significant number of articles on the relevant themes, with Pandita R. being the most productive author. Scientometrics received the most citations (515), followed by The Journal of Academic Librarianship (410), College Research Libraries (399), and Library Management (317 times). The Journal of Academic Librarianship and Library Philosophy and Practice had the highest h-index scores, 9 and 7, respectively. The United States contributed the most to collaboration; of the 260 papers where 246 documents have collaborated across the country, and 14 papers collaborated with authors from several countries. The widely studied topics include libraries, medical libraries, library science, organization and management, librarian of biomedical research, scientific libraries, qualitative research, meta-analysis, systematic reviews, and Cochrane libraries

Styles APA, Harvard, Vancouver, ISO, etc.

35

Halawi, Ali, et Ossama Abbas. « Isotretinoin-induced Facial Hyperpigmentation : Idiosyncratic Reaction ? » Journal of Dermatologic Research And Therapy 1, n^o 1 (19 mai 2015) : 1–6. http://dx.doi.org/10.14302/issn.2471-2175.jdrt-14-515.

Texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

36

Medvedeva, Anna, et Petr Khopin. « Thermal test bench designing for turbojet engines turbines studying ». Thermal processes in engineering 14, n^o 11 (2022) : 515–26. http://dx.doi.org/10.34759/tpt-2022-14-11-515-526.

Texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

37

Poon, Eric Tsz-Chun, John O’Reilly, Sinead Sheridan, Michelle Mingjing Cai et Stephen Heung-Sang Wong. « Markers of Bone Health, Bone-Specific Physical Activities, Nutritional Intake, and Quality of Life of Professional Jockeys in Hong Kong ». International Journal of Sport Nutrition and Exercise Metabolism 28, n^o 4 (1 juillet 2018) : 440–46. http://dx.doi.org/10.1123/ijsnem.2016-0176.

Texte intégral

Résumé :

Weight-making practices, regularly engaged in by horse racing jockeys, have been suggested to impair both physiological and mental health. This study aimed to assess bone health markers, nutritional intake, bone-specific physical activity (PA) habits, and quality of life of professional jockeys in Hong Kong (n = 14), with gender-, age-, and body mass index-matched controls (n = 14). Anthropometric measurements, serum hormonal biomarkers, bone mineral density, bone-specific PA habits, nutritional intake, and quality of life were assessed in all participants. The jockey group displayed significantly lower bone mineral density at both calcanei than the control group (left: 0.50 ± 0.06 vs. 0.63 ± 0.07 g/cm2; right: 0.51 ± 0.07 vs. 0.64 ± 0.10 g/cm2, both ps < .01). Thirteen of the 14 jockeys (93%) showed either osteopenia or osteoporosis in at least one of their calcanei. No significant difference in bone mineral density was detected for either forearm between the groups. The current bone-specific PA questionnaire score was lower in the jockey group than the control group (5.61 ± 1.82 vs. 8.27 ± 2.91, p < .05). Daily energy intake was lower in the jockeys than the controls (1,360 ± 515 vs. 1,985 ± 1,046 kcal/day, p < .01). No significant group difference was found for micronutrient intake assessed by the bone-specific food frequency questionnaire, blood hormonal markers, and quality of life scores. Our results revealed suboptimal bone conditions at calcanei and insufficient energy intake and bone-loading PAs among professional jockeys in Hong Kong compared with healthy age-, gender-, and body mass index-matched controls. Further research is warranted to examine the effect of improved bone-loading PAs and nutritional habits on the musculoskeletal health of professional jockeys.

Styles APA, Harvard, Vancouver, ISO, etc.

38

Nadal, Rosa Maria, Amir Mortazavi, Mark Stein, Sumanta K. Pal, Nicole N. Davarpanah, Howard L. Parnes, Yang-Min Ning et al. « Results of phase I plus expansion cohorts of cabozantinib (Cabo) plus nivolumab (Nivo) and CaboNivo plus ipilimumab (Ipi) in patients (pts) with with metastatic urothelial carcinoma (mUC) and other genitourinary (GU) malignancies. » Journal of Clinical Oncology 36, n^o 6_suppl (20 février 2018) : 515. http://dx.doi.org/10.1200/jco.2018.36.6_suppl.515.

