Literatura académica sobre el tema "Platinum compounds Therapeutic use"
Crea una cita precisa en los estilos APA, MLA, Chicago, Harvard y otros
Consulte las listas temáticas de artículos, libros, tesis, actas de conferencias y otras fuentes académicas sobre el tema "Platinum compounds Therapeutic use".
Junto a cada fuente en la lista de referencias hay un botón "Agregar a la bibliografía". Pulsa este botón, y generaremos automáticamente la referencia bibliográfica para la obra elegida en el estilo de cita que necesites: APA, MLA, Harvard, Vancouver, Chicago, etc.
También puede descargar el texto completo de la publicación académica en formato pdf y leer en línea su resumen siempre que esté disponible en los metadatos.
Artículos de revistas sobre el tema "Platinum compounds Therapeutic use"
1
Xiao, Xiao, James Trevor Oswald, Ting Wang, Weina Zhang y Wenliang Li. "Use of Anticancer Platinum Compounds in Combination Therapies and Challenges in Drug Delivery". Current Medicinal Chemistry 27, n.º 18 (3 de junio de 2020): 3055–78. http://dx.doi.org/10.2174/0929867325666181105115849.
Texto completoResumen
As one of the leading and most important metal-based drugs, platinum-based pharmaceuticals are widely used in the treatment of solid malignancies. Despite significant side effects and acquired drug resistance have limited their clinical applications, platinum has shown strong inhibitory effects for a wide assortment of tumors. Drug delivery systems using emerging technologies such as liposomes, dendrimers, polymers, nanotubes and other nanocompositions, all show promise for the safe delivery of platinum-based compounds. Due to the specificity of nano-formulations; unwanted side-effects and drug resistance can be largely averted. In addition, combinational therapy has been shown to be an effective way to improve the efficacy of platinum based anti-tumor drugs. This review first introduces drug delivery systems used for platinum and combinational therapeutic delivery. Then we highlight some of the recent advances in the field of drug delivery for combinational therapy; specifically progress in leveraging the cytotoxic nature of platinum-based drugs, the combinational effect of other drugs with platinum, while evaluating the drug targeting, side effect reducing and sitespecific nature of nanotechnology-based delivery platforms.
2
Hassan Marouf, Bushra y Mayyadah Mahmood Ali. "Prevention and Management of Platinum Compounds-Induced Neurotoxicity". Al-Rafidain Journal of Medical Sciences ( ISSN: 2789-3219 ) 1 (22 de noviembre de 2021): 102–9. http://dx.doi.org/10.54133/ajms.v1i.43.
Texto completoResumen
Oncologists considered platinum-based medicines as potent cytotoxic agents. Despite their efficacy in combination chemotherapy regimens for many solid tumors, they have many substantial side effects that limit their use. There is no known prophylactic strategy for platinum drugs-induced neurotoxicity, which limit a therapeutic dose benefit. This review highlights the etiology of platinum-drugs-induced neuropathy, and covers the preventative and therapeutic options for cancer patients. It focuses on clinical studies conducted between 2010 and 2020. Loss of functional indications such as touch, vibration and joint location, as well as diminished or missing deep tendon reflexes in the upper and lower limbs are all markers of neurotoxicity. These side effects may last for months or years after treatment, lower quality of life, and creating a substantial survivorship issue. DNA damage, oxidative stress, mitochondrial dysfunction, dysregulation of intracellular signaling, impairment of voltage gated ion channel function, and neuro-inflammation have all been proposed as mechanisms for chemotherapy-induced peripheral neuropathy (CIPN). There are no proven pharmaceutical or nutritional therapies to prevent CIPN. Several anti-CIPN medications have been investigated, but either had no effect or had an effect in a limited sample study. Supportive care medications such anti-epileptics and antidepressants are used to treat CIPN.
3
Makovec, Tomaz. "Cisplatin and beyond: molecular mechanisms of action and drug resistance development in cancer chemotherapy". Radiology and Oncology 53, n.º 2 (28 de marzo de 2019): 148–58. http://dx.doi.org/10.2478/raon-2019-0018.
Texto completoResumen
AbstractBackgroundPlatinum-based anticancer drugs are widely used in the chemotherapy of human neoplasms. The major obstacle for the clinical use of this class of drugs is the development of resistance and toxicity. It is therefore very important to understand the chemical properties, transport and metabolic pathways and mechanism of actions of these compounds. There is a large body of evidence that therapeutic and toxic effects of platinum drugs on cells are not only a consequence of covalent adducts formation between platinum complexes and DNA but also with RNA and many proteins. These processes determine molecular mechanisms that underlie resistance to platinum drugs as well as their toxicity. Increased expression levels of various transporters and increased repair of platinum-DNA adducts are both considered as the most significant processes in the development of drug resistance. Functional genomics has an increasing role in predicting patients’ responses to platinum drugs. Genetic polymorphisms affecting these processes may play an important role and constitute the basis for individualized approach to cancer therapy. Similar processes may also influence therapeutic potential of nonplatinum metal compounds with anticancer activity.ConclusionsCisplatin is the most frequently used platinum based chemotherapeutic agent that is clinically proven to combat different types of cancers and sarcomas.
4
Jurgens, Sophie, Fritz E. Kuhn y Angela Casini. "Cyclometalated Complexes of Platinum and Gold with Biological Properties: State-of-the-Art and Future Perspectives". Current Medicinal Chemistry 25, n.º 4 (12 de febrero de 2018): 437–61. http://dx.doi.org/10.2174/0929867324666170529125229.
Texto completoResumen
Background: The inherent problems accompanying chemotherapy necessitate the development of new anticancer approaches. The development of compounds that can disrupt cancerous cellular machinery by novel mechanisms, via interactions with proteins and non-canonical DNA structures (e.g. G-quadruplexes), as well as by alteration of the intracellular redox balance, is nowadays focus of intense research. In this context, organometallic compounds of the noble metals Pt and Au have become prominent experimental therapeutic agents. This review provides an overview of the Pt(II) and Au(III) cyclometalated compounds with a chelating ring containing a strong C-M σ -bond to improve the stability of the compounds with respect to ligand exchange reactions and biological reduction. Furthermore, these properties can be easily tuned by modification of either the anionic cyclometalated or the ancillary ligands. Special focus has been set to C^N, C^N^C, C^N^N and C^N^S platinum(II) and gold(III) pincer complexes regarding their synthesis and biological mechanisms of action as anticancer agents. Methods: A structured search of both chemical and medicinal databases for peerreviewed research literature has been conducted. The quality of retrieved papers was appraised using standard tools. The synthesis as well as the chemical and biological properties of the described compounds were carefully reviewed and described. The findings were outlined using a conceptual framework. Results: In this review we included 155 papers, the majority originating from high-impact papers on the synthesis and biological modes of platinum(II) and gold(III) compounds. Among them, 17 papers were highlighted to give an introduction to the use of Pt and Au compounds with medicinal properties, mainly focussing on coordination compounds. The synthesis and medicinal properties of organometallic compounds of various metals (such as Fe, Ru, Ti) were outlined in 51 papers. These compounds included metallocenes, metallo- arenes, metallo-carbonyls, metallo-carbenes (e.g. N-heterocyclic carbenes), and alkynyl complexes. The C^N, C^N^C, C^N^N and C^N^S pincer complexes of platinum( II) (46 papers) and gold(III) (44 papers) were discussed concerning their synthesis, stability and advantages to develop therapeutic compounds. We strove to show the consistent development of C^N, C^N^C, C^N^N and C^N^S platinum(II) and gold(III) pincer complexes regarding their synthesis and biological modes from the early beginnings to the most recent findings. Conclusion: This review supplies a profound overview of the development of organometallic compounds for medicinal purposes, setting special focus to the synthesis and stability of C^N, C^N^C, C^N^N and C^N^S pincer complexes of platinum(II) and gold(III) and their use as anticancer agents.
