Siga este enlace para ver otros tipos de publicaciones sobre el tema: NFA Position.

Artículos de revistas sobre el tema "NFA Position"

Crea una cita precisa en los estilos APA, MLA, Chicago, Harvard y otros

Elija tipo de fuente:

Consulte los 50 mejores artículos de revistas para su investigación sobre el tema "NFA Position".

Junto a cada fuente en la lista de referencias hay un botón "Agregar a la bibliografía". Pulsa este botón, y generaremos automáticamente la referencia bibliográfica para la obra elegida en el estilo de cita que necesites: APA, MLA, Harvard, Vancouver, Chicago, etc.

También puede descargar el texto completo de la publicación académica en formato pdf y leer en línea su resumen siempre que esté disponible en los metadatos.

Explore artículos de revistas sobre una amplia variedad de disciplinas y organice su bibliografía correctamente.

1

Brzoza-Brzezina, Michał y Jacek Kotłowski. "THE NONLINEAR NATURE OF COUNTRY RISK AND ITS IMPLICATIONS FOR DSGE MODELS". Macroeconomic Dynamics 24, n.º 3 (3 de agosto de 2018): 601–28. http://dx.doi.org/10.1017/s136510051800038x.

Texto completo
Resumen
Country risk premia can substantially affect macroeconomic dynamics. We concentrate on one of their most important determinants—a country’s net foreign asset (NFA) position and—in contrast to the existing research—investigate its nonlinear link to risk premia. The importance of this particular nonlinearity is two-fold. First, it allows to identify the NFA level above which the elasticity becomes much (possibly dangerously) higher. Second, such a nonlinear relationship is a standard ingredient of dynamic stochastic general equilibrium (DSGE) models, but its proper calibration/estimation is missing. Our estimation shows that indeed the link is highly nonlinear and helps to identify the NFA position where the nonlinearity kicks in at approximately −70% to −75% of GDP. We also provide a proper calibration of the risk premium—NFA relationship which can be used in DSGE models and demonstrate that its slope matters significantly for economic dynamics in such a model.
Los estilos APA, Harvard, Vancouver, ISO, etc.
2

CHAMPARNAUD, J. M., F. OUARDI y D. ZIADI. "NORMALIZED EXPRESSIONS AND FINITE AUTOMATA". International Journal of Algebra and Computation 17, n.º 01 (febrero de 2007): 141–54. http://dx.doi.org/10.1142/s021819670700355x.

Texto completo
Resumen
There exist two well-known quotients of the position automaton of a regular expression. The first one, called the equation automaton, was first introduced by Mirkin from the notion of prebase and has been redefined by Antimirov from the notion of partial derivative. The second one, due to Ilie and Yu and called the follow automaton, can be obtained by eliminating ε-transitions in an ε-NFA that is always smaller than the classical ε-NFAs (Thompson, Sippu and Soisalon–Soininen). Ilie and Yu discussed the difficulty of succeeding in a theoretical comparison between the size of the follow automaton and the size of the equation automaton and concluded that it is very likely necessary to realize experimental studies. In this paper we solve the theoretical question, by first defining a set of regular expressions, called normalized expressions, such that every regular expression can be normalized in linear time, and proving then that the equation automaton of a normalized expression is always smaller than its follow automaton.
Los estilos APA, Harvard, Vancouver, ISO, etc.
3

Kondo, Hiroko X., Haruki Nakamura y Yu Takano. "Depolarizing Effects in Hydrogen Bond Energy in 310-Helices Revealed by Quantum Chemical Analysis". International Journal of Molecular Sciences 23, n.º 16 (12 de agosto de 2022): 9032. http://dx.doi.org/10.3390/ijms23169032.

Texto completo
Resumen
Hydrogen-bond (H-bond) energies in 310-helices of short alanine peptides were systematically examined by precise DFT calculations with the negative fragmentation approach (NFA), a modified method based on the molecular tailoring approach. The contribution of each H-bond was evaluated in detail from the 310-helical conformation of total energies (whole helical model, WH3-10 model), and the results were compared with the property of H-bond in α-helix from our previous study. The H-bond energies of the WH3-10 model exhibited tendencies different from those exhibited by the α-helix in that they depended on the helical position of the relevant H-bond pair. H-bond pairs adjacent to the terminal H-bond pairs were observed to be strongly destabilized. The analysis of electronic structures indicated that structural characteristics cause the destabilization of the H-bond in 310-helices. We also found that the longer the helix length, the more stable the H-bond in the terminal pairs of the WH3-10 model, suggesting the action of H-bond cooperativity.
Los estilos APA, Harvard, Vancouver, ISO, etc.
4

Sato, T., J. Hirono, M. Tonoike y M. Takebayashi. "Tuning specificities to aliphatic odorants in mouse olfactory receptor neurons and their local distribution". Journal of Neurophysiology 72, n.º 6 (1 de diciembre de 1994): 2980–89. http://dx.doi.org/10.1152/jn.1994.72.6.2980.

Texto completo
Resumen
1. Odor responses to two homologous series of n-fatty acids (nFA) and n-aliphatic alcohols (nAA) with a straight chain of three to nine carbons were examined by measuring odor-induced [Ca2+]i increase in mouse olfactory receptor neurons (ORNs) isolated by the tissue-printing method. 2. One-third of the ORNs responsive to nFA and/or nAA were alternately sensitive to either type of odorant. Their sensitivities were usually near maximal for one or two odorants and decreased with differences in the carbon chain length from the tuned odorants. 3. Two-thirds of the ORNs responsive to nFA and/or nAA were sensitive to both types of odorants. Most of them were also tuned to one or two odorants in each series with similar carbon chain lengths and showed a decrease of sensitivity with increasing stereochemical discrepancy, similar to nFA/nAA discriminating ORNs. 4. In 10 of 20 non-nFA/nAA discriminating ORNs, the sensitivity to nFA was > 10 times greater than to nAA, and 80% of them were localized in a central region of olfactory epithelium on the septum wall where ORNs preferentially project to the dorsomedial or centromedial regions of the olfactory bulb. In addition, the sensitivity to three series of n-aliphatic odorants with an added amino group was examined. Sensitivity became higher as the electronegativity of the functional groups increased, suggesting that a hydrogen bond might partly mediate affinity in one type of non-nFA/nAA discriminating ORNs. 5. The diversity in odorant tuning specificity and sensitivity of the individual ORNs indicated that their receptor sites were finely tuned to the stereochemical structures of numerous odorants by changes in the three-dimensional size and intermolecular positions of the hydrophobic domains for hydrophobic bond, as well as the proton-acceptor or donor for the hydrogen bond and the electrical charge for the ionic bond. 6. The subpopulation of ORNs tuned to an individual odorant increased as the length of carbon chain of the odorant increased from three to nine. This tendency was more marked for nFA than for nAA in the case of non-nFA/nAA discriminating ORNs. 7. Data obtained by the in vitro approach using the tissue-printing method suggested that three or more subtypes of ORNs, which were similar in some cases and significantly different in other cases, were located within close proximity to one another.
Los estilos APA, Harvard, Vancouver, ISO, etc.
5

Sukamto, L. Agus. "HYPOCOTYL ORIENTATION AND HORMONE INFLUENCE IN VITRO REGENERATION OF ROOT AND SHOOT OF CAULIFLOWER (BRASSICA OLERACEA L. VAR. BOTRYTIS) `PUAKEA'." HortScience 27, n.º 6 (junio de 1992): 617g—618. http://dx.doi.org/10.21273/hortsci.27.6.617g.

Texto completo
Resumen
Hypocotyl sections of cauliflower were cultured in horizontal, upright or inverted positions on Murashige and Skoog medium with different concentrations of 6-benzylaminopurine (BAP) and α-naphthylacetic acid (NAA). Inverted position gave the highest differentiated score and greatest fresh weight of the two month-old tissues, followed by upright and horizontal positions respectively. Combination BAP and NAA caused synergistic effect on tissues. The best treatment for getting callus was combination of 5 mg/liter BAP, 2 mg/liter NAA and upright position, whereas for getting tissue differentiation was combination of 5 mg/liter BAP, 1 mg/liter NAA and inverted position.
Los estilos APA, Harvard, Vancouver, ISO, etc.
6

Plotkin, S. R., M. Singh, W. Cai, C. O'Donnell, S. Esparza, M. J. Smith, G. J. Harris, A. Muzikansky, M. A. Bredella y A. Kassarjian. "Whole-body MRI evaluation of tumor burden in the neurofibromatosis tumor suppressor syndromes". Journal of Clinical Oncology 27, n.º 15_suppl (20 de mayo de 2009): 2074. http://dx.doi.org/10.1200/jco.2009.27.15_suppl.2074.