Texte intégral

Résumé :

515 Background: Tolerability and efficacy of CaboNivo and CaboNivoIpi were demonstrated in the initial phase I cohort, prompting longer follow-up and the addition of expansion cohorts to further evaluate both combinations Methods: Phase I cohort had 7 dose levels (DL). Recommended phase 2 doses for CaboNivo=Cabo 40mg/Nivo 3mg/kg (DL2) & CaboNivoIpi=Cabo 40mg/Nivo 3mg/kg/Ipi 1mg/kg (DL6) (Nadal ESMO 2017).In expansion cohorts, pts were treated: [1] DL8: Cabo 40mg/Nivo 1mg/kg/Ipi 3mg/kg; [2]DL2: mUC, metastatic renal cell carcinoma (mRCC), adenocarcinoma bladder (AcB): post-PD-1-PDL1 inhibitor mUC (p-mUC), and [3] DL6 mRCC. Objectives: safety, objective response rate (ORR), duration of response (DOR), progression-free survival (PFS) & overall survival (OS). Results: 75 pts enrolled. Median age 59 yo. 83% male, 17% female. 47 treated with CaboNivo (mUC n=24; AcB n= 9; germ cell tumor (GCT) n= 5; castrate-resistant prostate cancer (CRPC) n= 4; bladder squamous cell carcinoma (SCC) n= 2; penile n=1; mRCC n= 7). 28 treated with CaboNivoIpi: (mUC n=8; penile n=3; CRPC n=7; Sertoli n=1; mRCC n=6; bladder small cell carcinoma n=1; renal medullary carcinoma (RMC) n=2). Any grade (G) adverse events (AEs) (CaboNivo 96% & CaboNivoIpi 96%)/G3–4 AEs (CaboNivo 62% & CaboNivoIpi 71%). Most common any G, CaboNivo: fatigue 70%, diarrhea 60%, AST/ALT 60%, hypophosphatemia (hypoP) 45% & CaboNivoIpi: fatigue 71%, diarrhea 68%, hypoP 50%, AST/ALT 43%. Most common G3-4, CaboNivo: lipase 17%, hypoP 15%, fatigue 6% & CaboNivoIpi: hypoP 21%, AST/ALT 14%, lipase 14%. Selected irAs: colitis (2.6%), hepatitis (2.6%), pneumonitis (2.6%), aseptic meningitis (1.3%). ORR: 36%; 3CR (2mUC, 1SCC) & 20PR (5mUC, 2SCC, 7mRCC, 2Penile, 2AcB, 1CRPC, 1RMC). mDOR: 24.1 mo [95% CI: 14.7-NR], mPFS: 7.2 mo [95%CI: 5.1-18.4], mOS:18.8 mo [95%CI: 10.6-NR]. OS 6/12 mo: 83%/61%. Cohort of p-mUC pts(n=5):1PR/3SD/1PD Conclusions: Updated results from phase I and expanded cohorts confirm initial safety findings and promising antitumor activity for both combinations in mUC, mRCC, and rare GU malignancies Clinical trial information: NCT02496208.

Styles APA, Harvard, Vancouver, ISO, etc.

39

Botega, Neury José, Marilisa Berti de Azevedo Barros, Helenice Bosco de Oliveira, Paulo Dalgalarrondo et Letícia Marín-León. « Suicidal behavior in the community : prevalence and factors associated with suicidal ideation ». Revista Brasileira de Psiquiatria 27, n^o 1 (mars 2005) : 45–53. http://dx.doi.org/10.1590/s1516-44462005000100011.