5
Roszczenko, Piotr, Olga Klaudia Szewczyk, Robert Czarnomysy, Krzysztof Bielawski y Anna Bielawska. "Biosynthesized Gold, Silver, Palladium, Platinum, Copper, and Other Transition Metal Nanoparticles". Pharmaceutics 14, n.º 11 (25 de octubre de 2022): 2286. http://dx.doi.org/10.3390/pharmaceutics14112286.
Texto completoResumen
Nanomedicine is a potential provider of novel therapeutic and diagnostic routes of treatment. Considering the development of multidrug resistance in pathogenic bacteria and the commonness of cancer, novel approaches are being sought for the safe and efficient synthesis of new nanoparticles, which have multifaceted applications in medicine. Unfortunately, the chemical synthesis of nanoparticles raises justified environmental concerns. A significant problem in their widespread use is also the toxicity of compounds that maintain nanoparticle stability, which significantly limits their clinical use. An opportunity for their more extensive application is the utilization of plants, fungi, and bacteria for nanoparticle biosynthesis. Extracts from natural sources can reduce metal ions in nanoparticles and stabilize them with non-toxic extract components.
6
Wimberger, Pauline, Barbara Klink, Konrad Gruetzmann, Julian Puppe, Daniel Klotz, Evelin Schroeck, Jan Dominik Kuhlmann y Sarah Schott. "The activity of the conjugated antimetabolite 5-FdU-ECyd against platinum-resistant ovarian cancer." Journal of Clinical Oncology 35, n.º 15_suppl (20 de mayo de 2017): e17077-e17077. http://dx.doi.org/10.1200/jco.2017.35.15_suppl.e17077.
Texto completoResumen
e17077 Background: Primary or secondary resistance to platinum-based chemotherapy is an important clinical challenge in the treatment of ovarian cancer (OC) and limits survival. Therefore, the development of innovative drugs against platinum resistance is urgently needed. Our therapeutic concept is based on the conjugation of two chemotherapeutic compounds to a monotherapeutic pro-drug, which is taken up by cancer cells and is subsequently cleaved into several active cytostatic metabolites. Our in vitro study evaluates the effects of the conjugated antimetabolite 5-FdU-ECyd, consisting of 2-deoxy-5-fluorouridine (5-FdU) and ethynylcytidine (ECyd), on platinum-resistant OC cells. Methods: In vitro assays and RNA-Seq (Illumina) were applied for characterization of 5-FdU-ECyd treated platinum-sensitive A2780 and isogenic platinum-resistant A2780cis as well as independent platinum-resistant Skov-3-IP OC cells. Results: Nano molar 5-FdU-ECyd concentrations induced a rapid dose-dependent decline of cell viability in platinum-sensitive and platinum-resistant OC cells. The cytotoxicity of 5-FdU-ECyd was accompanied by the formation of DNA double strand breaks and by the induction of apoptosis, indicated by a strong increase of pro-apoptotic molecular markers (caspase-3/7 activation, PARP-cleavage). Moreover, 5-FdU-ECyd efficiently decreased cell migration of platinum-resistant OC cells and inhibited other tumor-associated cellular functions, such as clonogenic or spheroidal growth. Transcriptome analysis indicated that, independently of platinum-resistance status, 5-FdU-ECyd influences distinct cellular pathways, involved in cell cycle regulation, apoptosis, DNA-damage response and RNA/pyrimidine metabolism. Combination treatment of 5-FdU-ECyd and platin did not show a synergistic cellular response, suggesting the potential use of 5-FdU-ECyd as a monotherapeutic agent. Conclusions: Our data provide a rationale to characterize the effect of 5-FdU-ECyd in a pre-clinical in vivo setting. We hypothesize that this conjugate is a promising therapeutic option for OC patients with resistance to conventional platinum-based chemotherapy.
7
Maiorano, Brigida Anna, Ugo De Giorgi, Davide Ciardiello, Giovanni Schinzari, Antonio Cisternino, Giampaolo Tortora y Evaristo Maiello. "Immune-Checkpoint Inhibitors in Advanced Bladder Cancer: Seize the Day". Biomedicines 10, n.º 2 (9 de febrero de 2022): 411. http://dx.doi.org/10.3390/biomedicines10020411.
Texto completoResumen
Background: In advanced bladder cancer (BCa), platinum-based chemotherapy represents the first-choice treatment. In the last ten years, immune checkpoint inhibitors (ICIs) have changed the therapeutic landscape of many solid tumors. Our review aims to summarize the main findings regarding the clinical use of ICIs in advanced BCa. Methods: We searched PubMed, Embase, and Cochrane databases, and conference abstracts from international congresses (ASCO, ESMO, ASCO GU) for clinical trials, focusing on ICIs as monotherapy and combinations in metastatic BCa. Results: 18 studies were identified. ICIs targeting PD1 (nivolumab, pembrolizumab), PD-L1 (avelumab, atezolizumab, durvalumab), and CTLA4 (ipilimumab, tremelimumab) were used. Survival outcomes have been improved by second-line ICIs, whereas first-line results are dismal. Avelumab maintenance in patients obtaining disease control with chemotherapy has achieved the highest survival rates. Conclusions: ICIs improve survival after platinum-based chemotherapy. Avelumab maintenance represents a new practice-changing treatment. The combinations of ICIs and other compounds, such as FGFR-inhibitors, antibody-drug conjugates, and anti-angiogenic drugs, represent promising therapeutic approaches. Biomarkers with predictive roles and sequencing strategies are warranted for best patient selection.
8
Marcu, Loredana G. "Gender and Sex-Related Differences in Normal Tissue Effects Induced by Platinum Compounds". Pharmaceuticals 15, n.º 2 (20 de febrero de 2022): 255. http://dx.doi.org/10.3390/ph15020255.
Texto completoResumen
Gender medicine in the field of oncology is an under-researched area, despite the existing evidence towards gender-dependent response to therapy and treatment-induced adverse effects. Oncological treatment aims to fulfil its main goal of achieving high tumour control by also protecting normal tissue from acute or chronic damage. Chemotherapy is an important component of cancer treatment, with a large number of drugs being currently in clinical use. Cisplatin is one of the most commonly employed chemotherapeutic agents, used either as a sole drug or in combination with other agents. Cisplatin-induced toxicities are well documented, and they include nephrotoxicity, neurotoxicity, gastrointestinal toxicity, ototoxicity, just to name the most frequent ones. Some of these toxicities have short-term sequelae, while others are irreversible. Furthermore, research showed that there is a strong gender-dependent aspect of side effects caused by the administration of cisplatin. While evidence towards sex differences in animal models is substantial, clinical studies considering sex/gender as a variable factor are limited. This work summarises the current knowledge on sex/gender-related side effects induced by platinum compounds and highlights the gaps in research that require more attention to open new therapeutic possibilities and preventative measures to alleviate normal tissue toxicity and increase patients’ quality of life in both males and females.
9
Faraoni, Isabella y Grazia Graziani. "Role of BRCA Mutations in Cancer Treatment with Poly(ADP-ribose) Polymerase (PARP) Inhibitors". Cancers 10, n.º 12 (4 de diciembre de 2018): 487. http://dx.doi.org/10.3390/cancers10120487.
Texto completoResumen
Inhibition of poly(ADP-ribose) polymerase (PARP) activity induces synthetic lethality in mutated BRCA1/2 cancers by selectively targeting tumor cells that fail to repair DNA double strand breaks (DSBs). Clinical studies have confirmed the validity of the synthetic lethality approach and four different PARP inhibitors (PARPi; olaparib, rucaparib, niraparib and talazoparib) have been approved as monotherapies for BRCA-mutated or platinum-sensitive recurrent ovarian cancer and/or for BRCA-mutated HER2-negative metastatic breast cancer. PARPi therapeutic efficacy is higher against tumors harboring deleterious germline or somatic BRCA mutations than in BRCA wild-type tumors. BRCA mutations or intrinsic tumor sensitivity to platinum compounds are both regarded as indicators of deficiency in DSB repair by homologous recombination as well as of favorable response to PARPi. However, not all BRCA-mutated or platinum-responsive patients obtain clinical benefit from these agents. Conversely, a certain percentage of patients with wild-type BRCA or platinum-resistant tumors can still get benefit from PARPi. Thus, additional reliable markers need to be validated in clinical trials to select patients potentially eligible for PARPi-based therapies, in the absence of deleterious BRCA mutations or platinum sensitivity. In this review, we summarize the mechanisms of action of PARPi and the clinical evidence supporting their use as anticancer drugs as well as the additional synthetic lethal partners that might confer sensitivity to PARPi in patients with wild-type BRCA tumors.
