Artículos de revistas: "S. anastasia"

1

Dergacheva, Irina. "Autobiographical Novel of the 20th century (based on Margarita Sabashnikova᾿s “Die Grtine Schlange. Lebenserinnerungen”, Anastasia Tsvetaeva᾿s “Memories” and Gala Dalí᾿s “A History, Invented by Herself”". Stephanos Peer reviewed multilanguage scientific journal 55, n.º 5 (30 de septiembre de 2022): 78–87. http://dx.doi.org/10.24249/2309-9917-2022-55-5-78-87.

Texto completo

Resumen

The article is devoted to comparison, analysis of problems, features of the composition of autobiographical novels of three contemporaries: Margarita Sabashnikova, Anastasia Tsvetaeva, Gala Dali. The genre of the autobiographical novel is interesting for the researcher because it combines the documentary and artistic components. The choice of material is determined by the typological commonality of the fates of the authors of the works. The range of ideas presented in these novels allows us to imagine the attitude and psychology of the people of that era.

Los estilos APA, Harvard, Vancouver, ISO, etc.

2

Kovačević, Marijana. "Olipski fragment gotičkoga srebrnog ophodnog križa s prikazom Sv. Stošije". Ars Adriatica, n.º 3 (1 de enero de 2013): 103. http://dx.doi.org/10.15291/ars.463.

Texto completo

Resumen

This paper discusses an interesting silver fragment showing an image of a saint which was found a few years ago in the rectory of the island of Olib. Based on a thorough comparison of the fragment with similar liturgical objects from the wider area of Zadar, especially with the processional cross from Vlašići (Pag), the authoress proposes that the fragment once belonged to a Gothic proccessional cross dating from the end of the 14th century and that it was nailed as the middle part of its reverse side. The image of the saint depicted on this fragment is identified, based partly on the place of its discovery, with the patron saint of the parish of Olib, St.Anastasia. This identification is further strenghtened also by an iconographical analysis of various depictions of St. Ananstasia in Romanesque and Gothic art of Zadar and its area, especially in goldsmiths’ work of the time, where there are relatively many of her images considering that St. Anastasia was the patron saint of Zadar cathedral, where her relic was treasured for centuries, and also one of four main patron saints of this important Adriatic city. That analysis led to the conclusion that there was a certain evolutive change in the depiction of the saintly patroness during that era, and that, starting form ourfragment and the end of the 14th century, she is more often adorned with a book as her standard attribute.It was also noted that the image depicted on the Olib fragment may, perhaps, be identified with St. Catherine of Alexandria who was also often depicted with a book. Namely, she was the patron saint of a church in Novigrad, a small medieval town situated in the hinterland of Zadar,whence its inhabitants could have brought a whole cross, or solely this fragment, centuries after its making, as C. F. Bianchi recorded thet they brought to Olib a worshipped painting when fleeing from the Turks. This move of the local treasure from Novigrad to Olib in times of crisis and flight would thus coincide with the same practice of the move of the processional cross from Gorica to Pašman, as proposed by N. Jakšić. The stumbling stone of this theory is, of, course, the existence of the 14th century processional cross in Novigrad, with very similar image of St. Catherine on its reverse. Although she is iconographically coherent with the saintly image on the fragment from Olib, it is rather difficult toexplain the making of two similar processional crosses in such a short period of time, since the evident stylistic and tehnical differences between the two images allow only for a short time difference. On the other hand, if the saint on the Olib fragment indeed is St. Anastasia, this would mean that the parish church of Olib regularly refurbished its liturgical equipment during the period of less than two centuries, since one processional cross from Olib older than our fragment has also survived, still partly Romanesque in its morphology and iconography, as well as has survived the late 15th century cross attributed to Toma Martinov, goldsmith from Zadar, whose style is already Rennaissance in many aspects. In course of the search for the images of St. Anastasia in the medieval goldsmiths’ work of Zadar it was also observed that the long established iconographical identification of the figures depicted on the luxurious bishop’s staff of the archbishop Maffeo Vallaresso (1460) has to be partially revised.

Los estilos APA, Harvard, Vancouver, ISO, etc.

3

SINEV, ARTEM Y., MIGUEL ALONSO, MARIA ROSA MIRACLE y MARIA SAHUQUILLO. "The West Mediterranean Alona azorica Frenzel & Alonso, 1988 (Cladocera: Anomopoda: Chydoridae) is composed of two species". Zootaxa 3276, n.º 1 (24 de abril de 2012): 51. http://dx.doi.org/10.11646/zootaxa.3276.1.3.

Texto completo

Resumen

A study of several populations of the West Palaearctic endemic Alona azorica Frenzel & Alonso, 1988 reveals the exis-tence of a sibling-species. Alona azorica s. str. is confined to the Azores and the Atlantic part of West Iberia; Alona anas-tasia sp. nov. inhabits temporary ponds in Mediterranean Iberia and other West Mediterranean regions. It differs by size,by the morphology of the head shield and head pores, and by the shape of the male postabdomen. Both species belong tothe pulchella-group of Alona s. lato. Alona anastasia sp. nov. population dynamics and seasonal variation in body size in the province of Valencia (Spain) are also studied.

Los estilos APA, Harvard, Vancouver, ISO, etc.

4

Vedriš, Trpimir. "Ponovno otkriveni srednjovjekovni rukopis Codex Filippi i zadarska redakcija Pasije sv. Anastazije*". Ars Adriatica, n.º 6 (1 de enero de 2016): 61. http://dx.doi.org/10.15291/ars.177.

Texto completo

Resumen

Zadar’s medieval manuscript known as Cod. Lat. Iaderensis Filippi (S. Mariae) has been rediscovered after its whereabouts were unknown following its translocation from Zadar during World War II and its acquisition in London in 1997. The most recent research on the manuscript, which was familiar to the older experts on Zadar’s hagiography, has confirmed many of the previous conclusions and suggestions, but the possibility to work on the manuscript itself after almost a century has also brought new insights about its nature and the nature of the legends contained therein. As the older experts argued, it is a segment of a once far larger liturgical codex (of some 300 pages) owned by the Benedictine monastery of St Chrysogonus. The author has accepted the conclusions of the previous researchers and suggested that the manuscript should be described as Legendarium. In its present form (consisting of only 21 sheets), the Cod. Lat. Iaderensis Filippi (S. Mariae) contains two hagiographic legends: a late antique Passio Sanctae Anastasiae and a local legend called Translatio Beati Grisogoni martyris. Based on a codicological and palaeographic analysis, as well as the stylistic and iconographic features of the preserved miniatures and other decorative elements, the author has suggested the period between the late 13th and late 14th centuries as the probable date of its making. Having thus delimited the approximate terminus ante quem for this redaction of the two legends about the saints of Zadar, the author has further suggested a link between this variant of the Passio Sanctae Anastasiae and other known medieval versions of that originally late antique legend. Based on the content, palaeography, and style of the manuscript, the codex has been compared to similar liturgical books from a wider northern Adriatic area. Having observed some analogies (primarily in terms of content and language) with a group of manuscripts from a wider Aquileian area, the author has further suggested a link between the Passio Sanctae Anastasiae preserved in the manuscript and a northern Italian redaction of the legend, thus paving the way for further research on the origins of Zadar’s cult and hagiography of St Anastasia and St Chrysogonus.

Los estilos APA, Harvard, Vancouver, ISO, etc.

5

Smykovskaya, Tatyana E. "Anastasia Tsvetaeva`s novel Amor: the lyrical genre model as the embodiment of spiritual resistance". Vestnik slavianskikh kul’tur [Bulletin of Slavic Cultures] 63 (2022): 198–207. http://dx.doi.org/10.37816/2073-9567-2022-63-198-207.

Texto completo

Resumen

The study looks at Anastasia Tsvetaeva’s novel Amor, the first draft of which (1939–1941) was composed when the author was incarcerated in Amurlag, a labor camp located in the Soviet Far East. Tsvetaeva resumed work on the manuscript, which was smuggled to Moscow by some free workers employed in the camp, in 1960, after she had served her term of “perpetual exile” in Siberia. Yet the definitive, canonical text was completed only in the 1980s. The novel was first published in the journal Moskva. The paper examines the novel from a concrete, genre-based perspective and interprets it as a lyrical work, owing to its focus on the psychological depiction of the consciousness of the protagonist, Nikki, Tsvetaeva’s alter ego. The genre of the lyrical novel, to which the work conforms, determines its poetics. Amor exhibits a degree of multilayered lyrical fragmentation that frames several of its aspects: narrational and compositional structure (a multilayered chronotope), mythopoetic dimension (a novel about the authorial self, the poem about Moritz, and the author’s own verse productions), discursive design (complex monologues of a voiced and interior kind), portrait sketches, and landscapes notes. By making use of this lyrical genre during a period of the totalitarian enslavement of the individual, Tsvetaeva asserts the value of every human being and gives expression of her axiological and humanistic stance, aimed at defending personhood under any historical and social circumstances.

Los estilos APA, Harvard, Vancouver, ISO, etc.

6

Iakovleva, Tatiana A. "VISUALIZATION OF MEMORY IN PROJECTS OF URAL PHOTOGRAPHERS A. BOGOMOLOVA AND S. POTERYAEV". Vestnik Tomskogo gosudarstvennogo universiteta. Kul'turologiya i iskusstvovedenie, n.º 43 (2021): 179–96. http://dx.doi.org/10.17223/22220836/43/14.

Texto completo

Resumen

The article is devoted to the problem of memory visualization in the language of photography. Photography is presented as a sign system and a communicative tool of culture, as one of its mnemonic and memorial techniques. An image archive is created through a photo. It becomes a refuge of memory and material for the reconstruction and reinterpretation of memory. The author explores the nostalgic, retrospective genre of photography. The appearance of this genre demonstrates an increase in the demand of culture, society and personality for memory, to assert themselves in the present through a search for a connection with the past. The purpose of the article is the analysis of the visual language of photographic projects related to the theme of memory, the analysis of visual rhetoric, and the identification of a set of "visual toposes" and metaphors of memory. This article reviewed the projects of two young Ural photographers Anastasia Bogomolova and Sergey Poteryayev. Their work connects the theme of memory, the problem of reconstruction, reinterpretation and retranscription of the past. These projects are a kind of visual research of personal and collective memory, the development of the problems of places of memory and mythology of the place. The theme of memory in projects is directly related to the problem of identity. In the course of the study, the author of the article relies on materials from creative projects and exhibitions, information from copyright sites. The author also uses materials interviews in which photographers talk about themselves, about the history of project creation, conceptual ideas and creative orientations. Creativity of Anastasia Bogomolova appears as a performative act, as "unpacking the archive". For a photographer, memory becomes the basis of individual and family identity. In the exposition space, photographs are complemented by objects, video and sound installations, and performances. The projects of Sergey Poteryaev represent photo stories about real places and people. The photographer refers to the relationship of the fate of the disappearing settlements and their inhabitants. Using a collage technique, the photographer connects the past and the present, creates pictures of memory. The analysis of the visual language of the photo projects was carried out, the conceptual bases of the projects and creative techniques were investigated. The article identifies the key methods and techniques of working with photography, the basic metaphors and images through which personal, family, and collective memory became visible. The author shows that both photographers apply a topographical approach to memory in accordance with the nature of photography. Project photos convey such memory characteristics as paradox and surreality, multi-layered and collage, selectivity, fragmentation, and construction. The events of the past are distant from us, but images of memory exist in the present. Images of memory can fade; overlap each other like images in a photo. At the same time, they are overloaded and insufficient. Just as memory is changeable, mobile, its images can be fluid, distorted, but they help us comprehend the past for the present.

Los estilos APA, Harvard, Vancouver, ISO, etc.

7

Kozlova, N. K. "The fairy-tale repertoire of A. S. Kozhemyakina collected by Omsk local historian I. S. Korovkin (based on materials of the folklore archive of the Omsk State Pedagogical University)". Languages and Folklore of Indigenous Peoples of Siberia, n.º 38 (2019): 5–15. http://dx.doi.org/10.25205/2312-6337-2019-2-5-15.

Texto completo

Resumen

The article is devoted to the analysis of fairy-tale material from the folklore collection of the Omsk local historian I. S. Korovkin whose wide collection of folklore materials is stored in the folklore archive of the Omsk State Pedagogical University. The article will focus on the texts of fairy tales written by a collector from a Siberian performer Anastasia Stepanovna Kozhemyakina, manuscripts of these recordings are stored in the folklore archive of the Pedagogical Uni- versity. Of the 40 fairy tales recorded by Korovkin from the performer, the author of the article was able to identify (from archival records and published materials) 36 texts. The repertoire represents the Russian old-time tradition of Siberia. Tales by A. S. Kozhemyakina reflect the process of the existence of a folklore text in the oral tradition (which is typical for the late XIX - early XX centuries). The bearers of the tradition have a certain “baggage” or a set of elements specific for a particular genre (poetic, content) in order to “form” a text from these elements when reproducing it. "Forming" a fairy tale, Kozhemyakina takes out any element, image, plot episode, etc. from her fairy-tale "baggage". It includes not only fairy-tale, but also epic episodes, formulas, elements, as well as images, plot conflicts from adventure stories or novels. Fairy-tale contaminations are also peculiar. They are as well due to the specifics of the oral existence of fairy tales. A special publication of this fairy-tale heritage with scientific commentary on each text is needed.

Los estilos APA, Harvard, Vancouver, ISO, etc.

8

Smykovskaya, Tatyana Ye. "“A Word from Heaven in Hell′s Three Dimensions”: The Specifics of the Artistic Topos in the Camp Poems of Anastasia Tsvetaeva". Philological Sciences. Scientific Essays of Higher Education, n.º 1 (enero de 2018): 97–104. http://dx.doi.org/10.20339/phs.1-18.097.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

9

Alexandri, Styliani, Maria Tsaktsira, Stefanos Hatzilazarou, Stefanos Kostas, Irini Nianiou-Obeidat, Athanasios Economou, Apostolos Scaltsoyiannes y Parthena Tsoulpha. "Selection for Sustainable Preservation through In Vitro Propagation of Mature Pyrus spinosa Genotypes Rich in Total Phenolics and Antioxidants". Sustainability 15, n.º 5 (2 de marzo de 2023): 4511. http://dx.doi.org/10.3390/su15054511.

Texto completo

Resumen

Pyrus spinosa Forssk. (almond-leaved pear) is a wild-growing native tree of the hilly countryside of Greece, which has recently gained interest for its valuable endogenous substances. In the present work, the determination of the total phenol content (TPC) and antioxidant capacity (AC) was carried out during 2021 and 2022 in leaves from 32 genotypes of mature wild-growing trees at four different locations of Central Macedonia District, Greece: Agia Anastasia, Chalkidiki, Lagadas and Pieria. The measurements taken from the leaf samples of all genotypes revealed a strong positive linear correlation between TPC and AC (R2 = 0.772). Two genotypes from Agia Anastasia, coded as AA2 and AA3, were comparatively the richest in TPC (44.86 for AA2 and 46.32 mg GAE/g fresh weight for AA3) and AC (70.31 and 71.21 μg AAE/g fresh weight for the same genotypes). For these two genotypes of high TPC and AC, an efficient micropropagation protocol was developed to preserve and multiply this valuable germplasm. Newly emerged shoot tips were excised from winter shoots and, after disinfestation, they were established on a modified Murashige and Skoog (MS) nutrient medium with 5 μΜ of 6-Benzyloaminopurine (ΒΑP). For shoot multiplication, explants from clean cultures were transferred to Pear Medium 1 with 5 μΜ of BAP. The effect of the nutrient medium was tested by using five different nutrient media (modified MS, Pear Medium 1, Pear Medium 2, DKW and WPM) supplemented with 5 μΜ of BAP. Pear Medium 1 was the most effective in shoot formation. Among the four different BAP concentrations (0, 5, 10 and 20 μΜ) used in Pear Medium 1, 5 μΜ of BAP resulted in the production of the significantly highest number of shoots (22.7 shoots per explant, 2.4 cm long). The exposure of cultures to 10 μmol·m−2·s−1 for one week under light irradiance followed by 35 μmol·m−2·s−1 for four weeks increased both the number and length of the shoots produced. A 20-sec dip of the shoot bases into 49.0 μΜ of Indole-3-butyric acid (IBA) in EtOH equally affected rooting in a modified rooting MS (79%) and Pear Medium 1 (80%). The root system developed better in the modified rooting MS medium (mean number of roots of 2.7 with a length of 3.9 cm). The acclimatization of the plantlets was successfully carried out (high survival rates five weeks after their establishment) on a perlite substrate under controlled environmental conditions.