Texte intégral

Résumé :

OBJECTIVES: To estimate the life prevalence rates of suicidal ideation, suicidal plans and suicide attempts and verify factors associated to suicidal ideation. METHODS: 515 individuals > 14 years old were selected at random (cluster and stratified sample) and assessed by means of the WHO SUPRE-MISS interview, SRQ-20 and AUDIT. Life prevalence rates were estimated. Uni and multivariate analyses were performed. Odds ratios, together with confidence intervals, were adjusted by gender and age. RESULTS: Life prevalence rates were 17.1% (95% CI: 12.9 - 21.2) for suicidal ideation, 4.8% (95% CI: 2.8 - 6.8) for plans and 2.8% (95% CI: 0.09 - 4.6) for suicide attempts. Only one-third of those who attempted suicide were later treated at a health facility. The 12-month prevalence rates were, respectively, 5.3% (95% CI: 3.5 - 7.2), 1.9% (95% CI: 1.0 - 2.8) and 0.4% (95% CI: -0.3 - 1.1). Suicidal ideation was more frequently reported by women (OR = 1.7), young adults (20-29 years old: OR = 2.9; 30-39 years old: OR = 3.6, compared to the 14-19 year old group), those living alone (OR = 4.2) and those presenting mental disorders (OR between 2.8 and 3.8). CONCLUSION: The prevalence of suicidal behavior was similar to that found in most studies carried out in other countries. Suicidal ideation was consistently associated with factors related to mental disorders or psychological distress. This should be taken into account when developing strategies to prevent suicidal behavior.

Styles APA, Harvard, Vancouver, ISO, etc.

40

Mateo-Seco, Lucas F. « Félix María AROCENA, Sol Salutis. La Navidad en la liturgia mozárabe y romana, Regina, Barcelona 2002, 255 pp., 14 x 21, ISBN 84-7129-515-6. » Scripta Theologica 35, n^o 2 (22 novembre 2017) : 627. http://dx.doi.org/10.15581/006.35.13165.

Texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

41

Giliker, Paula. « Rediscovering the Law of Negligence, by Allan Beever. Oxford : Hart Publishing, 2007, xxxi + 515 + (bibliography + index) 14 pp (£50 hardback). ISBN : 978-1-84113-686-8. » Legal Studies 28, n^o 1 (mars 2008) : 140–43. http://dx.doi.org/10.1111/j.1748-121x.2007.00082_1.x.

Texte intégral

Styles APA, Harvard, Vancouver, ISO, etc.

42

Marín-León, Leticia, Helenice Bosco de Oliveira, Marilisa Berti de Azevedo Barros, Paulo Dalgalarrondo et Neury José Botega. « Percepção dos problemas da comunidade : influência de fatores sócio-demográficos e de saúde mental ». Cadernos de Saúde Pública 23, n^o 5 (mai 2007) : 1089–97. http://dx.doi.org/10.1590/s0102-311x2007000500011.

Texte intégral

Résumé :

Foi realizado estudo transversal para identificar quais os problemas da comunidade, de uma lista de 17, que foram referidos como mais importantes e analisar se tal percepção apresenta diferenças segundo variáveis sócio-demográficas e condição de saúde mental dos entrevistados. Em amostra estratificada por conglomerados representativa da população urbana de Campinas, São Paulo, Brasil, de 14 anos e mais (N = 515) aplicou-se entrevista domiciliar da Organização Mundial da Saúde sobre comportamento suicida (SUPRE-MISS) e SRQ-20. Foram calculadas prevalências ponderadas e razões de prevalência bruta e respectivos intervalos de confiança de 95%. Foi realizada análise multivariada mediante regressão de Poisson. Tráfico de drogas, abuso de drogas, desemprego, criminalidade e abuso de álcool foram considerados problemas graves por mais de 45% da população. Mulheres e pessoas residentes em áreas de nível sócio-econômico médio/baixo atribuíram maior gravidade ao tráfico de drogas, abuso de álcool, de drogas, abuso de crianças e esposa, desemprego e pobreza. Mulheres e pessoas positivas no SRQ-20 julgaram como graves os problemas relativos à educação. Diferenças na percepção segundo condições sócio-econômicas e gênero apontam maior suscetibilidade da mulher e de residentes em áreas pobres.

Styles APA, Harvard, Vancouver, ISO, etc.