10
Krasnopolsky, Yu, D. Pylypenko y G. Grigoryeva. "NANOMEDICINE IN ANTICANCER THERAPY". Bulletin of the National Technical University "KhPI". Series: Chemistry, Chemical Technology and Ecology 1, n.º 7 (30 de diciembre de 2022): 3–13. http://dx.doi.org/10.20998/2079-0821.2022.01.
Texto completoResumen
The use of liposomal nanoparticles as a drug delivery system today is a promising area of modern nanopharmacology, in particular in the development of antitumor drugs. Liposomal forms of antitumor active pharmaceutical ingredients are characterized by reduced toxicity, stability, and increased antitumor activity of nanoparticle-encapsulated antitumor agent, prolonged action of the drug. Commercially available liposomal anticancer drugs are passively targeted drugs that accumulate in cells by passive diffusion in tumor cells due to the EPR effect of the vascular system. This review presents data from the study of antitumor activity of liposomal drugs conducted by Ukrainian scientists in recent decades. Today, the antitumor activity of liposomal forms of therapeutic agents of various natures has been proven, among them are anthracycline antibiotics, platinum drugs, semisynthetic alkaloid derivatives, natural polyphenolic antioxidants, etc. Thus, the encapsulation of doxorubicin hydrochloride in liposomes has reduced its cardiotoxicity and other side effects, provided an opportunity to treat doxorubicin-resistant tumors. Liposomal forms of complex platinum compounds, in particular cisplatin, have been shown to be more effective than free forms of cytostatics in the treatment of cisplatin-resistant ovarian cancer. The use of polyphenolic antioxidants, quercetin and curcumin, in complex therapy can not only enhance the antitumor effect, but also have a protective effect on healthy tissues and organs.
Tesis sobre el tema "Platinum compounds Therapeutic use"
1
Todd, Jean Ann. "Platinum(II) complexes containing 1,2- and 1,7-carborane ligands for boron neutron capture therapy". Title page, contents and abstract only, 2001. http://web4.library.adelaide.edu.au/theses/09PH/09pht634.pdf.
Texto completo
2
Du, Plessis-Stoman Debbie. "A combination of platinum anticancer drugs and mangiferin causes increased efficacy in cancer cell lines". Thesis, Nelson Mandela Metropolitan University, 2010. http://hdl.handle.net/10948/d1016160.
Texto completoResumen
This thesis mainly deals with some biochemical aspects regarding the efficacy of novel platinum anticancer compounds alone and in combination with mangiferin, as part of a broader study in which both chemistry and biochemistry are involved. Various novel diamine and N-S donor chelate compounds of platinum II and IV have been developed in which factors such as stereochemistry, ligand exchange rate and biocompatibility were considered as additional parameters. In the first order testing, each of these compounds was tested with reference to their “killing” potential by comparing their rate of killing, over a period of 48 hours with those of cisplatin and oxaliplatin. Numerous novel compounds were tested in this way, using the MTT cell viability assay and the three cancer cell lines MCF7, HT29 and HeLa. Although only a few could be regarded as equal to or even better than cisplatin, CPA7 and oxaliplatin, the testing of these compounds on cancer cells provided useful knowledge for the further development of novel compounds. Three of the better compounds, namely Yol 25, Yol 29.1 and Mar 4.1.4 were selected for further studies, together with oxaliplatin and CPA7 as positive controls, to obtain more detailed knowledge of their anticancer action, both alone and when applied in combination with mangiferin. In addition to the above, resistant cells were produced for each of the three different cell lines tested and all the selected compounds, both in the presence and absence of mangiferin. The effects of these treatments on the activation of NFĸB when applied to normal and resistant cell lines were also investigated. All the compounds induced apoptosis in the cell lines tested as well as alter the DNA cycle at one or more phase. Additionally, combination of these compounds with mangiferin enhanced the above-mentioned effects. Mangiferin decreases the IC50 values of the platinum drugs by up to 3.4 times and, although mangiferin alone did not induce cell cycle arrest, the presence of mangiferin in combination with oxaliplatin and Yol 25 shows an earlier and greatly enhanced delay in the S-phase, while cells treated with CPA7, Yol 29.1 and Mar 4.1.4 in combination with mangiferin showed a later, but greatly enhanced delay in the S-phase. It was also found that mangiferin acts as an NFĸB inhibitor when applied in combination with these drugs, which, in turn, reduces the occurrence of resistance in the cell lines. Resistance to oxaliplatin was counteracted by the combination with mangiferin in HeLa and HT29, but not in MCF7 cells, while resistance to CPA7 was only counteracted in the MCF7 cell line. Yol 25 and Mar 4.1.4 did not seem to induce resistance in HeLa and MCF7 cells, but did in HT29 cells, whereas Yol 29.1 caused resistance in HeLa and HT29 cells, but not in MCF7 cells. Finally, an effort was made to evaluate the different compounds by comparing them with respect to their properties relating to anticancer action with and without the addition of mangiferin.
3
Thomas, Donald S. "Molecular modelling and NMR studies of multinuclear platinum anticancer complexes". University of Western Australia. School of Biomedical, Biomolecular and Chemical Sciences, 2006. http://theses.library.uwa.edu.au/adt-WU2007.0009.
Texto completoResumen
[Truncated abstract] The trinuclear anti-cancer agent [(trans-Pt(NH3)3Cl)2{μ-trans-Pt(NH3)2(H2N(CH2)6NH2)2}]4+ (BBR3464 or 1,0,1/t,t,t) is arguably the most significant development in the field of platinum anti-cancer agents since the discovery of cisplatin as a clinical agent more than 30 years ago. Professor Nicholas Farrell of Virginia Commonwealth University was responsible for the development of 1,0,1/t,t,t and an entire class of multinuclear platinum complexes. The paradigm shift that was required in the development of these compounds is based on a simple idea. In order to increase the functionality of platinum anti-cancer drugs a new way of binding to DNA must be employed. By increasing the number of platinum centres in the molecule and separating the binding sites, by locating them on the terminal platinum atoms, the result is a new binding motif that does not occur with cisplatin. The work described in this thesis involves the use of [¹H,¹5N] NMR spectroscopy combined with molecular modelling to investigate various aspects of the solution chemistry and DNA binding interactions of BBR3464 and the related dinuclear analogues [{trans-PtCl(NH3)2}2(μ- NH2(CH2)6NH2)]2+ (1,1/t,t) and [{cis-PtCl(NH3)2}2(μ-NH2(CH2)6NH2)]2+ (1,1/c,c). Chapter 2 contains detailed descriptions of the various methodologies used, including the molecular mechanics parameters that were developed for the various modelling studies described in this thesis.... The work described in Chapter 6 employed three duplexes; 5'-d(TCTCCTATTCGCTTATCTCTC)-3'·5'- d(GAGAGATAAGCGAATAGGAGA)-3' (VB12), 5'-d(TCTCCTTCTTGTTCTTCCTCC)- 3'·5'-d(GGATTAAGAACAAGAAGGAGA)-3' (VB14) and 5'- d(CTCTCTCTATTGTTATCTCTTCT)-3'·5'-d(AGAAGAGATAACTATAGAGAGAG)-3' (VB16). Two minor groove preassociated forms of 1,0,1/t,t,t with each duplex were created in which the complex was orientated in two different directions around the central guanine (labelled the 3'→3' and 5'→5' directions). The molecular dynamics simulations of these six systems indicated that each preassociated states was stable within the minor groove and could effectively support the formation of multiple interstrand cross-links. Subsequent investigations into the dynamic nature of the monofunctional adduct were conducted by the assembly of a single monofunctional adduct of the VB14 duplex with 1,0,1/t,t,t. Here it was found that the monofunctionally anchored 1,0,1/t,t,t adopted a position along the phosphate backbone of the duplex in the 5'→5' direction.