Los estilos APA, Harvard, Vancouver, ISO, etc.

10

Skulkin, Artyom. "THE CONCEPT OF LOVE AND THE FORMS OF ITS EMBODIMENT IN THE NOVEL BY F. M. DOSTOEVSKY “THE IDIOT”". Проблемы исторической поэтики 20, n.º 1 (febrero de 2022): 187–207. http://dx.doi.org/10.15393/j9.art.2022.10603.

Texto completo

Resumen

In the article, the concept of love, embodied in F. M. Dostoevsky’s novel “The Idiot,” is considered from the point of view of three religious and philosophical types of love identified by V. S. Solovyov, namely, ascending love (amor ascendens), descending love (amor descendens) and balanced love (amor aequalis). This approach allows not only to conceptualize the forms of manifestation of love in “The Idiot” in the context of V. S. Solovyov’s thoughts, but also to identify the readers’ tradition of adequate perception of Dostoevsky's work, associated with the mental and spiritual atmosphere of the era. Seeing the meanings of the novel through the “eyes” of V. S. Solovyov allows to outline the national value code of reading. Each type of love designated by the philosopher in Dostoevsky's novel corresponds to descending love (amor descendens), embodied in parental love (Lizaveta Prokofievna and Ardalion Alexandrovich), sacrificial love (Nastasya Filippovna Barashkina) and Christian love (Lev Nikolaevich Myshkin). The manifestations of selfless children's love (Swiss children) and passionate love (Parfyon Rogozhin) became forms of embodiment of ascending love (amor ascendens). The forms of embodiment of balanced love (amor aequalis) include “brotherly” love (Epanchiny sisters: Aglaya, Adelaide, Anastasia). However, the love of God is the highest form of love in hierarchy (which includes all others), the effective power of which begins with faith: therefore, it is no coincidence that the episode with the painting by Hans Holbein the Younger “Dead Christ in the Tomb” becomes the meaning-generating theoanthropic center of “The Idiot.”

Los estilos APA, Harvard, Vancouver, ISO, etc.

11

Velalopoulou, Anastasia, Ilias V. Karagounis, Giorgos Skoufos, Ioannis I. Verginadis, Michele Kim, Khayrullo Shoniyozov, Artemis G. Hatzigeorgiou et al. "Abstract 3304: Gene expression profiling of full-thickness skin after FLASH proton radiotherapy". Cancer Research 82, n.º 12_Supplement (15 de junio de 2022): 3304. http://dx.doi.org/10.1158/1538-7445.am2022-3304.

Texto completo

Resumen

Abstract Purpose: To investigate the transcriptomic changes induced by FLASH proton radiotherapy (F-PRT) that could be responsible for the protection of normal epithelial tissues by radiation-induced toxicities as have been previously shown by us and others. Methods: C57BL/6J mice received 30 Gy of F-PRT or S-PRT to the hind leg at respective dose rates of 69-124 Gy/sec or 0.39-0.65 Gy/sec. RNA sequencing was performed using full-thickness leg skin at 5 days after radiation revealing major pathways regulated by F-PRT and S-PRT. In an endeavor to identify the full repertoire of cells and gene expression profiles that are involved in the sparing effects of FLASH PRT, we expanded our studies to include single-cell RNA sequencing (sc-RNA seq) and examined additional time points such as Day 2 and Day 10 after radiation. Single-cell transcriptome libraries were generated on a 10X Genomics Chromium system. Datasets were acquired from cell samples derived and sequenced from pooled skin samples of three mice per group. Skin from the sequenced mice was also embedded for spatial analysis of gene expression. Results: RNA sequencing revealed that F-PRT uniquely upregulates almost four times more genes compared to S-PRT (F-PRT-uniquely upregulated 489 genes vs S-PRT-uniquely upregulated 129 genes). Also, F-PRT uniquely downregulated 178 genes, compared to the 125 genes uniquely downregulated by S-PRT. GO analysis demonstrates that the keratinization and apoptosis pathways are uniquely upregulated by S-PRT, whereas F-PRT uniquely upregulates genes involved in vascular development pathway. During submission of the abstract, analysis of sc-RNA seq samples was pending. Conclusion: Our comprehensive studies inform on the transcriptomic profiling of skin cell populations that are affected by F-PRT vs S-PRT; this insight will further spur discoveries on the biology of FLASH radiotherapy effects. Citation Format: Anastasia Velalopoulou, Ilias V. Karagounis, Giorgos Skoufos, Ioannis I. Verginadis, Michele Kim, Khayrullo Shoniyozov, Artemis G. Hatzigeorgiou, Eric Diffenderfer, Lei Dong, James Metz, Constantinos Koumenis, Keith A. Cengel, Amit Maity, Theresa M. Busch. Gene expression profiling of full-thickness skin after FLASH proton radiotherapy [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2022; 2022 Apr 8-13. Philadelphia (PA): AACR; Cancer Res 2022;82(12_Suppl):Abstract nr 3304.

Los estilos APA, Harvard, Vancouver, ISO, etc.

12

Vorozhikhina, Ksenia V. "The Birth of a Philosopher (Review on N.A. Gromova’s “Otherworldly Friend. The Love Story of Lev Shestov and Varvara Malahieva-Mirovich in Letters and Documents”. Moscow: AST Publishing House: Edited by Elena Shubina, 2021. 413 p.)". History of Philosophy 27, n.º 2 (10 de noviembre de 2022): 131–36. http://dx.doi.org/10.21146/2074-5869-2022-27-2-131-136.

Texto completo

Resumen

The review is devoted to a new book by the writer and literary historian Natalia A. Gromova, in which, on the basis of letters and archival documents, the love story of Varvara Malahieva-Mirovich and Lev Shestov is reconstructed. According to Gromova, their relationship became an impulse that had a key influence on the formation of Shestov as an existential thinker, whose philosophy is not based on speculative contemplation, but is inextricably linked with life experience. Shestov’s philosophy of tragedy grows out of the relationship between Shestov and Malakhieva-Mirovich. On the basis of Shestov’s letters addressed to Malahieva-Mirovich, recently found in the family archive of Shik-Shakhovskie, the author of the book reconstructs the autobiographical events of the philosopher’s life, when for him “the time is out of joint” and he experienced an ideological and psychological crisis that marked the beginning of a new stage in his work. Gromova shows how the events of his life are reflected in Shestov’s writings: in his writings, the philosopher seeks answers to the questions that his relationship with Varvara Malahieva-Mirovich poses to him. Gromova introduces into scientific circulation the previously unpublished correspondence between Shestov and Malahieva-Mirovich, letters from Malahieva-Mirovich to her friend Leonilla N. Tarasova, as well as the memoirs of Malahieva-Mirovich about the actress of the Moscow Art Theater Nadezhda S. Butova. The book contains unique information about Shestov’s circle in Russia (for example, about the decadent poetess Anastasia Mirovich), including the so-called “shestovites”, a.i. the poetess and writer Varvara G. Malahieva-Mirovich, philosopher, lawyer and publisher Semyon M. Lurie, actress Nadezhda S. Butova, who is trying to find a philosophical and religious “justification” for the actor’s craft.

Los estilos APA, Harvard, Vancouver, ISO, etc.

13

Badarevski, Bobi y Anastazija Kirkova. "Science, Gay Gene, Human Rights". Identities: Journal for Politics, Gender and Culture 1, n.º 3 (1 de junio de 2002): 17–36. http://dx.doi.org/10.51151/identities.v1i3.60.

Texto completo

Resumen

Author(s): Bobi Badarevski | Боби Бадаревски Title (English): Science, Gay Gene, Human Rights Title (Macedonian): Наука, геј ген, човекови права Translated by (Macedonian to English): Anastazija Kirkova | Анастазија Киркова Journal Reference: Identities: Journal for Politics, Gender and Culture, Vol. 1, No. 3 (Summer 2002) Publisher: Research Center in Gender Studies - Skopje and Euro-Balkan Institute Page Range: 17-36 Page Count: 19 Citation (English): Bobi Badarevski, “Science, Gay Gene, Human Rights,” translated from the Macedonian by Anastasija Kirkova, Identities: Journal for Politics, Gender and Culture, Vol. 1, No. 3 (Summer 2002): 17-36. Citation (Macedonian): Боби Бадаревски, „Наука, геј ген, човекови права“, Идентитети: списание за политика, род и култура, т. 1, бр. 3 (лето 2002): 17-36.

Los estilos APA, Harvard, Vancouver, ISO, etc.

14

Editorial, Article. "Comment. Maxim P. Salamachin, Tatiana S. Dergacheva, Oleg V. Leonov, Dmitry V. Sidorov, Andrey O. Soloviev, Anastasia O. Leonova Manual intracorporeal end-to-end invagination ileotransverse anastomosis, own experience". Koloproktologia 20, n.º 1 (18 de marzo de 2021): 32. http://dx.doi.org/10.33878/2073-7556-2021-20-1-32.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

15

Faure, Richard. "Revisiting unselected embedded questions in the light of Classical Greek wh-clauses". Linguistic Review 36, n.º 2 (26 de mayo de 2019): 191–230. http://dx.doi.org/10.1515/tlr-2018-2011.

Texto completo

Resumen

Abstract This paper addresses the issue of the questions embedded under predicates normally selecting for propositions like know (unselected embedded questions UEQ). This problem was handled in Adger and Quer (Adger, David & Josep Quer. 2001. The syntax and semantics of unselected embedded questions. Language 77. 107–133) and Öhl (Öhl, Peter. 2007. Unselected embedded interrogatives in German and English : S-selection as dependency formation. Linguistische Berichte 212. 403–438). Both articles notice a difference between yes/no- and wh-questions. The distribution of the latter seems to be less restricted. However data from Classical Greek shed new light on the matter. Classical Greek uses two sets of wh-items in what looks like embedded questions (h- and t-). It is shown that h-clauses do not denote questions but propositions. The selection mismatch arises with t-clauses. They denote questions and have the same distribution as yes/no-questions. Moreover Classical Greek provides new evidence in favor of 1) the sensitivity of the UEQ to the polarity of the environment, building on Giannakidou’s (Giannakidou, Anastasia. 1998. Polarity sensitivity as (non) veridical dependency. Amsterdam & Philadelphia: John Benjamins) definition of nonveridicality; 2) the presence of a determiner on top of the UEQ as proposed in Adger and Quer (2001). The article argues nevertheless that the sensitivity is not due to the determiner, but to an operator going along with UEQs. It is shown that the determiner is a type-shifter turning the question into a proposition and thus repairing the apparent selection mismatch.

Los estilos APA, Harvard, Vancouver, ISO, etc.

16

Evelyn, Angelia. "Reviewer Acknowledgements". Applied Finance and Accounting 5, n.º 1 (25 de febrero de 2019): 68. http://dx.doi.org/10.11114/afa.v5i1.4093.

Texto completo

Resumen

Reviewer AcknowledgementsApplied Finance and Accounting [AFA] would like to acknowledge the following reviewers for their assistance with peer review of manuscripts for this issue. Many authors, regardless of whether AFA publishes their work, appreciate the helpful feedback provided by the reviewers. Their comments and suggestions were of great help to the authors in improving the quality of their papers. Each of the reviewers listed below returned at least one review for this issue.Reviewers for Volume 5, Number 1 Anastasia Kopaneli, University of Patras, GreeceNoriaki Okamoto, Rikkyo University, JapanVineet Chouhan, Sir Padampat Singhania University, IndiaYu Peng Lin, University of Detroit Mercy, USAMarco Muscettola, Independent researcher, ItalyZi-Yi Guo, Wells Fargo Bank, N.A., USALektore Oltiana Muharremi, University of Vlora, AlbaniaJayendra S. Gokhale, Embry-Riddle Aeronautical University, USAMohamed Jalloh, Economic Community of West African States (ECOWAS), NigeriaRui Fernandes, Porto Accounting and Business School, PortugalNikolay Patonov, European Polytechnical University, BulgariaMojeed Idowu John Odumeso-Jimoh, Noble Integrated Resources & Management, NigeriaFlorin Peci, University of Peja, KosovoGheorghe Morosan, Stefan Cel Mare University Suceava Romania, RomaniaNicoleta Radneantu, Romanian – American University, RomanianAugustine Akhidime, Benson Idahosa University, NigeriaHajar Jahangard , Central Bank of Iran(CBI), IranHassan Rkein , Al Maaref University , LebanonAndrey Kudryavtsev, The Max Stern Yezreel Valley Academic College, IsraelIoan Bogdan Robu, Alexandru Ioan Cuza University of Iasi, RomaniaLingesiya Kengatharan, University of Jaffna, Sri LankaMohammad Sami Ali Al-Dahrawi, Zarqa University, Jordan Angelia EvelynEditorial AssistantOn behalf of,The Editorial Board of Applied Finance and AccountingRedfame Publishing9450 SW Gemini Dr. #99416Beaverton, OR 97008, USAE-mail: afa@redfame.comURL: http://afa.redfame.com

Los estilos APA, Harvard, Vancouver, ISO, etc.

17

Zhuravleva, V. y I. Ibragimov. "The Afghan Crisis of the Future Greater Middle East". Analysis and Forecasting. IMEMO Journal, n.º 2 (2022): 83–97. http://dx.doi.org/10.20542/afij-2022-2-83-97.

Texto completo

Resumen

On October 20, 2021 the round table devoted to the crisis in Afghanistan was held at the IMEMO. Participants of the discussion were staff members the Center for North American Studies and the Laboratory ‘Center for the Middle East Studies’. Presented review, based on that round table, analyzes the key issues related to the current Afghan crisis. First of all, the revision of the approach to this problem by regional powers that have disagreements and contradictions between themselves. Moreover, special attention is paid to the changes of the US policy in the region and the consequences of the withdrawal of American troops from Afghanistan. Also, the article brings up questions regarding Taliban’s legitimacy and analyzes situation within the country at this stage. The views and interests were considered from various standpoints: as perceived by the main participants – the United States of America, Afghanistan, and the Middle Eastern countries involved one way or another – Turkey, Iran, Israel and the Arab states. The authors emphasize the fact that the Afghan crisis has created a new situation on a regional scale and a serious challenge for the international community primarily by the growth of the terrorist threat, the socio-economic crisis in Afghanistan and the escalation of the migration crisis. The main presenters were as follows: BELKOV Evgeny A., BOGACHEVA Anastasia S., DAVYDOV Alexey A., Zimin Ilya A., IBRAGIMOV Ibragim E., LAZOVSKY Stanislav O., SAMARSKAIA Liudmila M., SVISTUNOVA Irina A., TYUKAEVA Tatiana I. The review of the main conclusions made upon discussion was prepared by ZHURAVLEVA Victoria Y., Cand. Sci. (Polit.), Head of Center of the North American Studies, IMEMO (zhvika@imemo.ru, ORCID: 0000-0003-1911-625Х) and IBRAGIMOV Ibragim E., junior researcher of the Laboratory ‘Center of the Middle East Studies’ (ibragim07_93@mail.ru, ORCID: 0000-0001-9669-4243).