43

Puis, Luc, Eddy Vandezande, Leen Vercaemst, Patrick Janssens, Yvan Taverniers, Mark Foulon, Roland Demeyere, Marion Delcroix et Willem Daenen. « Pulmonary thromboendarterectomy for chronic thromboembolic pulmonary hypertension ». Perfusion 20, n^o 2 (mars 2005) : 101–8. http://dx.doi.org/10.1191/0267659105pf791oa.

Texte intégral

Résumé :

Introduction. Pulmonary thromboendarterectomy (PTE) is a surgical procedure which is considered the only effective and potentially curative treatment for chronic thromboembolic pulmonary hypertension (CTEPH). CTEPH is a rare outcome from pulmonary emboli and, when left untreated, will result in right ventricular failure and death. Methods. From June 1999 to November 2003, 40 of these procedures were performed in our institution. Emphasis is placed on multidisciplinarity and cooperation between different medical and surgical disciplines. Perfusion management consists of myocar-dial and cerebral protection, deep hypothermia with multiple periods of circulatory arrest, reperfusion at hypothermia, hemofiltration and cellsaving techniques. Results. Hemodynamic improvement occurs immediately post operation. Mean pulmonary artery pressure decreased from 50±11 to 38±10 mmHg, pulmonary vascular resistance from 1246±482 to 515±294 dynes s/cm5 and cardiac index increased from 1.54±0.54 to 2.63±0.75 L/min per m2. Pump runs had an average duration of 187±29 min, circulatory arrest time was 29±11 min and crossclamp time 36±14 min. Extracorporeal membrane oxygenation can be an ultimate treatment for specific postoperative problems like persistent pulmonary hypertension and/or reperfusion pulmonary edema.

Styles APA, Harvard, Vancouver, ISO, etc.

44

Anders, Carey K., Allison Mary Deal, Vandana Gupta Abramson, Minetta C. Liu, Anna Maria Storniolo, John T. Carpenter, Shannon Puhalla et al. « TBCRC 018 : Phase II study of iniparib plus chemotherapy to treat triple-negative breast cancer (TNBC) central nervous system (CNS) metastases (mets). » Journal of Clinical Oncology 31, n^o 15_suppl (20 mai 2013) : 515. http://dx.doi.org/10.1200/jco.2013.31.15_suppl.515.

Texte intégral

Résumé :

515 Background: Nearly half of women with advanced TNBC develop CNS mets. This study evaluated the safety and efficacy of iniparib, a small molecule anti-cancer agent that penetrates the blood brain barrier (BBB), and the topoisomerase I inhibitor, irinotecan, in patients (pts) with TNBC CNS mets. Methods: Eligible pts had TNBC with new or progressive CNS mets with at least 1 measurable (> 5mm) lesion. Pts received irinotecan 125mg/m2 IV days (d) 1, 8 and iniparib (initial dose 5.6mg/kg, later changed to 8mg/kg) IV d 1, 4, 8, 11 every 21d. Tumor response rate (RR) was assessed by brain MRI and body CT every 9 weeks. The Kaplan Meier method estimated the primary endpoint of time to progression (TTP, intracranial [modified RECIST] or extracranial [RECIST 1.1]). Secondary endpoints were RR, PFS, OS, quality of life (QOL) and correlative endpoints. Results: Of 37 pts who began treatment, 34 were evaluable for efficacy. Mean age was 48 yrs (34 – 80 yrs). BRCA status was known for 16 patients of whom 5 had a mutation (4 BRCA1, 1 BRCA2). 88% received prior (neo)adjuvant and 68% prior metastatic chemotherapy (median 2 [1–14] lines). While 15% were CNS radiation (RT) naïve, 32% had received whole brain RT, 21% stereotactic RT, and 32% both. The most common grade (gr) 3/4 adverse events were neutropenia (14%), fatigue (5%), leukopenia (5%), hypokalemia (5%). Diarrhea was common (54%), but gr 3/4 was rare (3%). Median TTP (CNS and non-CNS) was 2.1 months (mos) (95% CI 1.7–4.3) and OS was 7.6 mos (95% CI 5.1-10.2). First progression site was CNS in 39%, non-CNS in 29% or both in 32%. CNS best RR was (12%; 0 CRs, 4 PRs); CNS clinical benefit rate (CBR, CR + PR + SD ≥ 6 mos) was 30%. Non-CNS RR was 5% (0 CRs, 1 PR) and CBR was 11%. Conclusions: Iniparib and irinotecan was well-tolerated among pts with TNBC CNS mets. While TTP was shorter than expected and contribution of iniparib to irinotecan remains uncertain, 30% of pts demonstrated CNS clinical benefit raising the question of whether predictive biomarkers could be identified. QOL, volumetric analysis of CNS lesions and translational studies evaluating molecular subtype, germline BRCA1/2, and DNA repair gene expression/methylation are ongoing. Clinical trial information: NCT01173497.