4
Moniodis, Joseph John. "Studying the DNA binding of a non-covalent analogue of the trinuclear platinum anticancer agent BBR3464". University of Western Australia. School of Biomedical, Biomolecular and Chemical Sciences, 2006. http://theses.library.uwa.edu.au/adt-WU2007.0008.
Texto completoResumen
[Truncated abstract] The Phase II clinical candidate, [(trans-Pt(NH3)2Cl)2{μ-trans-Pt(NH3)2(H2N(CH2)6NH2)2}]4+ (BBR3464 or 1,0,1/t,t,t) shows a unique binding profile when compared to the anticancer agent cis-[Pt(NH3)2Cl2] (cisplatin) and dinuclear platinum complexes of the general formula [(trans-Pt(NH3)2Cl)2(H2N(CH2)nNH2)]2+. There is evidence that the increased efficacy of 1,0,1/t,t,t results from the presence of the charged central linker, which can alter the mode of binding to DNA. This alternate binding mode may be due to an electrostatic and hydrogen bonding association of the central platinum moiety in the minor groove that occurs prior to covalent binding (termed “pre-association”) . . . This research shows that 0,0,0/t,t,t is an adequate model to study the pre-association process of 1,0,1/t,t,t and that it binds in the minor groove of DNA. Therefore it is likely that 1,0,1/t,t,t pre-associates in the minor groove of DNA prior to covalent binding. This work supports the conclusions reached in NMR studies of the binding of 1,0,1/t,t,t with the 1,4-GG sequence (Qu et al. JBIC. 8, 19-28 (2003)), which showed simultaneous binding in the major and minor groove. The findings of the current work may also explain the observed binding mode of 1,0,1/t,t,t, which can bind to DNA in both the 3',3' and 5',5' directions (Kasparkova et al. JBC. 277, 48076-48086 (2002)). These unique binding characteristics are thought to be responsible for the increased efficacy of 1,0,1/t,t,t, and in light of the current results the observed binding mode most likely stems from the electrostatic pre-association of the central platinum moiety.
5
Zhang, Jingjing y 张晶晶. "The anti-cancer properties of cyclometalated gold(III) complexes and organogold(III) supramolecular polymers". Thesis, The University of Hong Kong (Pokfulam, Hong Kong), 2014. http://hdl.handle.net/10722/208171.
Texto completoResumen
Prompted by the successful clinical application of cisplatin in cancer therapy, worldwide efforts have been devoted to develop new metal-based drugs for anticancer treatment. Gold(III) complexes at first received attention as anti-cancer drug candidates because of their square-planar geometry which resembles that of platinum(II) complexes. Subsequent studies revealed that various gold(III) complexes displayed promising anti-cancer activities with different biological mechanisms. Although some achievements have been obtained in the development of anti-cancer gold(III) complexes, challenges including the improvement of bioavailability, stability and selectivity, elucidation of the action mechanisms, and the development of novel delivery approaches of gold(III) complexes to reduce systematic toxicity, remain to be exploited.
A panel of anti-cancer complexes [AuIII(R-C^N)(L)]n+ (wherein HC^N is 2-phenylpyridine, L is biguanide or biuret) have been identified and described in Chapter 3. Biguanide or biuret have been employed to improve the solubility of the complexes in aqueous solutions. Meanwhile, the lipophilicity could readily be adjusted by varying the R group to obtain a balance between lipophilicity and aqueous solubility. Among the synthesized complexes, the cationic complexes, [AuIII(butyl-C^N)biguanide]Cl (3.1) and [AuIII(C^N)biguanide]Cl (3.2) are soluble in aqueous solutions with solubility over 5 mg/mL. Besides, introduction of butyl groups to 3.1 and [AuIII(butyl-C^N)biuret] (3.3) resulted in higher cellular uptake of gold, which might enhance their cytotoxic activities (IC50 values: 1.5–17 μM) compared with 3.2 and [AuIII(C^N)biuret] (3.4) (IC50 values: 9.4–47.3 μM). Moreover, 3.1 was also found to induce cell cycle arrest in S-phase and endoplasmic reticulum (ER) damage in human cervical epithelial carcinoma (HeLa) cells, and display significant anti-angiogenic activity at its sub-cytotoxic concentrations.
In Chapter 4, a series of gold(III) complexes with dithiocarbamate and 2-phenylpyridine ligands to target deubiquitinases (DUBs), have been designed. These complexes achieved significant inhibition on purified DUBs. Notably, [AuIII(2-(4-nbutylphenyl) pyridyl)(diethyldithiocarbamate)]PF6 (4.1) inhibited both the purified (IC50 values: 46–223 nM) and cell-based DUBs activities with high efficiency. Its interaction with DUB UCHL1 and peptides which are present in several types of DUBs and contain active cysteine residue were confirmed by mass spectrometric analysis. All complexes displayed significant cytotoxicities, and those containing diethyldithiocarbamate ligand displayed specific cytotoxicity on breast cancer cells. Accumulation of a tumor suppressor p53, cell-cycle arrest, and apoptotic cell death were induced in breast cancer cells by 4.1. Besides, 4.1 also showed anti-angiogenic effects. These biological activities might be related with DUBs inhibition.
In Chapter 5, a cytotoxic complex [AuIII(C^N^C)(4-dpt)](CF3SO3) (5.1, HC^N^CH = 2,6-diphenylpyridine; 4-dpt = 2,4-diamino-6-(4-pyridyl)-1,3,5-triazine) has been designed to self-assemble into supramolecular polymers (5.1-SP) in acetonitrile. In physiologically relevant solutions, 5.1-SP displayed a sustained-release property of the anti-angiogenic ligand 4-dpt, and in the presence of glutathione (GSH), [AuIII(C^N^C)-GSH] adduct(s) were also gradually released. The supramolecular polymers 5.1-SP also showed selective cytotoxicity toward cancerous cells, and could act as drug-carriers of other cytotoxic agents to achieve sustained-release behavior.published_or_final_version
Chemistry
Doctoral
Doctor of Philosophy
6
Wong, Lai-Ming Ella y 黃禮明. "Iron and ruthenium complexes with nitrogen and oxygen donor ligands for anti-cancer and anti-viral studies". Thesis, The University of Hong Kong (Pokfulam, Hong Kong), 2006. http://hub.hku.hk/bib/B3587742X.
Texto completo
7
Brynne, Niclas. "Consequences of CYP2D6 polymorphism for the disposition and dynamics of tolterodine : a novel drug in the treatment of urinary bladder overactivity /". Stockholm, 1998. http://diss.kib.ki.se/1998/91-628-3205-0/.
Texto completo
8
Tian, Songhai y 田松海. "Proteomic and pharmacological analyses of the mechanism of actions of anticancer gold(I) complexes". Thesis, The University of Hong Kong (Pokfulam, Hong Kong), 2014. http://hdl.handle.net/10722/206471.
Texto completoResumen
Gold complexes have a long history of being used as therapeutic agents, especially in applications against immune diseases such as rheumatoid arthritis. In 1979, an oral gold(I) drug – auranofin (AuRF, brand name as Ridaura®) – was demonstrated to exhibit anticancer properties. Since then, a considerable number of gold(I) complexes have been reported to show remarkable anticancer activities, but the understanding of their mechanism of actions is limited.
In the present study, AuRF and several other anticancer gold(I)-phosphine complexes including AuPEt ([Au(triethylphosphine)Cl]) were demonstrated to induce autophagy – a cellular catabolic process of macromolecules and organelles through lysosomal degradation. The induced autophagy involved the accumulation of autophagosomes, which was mediated by the enhancement of autophagy initiation rather than by the blockage of autophagosomes maturation. Moreover, the AuRF and AuPEt induced autophagy was demonstrated to have a pro-survival effect for the cancer cells.