Los estilos APA, Harvard, Vancouver, ISO, etc.

18

Verginadis, Ioannis I., Clara Morral Martinez, Tristan Lim, Priyanka Chowdhury, Giorgos Skoufos, Michele M. Kim, Anastasia Velalopoulou et al. "Abstract 3320: Single-cell RNA sequencing analysis and transgenic mouse models reveal differential effects of flash vs. standard proton radiotherapy on gastrointestinal tissues and tumors". Cancer Research 82, n.º 12_Supplement (15 de junio de 2022): 3320. http://dx.doi.org/10.1158/1538-7445.am2022-3320.

Texto completo

Resumen

Abstract Recent studies suggest that ultrahigh-dose-rate, “FLASH,” radiation therapy (RT) decreases normal tissue damage while maintaining tumor response compared with conventional dose rate RT. Our group has designed and tested the first system to accurately deliver dosimetrically identical FLASH Proton RT (F-PRT; 60-110 Gy/sec) or Standard Proton RT (S-PRT; 0.5-1 Gy/sec) using double-scattered protons. Our purpose is to identify if F-PRT is superior to S-PRT in protecting normal tissues, while equipotent in controlling tumor growth. We previously demonstrated that compared to S-PRT, F-PRT significantly decreases overall mortality from late epithelial gastrointestinal (GI) fibrosis (p<0.005) in mouse models following 14 (males) and 15 Gy (females) whole-abdomen and 18 Gy focal intestinal RT, whereas tumor growth inhibition is essentially indistinguishable between the two modalities. We also found that F-PRT-treated mice displayed a significantly higher percentage of regenerated crypts (EdU incorporation) in comparison to the S-PRT (p<0.01). To better understand the differential responses of the normal intestine between the two treatment modalities, we performed single-cell RNA sequencing on 14 Gy F-PRT and S-PRT-treated intestines at 2, 10, and 20 days post-RT. Analysis revealed enrichment of stem/progenitor epithelial cell populations with increased proliferative signatures and expression of genes related to the interferon-alpha signature in epithelial and immune cells post F-PRT treatment compared to the S-PRT. Immunofluorescence staining of F-PRT and S-PRT treated intestinal tissues confirmed a) the higher proliferation rate of epithelial cells observed in F-PRT-treated mice, b) significantly higher number of infiltrated immune cells in F-PRT- compared to the S-PRT-treated mice and c) higher expression of interferon signaling in immune cells in F-PRT treated mice. Collectively, our preliminary findings suggest that F-PRT may enhance a regenerative or facultative stem cell program that is associated with greater and more persistent IFN Type I signaling. Moreover, using a model of epithelial-specific knockout of p53 (Villin-Cre;p53), we found that mice treated with 13 Gy S-PRT quickly succumb to acute radiation GI syndrome, while F-PRT treated mice had significantly improved survival (median survival: 8.5 days for S-PRT vs 164 days for F-PRT; p<0.05). This suggests that F-PRT may preserve a higher proportion of progenitor epithelial cells with enhanced regeneration potential. Understanding the cellular and molecular basis for the effects of F-PRT provides a framework for clinical application of this novel modality with the potential to improve the therapeutic outcome and quality of life of cancer patients. Citation Format: Ioannis I. Verginadis, Clara Morral Martinez, Tristan Lim, Priyanka Chowdhury, Giorgos Skoufos, Michele M. Kim, Anastasia Velalopoulou, Denisa Goia, Leo Luo, Caitlin J. Foley, Zachary J. Reitman, Andrea R. Daniel, Eric Diffenderfer, Lei Dong, James Metz, David G. Kirsch, Andy Minn, Constantinos Koumenis. Single-cell RNA sequencing analysis and transgenic mouse models reveal differential effects of flash vs. standard proton radiotherapy on gastrointestinal tissues and tumors [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2022; 2022 Apr 8-13. Philadelphia (PA): AACR; Cancer Res 2022;82(12_Suppl):Abstract nr 3320.

Los estilos APA, Harvard, Vancouver, ISO, etc.

19

Sweeney, Ryan W., John T. Fitzpatrick, Ashten N. Omstead, Ping Zheng, Anastasia Gorbunova, Patrick L. Wagner, Juliann E. Kosovec, Blair A. Jobe, Ronan J. Kelly y Ali H. Zaidi. "Abstract B60: Sitravatanib enhances immune checkpoint blockade in a de novo esophageal adenocarcinoma model". Cancer Immunology Research 10, n.º 12_Supplement (1 de diciembre de 2022): B60. http://dx.doi.org/10.1158/2326-6074.tumimm22-b60.

Texto completo

Resumen

Abstract Background: Esophageal adenocarcinoma (EAC) is a leading cause of cancer-related mortality. Sitravatinib is a small molecule spectrum-selective tyrosine kinase inhibitor (TKI) that targets TAM receptors (AXL, MERTK and TYRO3), VEGF, PDGF, and c-Kit. Previously, dual inhibition of TAM and VEGF receptors has shown to successfully modulate the tumor immune microenvironment towards a less immunosuppressive state, by depletion of MDSCs and repolarization of TAMs towards a proinflammatory M1 phenotype. In clinical trials, TKIs have shown to improve patient outcomes, alone or in combination with immune checkpoint inhibitors, in multiple solid tumors. In the present study, the antitumor activity of sitravatinib alone and in combination with PD-1 blockade was investigated in a de novo EAC rat model. Methods: Ninety-six rats underwent an end-to-side esophagojejunostomy to induce gastroesophageal reflux, resulting in EAC carcinogenesis. At 32 weeks post-operatively, tumor bearing animals were randomized to a dose of 10mg/kg of sitravatanib (S) or vehicle control (VC), for a total of three 14 day cycles. A PD-1 inhibitor, AUNP-12 (IO), was administered at a dose of 3mg/kg or placebo, on day 12 of each cycle. At 38 weeks post-operatively animals were euthanized. Safety and efficacy was evaluated by on-treatment mortality, MRI, immunofluorescence and qRT PCR. Results: The S+/-IO groups demonstrated a higher mortality when compared to the control groups (p<0.001). Pre- to post-treatment, mean MRI tumor volume decreased by 32% and 73% in the S-IO and S+IO and increased by 90% and 160% in the VC+IO and VC-IO, respectively (p<0.001). Enhanced CD3+CD8+ T-cell densities were observed in the treatment groups when compared to the control groups (p<0.001). Additionally, a higher CD86/CD206 ratio was observed in the S-IO and S+IO groups than in the control groups (p<0.001), indicating a repolarization from M2 to M1 macrophage phenotype. Gene expression analysis of post treatment samples demonstrated upregulation of pro-inflammatory cytokines TNF-α, IFN-γ, IL-1β, IL-6, IL-12 and downregulation of anti-inflammatory cytokines including TGF-β, IL-4, IL-10, and IL-13 in the treated versus control animals (p<0.05). Pre- to post-treatment qRT-PCR levels demonstrated significant inhibition of pathway genes, AXL, AKT, MERTK and PI3K, in the treated animals (p=<0.001). Moreover, pre-treatment AXL levels were significantly higher in major responders (>80% tumor reduction n=8) compared to the non-responders (<25% tumor reduction/progression n=6), in the merged S +/- IO group (p=0.009). Lastly, increased apoptosis and decreased proliferation were confirmed through Cas-3 and Ki-67, respectively, in both treatment groups (p<0.001). Conclusion: This study establishes a promising combination strategy using the multi-gene TKI sitravatinib to overcome PD-1/PD-L1 resistance and potentiate immune checkpoint inhibition in an EAC model. Citation Format: Ryan W. Sweeney, John T. Fitzpatrick, Ashten N. Omstead, Ping Zheng, Anastasia Gorbunova, Patrick L. Wagner, Juliann E. Kosovec, Blair A. Jobe, Ronan J. Kelly, Ali H. Zaidi. Sitravatanib enhances immune checkpoint blockade in a de novo esophageal adenocarcinoma model [abstract]. In: Proceedings of the AACR Special Conference: Tumor Immunology and Immunotherapy; 2022 Oct 21-24; Boston, MA. Philadelphia (PA): AACR; Cancer Immunol Res 2022;10(12 Suppl):Abstract nr B60.

Los estilos APA, Harvard, Vancouver, ISO, etc.

20

Hon, Jennifer, Carson Kenum, Pushpinder S. Bawa, Vijaya L. Dommeti, Anastasia A. Sahu, Miriam Gandham, Chi-Chiang Li et al. "Abstract 2538: Role of Argonaute 2 in regulation of immune microenvironment in pancreatic cancer". Cancer Research 82, n.º 12_Supplement (15 de junio de 2022): 2538. http://dx.doi.org/10.1158/1538-7445.am2022-2538.

Texto completo

Resumen

Abstract KRAS mutations have been observed in nearly 95% of pancreatic ductal adenocarcinoma (PDAC), however targeting KRAS remains a major therapeutic challenge. Previous studies from our group have discovered a novel interaction between KRAS and Argonaute 2 (AGO2) and have uncovered a significant role of this interaction in regulating KRAS signaling. Knockout of AGO2 in genetically engineered mouse models of KRAS driven pancreatic and lung cancer dramatically impacted tumor progression. Intriguingly, in pancreatic cancer loss of AGO2 expression resulted in early pancreatic intraepithelial lesions (PanINs) that failed to progress to PDAC. We observed increased senescence in these AGO2 knockout lesions that abrogated PDAC progression. Further, there was pronounced infiltration of immune cells in pancreata lacking AGO2 in comparison to wild type. We particularly observed a 20-fold increase in natural killer (NK) cells population in pancreata lacking AGO2. This instigated us to evaluate potential role of AGO2 in regulating immune microenvironment in pancreatic cancer. Gene set enrichment analysis of AGO2 knockout SW1990 PDAC cells revealed significant upregulation of inflammatory and interferon response pathways. We observed increased expression of several signaling proteins implicated in immune activation pathways. Further characterization of these knockout cells indicated upregulation of MHC proteins that consequently added to mechanistic insights. Additionally, we are also exploring syngeneic models of pancreatic cancer and we will present findings from our ongoing studies to evaluate the impact of AGO2 knockout on immune axis. Overall, our findings suggest potential involvement of AGO2 in regulating immune microenvironment in pancreatic cancer. Citation Format: Jennifer Hon, Carson Kenum, Pushpinder S. Bawa, Vijaya L. Dommeti, Anastasia A. Sahu, Miriam Gandham, Chi-Chiang Li, Zainab I. Taher, Sylvia Zelenka-Wang, Jean C. Tien, Sunita Shankar, Seema Chugh, Arul M. Chinnaiyan. Role of Argonaute 2 in regulation of immune microenvironment in pancreatic cancer [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2022; 2022 Apr 8-13. Philadelphia (PA): AACR; Cancer Res 2022;82(12_Suppl):Abstract nr 2538.

Los estilos APA, Harvard, Vancouver, ISO, etc.

21

Kalverkämper, Hartwig. "Johan Franzon / Annjo K. Greenall / Sigmund Kvam / Anastasia Parianou [Eds.]: Song Translation: Lyrics in Context. Berlin: Frank & Timme 2021. (= TransÜD – Arbeiten zur Theorie und Praxis des Übersetzens und Dolmetschens. 113). 498 S. 68,00 Euro". Lebende Sprachen 66, n.º 2 (1 de octubre de 2021): 361–76. http://dx.doi.org/10.1515/les-2021-0017.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

22

Anastasi, Anne. "Ability Testing in the 1980's and Beyond: Some Major Trends". Public Personnel Management 18, n.º 4 (diciembre de 1989): 471–85. http://dx.doi.org/10.1177/009102608901800407.

Texto completo

Resumen

This article is the complete text of the keynote address delivered at the 1989 International Personnel Management Association Assessment Council Conference, held in Orlando, Florida. In this article, Anastasi discusses the magnitude of changes in psychological testing and the rapidity of their development. She described trends taking place in three categories: the role of the test user, technical methodology of test construction, and substantive interpretation of test scores. The focus on the test user emphasizes efforts to correct the misuses of tests by unqualified persons in education, industry, clinical practice, and other applied settings. Anastasi reviews the importance of test users having knowledge about the statistical properties of test scores, the psychological characteristics of the behavior assessed, and confirmatory data from other sources, in order to make an adequately informed sustantive interpretation of test scores. The increasing emphasis on qualified test users has in no way diminished the concern for psychometrically sound instruments. Anastasi outlines approaches to the development of valid tests through multiple procedures, which are employed sequentially, at different stages of test construction. Several examples describe special techniques for local validation purposes. The contribution of validity generalization, item response theory, and adaptive testing are reviewed. Subjective interpretation of test scores requires knowledge about the behavior domain assessed by the test. Many current misuses and misinterpretations of test scores result from erroneous or outdated knowledge about human behavior. Proper interpretation of test scores are examined in relation to real-life contexts—both past and present—within the framework of cultural diversity.

Los estilos APA, Harvard, Vancouver, ISO, etc.

23

Montesinos-Tubée, Daniel B. "Senecio anastasioi (Asteraceae / Compositae: Senecioneae), a new caespitose species from the South Andes of Peru". Ukrainian Botanical Journal 79, n.º 6 (31 de diciembre de 2022): 355–66. http://dx.doi.org/10.15407/ukrbotj79.06.355.

Texto completo

Resumen

Senecio anastasioi Montesinos, a new species of Asteraceae / Compositae: Senecioneae allied to Senecio ser. Suffruticosi subser. Caespitosi, is described from the Andean regions located in South Peru. In morphological terms, S. anastasioi is similar to S. gamolepis Cabrera but clearly distinguished by its larger habit size, irregular arrangement of leaves, greater length and width of leaves, leaf lamina covered by scarce fimbriate or sericeous trichomes, capitules with larger, calycular bracts and phyllaries, both densely pubescent apically, and longer pedicels and pappus bristles. The morphological differences between these species are identified and further discussed. The preliminary IUCN status for the new species is assessed.

Los estilos APA, Harvard, Vancouver, ISO, etc.

24

Anastasova, Senka. "Towards Jamie McCallum (Dir.), The Real Work". Identities: Journal for Politics, Gender and Culture 15, n.º 1-2 (1 de junio de 2018): 204–9. http://dx.doi.org/10.51151/identities.v15i1-2.348.

Texto completo

Resumen

Author(s): Senka Anastasova Title (English): Towards Jamie McCallum (Dir.), The Real Work Journal Reference: Identities: Journal for Politics, Gender and Culture, Vol. 15, No. 1-2 (Summer 2018) Publisher: Institute of Social Sciences and Humanities – Skopje Page Range: 204-209 Page Count: 6 Citation (English): Senka Anastasova, “Towards Jamie McCallum (Dir.), The Real Work,” Identities: Journal for Politics, Gender and Culture, Vol. 15, No. 1-2 (Summer 2018): 204-209.

Los estilos APA, Harvard, Vancouver, ISO, etc.

25

Gjurchinova, Anastasija y Lindita Ahmeti. "Номадизам и феминизам. Кон Rosi Braidotti, Soggeto nomade. Femminismo e crisi della modernità". Identities: Journal for Politics, Gender and Culture 1, n.º 3 (1 de junio de 2002): 183–87. http://dx.doi.org/10.51151/identities.v1i3.75.