Styles APA, Harvard, Vancouver, ISO, etc.

45

Gruel, Y., B. Boizard, F. Daffos, F. Forestier, J. Caen et JL Wautier. « Determination of platelet antigens and glycoproteins in the human fetus ». Blood 68, n^o 2 (1 août 1986) : 488–92. http://dx.doi.org/10.1182/blood.v68.2.488.bloodjournal682488.

Texte intégral

Résumé :

The autosomal recessive transmission of Glanzmann's thrombasthenia (GT) and Bernard-Soulier syndrome (BSS), together with requests of families who already had children with these diseases, prompted us to investigate the feasibility of their antenatal diagnosis. The preliminary step leading to the early detection of GT or BSS was to characterize, in the normal human fetus, the platelet antigens and glycoproteins (GPs) and to define their normal amounts on the membrane surface. Blood samples from 32 fetuses between 18 to 26 weeks of gestation were collected by direct puncture of the umbilical vein using an ultrasound-guided needle. Polyclonal antibodies from human origin directed against PLA1, Leka antigens, and the GPIIb IIIa complex (IgGL), or murine monoclonal antibodies specific for GPIb (AN51, 6D1), GPIIIa (AP-3), or GPIIb IIIa (AP-2) were studied using platelet suspension immunofluorescence tests. The binding of each antibody was quantified using a cytofluorograph (Ortho 50H). PLA1 and Leka antigens were expressed in normal amounts on fetal platelets as early as 16 weeks of intrauterine life. The GPIIb IIIa complex quantified by polyclonal or monoclonal antibodies was in the same range in fetuses (IgGL = 427 +/- 23 AUF, AP-2 = 459.5 +/- 8.5; AP-3 = 536 +/- 14) and in adults (IgGL = 420 +/- 30; AP-2 = 498 +/- 11; AP-3 = 515 +/- 13). The platelet binding of antibodies that recognized GPIb was higher in fetuses (AN51 = 491.5 +/- 14; 6D1 = 479 +/- 15) than in adults (AN51 = 426.5 +/- 9; 6D1 = 449 +/- 8.7). These results suggest that immunological techniques can be applied as early as 18 weeks of gestation for the antenatal diagnosis of GT and BSS.

Styles APA, Harvard, Vancouver, ISO, etc.

46

Whitten, Pamela, Matthew S. Eastin et Sally Davis. « Telemedicine in the Michigan Upper Peninsula region : an evaluation of the first five years ». Journal of Telemedicine and Telecare 7, n^o 5 (1 octobre 2001) : 288–99. http://dx.doi.org/10.1258/1357633011936552.