To better explore the mechanism of actions of AuRF and other anticancer gold(I) complexes, a subcellular fractionation-based proteomic approach has been developed and optimized. This approach combined the use of subcellular fractionation, protein extraction, HPLC-LTQ-Orbitrap mass spectrometry, and bottom-up protein identification and quantification. By using this approach, the proteome coverage was increased, the complexities of the sub-proteomes were reduced, and the low-abundant organelle proteins were enriched.
The nuclear sub-proteomes of AuRF-treated or AuPEt-treated cells were analyzed to identify the significantly regulated transcription regulators and the signaling pathways involved. The analysis delineates the possible AuRF-activated anticancer pathways involving up-regulation of the tumor suppressor cyclin-dependent kinase inhibitor 2A (〖p14〗^ARF), inhibition of the E2F transcription activity, blocking of the translocation of E3 ubiquitin-protein ligase (MDM2) from nucleus to cytoplasm and induction of the tumor suppressor p53. Furthermore, the KeyNode-based pathway analysis was applied to analyze the whole proteomes obtained from merging the sub-proteomes. Alongside the p53 pathway and E2F network, the regulation of 3-hydroxy-3-methylglutaryl-CoA
reductase (HMGCR, the rate-limiting enzyme of cholesterol biosynthesis) is one of the most up-regulated pathways of AuRF treatment. AuRF also showed significant inhibition to HMGCR activity in vitro with an IC50 value at the
micromolar level.
The effects of AuRF and AuPEt on the high mobility group box-1 protein (HMGB1), which exhibits distinct functions dependent on its cellular locations, were investigated. Treatment of cells with AuRF or AuPEt resulted in down-regulation of nuclear HMGB1, which is associated with p53-dependent cytotoxicities. The cytoplasmic HMGB1, which can induce autophagy, was found to be up-regulated. The levels of secreted HMGB1, which exhibits pro-inflammatory properties, were reduced, possibly contributing to anti-rheumatoid arthritis actions of AuRF.
Collectively, the pharmacological and proteomic analyses in this research of AuRF and other anticancer gold(I) complexes supplement the current knowledge of their mechanism of actions.published_or_final_version
Chemistry
Doctoral
Doctor of Philosophy
9
Vezmar, Marko. "Pharmacological effects of quinoline-related compounds in human tumour cells overexpressing the multidrug resistance protein (MRP)". Thesis, National Library of Canada = Bibliothèque nationale du Canada, 1997. http://www.collectionscanada.ca/obj/s4/f2/dsk2/tape16/PQDD_0003/MQ37175.pdf.
Texto completo
10
Wei, Lai y 魏来. "Induction of LTB4 12-hydroxydehydrogenase (LTB4DH) by Radix Astragali and Radix Paeoniae Rubra: a study of theactive compounds and related biological functions". Thesis, The University of Hong Kong (Pokfulam, Hong Kong), 2009. http://hub.hku.hk/bib/B44683443.
Texto completoLibros sobre el tema "Platinum compounds Therapeutic use"
1
Kuduk-Jaworska, Janina. Przeciwnowotworowo aktywne kompleksy platyny. Wrocław: Wydawn. Uniwersytetu Wrocławskiego, 1992.
Buscar texto completo
2
International, Congress on Neo-Adjuvant Chemotherapy (2nd 1987 Paris France). Paraplatine: Carboplatine: symposium satellite du deuxième congrès international sur la chimiothérapie néo-adjuvante Paris, 20 frévier 1988. Paris: Libbey Eurotext, 1988.
Buscar texto completo
3
International Symposium on Platinum Coodination Compounds in Cancer Chemotherapy (10th 2007 Verona, Italy). Platinum and other heavy metal compounds in cancer chemotherapy: Molecular mechanisms and clinical applications. New York: Humana Press, 2009.
Buscar texto completo
4
International Symposium on Platinum and Other Metal Coordination Compounds in Cancer Chemotherapy (6th 1991 San Diego, Calif.). Platinum and other metal coordination compounds in cancer chemotherapy. New York: Plenum Press, 1991.
Buscar texto completo
5
M, Pinedo H. y Schornagel J. H, eds. Platinum and other metal coordination compounds in cancer chemotherapy 2. New York: Plenum Press, 1996.
Buscar texto completo
6
International Symposium on Platinum Coodination Compounds in Cancer Chemotherapy (10th 2007 Verona, Italy). Platinum and other heavy metal compounds in cancer chemotherapy: Molecular mechanisms and clinical applications. New York: Humana Press, 2009.
Buscar texto completo
7
Marino, Nicolini, ed. Platinum and other metal coordination compounds in cancer chemotherapy: Proceedings of the Fifth International Symposium on Platinum and Other Metal Coordination Compounds in Cancer Chemotherapy, Abano Padua, Italy, June 29-July 2, 1987. Boston: Nijhoff, 1988.
Buscar texto completo
8
Malinowski, Jerzy. Sztuka i nowa wspólnota: Zrzeszenie Artystów Bunt, 1917-1922. Wrocław: "Wiedza o Kulturze", 1991.
Buscar texto completo
9
R, Kelland Lloyd y Farrell Nicholas 1948-, eds. Platinum-based drugs in cancer therapy. Totowa, N.J: Humana Press, 2000.
Buscar texto completo
10
S, Tracey Alan y Crans Debbie Catharina, eds. Vanadium compounds: Chemistry, biochemistry, and therapeutic applications. Washington, DC: American Chemical Society, 1998.
Buscar texto completoCapítulos de libros sobre el tema "Platinum compounds Therapeutic use"
1
Bernfeld, G. J., A. J. Bird, R. I. Edwards, Hartmut Köpf, Petra Köpf-Maier, Christoph J. Raub, W. A. M. te Riele, Franz Simon y Walter Westwood. "Medical Use of Cytostatic Platinum Compounds". En Pt Platinum, 318–38. Berlin, Heidelberg: Springer Berlin Heidelberg, 1985. http://dx.doi.org/10.1007/978-3-662-10278-7_5.
Texto completo
2
Pétain, Aurélie, Antonin Schmitt, Fabienne Thomas, Christine Chevreau y Etienne Chatelut. "Optimising Carboplatin Dose using Patient Characteristics and Therapeutic Drug Monitoring". En Platinum and Other Heavy Metal Compounds in Cancer Chemotherapy, 373–80. Totowa, NJ: Humana Press, 2009. http://dx.doi.org/10.1007/978-1-60327-459-3_42.
Texto completo
3
Voegeli, R., J. Pohl, P. Hilgard, J. Engel, W. Schumacher, H. Brunner, M. Schmidt, U. Holzinger y H. Schönenberger. "Synthesis and Therapeutic Effect of New Cis-Platinum Complexes on Experimental Tumors". En Platinum and Other Metal Coordination Compounds in Cancer Chemotherapy, 343–47. Boston, MA: Springer US, 1988. http://dx.doi.org/10.1007/978-1-4613-1717-3_40.
Texto completo
4
Crans, Debbie C., Mohammed Mahroof-Tahir y Anastasios D. Keramidas. "Vanadium chemistry and biochemistry of relevance for use of vanadium compounds as antidiabetic agents". En Vanadium Compounds: Biochemical and Therapeutic Applications, 17–24. Boston, MA: Springer US, 1995. http://dx.doi.org/10.1007/978-1-4613-1251-2_2.
Texto completo
5
Sinkó, Bálint y Krisztina Takács-Novák. "Related Topic: Use of PAMPA and Artificial Membranes". En Skin Permeation and Disposition of Therapeutic and Cosmeceutical Compounds, 391–97. Tokyo: Springer Japan, 2017. http://dx.doi.org/10.1007/978-4-431-56526-0_35.