Texto completo
Resumen
2074 Background: Neurofibromatosis 1 (NF1), NF2, and schwannomatosis are a group of related genetic disorders in which affected individuals share the predisposition to develop multiple neurofibromas and schwannomas. The prevalence of internal tumors is not known because current estimates are based on regional MRI scans that may not detect occult tumors. A rapid and sensitive method to detect internal tumors is highly desirable since they can cause neurologic dysfunction, compress vital structures, or transform into malignant tumors. Whole-body MRI (WBMRI) is an imaging technique by which the entire body can be imaged in a relatively short time without the use of ionizing radiation. Methods: We performed WBMRI in subjects with NF1, NF2, or schwannomatosis as part of an IRB-approved research study. Each subject was imaged from head to ankles in the supine position using a 1.5 Tesla magnet, integrated body coil, and no intravenous contrast. Using five acquisitions, the entire body was imaged using a fat suppressed fluid sensitive STIR sequence. The images were then fused into a single whole body DICOM image. The number and type of tumors (discrete vs. plexiform) were identified by a board-certified radiologist and tumor volume was calculated using semi-automated analysis. Results: A total of 100 subjects were imaged (NF1–50; NF2–25, schwannomatosis-25). Sixty-one percent of subjects had ≥1 internal tumor. The median number of tumors in affected individuals was 5 (range, 1 to 63 tumors). Overall, the legs harbored the greatest number of tumors (33%), followed by the pelvis (18%), thorax (15%), abdomen (12%), arms (10%), and head/neck (7%). Only 40% of internal tumors were classified as plexiform yet these tumors contributed 78% of the tumor burden by volume. Conclusions: WBMRI scan is a powerful tool to evaluate the number, size, and distribution of internal tumors in patients with neurofibromatosis. This technique provides unique phenotypic information for genetic studies on NF1, NF2, and schwannomatosis. In addition, WBMRI may prove useful in identifying individual patients at high risk for complications (such as neurologic dysfunction or malignant transformation) due to heavy internal tumor burden and in determining the efficacy of antitumor drugs in this unique patient population. No significant financial relationships to disclose.
Los estilos APA, Harvard, Vancouver, ISO, etc.
7

McRae, E. G. y R. A. Malic. "Low energy electron diffraction with position-sensitive detection: intensity measurements and comparison with positron diffraction for NaF(001)". Surface Science Letters 177, n.º 1 (noviembre de 1986): A591. http://dx.doi.org/10.1016/0167-2584(86)91075-3.

Texto completo
Los estilos APA, Harvard, Vancouver, ISO, etc.
8

McRae, E. G. y R. A. Malic. "Low energy electron diffraction with position-sensitive detection: Intensity measurements and comparison with positron diffraction for NaF(001)". Surface Science 177, n.º 1 (noviembre de 1986): 74–89. http://dx.doi.org/10.1016/0039-6028(86)90258-x.

Texto completo
Los estilos APA, Harvard, Vancouver, ISO, etc.
9

Cameron, Don. "The NEA Position on Testing In-Service Teachers". Educational Measurement: Issues and Practice 4, n.º 3 (septiembre de 1985): 26–27. http://dx.doi.org/10.1111/j.1745-3992.1985.tb00459.x.

Texto completo
Los estilos APA, Harvard, Vancouver, ISO, etc.
10

Quinsey, Carolyn S., Katie Krause, Lissa C. Baird, Christina M. Sayama y Nathan R. Selden. "Incidence of symptomatic tethered spinal cord in pediatric patients presenting with neurofibromatosis types 1 and 2". Journal of Neurosurgery: Pediatrics 21, n.º 5 (mayo de 2018): 456–59. http://dx.doi.org/10.3171/2017.12.peds17306.

Texto completo
Resumen
OBJECTIVEThe relationship between a tethered cord (TC) and neurofibromatosis type 1 (NF1) and NF2 is not known. The purpose of this study was to define the incidence of TC in pediatric neurosurgical patients who present with NF.METHODSThe authors performed a single-institution (tertiary care pediatric hospital) 10-year retrospective analysis of patients who were diagnosed with or who underwent surgery for a TC and/or NF. Clinical and radiological characteristics were analyzed, as was histopathology.RESULTSA total of 424 patients underwent surgery for a TC during the study period, and 67 patients with NF were seen in the pediatric neurosurgery clinic. Of these 67 patients, 9 (13%) were diagnosed with a TC, and filum lysis surgery was recommended. Among the 9 patients with NF recommended for TC-release surgery, 4 (44%) were female, the mean age was 8 years (range 4–14 years), the conus position ranged from L1–2 to L-3, and 3 (33%) had a filum lipoma, defined as high signal intensity on T1-weighted MR images. All 9 of these patients presented with neuromotor, skeletal, voiding, and/or pain-related symptoms. Histopathological examination consistently revealed dense fibroconnective tissue and blood vessels.CONCLUSIONSDespite the lack of any known pathophysiological relationship between NF and TC, the incidence of a symptomatic TC in patients with NF1 and NF2 who presented for any reason to this tertiary care pediatric neurosurgery clinic was 13%. Counseling patients and families regarding TC symptomatology might be indicated in this patient population.
Los estilos APA, Harvard, Vancouver, ISO, etc.
11

Kwiecinski, Jacek, Piotr J. Slomka, Marc R. Dweck, David E. Newby y Daniel S. Berman. "Vulnerable plaque imaging using 18F-sodium fluoride positron emission tomography". British Journal of Radiology 93, n.º 1113 (1 de septiembre de 2020): 20190797. http://dx.doi.org/10.1259/bjr.20190797.

Texto completo
Resumen
Positron emission tomography (PET) with 18F-sodium fluoride (18F-NaF) has emerged as a promising non-invasive imaging modality to identify high-risk and ruptured atherosclerotic plaques. By visualizing microcalcification, 18F-NaF PET holds clinical promise in refining how we evaluate coronary artery disease, shifting our focus from assessing disease burden to atherosclerosis activity. In this review, we provide an overview of studies that have utilized 18F-NaF PET for imaging atherosclerosis. We discuss the associations between traditional coronary artery disease measures (risk factors) and 18F-NaF plaque activity. We also present the data on the histological validation as well as show how 18F-NaF uptake is associated with plaque morphology on intravascular and CT imaging. Finally, we discuss the technical challenges associated with 18F-NaF coronary PET highlighting recent advances in this area.
Los estilos APA, Harvard, Vancouver, ISO, etc.
12

Amsler, S., J. Filledier y R. Millogo. "Attractifs olfactifs pour la capture de Glossina tachinoides et Glossina morsitans submorsitans (Diptera : Glossinidae) au Bukina Faso." Revue d’élevage et de médecine vétérinaire des pays tropicaux 47, n.º 3 (1 de marzo de 1994): 301–11. http://dx.doi.org/10.19182/remvt.9093.

Texto completo
Resumen
Deux expériences sont menées en saison sèche au Burkina Faso sur le site expérimental de la Comoé (zone soudano-guinéenne), afin d'étudier l'influence de la position du sachet diffuseur de produits olfactifs pour Glossina tachinoides et Glossina morsitans submorsitans. Cet essai compare les positions interne et externe du méta-crésol et de l'association méta-crésol/octénol (proportions 3/1) dans des pièges biconiques. La position du sachet n'apparaît pas comme un facteur fondamental d'efficacité des pièges et les résultats obtenus sont variables selon la saison et l'espèce de glossine considérée. Des différences selon le sexe sont également notées. Le rôle de la distance n'a pas été étudié.
Los estilos APA, Harvard, Vancouver, ISO, etc.
13

Lapa, Paula, Tiago Saraiva, Rodolfo Silva, Margarida Marques, Gracinda Costa y João Pedroso Lima. "Superioridade da PET/CT com FNa-F18 na Deteção de Metástases Ósseas quando Comparada com Outros Métodos de Diagnóstico por Imagem". Acta Médica Portuguesa 30, n.º 1 (31 de enero de 2017): 53. http://dx.doi.org/10.20344/amp.7818.