Texto completo

Resumen

Author(s): Anastasija Gjurchinova | Анастасија Ѓурчинова Title (Macedonian): Номадизам и феминизам. Кон Rosi Braidotti, Soggeto nomade. Femminismo e crisi della modernità Title (Albanian): Nomadizmi dhe feminizmi. Për Rosi Braidotti, Soggetto nomade. Femminismo e crisi della modernità Translated by (Macedonian to Albanian): Lindita Ahmeti Journal Reference: Identities: Journal for Politics, Gender and Culture, Vol. 1, No. 3 (Summer 2002) Publisher: Research Center in Gender Studies - Skopje and Euro-Balkan Institute Page Range: 183-187 Page Count: 5 Citation (Macedonian): Анастасија Ѓурчинова, „Номадизам и феминизам. Кон Rosi Braidotti, Soggeto nomade. Femminismo e crisi della modernità“, Идентитети: списание за политика, род и култура, т. 1, бр. 3 (лето 2002): 183-187. Citation (Albanian): Anastasija Gjurchinova, „Nomadizmi dhe feminizmi. Për Rosi Braidotti, Soggetto nomade. Femminismo e crisi della modernità“, përkthim nga Maqedonishtja Lindita Ahmeti, Identities: Journal for Politics, Gender and Culture, Vol. 1, No. 3 (Summer 2002): 183-187.

Los estilos APA, Harvard, Vancouver, ISO, etc.

26

Sri Wahyuni, Siti Fadilah y Adolf Bastian. "Children's independence Skills Analysis at Low Socioeconomic Environment". JPUD - Jurnal Pendidikan Usia Dini 14, n.º 2 (30 de noviembre de 2020): 303–12. http://dx.doi.org/10.21009/jpud.142.08.

Texto completo

Resumen

Research suggests that child independence is more popular in countries with greater wealth and a higher percentage of the educated population. Various research implications expect children's independence and compliance to increase over time in developing countries. This study aims to describe the independence of early childhood who comes from low-income families or at low socioeconomic environment. Using quantitative descriptive, data collection techniques are carried out through a questionnaire. The study population was 30 respondents from the ECE institution who were included in the list of low-income families in 2018, using an area sampling technique. Overall, the teacher stated that all indicators of dependence on children from low-income families had reached the high category, which was 75%. The implication of further research is that aspects of independence in physical abilities, self-confidence, responsibility, discipline, sociability, sharing, and independence in terms of emotional control in early childhood can develop better in a low socio-economic environment. Keywords: Early Childhood, Independence skills, low-socioeconomic environment References [BPS] Badan Pusat Statistik. (2019). Berita resmi statistik. Bps.Go.Id. Amini, M. (2018). Parental Involvement in Improving Independence in Early Childhood. Advances in Social Science, Education and Humanities Research (ASSEHR), 169(Icece 2017), 190–192. https://doi.org/10.2991/icece-17.2018.48 Blair, C., & Diamond, A. (2008). Biological processes in prevention and intervention: The promotion of self-regulation as a means of preventing school failure. Development and Psychopathology, 20(3), 899–911. https://doi.org/10.1017/S0954579408000436 Blair, C., & Raver, C. C. (2015). School Readiness and Self-Regulation: A Developmental Psychobiological Approach. Annual Reviews Psychology, 3(66), 711–731. https://doi.org/10.1146/annurev-psych-010814-015221.School Bridgett, D. J., Burt, N. M., Edwards, E. S., & Deater-deckard, K. (2015). Supplemental Material for Intergenerational Transmission of Self-Regulation: A Multidisciplinary Review and Integrative Conceptual Framework. Psychological Bulletin, 141(3), 602–654. https://doi.org/10.1037/a0038662.supp Brophy-Herb, H. E., Stansbury, K., Bocknek, E., & Horodynski, M. A. (2012). Modeling maternal emotion-related socialization behaviors in a low-income sample: Relations with toddlers’ self-regulation. Early Childhood Research Quarterly, 27(3), 352–364. https://doi.org/10.1016/j.ecresq.2011.11.005 Buckner, J. C., Mezzacappa, E., & Beardslee, W. R. (2009). Self-Regulation and Its Relations to Adaptive Functioning in Low Income Youths. American Journal of Orthopsychiatry, 79(1), 19–30. https://doi.org/10.1037/a0014796 Charilaos, Z., Anastasia, C., Artemis, G., & Dimitrios, S. (2018). The Relationship Between Performance of Neuromuscular Junction and Social Skills (Co-Operation, Interaction, Independence). European Journal of Physical Education and Sport Science, 4(12), 1–20. https://doi.org/10.5281/zenodo.1455997 Cirino, P. T., Miciak, J., Gerst, E., Barnes, M. A., Vaughn, S., Child, A., Huston-Warren, E., Coelho, V., Cadima, J., Pinto, A. I., Guimarães, C., Dark-Freudeman, A., West, R. L., Eisenberg, N., Sulik, M. J., Huh, Y., Reigeluth, C. M., Kim, S., Holloway, S. D., … Cheah, C. S. L. (2018). Attachment and self-regulation. Personality and Social Psychology Bulletin,16(2), 450–467. https://doi.org/10.1177/0022219415618497 Eisenberg, N., Valiente, C., & Eggum, N. D. (2010). Self-regulation and school readiness. Early Education and Development, 21(5), 681–698. https://doi.org/10.1080/10409289.2010.497451 Ellis, B. J., Boyce, W. T., Belsky, J., Bakermans-Kranenburg, M. J., & Van Ijzendoorn, M. H. (2011). Differential susceptibility to the environment: An evolutionary- neurodevelopmental theory. Development and Psychopathology, 23(1), 7–28. https://doi.org/10.1017/S0954579410000611 Evans, G. W., & Kim, P. (2013). Childhood Poverty, Chronic Stress, Self-Regulation, and Coping. Child Development Perspectives, 7(1), 43–48. https://doi.org/10.1111/cdep.12013 Fay-Stammbach, T., Hawes, D. J., & Meredith, P. (2014). Parenting Influences on Executive Function in Early Childhood: A Review. Child Development Perspectives, 8(4), 258–264. https://doi.org/10.1111/cdep.12095 Havighurst, S. S., Wilson, K. R., Harley, A. E., Prior, M. R., & Kehoe, C. (2010). Tuning in to Kids: Improving emotion socialization practices in parents of preschool children-findings from a community trial. Journal of Child Psychology and Psychiatry and Allied Disciplines. https://doi.org/10.1111/j.1469-7610.2010.02303.x Jimenez-Gomez, C., Haggerty, K., & Topçuoǧlu, B. (2020). Wearable activity schedules to promote independence in young children. Journal of Applied Behavior Analysis, 9999(9999), 1–20. https://doi.org/10.1002/jaba.756 Julian, M. M., Leung, C. Y. Y., Rosenblum, K. L., LeBourgeois, M. K., Lumeng, J. C., Kaciroti, N., & Miller, A. L. (2019). Parenting and Toddler Self-Regulation in Low-Income Families: What Does Sleep Have to do with it? Infant Ment Health J., 40(4), 479–495. https://doi.org/doi:10.1002/imhj.21783 Kaya, İ., & Deniz, M. E. (2020). The effects of life skills education program on problem behaviors and social skills of 4-year-old preschoolers. Elementary Education Online, 19(2), 612–623. https://doi.org/10.17051/ilkonline.2020.692983 Lengua, L. J., Moran, L., Zalewski, M., Ruberry, E., Kiff, C., & Thompson, S. (2015). Relations of Growth in Effortful Control to Family Income, Cumulative Risk, and Adjustment in Preschool-age Children. Journal of Abnormal Child Psychology,43(4), 705–720. https://doi.org/10.1007/s10802-014-9941-2 Meylia, K. N., Siswati, T., Paramashanti, B. A., & Hati, F. S. (2020). Fine motor, gross motor, and social independence skills among stunted and non-stunted children. Early Child Development and Care, 0(0), 1–8. https://doi.org/10.1080/03004430.2020.1739028 Nahar, B., Hossain, M., Mahfuz, M., Islam, M. M., Hossain, M. I., Murray-Kolb, L. E., Seidman, J. C., & Ahmed, T. (2020). Early childhood development and stunting: Findings from the MAL-ED birth cohort study in Bangladesh. Maternal and Child Nutrition, 16(1). https://doi.org/10.1111/mcn.12864 Park, H., & Lau, A. S. (2016). Socioeconomic Status and Parenting Priorities: Child Independence and Obedience Around the World. Journal of Marriage and Family, 78(1), 43–59. https://doi.org/10.1111/jomf.12247 Rhoades, B. L., Greenberg, M. T., Lanza, S. T., & Blair, C. (2011). Demographic and familial predictors of early executive function development: Contribution of a person-centered perspective. Journal of Experimental Child Psychology, 108(3), 638–662. https://doi.org/10.1016/j.jecp.2010.08.004 Schmitt, S. A., Mcclelland, M. M., Tominey, S. L., & Acock, A. C. (2014). a self-regulation intervention. Early Childhood Research Quarterly, 1–12. https://doi.org/10.1016/j.ecresq.2014.08.001

Los estilos APA, Harvard, Vancouver, ISO, etc.

27

Kiriy, Daria, Dmitry Tychinin, Nikita Kotlov, Olga Kudryashova, Anastasia Nikitina, Andrey Tyshevich, Naira Samarina et al. "Abstract 3823: Viral transcript and tumor immune microenvironment-based transcriptomic profiling of HPV-associated head and neck cancer identifies subtypes associated with prognosis". Cancer Research 82, n.º 12_Supplement (15 de junio de 2022): 3823. http://dx.doi.org/10.1158/1538-7445.am2022-3823.

Texto completo

Resumen

Abstract Human papillomavirus (HPV)-associated Head and Neck Squamous Cell Carcinoma (HPV+HNSCC) is now the most common HPV-associated malignancy in the United States. Current treatments can be associated with severe side-effects or lack of efficacy yet prognostic biomarkers are limited, slowing efforts to personalize treatment in HPV+HNSCC. Here, we describe the use of a transcriptomic-based analytical platform to analyze expression patterns of viral transcripts, the tumor microenvironment (TME), and viral genome integration, and associate these features with overall survival. Functional gene expression signatures were analyzed on publicly available HPV+HNSCC expression data (n=266). Unsupervised clustering analysis revealed 5 distinct and novel TME types across patients (immune-enriched non-fibrotic, immune-enriched fibrotic, fibrotic, immune-desert, immune-enriched luminal). These microenvironment subtypes were highly correlated with both overall survival and patient prognosis. Tumors with an immune-enriched microenvironment showed the highest survival rates, whereas fibrotic TME types were associated with poor survival (p < 0.05). Unsupervised clustering of a HPV+HNSCC cohort from The Cancer Genome Atlas (TCGA) (n=53), based on HPV transcript expression, revealed 4 HPV-related subtypes. Each subtype was enriched for distinct viral transcripts: E2/E5, E6/E7, E1/E4 and L1/L2. We then validated TME and HPV transcript-related classifications on an independent HPV+HNSCC cohort (n=132). Utilizing both viral transcript and TME subtypes, we found that the E2/E5 HPV subtype was associated with an immune-enriched TME and had a higher overall survival compared to the other subtypes. The E2/E5 subtype was also enriched for samples without HPV-genome integration, suggesting that HPV episomal DNA status and E2/E5 expression pattern may drive an inflamed microenvironment and improved prognosis. In contrast, E6/E7 subtype samples were associated with the fibrotic and depleted TME types, with lower values of T-cell and B-cell gene expression signatures and a lower survival rate. Both E1/E4 and L1/L2 subtypes were associated with the immune-enriched luminal TME types. These findings suggest that HPV-transcript expression patterns may drive modulation of the TME, and hence impact prognosis. Further validation of the relationships between viral gene expression, TME, and prognosis is warranted to understand if such subtypes could aid in the development of prognostic biomarkers for treatment selection. Citation Format: Daria Kiriy, Dmitry Tychinin, Nikita Kotlov, Olga Kudryashova, Anastasia Nikitina, Andrey Tyshevich, Naira Samarina, Ksenia Demina, Sandrine Degryse, Susan Raju Paul, Mark Poznansky, Krystle Lang Kuhs, James S. Lewis, Robert L. Ferris, Xiaowei Wang, Alexander Bagaev, Nathan Fowler, Lori Wirth, Daniel Faden. Viral transcript and tumor immune microenvironment-based transcriptomic profiling of HPV-associated head and neck cancer identifies subtypes associated with prognosis [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2022; 2022 Apr 8-13. Philadelphia (PA): AACR; Cancer Res 2022;82(12_Suppl):Abstract nr 3823.

Los estilos APA, Harvard, Vancouver, ISO, etc.

28

Koteska, Jasna y Anastazija Kirkova-Naskova. "Sanitary Enigma". Identities: Journal for Politics, Gender and Culture 3, n.º 1 (1 de enero de 2004): 107–32. http://dx.doi.org/10.51151/identities.v3i1.114.

Texto completo

Resumen

Author(s): Jasna Koteska | Јасна Котеска Title (English): Sanitary Enigma Title (Macedonian): Санитарна енигма Translated by (Macedonian to English): Anastazija Kirkova-Naskova | Анастазија Киркова-Наскова Journal Reference: Identities: Journal for Politics, Gender and Culture, Vol. 3, No. 1 (Summer 2004) Publisher: Research Center in Gender Studies - Skopje and Euro-Balkan Institute Page Range: 107-132 Page Count: 25 Citation (English): Jasna Koteska, “Sanitary Enigma,” translated from the Macedonian by Anastazija Kirkova-Naskova, Identities: Journal for Politics, Gender and Culture, Vol. 3, No. 1 (Summer 2004): 107-132. Citation (Macedonian): Јасна Котеска, „Санитарна енигма“, Идентитети: списание за политика, род и култура, т. 3, бр. 1 (лето 2004): 107-132.

Los estilos APA, Harvard, Vancouver, ISO, etc.

29

Anastasova, Senka. "Decentring Identity (Cultural, Political, Gender Identity in The Museum of Unconditional Surrender by Dubravka Ugrešić)". Identities: Journal for Politics, Gender and Culture 6, n.º 2-3 (1 de junio de 2007): 295–314. http://dx.doi.org/10.51151/identities.v6i2-3.222.

Texto completo

Resumen

Author(s): Senka Anastasova | Сенка Анастасова Title (English): Decentring Identity (Cultural, Political, Gender Identity in The Museum of Unconditional Surrender by Dubravka Ugrešić) Title (Macedonian): Децентрирање на идентитетот (културен, политички, родов идентитет во Музејот на безусловното предавање од Дубравка Угрешиќ) Translated by (Macedonian to English): Senka Anastasova | Сенка Анастасова Journal Reference: Identities: Journal for Politics, Gender and Culture, Vol. 6, No. 2-3 (Summer 2007 - Winter 2008) Publisher: Research Center in Gender Studies - Skopje and Euro-Balkan Institute Page Range: 295-314 Page Count: 20 Citation (English): Senka Anastasova, “Decentring Identity (Cultural, Political, Gender Identity in The Museum of Unconditional Surrender by Dubravka Ugrešić),” Identities: Journal for Politics, Gender and Culture, Vol. 6, No. 2-3 (Summer 2007 - Winter 2008): 295-314. Citation (Macedonian): Сенка Анастасова, „Децентрирање на идентитетот (културен, политички, родов идентитет во Музејот на безусловното предавање од Дубравка Угрешиќ)“, Идентитети: списание за политика, род и култура, т. 6, бр. 2-3 (лето 2007 - зима 2008): 295-314.