Texto completo
6
Altamura, A. C. y R. Curreli. "Antipsychotics in the Elderly: The Use of 'Typical� vs. 'Atypical� Compounds". En Mental Disorders in the Elderly: New Therapeutic Approaches, 125–38. Basel: KARGER, 1998. http://dx.doi.org/10.1159/000061373.
Texto completo
7
De Pauw, Ines, Carolien Boeckx y An Wouters. "Mechanisms of Cetuximab Resistance and How to Overcome It". En Critical Issues in Head and Neck Oncology, 21–51. Cham: Springer International Publishing, 2021. http://dx.doi.org/10.1007/978-3-030-63234-2_3.
Texto completoResumen
AbstractDeregulated or increased signalling of the epidermal growth factor receptor (EGFR) plays an integral role in the development of various cancer types, including head and neck squamous cell carcinoma (HNSCC), making it a compelling drug target. However, after initially promising results of EGFR-targeted therapies, such as the monoclonal antibody cetuximab, it became clear that both intrinsic and acquired therapeutic resistance are major roadblocks in the field of personalised cancer treatments.In order to unravel and overcome resistance to cetuximab, at least two strategies can be adopted.Firstly, therapeutic resistance to anti-EGFR therapy may arise from mechanisms that can compensate for reduced EGFR signalling and/or mechanisms that can modulate EGFR-dependent signalling. In this chapter, we discuss which mechanisms of cetuximab resistance are already known and which ones deserve further investigation. This enhanced knowledge will guide us to rationally design and test novel combination therapies that overcome resistance to EGFR-targeting agents in cancer treatment.Secondly, an urgent need remains to develop novel targeted treatments for single-agent or combined therapy use. In this view, due to the particular mode of activation of the EGFR receptor, involving ligand-induced homo- and heterodimerization of the four HER receptors, an increased inhibition scope of HER receptors most likely results in a more potent blockade of the HER network, preventing premature emergence of resistance and leading to a more pronounced therapeutic benefit. We discuss two multitargeted compounds, being MEHD7945A (duligotuzumab) and afatinib, in this chapter.Despite the huge efforts to unravel the molecular landscape of HNSCC, the main clinically validated target remains EGFR. However, immune checkpoints, like programmed cell death protein 1 (PD-1), are gaining clinical approvals as well. We underscore the importance of adopting rational drug combinations to enhance the therapeutic effect of the EGFR-inhibitor cetuximab and highlight the ongoing search for predictive biomarkers, with the ultimate goal of delivering individualized cancer therapy to HNSCC patients.
8
Erbaş, Oytun, İlknur Altuntaş, Özge Çağlar, Elif Özyilmaz, Ece Sari, İlayda Üzümcü y Kaan Erbakan. "Experimental Model of Cardiotoxicity". En Risk Factors for Cardiovascular Disease. IntechOpen, 2022. http://dx.doi.org/10.5772/intechopen.101401.
Texto completoResumen
The occurrence of heart electrophysiology dysfunction or/and muscle damage is referred to as cardiotoxicity. The heart weakens and becomes less efficient at pumping and hence circulating blood. Cardiomyopathy can be caused by a variety of factors, including viral infections, diseases such as diabetes, ischemia, hypertension, obesity, radiation therapy, antipsychotic drugs, cytotoxic drugs, most notably chemotherapeutic agents; antitumor antibiotics, monoclonal antibodies, tyrosine kinase inhibitors, platinum-based compounds, microtubule inhibitors, vinca alkaloids, antimetabolites, proteasome inhibitors, topoisomerase inhibitors, alkylating agents, corticosteroids. This chapter focuses on the mechanisms of cardiotoxicity, animal models and transgenic methods used in studies, and the effects of therapeutic agents on cardiotoxicity.
9
Dwarka, Depika, Himansu Baijnath y John Jason Mellem. "Bioactive Compounds as Therapeutic Intervention in Cancer Therapy". En Therapeutic Use of Plant Secondary Metabolites, 84–110. BENTHAM SCIENCE PUBLISHERS, 2022. http://dx.doi.org/10.2174/9789815050622122010007.
Texto completoResumen
Neither transmittable nor communicable, painstakingly the second most fataldisease worldwide, cancer has gained the interest of scientists who are attempting withtenacity to decrypt its unknown facets, discover new diagnosis techniques, as well as tocreate improved and more efficient treatment methods. A major impediment toeffective cancer therapy is the inability to destroy the complete malignant tumourgrowth and evolution of tumour resistance. Chemotherapeutic drugs are known fortheir cell death mode of action, thereby incapacitating non-cancerous cells in theprocess. A successful anti-cancer drug should kill or debilitate cancer cells withoutcausing unnecessary damage to normal cells. Administration of natural bioactivecompounds exemplifies an alternative technique as they are associated with lowertoxicities. These bioactive molecules are effective and demonstrate great specificity asthey possibly operate as potent anti-oxidants and apoptosis inducers. Moderatingapoptosis might be helpful in managing, treating, or deterring cancer. Significantly,bioactive compounds are providing such templates. Plants have a long history in cancertreatment. More than 3000 species have been known for their anti-cancer potential.Over 60% of currently used anti-cancer agents are derived in one way or another fromhigher plants. This chapter describes the roles and advancements of the use of bioactivecompounds in the treatment of cancer.
10
Adeola, Henry A., Rashmi Bhardwaj, Aderonke F. Ajayi-Smith, Afsareen Bano, Tayo A. Adekiya, Michael C. Ojo, Raphael T. Aruleba, Adeniyi C. Adeola, Babatunji E. Oyinloye y Chinedu E. Udekwu. "Bioactive Compounds as Therapeutic Intervention in Mucocutaneous Cancers". En Therapeutic Use of Plant Secondary Metabolites, 111–38. BENTHAM SCIENCE PUBLISHERS, 2022. http://dx.doi.org/10.2174/9789815050622122010008.
Texto completoResumen
There are several beneficial effects of plant bioactive compounds in theevidence-based prevention and treatment of mucocutaneous cancers. For instance,several bioactive compounds via various antioxidant and immunomodulatorymechanisms have been shown to positively improve different diseases, includingcancer. Considering the complex, multifactorial processes that regulate genetic andcellular function in cancer development, the use of small phytochemical moleculescapable of targeting multiple carcinogenetic genes and pathways is plausible. Furthermore, the identification of molecular targets and cognate dietary bioactivemolecules in mucocutaneous cancer, using applied combinatorial chemistryapproaches, potentially presents a key complementary ancillary tool for developingrobust, physiologically bioavailable, diversity-oriented, and cost-effective therapies.These systems biology and omics-based theragnostic tools are crucial for themanagement of cancers that affect the oral mucous membranes and skin in a resourcelimitedsetting. Natural products and nutraceuticals are poised to ameliorate the burdenof mucocutaneous cancers and improve the drug discovery pipelines if state-of-the-artresearch techniques are used to elucidate their therapeutic values in the era of precisionmedicine. Hence, this review focuses on the currently available and potentialtherapeutic benefits of plant bioactive compounds in the prevention and management ofmucocutaneous cancers.
Actas de conferencias sobre el tema "Platinum compounds Therapeutic use"
1
Lima, Paula Marynella Alves Pereira, Douglas Cardoso Brandão, Raquel Pereira Cruz, Priscila Capelari Orsolin, Wendell Guerra, Luiz Ricardo Goulart, Robson José de Oliveira Júnior y Thaise Gonçalves Araújo. "A NEW COPPER TERNARY COMPLEX IS A PROMISED COMPOUND FOR THE TREATMENT OF TRIPLE-NEGATIVE BREAST CANCER". En Abstracts from the Brazilian Breast Cancer Symposium - BBCS 2021. Mastology, 2021. http://dx.doi.org/10.29289/259453942021v31s2011.