Texto completo
Resumen
Introduction: The 18F-NaF positron emission tomography/computed tomography is being considered as an excellent imaging modalityfor bone metastases detection. This ability was compared with other imaging techniques.Material and Methods: We retrospectively evaluated 114 patients who underwent 18F-NaF positron emission tomography/ computed tomography. Of these, 49 patients also had bone scintigraphy, 61 18F-FDG positron emission tomography/computed tomography and 10 18F-FCH positron emission tomography/computed tomography. We identified the technique that detected the largest number of bone metastases. For the detection of skeletal metastases with the 18F-NaF positron emission tomography/computed tomography study,the contribution of the positron emission tomography component was compared with the contribution of the computed tomography component. Cases in which 18F-NaF positron emission tomography/computed tomography and bone scintigraphy required further additional tests for diagnosis clarification were registered.Results: The 18F-NaF positron emission tomography/computed tomography was superior to bone scintigraphy in 49% of the patients(p < 0.001); it was superior to 18F-FDG positron emission tomography/computed tomography in 59% of the patients (p < 0.001) and it was superior to 18F-FCH positron emission tomography/computed tomography in 40% of the patients (p < 0.001). None of the compared imaging techniques were superior to 18F-NaF positron emission tomography/computed tomography. The positron emission tomography component was superior to computed tomography in 35% of the cases (p < 0.001). Further investigation was suggested in only 3.5% of patients who underwent 18F-NaF positron emission tomography/computed tomography (45% for bone scintigraphy) (p < 0.001).Discussion: As with other authors, our experience also confirms that 18F-NaF positron emission tomography/computed tomography is an excellent imaging modality for the detection of bone metastases, detecting lesions in more patients and more lesions per patient.Conclusion: The 18F-NaF positron emission tomography/computed tomography showed a superior ability for the detection of bone metastases when compared with bone scintigraphy, 18F-FDG positron emission tomography/computed tomography and 18F-FCH positron emission tomography/computed tomography.
Los estilos APA, Harvard, Vancouver, ISO, etc.
14

McClaren, Nicholas y Andrea Vocino. "The direct and indirect effect of NFC on marketers’ work norms, vocational socialization, individual ethical position, and ethical perceptions". Journal of Business & Industrial Marketing 32, n.º 1 (6 de febrero de 2017): 109–23. http://dx.doi.org/10.1108/jbim-05-2015-0081.

Texto completo
Resumen
Purpose The research sought to expand the conceptual understanding of the antecedents of decision-making under ethical conditions. This study aims to better understand the relationships among need for cognition (NFC), the individual ethical positions of ethical idealism and ethical relativism, organizational and professional socialization, work-related norms and ethical perceptions. Design/methodology/approach The study compared the impact of environmental influences (i.e. socialization and work-related norm) and individual temporally stable characteristics (i.e. NFC and ethical position) on ethical perceptions. The research surveyed marketers and tested a hypothesized model using structural equation modeling. Findings NFC influences marketers’ individual ethical position, their professional socialization and their work norms. The work norms of marketers are influenced by individual ethical position and organizational socialization, but not by professional socialization. Professional socialization is influenced by ethical idealism and not ethical relativism. Research limitations/implications A judgmental sampling technique was used and the findings cannot be generalized to other populations. Practical implications This research provides managers with alternative tools to encourage compliance with professional and corporate guidelines. If managers are seeking an enduring positive influence on work norms, they should be as concerned about the thinking of their employees and their employees’ ethical positions as they are with the vocational rules their subordinates adopt. Social implications Society will benefit from better understanding the different ways in which the ethical perceptions of individual employees are influenced and the various ways in which managers can contribute to ethically responsible corporations. Originality/value Although NFC has been examined in other vocational and decision-making contexts, its influence on individual ethical position, vocational socialization and work-related norms has not been empirically examined in ethical contexts for business decision-making.
Los estilos APA, Harvard, Vancouver, ISO, etc.
15

Kim, Yong-Hak, Woo-Seok Song, Hayoung Go, Chang-Jun Cha, Cheolju Lee, Myeong-Hee Yu, Peter C. K. Lau y Kangseok Lee. "2-Nitrobenzoate 2-Nitroreductase (NbaA) Switches Its Substrate Specificity from 2-Nitrobenzoic Acid to 2,4-Dinitrobenzoic Acid under Oxidizing Conditions". Journal of Bacteriology 195, n.º 2 (2 de noviembre de 2012): 180–92. http://dx.doi.org/10.1128/jb.02016-12.

Texto completo
Resumen
ABSTRACT2-Nitrobenzoate 2-nitroreductase (NbaA) ofPseudomonas fluorescensstrain KU-7 is a unique enzyme, transforming 2-nitrobenzoic acid (2-NBA) and 2,4-dinitrobenzoic acid (2,4-DNBA) to the 2-hydroxylamine compounds. Sequence comparison reveals that NbaA contains a conserved cysteine residue at position 141 and two variable regions at amino acids 65 to 74 and 193 to 216. The truncated mutant Δ65-74 exhibited markedly reduced activity toward 2,4-DNBA, but its 2-NBA reduction activity was unaffected; however, both activities were abolished in the Δ193-216 mutant, suggesting that these regions are necessary for the catalysis and specificity of NbaA. NbaA showed different lag times for the reduction of 2-NBA and 2,4-DNBA with NADPH, and the reduction of 2,4-DNBA, but not 2-NBA, failed in the presence of 1 mM dithiothreitol or under anaerobic conditions, indicating oxidative modification of the enzyme for 2,4-DNBA. The enzyme was irreversibly inhibited by 5,5′-dithio-bis-(2-nitrobenzoic acid) and ZnCl2, which bind to reactive thiol/thiolate groups, and was eventually inactivated during the formation of higher-order oligomers at high pH, high temperature, or in the presence of H2O2. SDS-PAGE and mass spectrometry revealed the formation of intermolecular disulfide bonds by involvement of the two cysteines at positions 141 and 194. Site-directed mutagenesis indicated that the cysteines at positions 39, 103, 141, and 194 played a role in changing the enzyme activity and specificity toward 2-NBA and 2,4-DNBA. This study suggests that oxidative modifications of NbaA are responsible for the differential specificity for the two substrates and further enzyme inactivation through the formation of disulfide bonds under oxidizing conditions.
Los estilos APA, Harvard, Vancouver, ISO, etc.
16

Wattimena, Lucas. "ARSITEKTUR RUMAH TRADISIONAL DI MALUKU (STUDI ETNOARKEOLOGI)". Berkala Arkeologi 33, n.º 2 (1 de diciembre de 2013): 201–10. http://dx.doi.org/10.30883/jba.v33i2.28.

Texto completo
Resumen
South Ceram coastal communities consist of several groups, among others: Noa nea, Simalouw, Yalatan and Rohua. Each group has a hallmark of culture, as the identity of each society. It is manifestated - among other - in the traditional architecture. The meaning of traditional architecture here is the traditional house, where the traditional house on the south coast of Ceram Island, is not merely seen as a physical building but also has the structure (roles, functions and position) in the development of the society.it could be seen in the pattern of traditional houses. The research showed that the traditional houses had different structure (roles, functions and positions), but on the other those variety of function are then adapted to their roles according to the southtern coastal communities of Ceram island (Noa Nea, Rohua, Yalatan) traditional houses can be grouped into traditional houses and big houses.
Los estilos APA, Harvard, Vancouver, ISO, etc.
17

Arnauld, Marie-Charlotte. "Le cas maya : positions récentes". Les Nouvelles de l'archéologie, n.º 142 (18 de enero de 2016): 55–59. http://dx.doi.org/10.4000/nda.3281.

Texto completo
Los estilos APA, Harvard, Vancouver, ISO, etc.
18

Lavigne, Gilles, Nanouk Daudelin y Gilles Ritchot. "L’ethnicisation de l’établissement humain en Amérique du Nord : l’exemple du quartier portugais à Montréal". Cahiers de géographie du Québec 39, n.º 108 (12 de abril de 2005): 417–43. http://dx.doi.org/10.7202/022518ar.