Los estilos APA, Harvard, Vancouver, ISO, etc.

30

Dewi Wulansari, Maria Ariadne y Dimas Wihardyanto. "METODOLOGI PENILAIAN KUALITAS HUNIAN PASKA BENCANA SEBAGAI EVALUASI STRATEGI REKONSTRUKSI: ANALISIS FAKTUAL DAN PERSEPTUAL". LANGKAU BETANG: JURNAL ARSITEKTUR 4, n.º 2 (28 de diciembre de 2017): 89. http://dx.doi.org/10.26418/lantang.v4i2.23248.

Texto completo

Resumen

Salah satu target utama dalam rekonstruksi paska bencana ialah tersedianya hunian bagi korban bencana yang kehilangan tempat tinggalnya. Dalam pengadaan hunian paska bencana terdapat berbagai macam strategi rekonstruksi. Pada penelitian ini dibahas mengenai kemungkinan menggunakan penilaian kualitas hunian sebagai alat untuk melakukan evaluasi terhadap strategi rekonstruksi. Metode penilaian kualitas hunian baik secara faktual maupun perseptual dipaparkan sebagai pengantar, kemudian disajikan perbandingan dari beberapa penelitian terdahulu mengenai kualitas hunian paska bencana. Dari penelitian ini, disimpulkan bahwa penilaian kualitas hunian paska bencana merupakan cara yang efektif untuk melakukan evaluasi terhadap strategi rekonstruksi. Penilaian kualitas hunian paska bencana itu sendiri dapat menggunakan pendekatan faktual, perseptional, maupun perpaduan keduanya, sesuai dengan obyek pengamatan yang dipilih.Kata-kata Kunci: kualitas hunian, paska bencana, analisis faktual, analisis perseptual SCORING METHOD OF THE QUALITY OF POST DISASTER HOUSING AS RECONSTRUCTION STRATEGY’S EVALUATION : FACTUAL AND PERCEPTUAL ANALYSIS APPROACHOne of post disaster recontruction’s main targets is providing proper housing for the victims who lost their homes. In post-disaster housing procurement there are various reconstruction strategies. This research discusses about ability to rate the quality of housing in evaluating the reconstruction strategy. Scoring method of the quality of housing, factually or perceptually, both are explained as preface. And then comparation of previous study about the quality of post disaster housing is discussed. From this research it learned that scoring of the quality of post disaster housing is an effective way to evaluate the reconstruction strategy. The scoring method of the quality of post disaster housing itself, can be seen from different approaches, the factual analysis approach, the perceptual analysis approach, or both, depends on the chosen study object.Keywords: quality of housing, post disaster, factual analysis, perceptual analysisREFERENCESAl-Hussaini, T. M., Seraj, S. M., Islam, M. K., Safiullah, A. M. M., Choudhury, J. R. (1999). A Methodology For Selection Of Post Disaster Shelter. H&H Dhaka99Batchelor, Victoria. (2011). Tarpaulins, transitional shelter or permanent houses : how does the shelter assistance provide affect the recovery of communities after disaster? Dissertation on Oxford Brookes UniversityCollins, Sam. Corsellis, Tom. Vitale, Antonella. (2010).Transitional Shelter: Understanding Shelter from The Emergency Through Reconstruction and Beyond. ALNAP. Diakses melalui www.sheltercenter.orgDola, K. and Parva, M. (2012). Transformation Of Earthquake Disaster Victims’ Shelter Into Sustainable Home: The Case Of Lar City, Iran. ALAM CIPTA, International Journal of Sustainable Tropical Design Research and Practice. Universiti Putra Malaysia. Volume 5 (2) December 2012Kamel, Nabil M. O. and Loukaitou-Sideris, Anastasia (2003). Residential Assistance and Recovery Following the Northridge Earthquake. Urban Studies, Vol. 41, No. 3, 533–562, March 2004.Kwanda, T., Rahardjo, J., Wardhani, M.K. (2001). Analisis Kepuasan Penghuni Perumahan Sederhana di Denpasar Berdasarkan Faktor Lokasi, Prasarana, Sarana, Kualitas Bangunan, Desain dan Harga. Dimensi Teknik Arsitektur Vol. 29, No. 2, Desember 2001: 117 – 125.Leon, E., Kelman, I., Kennedy, J., and Ashmore,J. (2009). Capacity Building Lessons From A Decade Of Transitional Settlement And Shelter. International Journal Of Strategic Property Management (2009) 13, 247–265Önder, D. E., Köseoğlu, E., Bġlen, Ö. (2010). The Effect Of User Participation In Satisfaction: Beyciler After-Earthquake Houses In Düzce. Itu A|ZPamungkas, H.B.E, Harianto, F. (2012). Analisis Kualitas Perumahan Mutiara Regency Sidoarjo. Jurnal IPTEK Vol 16 No.1 Mei 2012Ratnayake R.M.G.D., Rameezdeen, Raufdeen. (2008).Post Disaster Housing Reconstruction: Comparative Study Of Donor Driven Vs. Owner Driven Approach. International Conference on Building Education and Research (BEAR)Rini, Johanita Anggia. (2012). Evaluasi Penerapan Prinsip Tahan Gempa pada Renovasi atau Rekonstruksi Rumah Pasca Gempa 2006 di Yogyakarta. Tesis Magister, Institut Teknologi Bandung.Saleh, Sakhrul Dachlan. (2010). Kajian Kualitas Bangunan Rumah Pondokan Terhadap Kenyamanan Huni Berdasarkan Persepsi Penghuni di Permukiman Sekitar Kampus Universitas Hasanuddin. Masters Thesis, Universitas Diponegoro.Samaddar, S., Okada, N. (2006). Participatory Approach for Post-Earthquake Reconstruction in the Villages of Kachchh, India. Annuals of Disas. Prev. Res. Inst., Kyoto Univ., No. 49 B, 2006

Los estilos APA, Harvard, Vancouver, ISO, etc.

31

Dewi Wulansari, Maria Ariadne y Dimas Wihardyanto. "METODOLOGI PENILAIAN KUALITAS HUNIAN PASKA BENCANA SEBAGAI EVALUASI STRATEGI REKONSTRUKSI: ANALISIS FAKTUAL DAN PERSEPTUAL". LANGKAU BETANG: JURNAL ARSITEKTUR 4, n.º 2 (28 de diciembre de 2017): 89. http://dx.doi.org/10.26418/lantang.v4i2.23272.

Texto completo

Resumen

Salah satu target utama dalam rekonstruksi paska bencana ialah tersedianya hunian bagi korban bencana yang kehilangan tempat tinggalnya. Dalam pengadaan hunian paska bencana terdapat berbagai macam strategi rekonstruksi. Pada penelitian ini dibahas mengenai kemungkinan menggunakan penilaian kualitas hunian sebagai alat untuk melakukan evaluasi terhadap strategi rekonstruksi. Metode penilaian kualitas hunian baik secara faktual maupun perseptual dipaparkan sebagai pengantar, kemudian disajikan perbandingan dari beberapa penelitian terdahulu mengenai kualitas hunian paska bencana. Dari penelitian ini, disimpulkan bahwa penilaian kualitas hunian paska bencana merupakan cara yang efektif untuk melakukan evaluasi terhadap strategi rekonstruksi. Penilaian kualitas hunian paska bencana itu sendiri dapat menggunakan pendekatan faktual, perseptional, maupun perpaduan keduanya, sesuai dengan obyek pengamatan yang dipilih.Kata-kata Kunci: kualitas hunian, paska bencana, analisis faktual, analisis perseptual SCORING METHOD OF THE QUALITY OF POST DISASTER HOUSING AS RECONSTRUCTION STRATEGY’S EVALUATION : FACTUAL AND PERCEPTUAL ANALYSIS APPROACHOne of post disaster recontruction’s main targets is providing proper housing for the victims who lost their homes. In post-disaster housing procurement there are various reconstruction strategies. This research discusses about ability to rate the quality of housing in evaluating the reconstruction strategy. Scoring method of the quality of housing, factually or perceptually, both are explained as preface. And then comparation of previous study about the quality of post disaster housing is discussed. From this research it learned that scoring of the quality of post disaster housing is an effective way to evaluate the reconstruction strategy. The scoring method of the quality of post disaster housing itself, can be seen from different approaches, the factual analysis approach, the perceptual analysis approach, or both, depends on the chosen study object.Keywords: quality of housing, post disaster, factual analysis, perceptual analysisREFERENCESAl-Hussaini, T. M., Seraj, S. M., Islam, M. K., Safiullah, A. M. M., Choudhury, J. R. (1999). A Methodology For Selection Of Post Disaster Shelter. H&H Dhaka99Batchelor, Victoria. (2011). Tarpaulins, transitional shelter or permanent houses : how does the shelter assistance provide affect the recovery of communities after disaster? Dissertation on Oxford Brookes UniversityCollins, Sam. Corsellis, Tom. Vitale, Antonella. (2010).Transitional Shelter: Understanding Shelter from The Emergency Through Reconstruction and Beyond. ALNAP. Diakses melalui www.sheltercenter.orgDola, K. and Parva, M. (2012). Transformation Of Earthquake Disaster Victims’ Shelter Into Sustainable Home: The Case Of Lar City, Iran. ALAM CIPTA, International Journal of Sustainable Tropical Design Research and Practice. Universiti Putra Malaysia. Volume 5 (2) December 2012Kamel, Nabil M. O. and Loukaitou-Sideris, Anastasia (2003). Residential Assistance and Recovery Following the Northridge Earthquake. Urban Studies, Vol. 41, No. 3, 533–562, March 2004.Kwanda, T., Rahardjo, J., Wardhani, M.K. (2001). Analisis Kepuasan Penghuni Perumahan Sederhana di Denpasar Berdasarkan Faktor Lokasi, Prasarana, Sarana, Kualitas Bangunan, Desain dan Harga. Dimensi Teknik Arsitektur Vol. 29, No. 2, Desember 2001: 117 – 125.Leon, E., Kelman, I., Kennedy, J., and Ashmore,J. (2009). Capacity Building Lessons From A Decade Of Transitional Settlement And Shelter. International Journal Of Strategic Property Management (2009) 13, 247–265Önder, D. E., Köseoğlu, E., Bġlen, Ö. (2010). The Effect Of User Participation In Satisfaction: Beyciler After-Earthquake Houses In Düzce. Itu A|ZPamungkas, H.B.E, Harianto, F. (2012). Analisis Kualitas Perumahan Mutiara Regency Sidoarjo. Jurnal IPTEK Vol 16 No.1 Mei 2012Ratnayake R.M.G.D., Rameezdeen, Raufdeen. (2008).Post Disaster Housing Reconstruction: Comparative Study Of Donor Driven Vs. Owner Driven Approach. International Conference on Building Education and Research (BEAR)Rini, Johanita Anggia. (2012). Evaluasi Penerapan Prinsip Tahan Gempa pada Renovasi atau Rekonstruksi Rumah Pasca Gempa 2006 di Yogyakarta. Tesis Magister, Institut Teknologi Bandung.Saleh, Sakhrul Dachlan. (2010). Kajian Kualitas Bangunan Rumah Pondokan Terhadap Kenyamanan Huni Berdasarkan Persepsi Penghuni di Permukiman Sekitar Kampus Universitas Hasanuddin. Masters Thesis, Universitas Diponegoro.Samaddar, S., Okada, N. (2006). Participatory Approach for Post-Earthquake Reconstruction in the Villages of Kachchh, India. Annuals of Disas. Prev. Res. Inst., Kyoto Univ., No. 49 B, 2006

Los estilos APA, Harvard, Vancouver, ISO, etc.

32

Šeleva, Elizabeta y Anastazija Kirkova. "Border Cultures / Cultures at the Border". Identities: Journal for Politics, Gender and Culture 2, n.º 1 (1 de enero de 2003): 123–39. http://dx.doi.org/10.51151/identities.v2i1.92.

Texto completo

Resumen

Author(s): Elizabeta Šeleva | Елизабета Шелева Title (English): Border Cultures / Cultures at the Border Title (Macedonian): Гранични култури / култури на границата Translated by (Macedonian to English): Anastazija Kirkova | Анастазија Киркова Journal Reference: Identities: Journal for Politics, Gender and Culture, Vol. 2, No. 1 (Summer 2003) Publisher: Research Center in Gender Studies - Skopje and Euro-Balkan Institute Page Range: 123-139 Page Count: 16 Citation (English): Elizabeta Šeleva, “Border Cultures / Cultures at the Border,” translated from the Macedonian by Anastazija Kirkova, Identities: Journal for Politics, Gender and Culture, Vol. 2, No. 1 (Summer 2003): 123-139. Citation (Macedonian): Елизабета Шелева, „Гранични култури / култури на границата“, Идентитети: списание за политика, род и култура, т. 2, бр. 1 (лето 2003): 123-139.

Los estilos APA, Harvard, Vancouver, ISO, etc.

33

Verginadis, Ioannis I., Harris Avgousti, Kyle Kim, Giorgos Skoufos, Frank Chinga, Nektaria Maria Leli, Ilias V. Karagounis et al. "Abstract 3178: A stromal integrated stress response activates perivascular cancer-associated fibroblasts to drive angiogenesis and tumor progression". Cancer Research 82, n.º 12_Supplement (15 de junio de 2022): 3178. http://dx.doi.org/10.1158/1538-7445.am2022-3178.

Texto completo

Resumen

Abstract Despite recent advances in prevention and treatment, including immune checkpoint inhibitors, malignant melanoma remains a particularly aggressive and deadly malignancy, which is partly attributed to its highly heterogeneous TME. However, malignant cells exhibit altered signaling pathways, which enables them to adapt to both cell-intrinsic and extrinsic stressors within TME. The activating transcription factor 4 (ATF4) is a master transcriptional effector of the Integrated Stress Response (ISR), a homeostatic mechanism coupling cell growth and survival to bioenergetic demands. We and others have established a critical tumor cell-intrinsic role of ATF4 which culminates in the promotion of primary tumor growth and in the establishment of micro- and macro-metastases in xenograft, allograft and transgenic models. However, the potential roles of the ISR and particularly of ATF4-mediated responses in host-dependent, tumor-related processes, have not been yet extensively investigated. Using novel conditional knockout ATF4 mouse models, we show that global loss of host ATF4 results in deficient tumor vascularization and a pronounced tumor growth delay in syngeneic melanoma and pancreatic tumor models. Immunofluorescence analysis revealed a severely impaired angiogenic phenotype in tumors grown in ATF4 KO mice which was accompanied by deficiencies in markers of CAF activation. Single-cell transcriptomic analysis of B16F10 melanoma tumors further localized this defect to a distinct CAF population, previously identified as vascular CAFs (vCAFs), and revealed a significant reduction in the expression of extracellular matrix components, primarily type I collagen, in tumors grown in ATF4 KO mice. Intriguingly, we identified a multifaceted impairment of the collagen biosynthetic pathway with the ATF4 to directly regulate the expression of the Col1a1 gene as well as the intracellular levels of glycine and proline, the major amino acids comprising collagen fibers. Moreover, we showed that the ATF4-deficient vCAFs secrete significantly lower levels of angiogenic factors (i.e., VEGF, SDF-1 etc.) in the perivascular area leading to an abnormal angiogenesis and significant attenuation of tumor growth. Specific deletion of ATF4 in the fibroblast compartment (Col1a1 promoter) produced a similar tumor growth delay as in the global ATF4 KO mice, and notably, co-injection of fibroblasts from ATF4-proficient mice led to significant recovery of tumor growth rates in ATF4-deficient mice. Finally, analysis of human melanoma and pancreatic tumor samples revealed a strong correlation between ATF4 and collagen levels and between an ISR gene signature and expression of collagen and CAF activation genes. Our findings uncover a novel role of stromal ATF4 in shaping CAF functionality, a key driver of disease progression, metastasis, and therapy resistance. Citation Format: Ioannis I. Verginadis, Harris Avgousti, Kyle Kim, Giorgos Skoufos, Frank Chinga, Nektaria Maria Leli, Ilias V. Karagounis, Brett I. Bell, Anastasia Velalopoulou, Victoria S. Wu, Yang Li, Jiangbin Ye, David A. Scott, Andrei L. Osterman, Arjun Sengupta, Aalim Weljie, Artemis G. Hatzigeorgiou, Sandra Ryeom, Alan J. Diehl, Serge Y. Fuchs, Ellen Puré, Constantinos Koumenis. A stromal integrated stress response activates perivascular cancer-associated fibroblasts to drive angiogenesis and tumor progression [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2022; 2022 Apr 8-13. Philadelphia (PA): AACR; Cancer Res 2022;82(12_Suppl):Abstract nr 3178.