Texte intégral

Résumé :

A telemedicine network has operated in the Upper Peninsula (UP) region of Michigan since 1995. The Marquette General Health System (MGHS) is the tertiary hospital that provides telemedicine services to 14 surrounding rural health facilities and another seven clinics. In order to assess the state of telemedicine in the UP region and its potential for development, three main factors were assessed: organizational development, telemedicine activity and perceptions of the key players. Data were collected through interviews with five MGHS telemedicine staff, 10 physicians (five from the MGHS and five from surrounding rural areas), 13 of the 14 chief executive officers (CEOs) of the remote telemedicine sites and a survey of 21 telemedicine site coordinators. This information was analysed in order to outline job roles and responsibilities; to document the process of doing telemedicine; and to understand current policies and procedures. Telemedicine activity from 1995 to 1999 was analysed in terms of the purpose of the session. In 1999, a total of 515 telemedicine sessions were conducted, 323 being non-educational and 192 being educational. Most CEOs of the rural hospitals were interested in furthering their use of clinical telemedicine applications. The data also indicated a great need for education, particularly of the rural physicians. The overall view of those surveyed about MGHS's telemedicine programme was positive. Respondents were quick to compliment the staff whenever possible. New telemedicine staff have been employed, which will allow responsibilities to be reassigned in such a way as to create a more efficient system.

Styles APA, Harvard, Vancouver, ISO, etc.

47

Vaisman, Alon, Michael Jula, Jessica Wagner et Lisa G. Winston. « Examining the association between hospital-onset Clostridium difficile infection and multiple-bed room exposure : a case-control study ». Infection Control & ; Hospital Epidemiology 39, n^o 9 (31 juillet 2018) : 1068–73. http://dx.doi.org/10.1017/ice.2018.163.

Texte intégral

Résumé :

AbstractObjectiveTo determine whether assignment to a multiple-bed room increased the risk of hospital-onset C. difficile diarrhea (HO-CDI).DesignCase-control study.SettingSan Francisco General Hospital and Trauma Center.PopulationAdult general medical and surgical inpatients.MethodsConsecutive cases of HO-CDI were identified between January 1, 2010, and December 31, 2015. To investigate the effect of multiple-bed room exposure both at admission and at the time of symptom onset, 2 sets of controls were selected from the general medical/surgical inpatient population using incidence density sampling. Conditional logistic regression was used to estimate the relationship between room assignment (single bed vs multiple beds) and the development of HO-CDI.ResultsIn total, 187 cases were identified and matched with 512 and 515 controls for the admission and at-diagnosis analyses, respectively. The adjusted rate ratio (RR) associated with the development HO-CDI associated with multiple-bed room exposure during the 7 and 14 days immediately prior to HO-CDI diagnosis were 1.08 (95% confidence interval [CI], 0.93–1.25; P=.31) and 0.96 (95% CI, 0.93–1.18; P=.12), respectively. Furthermore, no significant association was detected in the analysis of the first 7 and 14 days after case admission or among patients with Charlson comorbidity scores ≥4 in either period.ConclusionAssignment of patients to multiple-bed rooms on general medical and surgical wards was not associated with an increased risk in the development of HO-CDI. Future investigation should be performed with larger cohorts in multiple sites to more definitively address the question because this issue could have implications for patient room assignment and hospital design.

Styles APA, Harvard, Vancouver, ISO, etc.

48

Dowsett, M., I. Smith, A. Skene, A. Llombart, J. Mayordomo, S. Detre, J. Salter, E. Beresford et P. Magill. « Biological and clinical outcomes from a phase II placebo-controlled neoadjuvant study of anastrozole alone or with gefitinib in postmenopausal women with ER/PgR+ breast cancer (Study 223) ». Journal of Clinical Oncology 24, n^o 18_suppl (20 juin 2006) : 515. http://dx.doi.org/10.1200/jco.2006.24.18_suppl.515.

Texte intégral

Résumé :