Texto completo
Resumen
L’ethnicisation est un effet de l'immigration, sauf que les facteurs externes qui lui sont reliés font apparaître une dynamique interne propre aux positions géographiques ciblées. Cette dynamique interne est objective. Elle relève d'un contrôle de la mobilité par l'appropriation, qui pour sa part fait appel à une médiation politique garantie par l'État. L'émergence d'un quartier portugais à Montréal, à compter de 1956 environ, n'a pas seulement procédé d'une transplantation de caractères culturels en provenance des Açores. Elle a témoigné plutôt d'un investissement de valeurs culturelles dans une position terminative urbaine au demeurant régulée en fonction d'une dynamique interne à l'espace politique local.
Los estilos APA, Harvard, Vancouver, ISO, etc.
19

Lemme, Nicholas J., Neill Y. Li, Justin E. Kleiner, Sydney Tan, Steven F. DeFroda y Brett D. Owens. "Epidemiology and Video Analysis of Achilles Tendon Ruptures in the National Basketball Association". American Journal of Sports Medicine 47, n.º 10 (3 de julio de 2019): 2360–66. http://dx.doi.org/10.1177/0363546519858609.

Texto completo
Resumen
Background: There is a paucity of literature regarding risk factors and mechanisms of Achilles tendon (AT) ruptures in the National Basketball Association (NBA). Purpose: To identify the risk factors and outcomes of AT ruptures in NBA athletes. Furthermore, using video analysis, to characterize the mechanisms of rupture by identifying the most common playing situations and lower extremity positions at the time of injury. Study Design: Descriptive epidemiology study. Methods: AT ruptures in the NBA that occurred between the seasons of 1969-1970 and 2017-2018 were identified. Player data collected included age, position, body mass index, total games started before and after injury, and Player Efficiency Rating. Injury-related variables collected included date of injury, laterality, minutes played before injury, operative versus nonoperative treatment, and time to return to play. Available video footage was analyzed for the mechanism and body position at the time of injury. Univariable and multivariable linear regression was used to compare changes in performance before and after AT rupture. Statistical significance was set at P < .05. Results: Forty-four ruptures were identified between 1970 and 2018. The mean age was 28.3 years, with players averaging 6.8 seasons before AT rupture. AT ruptures were most prevalent during early-season game play (27.3%), followed by preseason (18.2%) and late season (18.2%). More than a third (36.8%) of players either did not return to play or started in fewer than 10 games in the remainder of their career, with 21% of ruptures leading to retirement. The mean time to return to play was 10.5 months. The Player Efficiency Rating declined by an average of 2.9 points (range, –11.5 to +2.3) ( P < .001). Analysis of available injury footage (n = 12) demonstrated all ruptures to be noncontact in nature, most commonly occurring just before takeoff as the player began to push off from a stopped position, with the foot in dorsiflexion, the knee in early flexion, and the hip in extension. Conclusion: In the NBA, a majority of AT ruptures occur early in the season, in veteran players, with almost half not returning to play or starting fewer than 10 games in the remainder of their career. The most common mechanism of injury is taking off from a stopped position just before toe-off in a dorsiflexed foot.
Los estilos APA, Harvard, Vancouver, ISO, etc.
20

Mills, A. P. y W. S. Crane. "Low-energy positron-diffraction study of NaF and LiF". Physical Review B 31, n.º 6 (15 de marzo de 1985): 3988–92. http://dx.doi.org/10.1103/physrevb.31.3988.

Texto completo
Los estilos APA, Harvard, Vancouver, ISO, etc.
21

Hutter, Sonja, Rosario M. Piro, Sebastian M. Waszak, Hildegard Kehrer-Sawatzki, Reinhard E. Friedrich, Alvaro Lassaletta, Olaf Witt et al. "No correlation between NF1 mutation position and risk of optic pathway glioma in 77 unrelated NF1 patients". Human Genetics 135, n.º 5 (11 de marzo de 2016): 469–75. http://dx.doi.org/10.1007/s00439-016-1646-x.

Texto completo
Los estilos APA, Harvard, Vancouver, ISO, etc.
22

Acosta, Laura K., Cheryl Suwen Law, Abel Santos, Josep Ferré-Borrull y Lluis F. Marsal. "Tuning intrinsic photoluminescence from light-emitting multispectral nanoporous anodic alumina photonic crystals". APL Photonics 7, n.º 2 (1 de febrero de 2022): 026108. http://dx.doi.org/10.1063/5.0078505.

Texto completo
Resumen
To control and harness the intrinsic photoluminescence of solid-state, light-emitting materials produced by self-organization approaches remain challenging. This study demonstrates how the intrinsic broadband photoluminescence emission from nanoporous anodic alumina (NAA) produced by anodization of aluminum in oxalic acid electrolyte can be precisely tuned by engineering its structure in the form of photonic crystals (PCs). A combination of pulse and constant anodization in distinct acid electrolytes makes it possible to engineer a novel heterogeneous optical structure consisting of two layers: (i) a non-emitting, light-filtering layer in the form of multi-spectral nanoporous anodic alumina photonic crystals (MS–NAA–PCs) on its top (i.e., 58 µm thick and average pore diameter of 17 nm) and (ii) an intrinsically light-emitting layer of NAA at its bottom (i.e., 50 µm thick an average pore diameter of 40 nm). MS–NAA–PCs are engineered to feature three intense, well-resolved photonic stopbands (PSBs), the positions of which are spaced at specific regions of the visible spectrum from ∼380 to 560 nm. It is demonstrated that the PSBs of the non-emitting MS–NAA–PCs on top of the heterogeneous optical structure act as a light-filtering component, which makes it possible to narrow and tune the characteristically broad, Gaussian-like photoluminescence emission from the underlying light-emitting NAA layer. This structural design makes it possible to narrow the width of photoluminescence emission up to ∼50 nm and blue shift its position for ∼15 nm. Our advances pave the way for novel designs of intrinsic, light-emitting NAA-based PC structures, which could find broad applicability across light technologies, such as sensing and biosensing, photodetection, and solar light harvesting.
Los estilos APA, Harvard, Vancouver, ISO, etc.
23

García-Rubio, Javier, Daniel Carreras, Sebastian Feu, Antonio Antunez y Sergio J. Ibáñez. "Citius, Altius, Fortius; Is It Enough to Achieve Success in Basketball?" International Journal of Environmental Research and Public Health 17, n.º 20 (9 de octubre de 2020): 7355. http://dx.doi.org/10.3390/ijerph17207355.

Texto completo
Resumen
The NBA Draft Combine includes a series of standardized measurements and drills that provide NBA teams with an opportunity to evaluate players. The purpose of this research was to identify the Combine tests that explain draft position and future performance in the NBA rookie season. Variables were selected from the previous categories of anthropometric measurements and strength and agility tests. A regression analysis was carried out. Combine variables, anthropometric and agility/strength variables were analyzed to explore their effect on draft position. Moreover, correlation analyses were performed to identify relationships among: (i) Combine anthropometric and strength and agility measures and game performance through game related statistics; and (ii) the draft position and game performance using Pearson’s correlation coefficients. Results show that the Combine test does not predict draft position, with the exception of hand width and height in frontcourt players, and standard vertical jump and running vertical jump. Future performance indicators were explained by several Combine tests in all players.
Los estilos APA, Harvard, Vancouver, ISO, etc.
24

Fan, Q., M. Paradon, C. Salvat, G. Bereziat y J. L. Olivier. "C/EBP factor suppression of inhibition of type II secreted phospholipase A2 promoter in HepG2 cells: possible role of single-strand binding proteins." Molecular and Cellular Biology 17, n.º 8 (agosto de 1997): 4238–48. http://dx.doi.org/10.1128/mcb.17.8.4238.