Los estilos APA, Harvard, Vancouver, ISO, etc.

34

Anastasova, Senka y Xhabir Ahmeti. "Чиста Дана. Кон Јасна Котеска, Санитарна енигма". Identities: Journal for Politics, Gender and Culture 7, n.º 1-2 (1 de enero de 2008): 235–50. http://dx.doi.org/10.51151/identities.v7i1-2.234.

Texto completo

Resumen

Author(s): Senka Anastasova | Сенка Анастасова Title (Macedonian): Чиста Дана. Кон Јасна Котеска, Санитарна енигма Title (Albanian): Danës së pastër. Për Јасна Котеска, Санитарна енигма Translated by (Macedonian to Albanian): Xhabir Ahmeti Journal Reference: Identities: Journal for Politics, Gender and Culture, Vol. 7, No. 1-2 (Summer 2008 - Winter 2009) Publisher: Research Center in Gender Studies - Skopje and Euro-Balkan Institute Page Range: 235-250 Page Count: 16 Citation (Macedonian): Сенка Анастасова, „Чиста Дана. Кон Јасна Котеска, Санитарна енигма“, Идентитети: списание за политика, род и култура, т. 7, бр. 1-2 (лето 2008 - зима 2009): 235-250. Citation (Albanian): Senka Anastasova, „Danës së pastër. Për Јасна Котеска, Санитарна енигма“, përkthim nga Maqedonishtja Xhabir Ahmeti, Journal for Politics, Gender and Culture, Vol. 7, No. 1-2 (Summer 2008 - Winter 2009): 235-250.

Los estilos APA, Harvard, Vancouver, ISO, etc.

35

Hammond, J., D. Bampi y M. D. Reinsel. "First Report of Plantago asiatica mosaic virus in Imported Asiatic and Oriental Lilies (Lilium hybrids) in the United States". Plant Disease 99, n.º 2 (febrero de 2015): 292. http://dx.doi.org/10.1094/pdis-08-14-0792-pdn.

Texto completo

Resumen

Asiatic and Oriental hybrid lilies (Lilium sp., Liliaceae) are bulbous ornamentals valued for their flowers. Bulbs of several varieties of each lily type, imported from the Netherlands, were purchased in spring 2013 from retail nurseries and grown in a cool greenhouse; additional bulbs were obtained in 2014. After flowering in 2013, but prior to leaf senescence, necrotic streaking was observed in midstem leaves of several plants. RNA extracted from leaves of several individual plants was subjected to reverse-transcription–polymerase chain reaction (RT-PCR) assay using NSNC-odT primed cDNA and PCR with primers PxDeg/BNSNC or potyS/BNSNC to amplify potexvirus/carlavirus and potyvirus products respectively (2,3,4). Sequencing of a c. 1.7-kb PCR product from one lily identified Lily symptomless virus (LSV). Mechanical inoculation of pooled lily leaf samples to Nicotiana benthamiana, N. glutinosa, and Chenopodium quinoa (not hosts of LSV) yielded chlorotic or necrotic local lesions on C. quinoa and systemic mosaic with necrotic spotting, streaking, or apical necrosis on N. benthamiana; electron microscopy revealed potexvirus-like flexuous particles. RT-PCR from C. quinoa and N. benthamiana with PxDeg/BNSNC yielded a c. 1.3-kb product, which was cloned and sequenced; the consensus sequence (KM205357) had 98.7% nucleotide identity to a Dutch isolate of Plantago asiatica mosaic virus (PlAMV, KF471012; 78.5 to 87.8% to other isolates), and 99.0% coat protein amino acid identity to KF471012 (88.9 to 93.2% to other isolates). The 2013 lilies were stored overwinter at 4°C, and RNA was extracted from roots of individual bulbs. Primers PlAMV CP-F2 (TTCGTCACCCTCAGCGG) and PlAMV CP-R3 (AAACGGTAAAATACACACCGGG) were designed based on alignment of KM205357 with all PlAMV sequences available in GenBank. RT-PCR using PlAMV CP-F2/CP-R3 yielded products of the expected 511 bp from 20 bulbs and no product from a no-template control. ELISA of root and bulbscale samples using PlAMV-lily specific antibody and conjugate (a gift of R. Miglino, BKD, The Netherlands) confirmed PlAMV in seven of 20 bulbs positive by RT-PCR. Bioassay of PCR-positive lilies on N. benthamiana, C. quinoa, and Tetragonia expansa confirmed infection in three out of eight by both symptoms and ELISA. Altogether nine out of 13 Asiatic lilies (four of four cultivars: America, Connecticut King, Grand Cru, and Pink Pixie) and 11 Oriental lilies (cvs. Stargazer and Starfighter) were found to be infected with PlAMV by RT-PCR, of which seven were confirmed by bioassay and/or ELISA. Bulbs obtained in 2014 were tested only by ELISA; five of 18 Asiatic lilies (three of six cultivars: Connecticut King, Crimson Pixie, and Yellow Electric) and three of 13 Oriental lilies (three of six cultivars: Anastasia, Casa Blanca, and Garden Party) were found to be infected. PlAMV was reported in lilies in the Netherlands in 2010, with losses of up to 80% in greenhouse cut-flower production (1). The Nandina mosaic isolate (PlAMV-NMV) has been known in the United States since 1976 (5), but PlAMV infection of lily has not previously been documented in the United States. Both RT-PCR and ELISA tests also detected PlAMV-NMV. The degree of damage observed in the Netherlands suggests that growers should seek bulb stocks free of PlAMV. References: (1) Anonymous. https://www.vwa.nl/txmpub/files/?p_file_id=2001424 , accessed June 11, 2014. (2) S. Chen et al. Acta Biochim. Biophys. Sin. 43:465, 2011. (3) J. Hammond et al. Arch. Virol. 151:477, 2006. (4) J. Hammond and M. Reinsel. Acta Hort. 901:119, 2011. (5) P. Moreno et al. Proc. Am. Phytopathol. Soc. 3:319, 1976.

Los estilos APA, Harvard, Vancouver, ISO, etc.

36

Blagojević, Jelisaveta, Anastazija Kirkova y Tatjana Mitrevska. "I Тhink, Therefore I Think the Other: Derrida’s Poetics of Hospitality". Identities: Journal for Politics, Gender and Culture 3, n.º 2 (1 de junio de 2004): 223–35. http://dx.doi.org/10.51151/identities.v3i2.142.

Texto completo

Resumen

Author(s): Jelisaveta Blagojević | Јелисавета Благојевиќ Title (English): I Тhink, Therefore I Think the Other: Derrida’s Poetics of Hospitality Title (Macedonian): Мислам, значи, го мислам другото: Деридаовата поетика на гостоприемство Translated by (Serbian to English): Anastazija Kirkova | Анастазија Киркова Translated by (Serbian to Macedonian): Tatjana Mitrevska | Татјана Митревска Journal Reference: Identities: Journal for Politics, Gender and Culture, Vol. 3, No. 2 (Winter 2004) Publisher: Research Center in Gender Studies - Skopje and Euro-Balkan Institute Page Range: 223-235 Page Count: 12 Citation (English): Jelisaveta Blagojević, “I Тhink, Therefore I Think the Other: Derrida’s Poetics of Hospitality,” translated from the Serbian by Anastazija Kirkova, Identities: Journal for Politics, Gender and Culture, Vol. 3, No. 2 (Winter 2004): 223-235. Citation (Macedonian): Јелисавета Благојевиќ, „Мислам, значи, го мислам другото: Деридаовата поетика на гостоприемство“, превод од српски Татјана Митревска, Идентитети: списание за политика, род и култура, т. 3, бр. 2 (зима 2004): 223-235.

Los estilos APA, Harvard, Vancouver, ISO, etc.

37

Moreno Cuadro, Fernando. "El Zodiaco Teresiano de los Klauber". Boletín de Arte, n.º 30-31 (15 de marzo de 2018): 169–84. http://dx.doi.org/10.24310/bolarte.2010.v0i30-31.4370.

Texto completo

Resumen

La Vita S .V. et M. Theresiae á Jesu Solis Zodiaco Parallela de fray Anastasio de la Cruz, con grabados de los Klauber, es el colofón de las series dedicadas a popularizar la doctrina y obra de la reformadora descalza. Plantea una singular relación entre la trayectoria vital de la santa abulense y el Zodiaco con la finalidad de que las escenas elegidas estén presentes -como la presencia estelar de los Patriarcas- y sirvan de enseñanza -como la predicación de los Apóstoles- a quienes estaban dirigidas, fundamentalmente el Carmelo teresiano, a lo largo de los doce meses del año, coincidiendo con los signos zodiacales.

Los estilos APA, Harvard, Vancouver, ISO, etc.

38

Zhu, Xixuan, Hui Xiao, Elena López-Knowles, Milana A. Bergamino Sirvén, Anastasia Alataki, Perry Maxwell, Holly Tovey et al. "Abstract P2-03-08: Deconstructing the molecular characteristics of ER+ HER2+ early breast cancer in the POETIC trial using multiplex immunofluorescence and gene expression profiles". Cancer Research 83, n.º 5_Supplement (1 de marzo de 2023): P2–03–08—P2–03–08. http://dx.doi.org/10.1158/1538-7445.sabcs22-p2-03-08.

Texto completo

Resumen

Abstract Background: POETIC was a phase III clinical trial, with patients randomised 2:1 to 2-week perioperative aromatase inhibitor (POAI) vs control for postmenopausal women with oestrogen receptor positive (ER+) early breast cancer (BC) (Smith et al., Lancet Oncology 2020). Our previous study on POETIC trial patients with ER+ human epidermal growth factor receptor 2 positive (HER2+) BC suggested both HER2 enriched subtype (HER2-E) and immune enrichment pre-POAI (baseline, B) are main drivers of poor early response to POAI (Bergamino et al., 2022). However, some patients with HER2-E or immune enriched BC at B still showed good response to POAI. In this study, we aim to further investigate a sub-cohort of ER+ HER2+ BC from the POETIC trial, including a subset of aforementioned HER2-E tumours, to further explore the multi-modal molecular characteristics of the tumours resistant to POAI. Methods: Proliferation rate was assessed as percentage of cancer cells stained by Ki67. Patient POAI response was determined by Ki67 reduction at 2 weeks of treatment. A sub-cohort of 37 patients were selected based on response and classified as poor responders (PR, reduction < 30%, n=18), good responders (GR, reduction > 90%, n=11) and good responders with HER2-E BC at B (GR, reduction > 65%, n=8). Paired B and post-POAI (surgery, S) samples were taken from each patient of the sub-cohort. Multiplex immunofluorescence (mIF) was performed on these samples, measuring the immune cell densities in stroma and tumour compartments using five biomarkers: CD3 (all T cells), CD20 (B cells), CD68 (Macrophages), FOXP3 (regulatory T cells), and CD3 FOXP3 co-expression. The samples were also profiled using Breast Cancer 360TM (NanoString, BC360), covering the expressions of 758 genes and 46 biological signatures. Wilcoxon test, hierarchical clustering and spearman correlation test were performed to compare the tumour characteristics of GR and PR. Results: In this study, two B and four S samples were not achievable for mIF experiments due to low tumour content. At B (n = 35), among the five mIF biomarker measurements in stroma and tumour, only the stromal CD3 density was significantly different between GR (median = 0.0013) and PR (median = 0.0003, p = 0.041). In GR, HER2-E BC at B were separated into immune-high and immune-low groups with mIF biomarkers at B; the immune-high group was more likely to change into luminal subtypes post-POAI, while the immune-low group remained HER2-E. After POAI, the density changes in five mIF biomarkers in stroma and CD68 in tumour were all significantly higher in PR than GR (Table 1, n of paired samples = 62). The BC360 signatures of BC p53 (p < 0.001), BC proliferation (p < 0.001), LumB (p < 0.001) and HER2-E correlation coefficients (p < 0.001) were significantly downregulated in GR after POAI, while LumA correlation coefficients (p < 0.001) were notably increased. Conclusions: Our results suggest that for this sub-cohort, increased stromal immune response is associated with poor response to 2-week POAI in ER+ HER2+ early BC. HER2-E GR display visible immune heterogeneity at B. Lower-risk BC characteristics were exhibited in GR after the 2-week treatment. Further integrating mIF imaging data and additional digital spatial profiling are ongoing to reveal additional characteristics of ER+ HER2+ BC and tumour microenvironment predicting POAI resistance. Table 1: List of medians of log2 fold changes in mIF biomarker densities between GR and PR among the 62 paired samples, and Wilcoxon test p-values. Citation Format: Xixuan Zhu, Hui Xiao, Elena López-Knowles, Milana A. Bergamino Sirvén, Anastasia Alataki, Perry Maxwell, Holly Tovey, Lucy Kilburn, Chris Holcombe, Anthony Skene, Ian Smith, John Robertson, Katherine A Hoadley, Roberto Salgado, Judith Bliss, Nicholas Turner, Manuel Salto-Tellez, Gene Schuster, Mitch Dowsett, Maggie Chon U Cheang. Deconstructing the molecular characteristics of ER+ HER2+ early breast cancer in the POETIC trial using multiplex immunofluorescence and gene expression profiles [abstract]. In: Proceedings of the 2022 San Antonio Breast Cancer Symposium; 2022 Dec 6-10; San Antonio, TX. Philadelphia (PA): AACR; Cancer Res 2023;83(5 Suppl):Abstract nr P2-03-08.

Los estilos APA, Harvard, Vancouver, ISO, etc.

39

Binni, Lanfranco, Anastasija Gjurchinova y Saše Tasev. "Open Identities". Identities: Journal for Politics, Gender and Culture 1, n.º 2 (1 de enero de 2002): 167–69. http://dx.doi.org/10.51151/identities.v1i2.48.

Texto completo

Resumen

Author(s): Lanfranco Binni | Ланфранко Бини Title (English): Open Identities Title (Macedonian): Отворени идентитети Translated by (Italian to Macedonian): Anastasija Gjurchinova | Анастасија Ѓурчинова Translated by (Macedonian to English): Saše Tasev | Саше Тасев Journal Reference: Identities: Journal for Politics, Gender and Culture, Vol. 1, No. 2 (Winter 2002) Publisher: Research Center in Gender Studies - Skopje and Euro-Balkan Institute Page Range: 167-169 Page Count: 3 Citation (English): Lanfranco Binni, “Open Identities,” translated from the Macedonian by Saše Tasev, Identities: Journal for Politics, Gender and Culture, Vol. 1, No. 2 (Winter 2002): 167-169. Citation (Macedonian): Ланфранко Бини, „Отворени идентитети“, превод од италијански Анастасија Ѓурчинова Саше Тасев, Идентитети: списание за политика, род и култура, т. 1, бр. 2 (зима 2001): 167-169.