515 Background: Gefitinib, an EGFR-tyrosine kinase inhibitor, reduces breast cancer cell growth and potentiates endocrine therapy in model systems. This double-blind multicentre study compared anastrozole 1 mg/day alone with anastrozole + gefitinib 250 mg/day as neoadjuvant therapy for breast cancer in a novel design aiming to assess additional benefit from gefitinib in individual patients. Methods: Postmenopausal women with stage I-IIIB breast cancer and ER and/or PgR+ tumours received anastrozole for 16 wks and were randomised (2:5:5 ratio) to: combination with gefitinib for 16 wks (AG); placebo for 2 wks then gefitinib for 14 wks (A:AG, to test for additional Ki67 suppression); placebo for 16 wks (A alone). Biopsies were taken at baseline, 2 and 16 wks. Primary comparison was change in Ki67 by 16 wks. Secondary comparison was objective tumour response rate (ORR) using UICC/WHO criteria at 16 wks. Results: 206 patients (pts) were randomised: (31 AG, 90 A:AG, 85 A alone); demography was well balanced between the groups. 109 pts were evaluable for Ki67: 59 AG + A:AG; 50 A alone. Change in Ki67 levels at 16 wks was not significantly different in those pts who received gefitinib + anastrozole versus anastrozole alone (p=0.257). The addition of gefitinib after 2 weeks of anastrozole did not further suppress Ki67 levels (p=0.164). 188 pts were evaluable for ORR (109 AG + A:AG; 79 A alone). The ORR was 48% in pts who received gefitinib + anastrozole and 61% in pts treated with anastrozole alone (p=0.067). Conclusions: Neither the biological nor the clinical activity of anastrozole was enhanced by the addition of gefitinib; although non-significant, both endpoints unexpectedly suggested a trend against the combination in this patient population. Molecular investigations of signal transduction pathways are underway to understand the significance of these findings. [Table: see text] [Table: see text]

Styles APA, Harvard, Vancouver, ISO, etc.

49

Costi, A. C., C. Pena, R. Aguila Maldonado, M. A. Pera et M. García. « AB0899 RITUXIMAB IN INFLAMMATORY MYOPATHIES : A SINGLE CENTER EXPERIENCE ». Annals of the Rheumatic Diseases 82, Suppl 1 (30 mai 2023) : 1664.2–1665. http://dx.doi.org/10.1136/annrheumdis-2023-eular.986.

Texte intégral

Résumé :

BackgroundRituximab (RTX) is currently the most widely used biologic agent in the treatment of IIM. The main indications for treatment with RTX in IIM are refractory muscle, lung, and skin involvement. There is growing evidence that biologic therapy in IIM has the potential to benefit patients with refractory disease. (1)ObjectivesDescribe and analyze the clinical indications for RTX in a cohort of patients with IIM. Describe adverse effects associated with RTX and clinical response to RTX.MethodsDescriptive, retrospective study, in a single center of patients diagnosed with IIM (Bohan and Peter-ACR/EULAR 2017), who received RTX (1993 to 2022). Patients with follow-up of at least 6 months after first infusion of RTX were included. The following variables were considered: myopathy subtype, clinical manifestations, RTX indication, RTX administration regimen, and adverse events. Significant clinical response to RTX was defined as improvement in organ function or symptoms, or halting of disease progression, or prevention of relapses, such that the patient did not require further immunosuppression or was maintained on stable immunosuppressive therapy, and no more than 10 mg prednisolone/day or additional doses of RTX were given to treat disease relapses or to maintain initial clinical benefit.ResultsOf 138 patients registered with MMII, 17 (12.3%) patients received treatment with RTX.Fourteen (14) patients (10.4%) were included in the analysis. Table 1 describes demographics and clinical characteristics. The main reason for indication was refractory disease (50%) (Table 2). One hundred percent (100%) of patients received glucocorticoids during RTX use at an average daily dose of 25 mg. Methotrexate was co-administered with RTX in the majority of patients and was also the most widely used drug before RTX. Regarding safety, 5 infectious adverse effects (35%) were recorded in 4 patients (28%), 3 of which were deemed as serious (21%). The clinical response to RXT at 3 months was 78.5%, and 71 % at 6 months.Table 1:FeaturesPatients n: (14)GenderFemale10 (71 %)Male4 (29%)Age (years) at diagnosis50 ± DS 17ComorbidityDiabetes1/14 (7%)Arterial hypertension1/14 (7%)dyslipidemia2/14 (14%)Statin use1/14 (7%)smoking1/14 (7%)Alcohol1/14 (7%)Neoplasma1/14 (7%Inflammatory myopathy (subtypes)Dermatomyositis9/14 (64 %)Polymyostis3/14 (21%)Necrotizing myopathy1/14 (7%)Overlap myopathy1/14 (7%)Clinical featuresSymmetric proximal muscle weakness12/14 (71%)Respiratory muscle weakness3/14 (21%)Neck muscle weakness7/14 (50%)Dysphagia9/4 (64%)Skin manifestationsskin compromise10/14 (71%)Gottron’s papules8/10 (80%)Heliotrope erythema7/10 (70%)Signs of the Shawl8/10 (80%)Sign of the “v”8/10 (80%)Raynaud7/14 (50%)Interstitial lung involvement0/14 (0%)Complementary studiesMuscle biopsy6/14 (42%)Electromyogram8/14 (57%)Video swallowing9/14 (64%)Skin biopsy6/14 (42,5%)Immunological LaboratoryANA positive11/14 (78,5%)SSB-Ro2/13 (15%)RNP1/12 (8,3%)Anticentromere1/4 (25%)Jo10/10 (0%)Myopathies Panel0/4 (0%)Table 2-Rituximabn 14 (%)Rituximab Dosage Guidelines:A: (1 gr every 15 days) average dose: 1357 gr ± 4208/14 (57%)B: (375 mg/m2/body sup) average dose 1730 ±7106/14 (43%)Infusion of hospitalized patients4/14 (28,5%)Infusion center10/14 (71,4%)Main reason for indication:Severity of diseases4/14 (28,5%)Refractory disease7/14 (50%)Both situations3/14 (21,5%)Indication of organic involvement (frequency)Dysphagia8/14 (57%)Cutaneous5/14 (37,5%)Peripheral muscles5/14 (37,5%)Respiratory muscles2/14 (14%)ConclusionIn this cohort of patients with IIM, 12.3% received treatment with RTX and the main indications were dysphagia and refractory disease.Adverse effects were recorded in 28% of the cases, all infectious, of which 21% were serious. Clinical response was obtained in 78.5% 3 months after the first indication of rituximab, which was maintained in 71% of the patients at 6 months.Reference[1]Rituximab Clin Exp Rheumatol. 2017 May-Jun;35(3):512-515. Epub 2016Acknowledgements:NIL.Disclosure of InterestsNone Declared.