Texto completo
Resumen
We previously reported that the type II secreted phospholipase A2 (sPLA2) promoter from positions (-326 to +20) ([-326;+20] promoter) is negatively regulated by two adjacent regulatory elements, C (-210 to -176) and D (-247 to -210). This study examines in greater detail the way in which this negative regulation operates. Successive 5' deletions of the [-326;+20] type II sPLA2 promoter indicated that the region upstream of position -195 inhibits the transcription activity sixfold in HepG2 cells but not in HeLa cells. Although the whole [-326;-176] region decreased the activity of a heterologous thymidine kinase promoter, this effect was orientation and position sensitive. C/EBP beta, C/EBP alpha, and C/EBP delta, which bind to element C, prevented the inhibition of promoter activity. Electrophoretic mobility shift experiments identified the binding of NF1-like proteins to the [-225;-218] site, which overlaps an insulin response-like sequence, 5'-TGTTTTG-3'. This sequence bound a factor which also recognized the promoters of the apolipoproteins C-III and A-II. Substitutions preventing the binding of this factor or the NF1-like proteins did not increase the transcription activity, but substitution in the [-217;-204] sequence blocked the transcription inhibition. This sequence did not bind any double-strand binding factor, but its antisense strand is critical for the binding of single-strand binding proteins to the [-232;-191] region. We therefore suggest that these single-strand binding proteins are involved in the inhibitory mechanism.
Los estilos APA, Harvard, Vancouver, ISO, etc.
25

Aronow, B. J., R. N. Silbiger, M. R. Dusing, J. L. Stock, K. L. Yager, S. S. Potter, J. J. Hutton y D. A. Wiginton. "Functional analysis of the human adenosine deaminase gene thymic regulatory region and its ability to generate position-independent transgene expression". Molecular and Cellular Biology 12, n.º 9 (septiembre de 1992): 4170–85. http://dx.doi.org/10.1128/mcb.12.9.4170-4185.1992.

Texto completo
Resumen
We previously observed that human ADA gene expression, required for the intrathymic maturation of T cells, is controlled by first-intron sequences. Used as a cis activator, the intron generates copy-dependent reporter expression in transgenic thymocytes, and we here dissect its critical determinants. Of six DNase I-hypersensitive sites (HS sites) in the intron, only HS III was a transfection-active classic enhancer in T cells. The enhancer contains a critical core region, ACATGGCAGTTGGTGGTGGAGGGGAACA, that interacts with at least two factors, ADA-NF1 and ADA-NF2. Activity of the core is strongly augmented by adjacent elements contained within a 200-bp domain corresponding to the limits of HS III hypersensitivity. These core-adjacent sequences include consensus matches for recognition by the AP-1, TCF-1 alpha, mu E, and Ets transcription factor families. In contrast, considerably more extensive sequences flanking the enhancer domain were required for position-independent and copy-proportional expression in transgenic mouse thymocytes. The additionally required upstream segment encompassed the nonenhancer HS II site. The required downstream segment, composed largely of Alu-repetitive DNA, was non-DNase I hypersensitive. Transgenes that lacked either segment were subject to strong positional effects. Among these variably expressing lines, the expression level correlated with the degree of hypersensitivity at HS III. This finding suggests that formation of hypersensitivity is normally facilitated by the flanking segments. These results delineate a complex thymic regulatory region within the intron and indicate that a series of interactions is necessary for the enhancer domain to function consistently within chromatin.
Los estilos APA, Harvard, Vancouver, ISO, etc.
26

Aronow, B. J., R. N. Silbiger, M. R. Dusing, J. L. Stock, K. L. Yager, S. S. Potter, J. J. Hutton y D. A. Wiginton. "Functional analysis of the human adenosine deaminase gene thymic regulatory region and its ability to generate position-independent transgene expression." Molecular and Cellular Biology 12, n.º 9 (septiembre de 1992): 4170–85. http://dx.doi.org/10.1128/mcb.12.9.4170.

Texto completo
Resumen
We previously observed that human ADA gene expression, required for the intrathymic maturation of T cells, is controlled by first-intron sequences. Used as a cis activator, the intron generates copy-dependent reporter expression in transgenic thymocytes, and we here dissect its critical determinants. Of six DNase I-hypersensitive sites (HS sites) in the intron, only HS III was a transfection-active classic enhancer in T cells. The enhancer contains a critical core region, ACATGGCAGTTGGTGGTGGAGGGGAACA, that interacts with at least two factors, ADA-NF1 and ADA-NF2. Activity of the core is strongly augmented by adjacent elements contained within a 200-bp domain corresponding to the limits of HS III hypersensitivity. These core-adjacent sequences include consensus matches for recognition by the AP-1, TCF-1 alpha, mu E, and Ets transcription factor families. In contrast, considerably more extensive sequences flanking the enhancer domain were required for position-independent and copy-proportional expression in transgenic mouse thymocytes. The additionally required upstream segment encompassed the nonenhancer HS II site. The required downstream segment, composed largely of Alu-repetitive DNA, was non-DNase I hypersensitive. Transgenes that lacked either segment were subject to strong positional effects. Among these variably expressing lines, the expression level correlated with the degree of hypersensitivity at HS III. This finding suggests that formation of hypersensitivity is normally facilitated by the flanking segments. These results delineate a complex thymic regulatory region within the intron and indicate that a series of interactions is necessary for the enhancer domain to function consistently within chromatin.
Los estilos APA, Harvard, Vancouver, ISO, etc.
27

Tritto, Viviana, Marica Eoli, Rosina Paterra, Serena Redaelli, Marco Moscatelli, Francesco Rusconi y Paola Riva. "Characterization of 22q12 Microdeletions Causing Position Effect in Rare NF2 Patients with Complex Phenotypes". International Journal of Molecular Sciences 23, n.º 17 (2 de septiembre de 2022): 10017. http://dx.doi.org/10.3390/ijms231710017.

Texto completo
Resumen
Neurofibromatosis type 2 is an autosomal dominant tumor-prone disorder mainly caused by NF2 point mutations or intragenic deletions. Few individuals with a complex phenotype and 22q12 microdeletions have been described. The 22q12 microdeletions’ pathogenic effects at the genetic and epigenetic levels are currently unknown. We here report on 22q12 microdeletions’ characterization in three NF2 patients with different phenotype complexities. A possible effect of the position was investigated by in silico analysis of 22q12 topologically associated domains (TADs) and regulatory elements, and by expression analysis of 12 genes flanking patients’ deletions. A 147 Kb microdeletion was identified in the patient with the mildest phenotype, while two large deletions of 561 Kb and 1.8 Mb were found in the other two patients, showing a more severe symptomatology. The last two patients displayed intellectual disability, possibly related to AP1B1 gene deletion. The microdeletions change from one to five TADs, and the 22q12 chromatin regulatory landscape, according to the altered expression levels of four deletion-flanking genes, including PIK3IP1, are likely associated with an early ischemic event occurring in the patient with the largest deletion. Our results suggest that the identification of the deletion extent can provide prognostic markers, predictive of NF2 phenotypes, and potential therapeutic targets, thus overall improving patient management.
Los estilos APA, Harvard, Vancouver, ISO, etc.
28

DOFNY, Jacques. "Lutte de sexes et lutte de classes". Sociologie et sociétés 6, n.º 1 (30 de septiembre de 2002): 3–16. http://dx.doi.org/10.7202/001192ar.

Texto completo
Resumen
Résumé La "question féminine", comme la "question nationale" ou la "question régionale" n'a jamais trouvé de réponse satisfaisante. Le mouvement pour la libération des femmes est-il un mouvement autonome qui passe à travers toutes les classes, ou est-il un combat lié à celui de la classe ouvrière et/ou de la classe moyenne? Ou surgit-il de nouvelles positions stratégiques occupées à la suite de transformations conjoncturelles et structurelles? Analysant les salaires comparés des hommes et des femmes, les causes des différences de salaire, la position dans les syndicats et des syndicats à l'égard des femmes salariées, l'article conclut en distinguant les différents combats que les femmes mènent et les situent par rapport à la lutte des classes.
Los estilos APA, Harvard, Vancouver, ISO, etc.
29

Zampelas, A., Christine M. Williams, Linda M. Morgan, J. Wright y P. T. Quinlan. "The effect of triacylglycerol fatty acid positional distribution on postprandial plasma metabolite and hormone responses in normal adult men". British Journal of Nutrition 71, n.º 3 (marzo de 1994): 401–10. http://dx.doi.org/10.1079/bjn19940147.