Los estilos APA, Harvard, Vancouver, ISO, etc.

40

Gnisci, Armando y Anastasija Gjurchinova. "Migrazione e letteratura (la stagione presente e viva)". Identities: Journal for Politics, Gender and Culture 3, n.º 1 (1 de enero de 2004): 135–57. http://dx.doi.org/10.51151/identities.v3i1.115.

Texto completo

Resumen

Author(s): Armando Gnisci | Арманди Њиши Title (Italian): Migrazione e letteratura (la stagione presente e viva) Title (Macedonian): Миграциите и литературата (сегашно и живо време) Translated by (Italian to Macedonian): Anastasija Gjurchinova | Анастасија Ѓурчинова Journal Reference: Identities: Journal for Politics, Gender and Culture, Vol. 3, No. 1 (Summer 2004) Publisher: Research Center in Gender Studies - Skopje and Euro-Balkan Institute Page Range: 135-157 Page Count: 22 Citation (Italian): Armando Gnisci, “Migrazione e letteratura (la stagione presente e viva),” Identities: Journal for Politics, Gender and Culture, Vol. 3, No. 1 (Summer 2004): 135-157. Citation (Macedonian): Армандо Њиши, „Миграциите и литературата (сегашно и живо време)“, превод од италијански Анастасија Ѓурчинова, Идентитети: списание за политика, род и култура, т. 3, бр. 1 (лето 2004): 135-157.

Los estilos APA, Harvard, Vancouver, ISO, etc.

41

Bucur, Maria, Alexandra Ghit, Ayşe Durakbaşa, Ivana Pantelić, Rochelle Goldberg Ruthchild, Elizabeth A. Wood, Anna Müller et al. "Book Reviews". Aspasia 14, n.º 1 (1 de marzo de 2020): 160–209. http://dx.doi.org/10.3167/asp.2020.140113.

Texto completo

Resumen

Cristina A. Bejan, Intellectuals and Fascism in Interwar Romania: The Criterion Association, Cham, Switzer land: Palgrave, 2019, 323 pp., €74.89 (hardback), ISBN 978-3-030-20164-7.Chiara Bonfiglioli, Women and Industry in the Balkans: The Rise and Fall of the Yugoslav Textile Sector, London: I. B. Tauris, 2020, 232 pp., £85 (hardback), ISBN: 978-1-78533-598-3.Aslı Davaz, Eşitsiz kız kardeşlik, uluslararası ve Ortadoğu kadın hareketleri, 1935 Kongresi ve Türk Kadın Birliği (Unequal sisterhood, international and Middle Eastern women’s movements, 1935 Congress and the Turkish Women’s Union), İstanbul: Türkiye İş Bankası, 2014, 892 pp., with an introduction by Yıldız Ecevit, pp. xxi–xxviii; preface by the author, pp. xxix–xlix, TL 42 (hardcover), ISBN: 978-605-332-296-2.Biljana Dojčinović and Ana Kolarić, eds., Feministički časopisi u Srbiji: Teorija, aktivizam i umetničke prakse u 1990-im i 2000-im (Feminist periodicals in Serbia: Theory, activism, and artistic practice in the 1990s and 2000s), Belgrade: Faculty of Philology, University of Belgrade, 2018, 370 pp., price not listed (paperback), ISBN: 978-86-6153-515-4.Melanie Ilic, ed., The Palgrave Handbook of Women and Gender in Twentieth-Century Russia and the Soviet Union, London: Palgrave Macmillan, 2018, 572 pp., $239 (e-book) ISBN: 978-1-137-54904-4; ISBN: 978-1-137-54905-1.Luciana M. Jinga, ed., The Other Half of Communism: Women’s Outlook, in History of Communism in Europe, vol. 8, Bucharest: Zeta Books, 2018, 348 pp., USD 40 (paperback), ISBN: 978-606-697-070-9.Teresa Kulawik and Zhanna Kravchenko, eds., Borderlands in European Gender Studies: Beyond the East-West Frontier, New York: Routledge, 2020, 264 pp., $140.00 (hardback), ISBN: 978-0-367-25896-2.Jill Massino, Ambiguous Transitions: Gender, the State, and Everyday Life in Socialist and Postsocialist Romania, New York: Berghahn Books, 2019, 466 pp., USD 122 (hardback), ISBN: 978-1-785-33598-3.Gergana Mircheva, (A)normalnost i dostap do publichnostta: Socialnoinstitucionalni prostranstva na biomedicinskite discursi v Bulgaria (1878–1939) ([Ab]normality and access to publicity: Social-institutional spaces of biomedicine discourses in Bulgaria [1878–1939]), Sofia: St. Kliment Ohridski University Press, 2018, 487 pp., BGN 16 (paperback), ISBN: 978-954-07-4474-2.Milutin A. Popović, Zatvorenice, album ženskog odeljenja Požarevačkog kaznenog zavoda sa statistikom (1898) (Prisoners, the album of the women’s section of Požarevac penitentiary with statistics, 1898), edited by Svetlana Tomić, Belgrade: Laguna , 2017, 333 pp., RSD 894 (paperback), ISBN: 978-86-521-2798-6.Irena Protassewicz, A Polish Woman’s Experience in World War II: Conflict, Deportation and Exile, edited by Hubert Zawadzki, with Meg Knott, translated by Hubert Zawadzki, London: Bloomsbury Academic, 2019, xxv pp. + 257 pp., £73.38 (hardback), ISBN: 978-1-3500-7992-2.Zilka Spahić Šiljak, ed., Bosanski labirint: Kultura, rod i liderstvo (Bosnian labyrinth: Culture, gender, and leadership), Sarajevo and Zagreb: TPO Fondacija and Buybook, 2019, xii + 213 pp., no price listed (paperback), ISBN: 978-9926-422-16-5.Gonda Van Steen, Adoption, Memory and Cold War Greece: Kid pro quo?, University of Michigan Press, 2019, 350 pp., $85.00 (hardback), ISBN: 978-0-472-13158-7.D imitra Vassiliadou, Ston tropiko tis grafi s: Oikogeneiakoi desmoi kai synaisthimata stin astiki Ellada (1850–1930) (The tropic of writing: Family ties and emotions in modern Greece [1850–1930]), Athens: Gutenberg, 2018, 291 pp., 16.00 € (paperback), ISBN: 978-960-01-1940-4.Radina Vučetić, Coca-Cola Socialism: Americanization of Yugoslav Culture in the Sixties, English translation by John K. Cox, Budapest: Central European University Press, 2018, 334 pp., €58.00 (paperback), ISBN: 978-963-386-200-1.Nancy M. Wingfield, The World of Prostitution in Late Imperial Austria, Oxford: Oxford University Press, 2017, xvi + 272 pp., $80 (hardback), ISBN: 978-0-19880-165-8.Anastasia Lakhtikova, Angela Brintlinger, and Irina Glushchenko, eds., Seasoned Socialism: Gender and Food in Late Soviet Everyday Life, Bloomington: Indiana University Press, 2019, xix + 373 pp., $68.41(hardback), ISBN: 978-0-253-04095-4.

Los estilos APA, Harvard, Vancouver, ISO, etc.

42

Istiningsih, Siti, Muhammad Fauzy y Khairun Nisa. "PENGGUNAAN MEDIA GAMBAR UNTUK MENINGKATKAN MOTIVASI BELAJAR MATEMATIKA PADA SISWA KELAS 1 SDN 1 KEDIRI TAHUN PELAJARAN 2017/2018". JKKP (Jurnal Kesejahteraan Keluarga dan Pendidikan) 5, n.º 1 (17 de abril de 2018): 31–41. http://dx.doi.org/10.21009/jkkp.051.04.

Texto completo

Resumen

Students' motivation in mathematics learning about addition and subtraction low. For that the research was conducted. The purpose of this paper is to increase the motivation to learn math on addition and subtraction with media images on first grade second semester students of SD Negeri 1 Kedri Year 2017/2018. To achieve these goals, researchers based on theories and concepts associated with increased motivation to learn math on addition and subtraction with media images. The studies of this class action through four stages: planning, implementation, observation and reflection conducted in two cycles. Subjects in this study were 25 students of class I Elementary School Kediri. The technique of collecting data through observation, inquiry and documentation Motivation Scale. Technical analysis of the data using descriptive analysis. The analysis showed that the students' motivation increases. In the initial conditions before using media images student motivation achievement of 27.97%. After using media images in the first cycle increased student motivation achievement is 50.63%. Because it has not achieved the expected researchers then followed the second cycle. In the second cycle students' achievement motivation increased to 80.85%. The achievement of students' achievement motivation from the first cycle to the second cycle increased by 30.22%. Based on the results of this study concluded that the media images can increase the motivation to learn mathematics of the addition and subtraction of first grade students at SDN 1 kediri Year 2017/2018. Keywords: motivation to learn, mathematics, media images. Abstrak Motivasi belajar siswa dalam pembelajaran matematika mengenai penjumlahan dan pengurangan rendah. Untuk itu penelitian ini dilaksanakan. Tujuan skripsi ini adalah untuk meningkatkan motivasi belajar matematika mengenai penjumlahan dan pengurangan dengan media gambar pada siswa kelas I semester genap SD Negeri 1 Kedri Tahun 2017/2018. Untuk mencapai tujuan tersebut, peneliti mendasarkan pada teori-teori dan pengertian yang terkait dengan peningkatan motivasi belajar matematika mengenai penjumlahan dan pengurangan dengan media gambar. Penilitian tindakan kelas ini melalui empat tahap yaitu perencanaan, pelaksanaan, pengamatan dan refleksi yang dilaksanakan dalam dua siklus. Subjek dalam penelitian ini adalah 25 siswa kelas I SD Negeri Kediri. Teknik pengumpulan data melalui observasi, Angket Skala Motivasi dan dokumentasi. Teknis analisis data menggunakan analisis Deskriptif. Hasil analisis menunjukkan bahwa motivasi belajar siswa meningkat. Pada kondisi awal sebelum menggunakan media gambar ketercapaian motivasi belajar siswa 27.97%. Setelah menggunakan media gambar pada siklus I ketercapaian motivasi belajar siswa meningkat yaitu 50.63%. Karena belum tercapai yang di harapkan peneliti maka dilanjutkan siklus II. Dalam siklus II ketercapaian motivasi belajar siswa meningkat menjadi 80.85%. Ketercapaian-ketercapaian motivasi belajar siswa dari siklus I ke siklus II meningkat 30.22 %. Berdasarkan hasil penelitian dapat disimpulkan bahwa dengan media gambar dapat meningkatkan motivasi belajar matematika mengenai penjumlahan dan pengurangan pada siswa kelas I SDN 1 kediri Tahun 2017/2018. Kata kunci : Motivasi belajar, pembelajaran matematika, media gambar. References Arief , Sadiman, dkk. 2013. Media pendidikan: pengertian, pengembangan, dan pemanfaatannya. PT Raja Grafindo Persada. Jakarta Arikunto, Suharsimi. 2014. Dasar-dasar Evaluasi Pendidikan. Aneka Cipta: Jakarta Arsyad, Azhar 2013. Media Pembelajaran. PT Raja Grafindo Persada : Jakarta Dimyanti .2013. Belajar dan Pembelajaran. Rineka Cipta : Jakarta Eman, Suherman, dkk. 2003 Strategi Pembelajaran Matematika Kontemporer. UPI Press : Jakarta Hamzah B. Uno. 2014, Teori Motivasi dan Pengukurannya, Analisis di Bidang Pendidikan. Bumi Aksara : Jakarta Hudoyo, Herman. 2001. Strategi belajar mengajar matematika. IKIP Malang : Malang Izzaty, Rita Eka .2008. Perkembangan Peserta Didik.UNYPress : Yogyakarta Permanarian S. dan Anastasia F. R. 2010 Peningkatan Kemampuan Membaca Permulaan pada Anak Tunarungu melalui Metode SAS dengan Animasi. E-Jurnal UPI: JASSI Anakku Vol. 9 No. 2 akses 13 januari 2017 Santrock, J.W. 2014. Psikologi Pendidikan (edisi kedua). (Penerj. Tri Wibowo B.S).Kencana : Jakarta Sardiman A.M. 2016. Interaksi dan Motivasi Belajar Mengajar. PT. Rajawali Pers: Jakarta Sutarto dan Syarifuddin. 2013. Desain pembelajaran Matematika.Penerbit Samudra Biru : Yogyakarta

Los estilos APA, Harvard, Vancouver, ISO, etc.

43

Anastasov, Tsvetelin. "Research Paper on Data-Driven Business Models: Why the Asia-Pacific Region Serves as an Example for the Western Companies? How Might they Improve Their Business Models in 5 Years?" International Journal of Trade, Economics and Finance 11, n.º 6 (diciembre de 2020): 169–76. http://dx.doi.org/10.18178/ijtef.2020.11.6.684.

Texto completo

Resumen

This article is an expansion of Anastasov, T.’s master’s thesis (2019) and attempts to give a clear definition and taxonomy of the Data-Driven Business Models (DDBMs) as well as illustrate data challenges and opportunities that come along with this. These definitions were cross-analyzed with 3 cases from the Asia-Pacific region to deliver concrete insights and inspiration for Western companies to reinvent their businesses in the next 5 years. A comparison between Data-Driven and Data-Centric models was given as well, not previously analyzed in the thesis, as a view on the current state-of-the-art data business models.

Los estilos APA, Harvard, Vancouver, ISO, etc.

44

RUEDA, J. L., J. URRA, S. GOFAS, N. LOPEZ-GONZALEZ, L. M. FERNANDEZ-SALAS y V. DIAZ-DEL-RIO. "New records of recently described chemosymbiotic bivalves for mud volcanoes within the European waters (Gulf of Cádiz)". Mediterranean Marine Science 13, n.º 2 (14 de septiembre de 2012): 262. http://dx.doi.org/10.12681/mms.307.

Texto completo

Resumen

Chemosymbiotic bivalves are important members of cold seep communities and information on their distribution in theEuropean waters is still quite scarce. This study reports the presence of living populations and shell remains of some recently described bivalves such as Lucinoma asapheus, Solemya elarraichensis and Acharax gadirae as well as Bathymodiolus sp. in the mud volcanoes of the Spanish Atlantic waters. Living populations of these species were thus far only found in Anastasya, Aveiro and Almazán mud volcanoes, together with other chemosymbiotic metazoa (Siboglinum spp.), suggesting the presence of moderate seepage activity. In other mud volcanoes (Albolote, Gazul), the benthic communities are dominated by sessile filter feeders on authigenic carbonates (chimneys, slabs) and only the shell remains of some chemosymbiotic bivalves were found, indicating earlier or very low seepage conditions. The present study elaborates on the known distribution of L. asapheus and S. elarraichensis to the European waters of the Gulf of Cádiz.

Los estilos APA, Harvard, Vancouver, ISO, etc.