Texto completoResumen
Objectives: Triple-negative breast cancer (TNBC) is a biologically aggressive tumor with poor prognosis due to the lack of effective therapeutic strategies. Although chemotherapy is widely employed, chemoresistance and severe side effects remain a challenge in controlling this breast cancer subtype. Doxorrubicin (DOX) and platinum-based drugs are commonly used in oncological regimens but with limitations. In this scenario, metallodrugs based on copper element have been emerged as novel and promised compounds, due to the presenting mechanisms of action and biodistribution different from the platinum drugs already used, and may be effective against tumors that are resistant to conventional chemotherapy. This study focuses on assessing the cytotoxic effect of new copper ternary metal complex (CBP-01) on breast cancer tumor cells. Methodology: Cell viability of human breast cell lines, MCF 10A (non-neoplastic) and neoplastic cells, MCF7, T-47D, and MDA-MB-231, was evaluated by 3-[4,5-dimethylthiazole-2-yl]2,5-diphenyltetra-zolium bromide — MTT methodology. CBP-01 was tested in different concentrations (1, 5, 10, 12.5, 25, and 50 μM) for 24, 48, and 72 h, and the cellular responses were compared with Carboplatin (CARB), Cisplatin (CIS), and DOX. Results: The dose-dependent profile was identified for the four drugs and the cell viability differed between the times of treatment. CBP-01 was effective against the tumor cell lines. Regarding the triple-negative cell line (MDA-MB231), CBP-01 was clearly more effective with lower IC50 (2.05) and higher SI (3.10) than the other compounds. Conclusion: Our data provide new prospects for TNBC treatment and may yield new directions for tumor management.
2
Suprunova, T. P., N. V. Markin, A. N. Ignatov, A. G. Solovyov, N. O. Kalinina y M. E. Talyansky. "Use of dsRNA-based antiviral compounds to protect potato plants". En Растениеводство и луговодство. Тимирязевская сельскохозяйственная академия, 2020. http://dx.doi.org/10.26897/978-5-9675-1762-4-2020-132.
Texto completoResumen
One of the most important food crops in the world, the potato (Solanum tuberosum L.) is infected with many viruses, of which the y virus (Potato virus Y, PVY) is the most important economically, causing significant crop losses. Several alternative methods of dsRNA delivery have been tested, with the most promising being spray - induced gene silencing (SIGS). The results showed a high effect of preventive use of dsRNA. Treatment with the initial working concentration of dsRNA protected 100% and 65% of plants from virus propagation for 14 and 21 days, respectively, and 65% of plants were protected by the minimum tested concentration (10 ng/MCL) for 14 days. Therapeutic use of dsRNA 3 days after inoculation did not significantly affect the dynamics of virus accumulation in the plant. Thus, in the course of the experiment, a high biological antiviral effectiveness of dsRNA was demonstrated in the preventive treatment of potato plants against the background of artificial infection of plants with the PVY virus.
3
Desiderio, Mayane Freitas, Marcela Bonalumi Santos, André Mattar, Jorge Yoshinori Shida y Luiz Henrique Gebrim. "PATHOLOGICAL COMPLETE RESPONSE IN 2,141 PATIENTS SUBMITTED TO NEOADJUVANT CHEMOTHERAPY IN A BREAST CANCER REFERENCE CENTER". En Scientifc papers of XXIII Brazilian Breast Congress - 2021. Mastology, 2021. http://dx.doi.org/10.29289/259453942021v31s1087.
Texto completoResumen
Introduction: The pathologic complete response (pCR) definition after neoadjuvant chemotherapy (NAC) for breast cancer is better defined as the absence of residual invasive cancer, although it allows the presence of ductal carcinoma in situ (DCIS). In the past, the presence of positive axillary lymph node was allowed; nowadays studies have shown that any positive lymph node should be not considered as pCR. In Brazil, the proportion of advanced cases varies between 30% to 55% of patients treated by the public health system (SUS). NAC has been recommended more frequently, especially for triple negative tumors and overexpressed Her 2 tumors because you can possibly change the adjuvant treatment, and it is an excellent predictor of prognosis. There is little data on pCR in the therapeutic regimens used in SUS. Objectives: Evaluate data on pathologic complete response in patients subjected to neoadjuvant chemotherapy in SUS schemes. Methods: We performed a retrospective study in Pérola Byington Hospital official database from January 2011 to December 2018 and 2,141 patients that underwent neoadjuvant chemotherapy (NAC) were included. Chemotherapy regimens varied during this period according to institutional protocols and availability of new drugs. The pCR was considered after a histopathological study of the surgical specimen in four molecular subtypes (luminal A and B, triple negative and HER -2 enriched). Results: We included 494 patients in Stage IIB and 1,645 patients in Stage III, most of them were luminal (1,077/50.3%), followed by triple negative (766/35,8%) and Her2 (298/13,9%). The pCR rate varied across the subtypes: luminal 78 (7.2%), triple negative 163 (21.3%) and Her2 69 (23.1%). Conclusions: NAC is an important treatment for breast cancer and is gradually obtainingmore indications. Most of the indications for NAC are: To allow surgical approaches (advanced cases); To allow / increase rate of conservative surgery; To allow conservative approach to the axila and recently select some cases for specific treatment (adjuvant TDM1 and capecitabine). The pCR rate varies through the studies: Cortazar et al. found 16% in Luminal; 33% in triple negative; 50% in Her2 when trastuzumab was used and 30,2% when it was not used. When platin is used for triple negative it is possible to achieve up to 50% of pCR. When double blockage for Her2 is used we can expect between 50%-70% in pCR. In our data most of our patients were stage III and we only had access to neoadjuvant trastuzumab after 2016; this directly impacted our results. The NAC protocols varied during this period and nowadays we have included platin compounds for triple negative.
4
Marshall, Lauren, Isabel Löwstedt, Paul Gatenholm y Joel Berry. "Prevascularized, Co-Culture Model for Breast Cancer Drug Development". En ASME 2012 Summer Bioengineering Conference. American Society of Mechanical Engineers, 2012. http://dx.doi.org/10.1115/sbc2012-80409.
Texto completoResumen
The objective of this study was to create 3D engineered tissue models to accelerate identification of safe and efficacious breast cancer drug therapies. It is expected that this platform will dramatically reduce the time and costs associated with development and regulatory approval of anti-cancer therapies, currently a multi-billion dollar endeavor [1]. Existing two-dimensional (2D) in vitro and in vivo animal studies required for identification of effective cancer therapies account for much of the high costs of anti-cancer medications and health insurance premiums borne by patients, many of whom cannot afford it. An emerging paradigm in pharmaceutical drug development is the use of three-dimensional (3D) cell/biomaterial models that will accurately screen novel therapeutic compounds, repurpose existing compounds and terminate ineffective ones. In particular, identification of effective chemotherapies for breast cancer are anticipated to occur more quickly in 3D in vitro models than 2D in vitro environments and in vivo animal models, neither of which accurately mimic natural human tumor environments [2]. Moreover, these 3D models can be multi-cellular and designed with extracellular matrix (ECM) function and mechanical properties similar to that of natural in vivo cancer environments [3].
5
Krasnoshtanova, Alla y Anastasiya Bezyeva. "DETERMINATION OF THE OPTIMAL CONCENTRATIONS OF PECTIN AND CALCIUM CHLORIDE FOR THE SYNTHESIS OF CHITOSAN-PECTIN MICROPARTICLES". En GEOLINKS Conference Proceedings. Saima Consult Ltd, 2021. http://dx.doi.org/10.32008/geolinks2021/b1/v3/09.