Texto completo
Resumen
The present study has examined the possibility that the positional distribution of fatty acids on dietary triacylglycerol (TAG) influences the postprandial response to a liquid meal in adult subjects. Postprandial TAG, non-esterified fatty acids (NEFA), ketones, glucose, insulin and gastric inhibitory polypeptide (GIP) responses were monitored in sixteen normal adult male subjects over 6 h following consumption of test meals containing dietary TAG in which palmitic acid was predominantly on the sn-1 (Control) or sn-2 positions (Betapol). Plasma total TAG, chylomicron-rich TAG and chylomicron-poor TAG concentrations were identical in response to the two test meals. The peak increase (mean (sd)) in chylomicron TAG was 0 85 (0 46) mmol/l after the Control meal and 0 85 (0 42) mmol/l after the Betapol meal. Plasma glucose, insulin, GIP, NEFA and ketone concentrations were also very similar following the two meals. It is concluded that dietary TAG containing saturated fatty acids on the sn-2 position appear in plasma at a similar level and over a similar timescale to TAG in which saturated fatty acids are predominantly located on sn-1 or sn-3 positions. The results reported in the present study demonstrate that the positional distribution of fatty acids on dietary TAG is not an important determinant of postprandial lipaemia in adult male subjects, but do not exclude the possibility that different responses may occur when these dietary TAG are given long term.
Los estilos APA, Harvard, Vancouver, ISO, etc.
30

Agha, Nola y David Berri. "Demand for Basketball: A Comparison of the WNBA and NBA". International Journal of Sport Finance 18, n.º 1 (febrero de 2023): 35–44. http://dx.doi.org/10.32731/ijsf/181.022023.03.

Texto completo
Resumen
There is considerable discussion regarding interest in women’s basketball, with critics often comparing the Women’s National Basketball Association (WNBA) and the National Basketball Association (NBA). This comparison is problematic because the WNBA is in an early growth phase while the NBA organizational life cycle position is far more mature. We investigate whether the demand features of early growth leagues are similar by comparing attendance data from the 8th‒21st seasons of the WNBA with attendance from the same point in NBA history and the current NBA. We find the factors that affect demand in the WNBA are uniquely different than the NBA in both size and significance in either period; thus, it is inappropriate to compare the two leagues.
Los estilos APA, Harvard, Vancouver, ISO, etc.
31

Mac, Cham V. "Effects of phytohormones and position on mother stem on culm cutting of Thyrsostachys siamensis gamble". Journal of Agriculture and Development 02 (29 de abril de 2019): 71–77. http://dx.doi.org/10.52997/jad.9.02.2019.

Texto completo
Resumen
The effects of phytohormones and positions on mother stem on shooting rate, number of shoots per cut, foot diameter of shoots, height of shoots, rooting rate, average number and length of roots by culm cuttings of Thyrsostachys siamensis Gamble Nam Bo were investigated. In this study, the phytohormones used were NAA, IBA and HVP. Cuttings were taken in three positions: near the root (V1), between the stem (V2) and near the tops (V3). The experiment was arranged randomly with 3 replications, with 36 culm cuttings per treatment. The results showed that the groups treated with NAA had highest shooting rate (91.7%) and highest number of shoots per cut (3.39 shoots/cut). The phytohormones did not significantly affect the foot diameter of the shoots but the height of the shoots. The NAA gave highest rooting rate (87.04%) and highest number of roots (8.5 roots/cuttings). The positions on mother stems did not significantly affect the shooting rate, but they significantly affected the number of shoots per cut. The foot diameter of the shoots, the height of the shoots, the rooting rate and the average root length of the cuttings taken between the stems were greater than those of near the root and near the top. In addition, the highest number of roots was observed when cuttings were taken at near the root
Los estilos APA, Harvard, Vancouver, ISO, etc.
32

Treglia, Giorgio, Silvia Taralli, Francesco Bertagna, Marco Salsano, Barbara Muoio, Pierluigi Novellis, Maria Letizia Vita, Fabio Maggi y Alessandro Giordano. "Usefulness of Whole-Body Fluorine-18-Fluorodeoxyglucose Positron Emission Tomography in Patients with Neurofibromatosis Type 1: A Systematic Review". Radiology Research and Practice 2012 (2012): 1–9. http://dx.doi.org/10.1155/2012/431029.

Texto completo
Resumen
Aim. To systematically review the role of positron emission tomography (PET) with fluorine-18-fluorodeoxyglucose (FDG) in patients with neurofibromatosis type 1 (NF1).Methods. A comprehensive literature search of published studies regarding FDG-PET and PET/CT in patients with NF1 was performed. No beginning date limit and language restriction were used; the search was updated until December 2011. Only those studies or subsets in studies including whole-body FDG-PET or PET/CT scans performed in patients with NF1 were included.Results. We identified 12 studies including 352 NF1 patients. Qualitative evaluation was performed in about half of the studies and semiquantitative analysis, mainly based on different values of SUV cutoff, in the others. Most of the studies evaluated the role of FDG-PET for differentiating benign from malignant peripheral nerve sheath tumors (MPNSTs). Malignant lesions were detected with a sensitivity ranging between 100% and 89%, but with lower specificity, ranging between 100% and 72%. Moreover, FDG-PET seems to be an important imaging modality for predicting the progression to MPNST and the outcome in patients with MPNST. Two studies evaluated the role of FDG-PET in pediatric patients with NF1.Conclusions. FDG-PET and PET/CT are useful methods to identify malignant change in neurogenic tumors in NF1 and to discriminate malignant from benign neurogenic lesions.
Los estilos APA, Harvard, Vancouver, ISO, etc.
33

Horsky, T. N., G. R. Brandes, K. F. Canter, P. H. Lippel y A. P. Mills. "Evidence for threshold effects in positron diffraction from NaF and LiF". Physical Review B 40, n.º 11 (15 de octubre de 1989): 7898–903. http://dx.doi.org/10.1103/physrevb.40.7898.

Texto completo
Los estilos APA, Harvard, Vancouver, ISO, etc.
34

Bert, Andrew G., Brett V. Johnson, Euan W. Baxter y Peter N. Cockerill. "A Modular Enhancer Is Differentially Regulated by GATA and NFAT Elements That Direct Different Tissue-Specific Patterns of Nucleosome Positioning and Inducible Chromatin Remodeling". Molecular and Cellular Biology 27, n.º 8 (5 de febrero de 2007): 2870–85. http://dx.doi.org/10.1128/mcb.02323-06.

Texto completo
Resumen
ABSTRACT We investigated alternate mechanisms employed by enhancers to position and remodel nucleosomes and activate tissue-specific genes in divergent cell types. We demonstrated that the granulocyte-macrophage colony-stimulating factor (GM-CSF) gene enhancer is modular and recruits different sets of transcription factors in T cells and myeloid cells. The enhancer recruited distinct inducible tissue-specific enhanceosome-like complexes and directed nucleosomes to different positions in these cell types. In undifferentiated T cells, the enhancer was activated by inducible binding of two NFAT/AP-1 complexes which disrupted two specifically positioned nucleosomes (N1 and N2). In myeloid cells, the enhancer was remodeled by GATA factors which constitutively displaced an upstream nucleosome (N0) and cooperated with inducible AP-1 elements to activate transcription. In mast cells, which express both GATA-2 and NFAT, these two pathways combined to activate the enhancer and generate high-level gene expression. At least 5 kb of the GM-CSF locus was organized as an array of nucleosomes with fixed positions, but the enhancer adopted different nucleosome positions in T cells and mast cells. Furthermore, nucleosomes located between the enhancer and promoter were mobilized upon activation in an enhancer-dependent manner. These studies reveal that distinct tissue-specific mechanisms can be used either alternately or in combination to activate the same enhancer.
Los estilos APA, Harvard, Vancouver, ISO, etc.
35

Rehman, Aasia y Deo Prakash. "Detection of PUE Attack in CRN with Reduced Error in Location Estimation Using Novel Bat Algorithm". International Journal of Wireless Networks and Broadband Technologies 6, n.º 2 (julio de 2017): 1–25. http://dx.doi.org/10.4018/ijwnbt.2017070101.