45

Toprover, M., M. Mechlin, A. Slobodnick, V. C. Pike, C. Oh, C. Davis, T. Fields, F. Becce y M. H. Pillinger. "POS0134 INCREASED PREVALENCE OF LUMBAR SPINE MONOSODIUM URATE DEPOSITION AMONG GOUT PATIENTS ON DUAL-ENERGY CT". Annals of the Rheumatic Diseases 80, Suppl 1 (19 de mayo de 2021): 278.2–279. http://dx.doi.org/10.1136/annrheumdis-2021-eular.2733.

Texto completo

Resumen

Background:Gout affecting the spine is reported as a rare event presenting with neuropathy, spinal compression and acute back pain (1). Cases are often diagnosed by tissue confirmation of monosodium urate (MSU) deposition. The frequency of gout involving the spine asymptomatically or with milder, non-specific symptoms is likely higher than reported.Objectives:Using dual-energy CT (DECT), we are determining prevalence/extent of MSU deposition in the lumbosacral spines of patients with gout and tophaceous gout, compared to non-gout controls.Methods:We are recruiting 25 controls, 25 non-tophaceous and 25 tophaceous gout patients, 45-80 years old. Exclusion criteria include CPPD disease, RA, spondyloarthropathy or spinal malignancy. All gout subjects meet ACR gout classification criteria with entry serum urate (sU) of >6.8 mg/dL, or sU >6.0 mg/dL on ULT for <6 months. Demographics, gout history, Aberdeen back pain scale, sU, ESR, and CRP are collected. DECT of the lumbosacral spine is used to assess MSU deposition and osteoarthritic changes.Results:63 subjects are enrolled and analyzed to date (25 control, 23 non-tophaceous and 15 tophaceous gout). Control, non-tophaceous gout, and tophaceous gout subjects have similar mean age in years (controls 61.8±3.8, non-tophaceous 64.0±6.2, tophaceous 63.5±9.2, p=0.45), but differ in BMI (controls 28.3±6.5 kg/m2, non-tophaceous 32.1±6.7 kg/m2, tophaceous 29.1±4.3 kg/m2, p=0.01) and creatinine (controls 1.0±0.2 mg/dL, non-tophaceous 1.4±0.6 mg/dL, tophaceous 1.7±0.9 mg/dL, p=0.048). Mean sU and ESR are higher in gout subjects (sU-controls 5.3±1 mg/dL, non-tophaceous 8.3±1.4 mg/dL, tophaceous 8.4±2.0 mg/dL, p<0.05; ESR-controls 13.7±13.8 mm/h, non-tophaceous 25.2±18.7 mm/h, tophaceous 22.5±15.1 mm/h, p<0.05). Using default threshold settings for MSU visualization, greater MSU deposition is observed in the spine of gout patients (controls 2.2±1.2 cm3, non-tophaceous 4.5±4.3 cm3, tophaceous 8.5±12.5 cm3, p<0.05; Table 1). Reanalysis of several scans using narrower threshold settings to limit possible artifact confirms increased MSU signal among gout patients. Although many subjects in each group do not have excessive MSU deposition, deposition is more common in both gout groups. No subject demonstrated a frank spinal tophus.Conclusion:Based on preliminary results, gout patients have higher inflammatory markers and greater spinal MSU deposition than controls. Preliminary analyes with more stringent DECT threshold settings suggests these differences are not artifact, but analysis is ongoing. These data suggest that MSU deposition in the spine occurs in a subset of gout patients.References:[1]Toprover M, Krasnokutsky S, Pillinger MH. Gout in the Spine: Imaging, Diagnosis, and Outcomes. Curr Rheumatol Rep. 2015;17(12):70.Figure 1.DECT of the spine. (A) Patient with tophaceous gout (SU 8.9mg/dL, DECT volume 39.76cm3). (B) Control patient (SU 4.5mg/dL, DECT volume 0.70cm3).Table 1.Baseline characteristics and mean DECT deposition volumes. Bold font indicates statistical significance.CharacteristicControlNon-tophaceous GoutTophaceous GoutP-valueNumber of subjects252315Age in years, mean ± SD61.8 ± 3.864.0 ± 6.263.5 ± 9.20.45Male sex, n (%)23 (92.0)23 (100.0)13 (86.7)0.23Race:0.52 -White, n (%)18 (72.0)14 (60.9)7 (46.7) -Black, n (%)6(24.0)6 (26.1)6 (40.0) -Hispanic, n (%)1 (4.0)3 (13.0)2 (13.3)BMI, mean ± SD28.3 ± 6.532.1 ± 6.729.1 ± 4.30.01Chronic kidney disease, n (%)0 (0.0)6 (26.1)3 (20.0)0.03Diabetes mellitus type II, n (%)3 (12.0)5 (21.7)2 (13.3)0.62Hyperlipidemia, n (%)14 (56.0)15 (65.2)7 (46.7)0.52History of myocardial infarction, n (%)1 (4.0)2 (8.7)1 (6.7)0.80Mean sU, mg/dL ± SD5.31 ± 0.988.25 ± 1.48.42 ± 2.0<0.001Mean ESR, mm/hr ± SD (normal 0-10)13.7 ± 13.825.2 ± 18.722.53 ± 15.10.04Mean CRP, mg/L ± SD (normal 0-5)2.7 ± 4.77.6 ± 12.54.1 ± 5.00.13Mean serum creatinine, mg/dL ± SD0.97 ± 0.181.36 ± 0.581.70 ± 0.880.048Mean DECT volume, cm32.2 ± 1.24.5 ± 4.38.5 ± 12.5p<0.05Acknowledgements:Supported by an investigator-initiated grant from Horizon TherapeuticsDisclosure of Interests:Michael Toprover Consultant of: Horizon Pharmaceuticals, Michael Mechlin: None declared, Anastasia Slobodnick: None declared, Virginia C. Pike: None declared, Cheongeun Oh: None declared, Claudine Davis: None declared, Theodore Fields Consultant of: Horizon Pharmaceuticals, Avion Pharmaceuticals, Fabio Becce Consultant of: Horizon Therapeutics, Michael H. Pillinger Consultant of: Horizon Pharmaceuticals, Grant/research support from: Horizon Pharmaceuticals

Los estilos APA, Harvard, Vancouver, ISO, etc.

46

Miglena, Nikolchina y Anastazija Kirkova. "Questions of Immortality in a Fragment by Sappho". Identities: Journal for Politics, Gender and Culture 3, n.º 2 (1 de junio de 2004): 155–68. http://dx.doi.org/10.51151/identities.v3i2.139.

Texto completo

Resumen

Author(s): Miglena Nikolchina | Миглена Николчина Title (English): Questions of Immortality in a Fragment by Sappho Title (Macedonian): Прашања за бесмртноста во фрагмент од Сафо Translated by (English to Macedonian): Anastazija Kirkova | Анастазија Киркова Journal Reference: Identities: Journal for Politics, Gender and Culture, Vol. 3, No. 2 (Winter 2004) Publisher: Research Center in Gender Studies - Skopje and Euro-Balkan Institute Page Range: 155-168 Page Count: 13 Citation (English): Miglena Nikolchina, “Questions of Immortality in a Fragment by Sappho,” Identities: Journal for Politics, Gender and Culture, Vol. 3, No. 2 (Winter 2004): 155-168. Citation (Macedonian): Миглена Николчина, „Прашања за бесмртноста во фрагмент од Сафо“, превод од англиски Анастазија Киркова, Идентитети: списание за политика, род и култура, т. 3, бр. 2 (зима 2004): 155-168.

Los estilos APA, Harvard, Vancouver, ISO, etc.

47

Vedriš, Trpimir. "O podrijetlu i najranijem kultu zadarskog zaštitnika Sv. Krševana". Ars Adriatica, n.º 4 (1 de enero de 2014): 29. http://dx.doi.org/10.15291/ars.487.

Texto completo

Resumen

The article focuses on the unresolved issue of the historicity of St Chrysogonus (San Crisogono), an Aquileian martyr and the late medieval patron saint of Zadar. It explores the circumstances surrounding the emergence of his cult and the influence this had on the shaping of the hagiography pertaining to this saint. In an attempt to establish the chronological and geographical framework of how the cult of St Chrysogonus came to be and developed, the author assesses key primary sources and provides an overview of the scholarly literature on the cult of this saint in the Aquileian region between the early fourth and the mid-seventh century. Accepting the hypothesis that the earliest centre of the cult of St Chrysogonus was the Roman settlement Ad Aquas Gradatas (present day San Canzian d’Isonzo) in the immediate vicinity of Aquileia, the author examines the archaeological and epigraphic evidence with the aim of contextualizing the early cult of St Chrysogonus. The cult spread rapidly throughout northern Italy and, as a result, this Aquileian saint entered the canon of the Mass in the churches of Ravenna and Milan. In Rome, his cult and the associated hagiography emerged as a combination of the local tradition connected to the titulus Chrysogoni and the import of the cult from Aquileia. The introduction of the cult to Rome was commonly dated to c. 500, but recent hypotheses which argue for an earlier date of the compilation of the Passio S. Anastasiae might shed new light on the matter. The article also attempts to detect how the cult of St Chrysogonus was disseminated during the late antiquity and the early middle ages, and in doing so the author discusses the historicity of the local Zadar account according to which the relics were brought to Zadar from Grado in the mid-seventh century. Referring to the analogy between the earliest well-attested evidence of the cult of St Chrysogonus in Byzantine Zadar and in the neighbouring Croatian principality in the late ninth century, the paper examines the role of San Canzian d’Isonzo in the early medieval dissemination of the cult. In this context, the names of the Croatian princes and their attendants which were recorded in the so-called Cividale Gospels between the mid-ninth and late ninth century are interpreted as a reflection of, possibly, the earliest connection between the cult of St Chrysogonus and the newly formed Croatian elites.St Chrysogonus, San Canzian d’Isonzo, Martyrologium Hieronymianum, Passio S. Anastasiae, Passio Cantianorum.

Los estilos APA, Harvard, Vancouver, ISO, etc.

48

Stauffer, Jill, Judith Butler y Anastazija Kirkova. "Ethics of Non-violence: Interview with Judith Butler". Identities: Journal for Politics, Gender and Culture 2, n.º 1 (1 de enero de 2003): 27–57. http://dx.doi.org/10.51151/identities.v2i1.87.

Texto completo

Resumen

Author(s): Jill Stauffer and Judith Butler | Џил Стауфер и Џудит Батлер Title (English): Ethics of Non-violence: Interview with Judith Butler Title (Macedonian): Етиката на ненасилството: Интервју со Џудит Батлер Translated by (English to Macedonian): Anastazija Kirkova | Анастазија Киркова Journal Reference: Identities: Journal for Politics, Gender and Culture, Vol. 2, No. 1 (Summer 2003) Publisher: Research Center in Gender Studies - Skopje and Euro-Balkan Institute Page Range: 27-57 Page Count: 30 Citation (English): Jill Stauffer and Judith Butler, “Ethics of Non-violence: Interview with Judith Butler,” Identities: Journal for Politics, Gender and Culture, Vol. 2, No. 1 (Summer 2003): 27-57. Citation (Macedonian): Џил Стауфер и Џудит Батлер, „Етиката на ненасилството: Интервју со Џудит Батлер“, превод од англиски Анастазија Киркова, Идентитети: списание за политика, род и култура, т. 2, бр. 1 (лето 2003): 27-57.

Los estilos APA, Harvard, Vancouver, ISO, etc.

49

SIDOROV, DMITRY A., JOHN R. HOLSINGER y VADIM V. TAKHTEEV. "Two new species of the subterranean amphipod genus Stygobromus (Amphipoda: Crangonyctidae) from Siberia, with new data on Stygobromus pusillus (Martynov) and remarks on morphology and biogeographic relationships". Zootaxa 2478, n.º 1 (20 de mayo de 2010): 41. http://dx.doi.org/10.11646/zootaxa.2478.1.2.

Texto completo

Resumen

Two new species of the subterranean amphipod genus Stygobromus are described from groundwater habitats in Siberia: Stygobromus mikhaili n. sp. from a spring in the Central Altay Mountains and Stygobromus anastasiae n. sp. from two non-freezing springs in South Pribaikalye in the Irkutsk area. Additional taxonomic details of the previously described S. pusillus (Martynov) from Teletskoye Lake, also in Central Altay, are illustrated based on syntype material. Utilization of SEM has revealed a tiny structure on antenna 2 that appears to be a new character, and may prove useful in future analyses. Descriptions of the two new species raise the total number of described species in the genus Stygobromus to 134, but four or possibly five have been found in the Palearctic region outside North America. However, it is likely that continued exploration of subterranean groundwater habitats in Siberia and other parts of the Palearctic will reveal additional new species of Stygobromus and provide more insight into the origin and geographic distribution of this large, northern hemisphere, subterranean freshwater amphipod genus. Careful evaluation of taxonomic affinities of the new species and comparison with previously described congeners should provide further insight into the biogeographic history of Stygobromus.

Los estilos APA, Harvard, Vancouver, ISO, etc.

50

YAN, CHENG-JIN, CORNELIS VAN ACHTERBERG, JUN-HUA HE y XUE-XIN CHEN. "Review of the tribe Helconini Foerster s.s. from China, with the description of 18 new species". Zootaxa 4291, n.º 3 (13 de julio de 2017): 401. http://dx.doi.org/10.11646/zootaxa.4291.3.1.

Texto completo

Resumen

The Chinese species of the tribe Helconini Foerster, 1863 s.s. (Hymenoptera, Braconidae, Helconinae) are reviewed. The tribe Helconini Foerster and its genera are redefined and a key to the genera of the tribe is given. Gymnoscelus rufithorax Turner, 1918, is provisionally transferred to the genus Parahelcon Kokujev, 1901 (comb. nov.). The Chinese species belonging to the genera Acarohelcon gen. nov. (type species: Acarohelcon varicolor sp. nov.), Helcon Nees, 1812, Helconidea Viereck, 1914, and Wroughtonia Cameron, 1899 (including Spasskia Belokobylskij, 1989, syn. nov.), are keyed, described and illustrated. Eighteen new species are described from China: Acarohelcon. varicolor sp. nov., Helcon sulcatus sp. nov., Wroughtonia acuta sp. nov., W. albobasalis sp. nov., W. areolata sp. nov., W. bifurcata sp. nov., W. breviantennata sp. nov., W. brachygena sp. nov., W. chui sp. nov., W. eurygenys sp. nov., W. hei sp. nov., W. jiangliae sp. nov., W. nigrifemoralis sp. nov., W. obtusa sp. nov., W. rugosa sp. nov., W. varifemora sp. nov., W. yaanensis sp. nov., and W. zhejiangensis sp. nov., Four species are reported for the first time from China: Helconidea dentipes Tobias, 1967, Wroughtonia planidorsum Watanabe, 1952, W. sibirica (Tobias, 1967) and W. unicornis (Turner, 1918). Helcon albus Chou et Hsu, 1998, H. claviventris Wesmael, 1835, H. orientalis Shestakov, 1940, Helconidea nigra Tobias, 1967, H. sibirica Tobias, 1967, Spasskia anastasiae Belokobylskij, 1998, S. brevicarinata Yan et Chen, 2014, S. indica Singh, Belokobylskij et Chauhan, 2005, and S. sigalphoides Belokobylskij, 1989, are transferred to the genus Wroughtonia (comb. nov.) and Helconidea duplidentipes Shenefelt, 1970, is replaced by H. dentipes Tobias, 1967 (reinstated). Duportia cincticornis Kieffer, 1921, is synonymized with Wroughtonia unicornis (Turner, 1918) syn. nov.

Los estilos APA, Harvard, Vancouver, ISO, etc.

Artículos de revistas sobre el tema "S. anastasia"

Crea una cita precisa en los estilos APA, MLA, Chicago, Harvard y otros