Styles APA, Harvard, Vancouver, ISO, etc.

50

Rauber, Lucio Pereira. « Efeito da indução do parto sobre o desempenho dos leitões ». Agrarian 10, n^o 36 (6 juin 2017) : 189. http://dx.doi.org/10.30612/agrarian.v10i36.5282.

Texte intégral

Résumé :

O experimento foi realizado com o objetivo de avaliar o desempenho dos leitões nascidos de porcas que tiveram o parto induzido. Foram utilizadas 33 fêmeas de linhagens comerciais com ordem de parto entre 2 e 7, as quais foram distribuídas em dois blocos, entre segundo e quarto parto (bloco 1) e entre o quinto e sétimo parto (bloco 2). Para o tratamento foram utilizadas 16 fêmeas que tiveram parto induzido com 75μg D- cloprostenol via submucosa vulvar. Para o grupo controle do experimento foram utilizadas 17 fêmeas que pariram naturalmente. A indução do parto foi realizada aos 114 dias de gestação. As leitegadas foram pesadas ao nascimento, aos 07 dias, aos 14 dias, aos 21 dias e aos 28 dias no desmame. A indução teve efeito significativo no peso individual dos leitões nascidos de parto induzido, sendo 162 g mais leves (p≤0,022) que os nascidos de parto natural, no peso individual aos 07 dias foram 332 g mais leves (p≤0,027), no peso individual aos 21 dias, 505 g mais leves (p≤0,042) e uma tendência no peso individual a desmama em serem 515 g mais leves (p=0,058). A indução de parto diminui o peso individual dos leitões ao nascimento e durante o crescimento lactacional.

Styles APA, Harvard, Vancouver, ISO, etc.

Articles de revues sur le sujet « 515/.14 »

Créez une référence correcte selon les styles APA, MLA, Chicago, Harvard et plusieurs autres