Texto completo
Resumen
Cognitive Radio Network Technology makes the efficient utilization of scarce spectrum resources by allowing the unlicensed users to opportunistically use the licensed spectrum. Cognitive Radio Network due to its flexible and open nature is vulnerable to a number of security attacks. This paper is mainly concerned with one of the physical layer attack called Primary User Emulation Attack and its detection. This paper solves the problem of PUE attack by localization technique based on TDOA measurements with reduced error in location estimation using a Novel Bat Algorithm (NBA). A number of cooperative secondary users are used for detecting the PUEA by comparing its estimated position with the known position of incumbent. The main goal of NBA is to minimize two fitness functions namely non-linear least square and the maximum likelihood in order to optimize the estimation error. After evaluation, simulation results clearly demonstrates that NBA results in reduced estimation error as compared to Taylor Series Estimation and Particle Swarm Optimization.
Los estilos APA, Harvard, Vancouver, ISO, etc.
36

Platten, David. "Polar Positions: On the Theme of Identity in Contemporary Noir Fiction". Nottingham French Studies 41, n.º 1 (marzo de 2002): 5–18. http://dx.doi.org/10.3366/nfs.2002.002.

Texto completo
Los estilos APA, Harvard, Vancouver, ISO, etc.
37

Ilsley, S. E. y H. M. Miller. "The influence of birth order and duration of farrowing on concentrations of metabolites in the umbilical cord blood of newborn piglets". Proceedings of the British Society of Animal Science 2003 (2003): 85. http://dx.doi.org/10.1017/s1752756200012448.

Texto completo
Resumen
It was the purpose of this study to ascertain whether concentrations of glucose (GLU), urea and non-esterified fatty acids (NEFA) in blood collected from the umbilical cords of newborn piglets vary according to the position of the piglet in the birth order of a litter. Umbilical cord blood is representative of the piglets status at the time of birth. It would therefore be advantageous to know whether blood withdrawn from the umbilical cord of one piglet is representative of the litter in terms of these metabolites. This study was therefore designed to test the hypotheses that position in the birth order, and time of birth relative to delivery of the first piglet in a litter, will influence GLU, urea and NEFA concentrations in umbilical cord blood.
Los estilos APA, Harvard, Vancouver, ISO, etc.
38

Cramer, Linsay M. "Postracism Mythology: NBA Commissioner Adam Silver’s “Heroic” Banishment of Racism From the NBA". Communication & Sport 7, n.º 3 (22 de abril de 2018): 271–91. http://dx.doi.org/10.1177/2167479518769895.

Texto completo
Resumen
On April 29, 2014, National Basketball Association (NBA) Commissioner Adam Silver delivered a press conference in which he fined the then-owner of the Los Angeles (L.A.) Clippers, Donald Sterling, 2.5 million dollars and banned him for life from any affiliation with the NBA due to racist comments that Sterling made to his then-girlfriend in a recorded phone conversation that was released to the public. This article examines how Silver, through his leadership performance and the global news and sports media reactions to his performance, rhetorically advanced postracism logics and hegemonic masculine ideals through mythological constructions of White masculinity. This rhetorical analysis and critique revealed that Silver’s press conference and the global news and sports media’s response to it obviate the racial and gender structures of NBA administrative positions that favor White masculinity while simultaneously advancing hegemonic ideals that function to marginalized those who do not occupy White masculine positionality.
Los estilos APA, Harvard, Vancouver, ISO, etc.
39

Schiepers, Christiaan, Paul Van Hecke, Rik Vandenberghe, Sylvie Van Oostende, Patrick Dupont, Philippe Demaerel, Guy Bormans y Herwig Carton. "Positron emission tomography, magnetic resonance imaging and proton NMR spectroscopy of white matter in multiple sclerosis". Multiple Sclerosis Journal 3, n.º 1 (febrero de 1997): 8–17. http://dx.doi.org/10.1177/135245859700300102.

Texto completo
Resumen
Objective: To assess characteristics of MS lesions and normal appearing white matter (NAWM) with various imaging modalities. Glucose metabolism was investigated with FDG - PET, metabolite concentration with proton NMR spectroscopy, and lesion detection with routine brain MRI. Methods: Thirteen patients were studied in a stable phase of their disease, and two during an acute episode. Nine healthy volunteers served as controls. Results: Three patients had a normal brain MRI, 12 had typical lesions. MR images were registered to the PET planes. Lesions and contra-lateral control areas were analyzed, 10/15 lesions showed relative hyper-metabolism and 2 hypo-metabolism. NAA concentration was significantly decreased in both lesions and NAWM. Conclusion: In stable MS, most large lesions have a relatively increased glucose utilization and decreased NAA concentration. NAWM showed a significantly decreased NAA concentration compared to healthy subjects, but no difference in glucose metabolism. Active lesions in acute MS are also hyper-metabolic. This finding opens a new window on the classification of white matter lesions based on glucose utilization.
Los estilos APA, Harvard, Vancouver, ISO, etc.
40

Wagalgave, Sopan M., Sachin D. Padghan, Mohammad Al Kobaisi, Duong Duc La, Keerti Bhamidipati, Nagaprasad Puvvada, Rajesh S. Bhosale, Sidhanath V. Bhosale y Sheshanath V. Bhosale. "Selectivity and bio-compatibility of self-assembled chiral flower-like and helical nanostructures". New Journal of Chemistry 44, n.º 41 (2020): 18092–101. http://dx.doi.org/10.1039/d0nj01235a.

Texto completo
Los estilos APA, Harvard, Vancouver, ISO, etc.
41

Shin, Kee-Sun, Kyung-Sook Bae, Kang Hyun Lee, Doo-Sang Park, Gi-Seok Kwon y Jung-Bok Lee. "Wickerhamomyces ochangensis sp. nov., an ascomycetous yeast isolated from the soil of a potato field". International Journal of Systematic and Evolutionary Microbiology 61, n.º 10 (1 de octubre de 2011): 2543–46. http://dx.doi.org/10.1099/ijs.0.026682-0.

Texto completo
Resumen
A novel ascomycetous yeast, designated strain N7a-Y2T, was isolated from soil collected in a potato field in Ochang, Korea, and its taxonomic position was studied. A neighbour-joining tree based on the D1/D2 domain of large-subunit rRNA gene sequences revealed that the isolate was a member of the Wickerhamomyces clade and that it was closely related to Wickerhamomyces bisporus, Candida quercuum, Candida ulmi and Wickerhamomyces alni. Strain N7a-Y2T formed Saturn-shaped ascospores in unconjugated and persistent asci. D1/D2 domain 26S rRNA gene sequence divergences of 11.0–21.1 % between strain N7a-Y2T and other members of the Wickerhamomyces clade indicate that the strain represents a novel species of the genus Wickerhamomyces, for which the name Wickerhamomyces ochangensis sp. nov. is proposed. The type strain is N7a-Y2T ( = KCTC 17870T = CBS 11843T).
Los estilos APA, Harvard, Vancouver, ISO, etc.
42

Baburin, Sergey N. "N.A. Vlasenko. The modern Russian state. Essays". Gosudarstvo i pravo, n.º 3 (2022): 204. http://dx.doi.org/10.31857/s102694520019176-4.

Texto completo
Resumen
The reviewed book by N.A. Vlasenko “The modern Russian state. Essays” touches on the content of many problems of Russian statehood, the political system, the entire political and legal life. The striking feature of the publication is an essay approach. This allowed the author to explore the problems of modern state studies through its system-forming fragments, leaving aside the coherence of these fragments and the gaps in the complex analysis of the modern state that are inevitable with this approach. Monograph of N.A. Vlasenko allows us to see many painful problems of the starting position of Russian society before its new state-legal transformation. The author does not impose conclusions, he only gives the basis for their birth.
Los estilos APA, Harvard, Vancouver, ISO, etc.
43

Edoff, M., P. M. P. Salomé, A. Hultqvist y V. Fjällström. "Analysis of NaF precursor layers during the different stages of the Cu(In,Ga)Se2 coevaporation process". MRS Proceedings 1538 (2013): 9–14. http://dx.doi.org/10.1557/opl.2013.998.