Texto completoResumen
"The oral route of drug inclusion is the most convenient for the patient. In addition to ease of use, this method of drug inclusion has such advantages as non-invasiveness of inclusion, absence of complications during injection; comparative safety for the organism due to the passage of the active substance and auxiliary compounds through the gastrointestinal tract; the possibility of introducing larger doses of the drug at one time. However, despite the obvious advantages, the oral route of inclusion has a number of significant disadvantages that significantly limit its use for a number of drugs. Among them are: relatively slow therapeutic action of the drug with this route of inclusion; the aggressive effect of a number of drugs (for example, antibiotics) on the gastrointestinal tract; low bioavailability of a number of substances (especially high molecular weight hydrophilic compounds), caused by poor permeability of the intestinal epithelium for hydrophilic and large molecules, as well as enzymatic and chemical degradation of the active substance in the gastrointestinal tract. There are various approaches used in the development of oral drug delivery systems. In particular, for the targeted delivery of drugs, it is proposed to use nano- and microcapsules with mucoadhesive properties. Among the polymers used for the synthesis of these microparticles, it is preferable to use pH-dependent, gelable biopolymers that change their structure depending on the acidity of the environment. Microcapsules obtained from compounds with the above properties are capable of protecting the active substance (or from the active substance) in the stomach environment and ensuring its release in the intestine. These properties are possessed by such polysaccharides as alginate, pectin, carrageenan, xylan, etc. The listed biopolymers are non-toxic, biocompatible, and biodegradable, which makes microparticles containing these polysaccharides promising as oral drug delivery systems. To impart mucoadhesive properties to nanoparticles, complexes of the listed polymers with chitosan are used. In this research, pectin, a polysaccharide formed mainly by residues of galacturonic acid, was used as a structural polymer. The concentrations of substances in the initial solutions were selected that were optimal for the synthesis of microcapsules. The main parameters for evaluating the resulting microparticles were the size of the capsules (less than 1 μm for oral inclusion), the zeta-potential, showing the tendency of the microparticles to stick together, and the completeness of the binding of the microparticles to chitosan. It was found that the optimal solutions for the synthesis of microparticles are: 15.7 ml of a solution of pectin 0.093% by weight, 3.3 ml of a solution of chitosan 0.07% by weight and 1.0 ml of a solution of CaCl2 20 mM. The diameter of the microparticles obtained by this method was 700-800 nm, and the value of their zetta-potential, equal to - (34 ± 3) mV, does not cross the particle adhesion threshold. It was also found that the synthesis of microparticles at these concentrations of calcium chloride provides the most complete binding of chitosan to their surface, which increases the mucoadhesive properties of microparticles."
6
Babarykin, Dmitry, Gaļina Smirnova, Svetlana Vasiļjeva, Anna Fedotova, Andrey Fedotov y Natālija Basova. "Evaluation of the biological activity of sugar-free fractionated red beetroot juice". En 80th International Scientific Conference of the University of Latvia. University of Latvia, 2023. http://dx.doi.org/10.22364/iarb.2022.05.
Texto completoResumen
In the case of type II diabetes, the most important preventive and therapeutic effect gives a diet with a minimal amount of easily digestible carbohydrates. Vegetable juices are posi-tioned as healthy food, because of the high content of phenolic and other biologically active compounds. However, due to the high glycemic index, juices are contraindicated in obesity, and diabetes, while juices with a reduced glycemic index, are not available on the market. We have developed a technology for the fractionation of red beetroot juice based on molecular mass using ultrafiltration. The resulting fraction stimulates the absorption of iron, increases blood hemoglobin level, and enhances capillary blood flow more effectively than native juice does. Both effects are important for patients with diabetes because the impaired blood supply to tissues and organs is an important pathogenetic factor in the development of diabetic renal failure, blindness, and gangrene. The sugar content in fractionated beetroot juice is 5–7%, which makes its use in diabetes problematic. The purpose of the study was to develop a technology for removing sugar from fractionated red beetroot juice and assessing the safety of its functional properties. The fractionated native red beetroot juice and fractionated fermented juice were studied. Fermentation was carried out using pre-activated yeast Saccharomyces cerevisiae. It was found that after 5-day fermentation, the sugar content in the fermented fractionated juice fell to 0.5–0.7%, while maintaining functional activity.
7
Chen, Kok Hao y Jong Hyun Choi. "DNA Oligonucleotide-Templated Nanocrystals: Synthesis and Novel Label-Free Protein Detection". En ASME 2009 International Mechanical Engineering Congress and Exposition. ASMEDC, 2009. http://dx.doi.org/10.1115/imece2009-11958.
Texto completoResumen
Semiconductor and magnetic nanoparticles hold unique optical and magnetic properties, and great promise for bio-imaging and therapeutic applications. As part of their stable synthesis, the nanocrystal surfaces are usually capped by long chain organic moieties such as trioctylphosphine oxide. This capping serves two purposes: it saturates dangling bonds at the exposed crystalline lattice, and it prevents irreversible aggregation by stabilizing the colloid through entropic repulsion. These nanocrystals can be rendered water-soluble by either ligand exchange or overcoating, which hampers their widespread use in biological imaging and biomedical therapeutics. Here, we report a novel scheme of synthesizing fluorescent PbS and magnetic Fe3O4 nanoparticles using DNA oligonucleotides. Our method of PbS synthesis includes addition of Na2S to the mixture solution of DNA sequence and Pb acetate (at a fixed molar ratio of DNA/S2−/Pb2+ of 1:2:4) in a standard TAE buffer at room temperature in the open air. In the case of Fe3O4 particle synthesis, ferric and ferrous chloride were mixed with DNA in DI water at a molar ratio of DNA/Fe2+/Fe3+ = 1:4:8 and the particles were formed via reductive precipitation, induced by increasing pH to ∼11 with addition of ammonium hydroxide. These nanocrystals are highly stable and water-soluble immediately after the synthesis, due to DNA termination. We examined the surface chemistry between oligonucleotides and nanocrystals using FTIR spectroscopy, and found that the different chemical moieties of nucleobases passivate the particle surface. Strong coordination of primary amine and carbonyl groups provides the chemical and colloidal stabilities, leading to high particle yields (Figure 1). The resulting PbS nanocrystals have a distribution of 3–6 nm in diameter, while a broader size distribution is observed with Fe3O4 nanoparticles as shown in Figure 1b and c, respectively. A similar observation was reported with the pH change-induced Fe3O4 particles of a bimodal size distribution where superparamagnetic and ferrimagnetic magnetites co-exist. In spite of the differences, FTIR measurements suggest that the chemical nature of the oligonucleotide stabilization in this case is identical to the PbS system. As a particular application, we demonstrate that aptamer-capped PbS QD can detect a target protein based on selective charge transfer, since the oligonucleotide-templated synthesis can also serve the additional purpose of providing selective binding to a molecular target. Here, we use thrombin and a thrombin-binding aptamer as a model system. These QD have diameters of 3∼6 nm and fluoresce around 1050 nm. We find that a DNA aptamer can passivate near IR fluorescent PbS nanocrystals, rendering them water-soluble and stable against aggregation, and retain the secondary conformation needed to selectively bind to its target, thrombin, as shown in Figure 2. Importantly, we find that when the aptamer-functionalized nanoparticles binds to its target (only the target), there is a highly systematic and selective quenching of the PL, even in high concentrations of interfering proteins as shown in Figure 3a and b. Thrombin is detected within one minute with a detection limit of ∼1 nM. This PL quenching is attributed to charge transfer from functional groups on the protein to the nanocrystals. A charge transfer can suppress optical transition mechanisms as we observe a significant decrease in QD absorption with target addition (Figure 3c). Here, we rule out other possibilities including Forster resonance energy transfer (FRET) and particle aggregation, because thrombin absorb only in the UV, and we did not observe any significant change in the diffusion coefficient of the particles with the target analyte, respectively. The charge transfer-induced photobleaching of QD and carbon nanotubes was observed with amine groups, Ru-based complexes, and azobenzene compounds. This selective detection of an unlabeled protein is distinct from previously reported schemes utilizing electrochemistry, absorption, and FRET. In this scheme, the target detection by a unique, direct PL transduction is observed even in the presence of high background concentrations of interfering negatively or positively charged proteins. This mechanism is the first to selectively modulate the QD PL directly, enabling new types of label free assays and detection schemes. This direct optical transduction is possible due to oligonucleotidetemplated surface passivation and molecular recognition. This chemistry may lead to more nanoparticle-based optical and magnetic probes that can be activated in a highly chemoselective manner.