Texto completo
Resumen
ABSTRACTNaF precursor layers used for providing Na to Cu(In,Ga)Se2 (CIGS) grown on Na-free substrates have been studied. The NaF layers were deposited on top of the Mo back contact prior to the CIGS co-evaporation process. The co-evaporation process was interrupted after the preheating steps, and after part of the CIGS layer was grown. Completed samples were also studied. After the preheating, the NaF layers were analyzed with X-ray Photoelectron Spectroscopy and after growing part and all of the CIGS film, the Mo/NaF/CIGS stack was characterized using transmission electron microscopy (TEM) and secondary ion mass spectrometry (SIMS). The NaF layers were found to be stable in thickness and composition during the pre-heating in selenium containing atmosphere before the CIGS process. The TEM analyses on the partly grown samples show a layer at the CIGS/Mo interface, which we interpret as a partly consumed NaF layer. This is corroborated by the SIMS analysis. In finalized samples the results are less clear, but TEM images show an increased porosity at the position of the NaF layer.
Los estilos APA, Harvard, Vancouver, ISO, etc.
44

Meyza, Henryk. "Nea Paphos. Seasons 2012 and 2013". Polish Archaeology in the Mediterranean XXIV, n.º 1 (28 de febrero de 2016): 443–52. http://dx.doi.org/10.5604/01.3001.0010.0086.

Texto completo
Resumen
Excavation at the site of the so-called Hellenistic House in Nea Paphos in 2012 and 2013 was focused on the main courtyard (1) and the southern portico (R.3). The architecture collapsed in an earthquake in the 2nd century AD. Blocks and architectural elements formed an oblong tumble extending across the courtyard, apparently already not in their original position save for some entablature blocks of the eastern peristyle, and two acroteria with symbols of Dioskouroi, a pilos with a superimposed star, and at least two column shafts belonging to the southern peristyle. The cistern under the southeastern part of the courtyard had two successive well-heads, one (the later one) uncovered earlier, the other 2.02 m to the northwest, the top of which collapsed into the cistern. The disturbed fill from the courtyard surface included a mold for sling bullets with decoration in the form of a scorpion in relief and fragments of “Nabatean” capitals belonging to a variant showing schematic volutes.
Los estilos APA, Harvard, Vancouver, ISO, etc.
45

Susumu, Takahashi. "Le Japon dans l'ordre mondial. Une position perpétuellement précaire". Études internationales 30, n.º 1 (12 de abril de 2005): 31–43. http://dx.doi.org/10.7202/703991ar.

Texto completo
Resumen
Les dirigeants du Japon de Meiji partageaient une vision « réaliste » de l'ordre du monde. Le but de la politique extérieure était de s'élever par la force dans la hiérarchie des nations. Mais en tant que « colonie informelle » des puissances occidentales (jusqu'en 1905), puis de « puissance régionale », le Japon ne pouvait pas s'assurer une position internationale stable. Il était pris entre son incapacité à légitimer son expansion vis-à-vis de ses « inférieurs » des autres pays asiatiques) et le contrôle exercé par ses « supérieurs » (les grandes puissances mondiales). La brutalité et la frustration en ont découlé. Après 1945, son accoutumance au « réalisme » et à une pratique des relations internationales fondée sur l'usage de la force militaire a permis au Japon de trouver aisément sa place dans l'ordre de la guerre froide, en qualité de « puissance régionale subordonnée ». Il n'a pas su devenir, à l'instar de l'Allemagne, une « puissance moyenne ». Il en restera incapable aussi longtemps que la vision du monde de ses dirigeants ne changera pas.
Los estilos APA, Harvard, Vancouver, ISO, etc.
46

Anastasaki, Corina, Stephanie M. Morris, Feng Gao y David H. Gutmann. "Children with 5′-end NF1 gene mutations are more likely to have glioma". Neurology Genetics 3, n.º 5 (22 de septiembre de 2017): e192. http://dx.doi.org/10.1212/nxg.0000000000000192.

Texto completo
Resumen
Objective:To ascertain the relationship between the germline NF1 gene mutation and glioma development in patients with neurofibromatosis type 1 (NF1).Methods:The relationship between the type and location of the germline NF1 mutation and the presence of a glioma was analyzed in 37 participants with NF1 from one institution (Washington University School of Medicine [WUSM]) with a clinical diagnosis of NF1. Odds ratios (ORs) were calculated using both unadjusted and weighted analyses of this data set in combination with 4 previously published data sets.Results:While no statistical significance was observed between the location and type of the NF1 mutation and glioma in the WUSM cohort, power calculations revealed that a sample size of 307 participants would be required to determine the predictive value of the position or type of the NF1 gene mutation. Combining our data set with 4 previously published data sets (n = 310), children with glioma were found to be more likely to harbor 5′-end gene mutations (OR = 2; p = 0.006). Moreover, while not clinically predictive due to insufficient sensitivity and specificity, this association with glioma was stronger for participants with 5′-end truncating (OR = 2.32; p = 0.005) or 5′-end nonsense (OR = 3.93; p = 0.005) mutations relative to those without glioma.Conclusions:Individuals with NF1 and glioma are more likely to harbor nonsense mutations in the 5′ end of the NF1 gene, suggesting that the NF1 mutation may be one predictive factor for glioma in this at-risk population.
Los estilos APA, Harvard, Vancouver, ISO, etc.
47

Pikus, S., E. Olszewska, M. Majdan y L. Pajak. "High quality powder diffraction data for A-type zeolite with selected divalent d-electron metals". Powder Diffraction 19, n.º 2 (junio de 2004): 172–80. http://dx.doi.org/10.1154/1.1707039.

Texto completo
Resumen
Six A-type zeolites: NaA, MnNaA, CoNaA, NiNaA, ZnNaA, CdNaA have been characterized by X-ray powder diffraction. The zeolites with selected divalent cations have been synthesized by a very careful ion-exchange process using very high quality NaA zeolite. Experimental 2θ peak positions, relative peak intensities, values of d and Miller indices as well as a unit cell parameter are reported.
Los estilos APA, Harvard, Vancouver, ISO, etc.
48

Harmon, Stephanie A., Timothy Perk, Christie Lin, Jens Eickhoff, Peter L. Choyke, William L. Dahut, Andrea B. Apolo et al. "Quantitative Assessment of Early [18F]Sodium Fluoride Positron Emission Tomography/Computed Tomography Response to Treatment in Men With Metastatic Prostate Cancer to Bone". Journal of Clinical Oncology 35, n.º 24 (20 de agosto de 2017): 2829–37. http://dx.doi.org/10.1200/jco.2017.72.2348.

Texto completo
Resumen
Purpose [18F]Sodium fluoride (NaF) positron emission tomography (PET)/computed tomography (CT) is a promising radiotracer for quantitative assessment of bone metastases. This study assesses changes in early NaF PET/CT response measures in metastatic prostate cancer for correlation to clinical outcomes. Patients and Methods Fifty-six patients with metastatic castration-resistant prostate cancer (mCRPC) with osseous metastases had NaF PET/CT scans performed at baseline and after three cycles of chemotherapy (n = 16) or androgen receptor pathway inhibitors (n = 40). A novel technology, Quantitative Total Bone Imaging, was used for analysis. Global imaging metrics, including maximum standardized uptake value (SUVmax) and total functional burden (SUVtotal), were extracted from composite lesion–level statistics for each patient and tracked throughout treatment. Progression-free survival (PFS) was calculated as a composite end point of progressive events using conventional imaging and/or physician discretion of clinical benefit; NaF imaging was not used for clinical evaluation. Cox proportional hazards regression analyses were conducted between imaging metrics and PFS. Results Functional burden (SUVtotal) assessed midtreatment was the strongest univariable PFS predictor (hazard ratio, 1.97; 95% CI, 1.44 to 2.71; P < .001). Classification of patients based on changes in functional burden showed stronger correlation to PFS than did the change in number of lesions. Various global imaging metrics outperformed baseline clinical markers in predicting outcome, including SUVtotal and SUVmean. No differences in imaging response or PFS correlates were found for different treatment cohorts. Conclusion Quantitative total bone imaging enables comprehensive disease quantification on NaF PET/CT imaging, showing strong correlation to clinical outcomes. Total functional burden assessed after three cycles of hormonal therapy or chemotherapy was predictive of PFS for men with mCRPC. This supports ongoing development of NaF PET/CT–based imaging biomarkers in mCRPC to bone.
Los estilos APA, Harvard, Vancouver, ISO, etc.
49

Guss, Michael S., John P. Begly, Austin J. Ramme, Richard M. Hinds, Raj J. Karia y John T. Capo. "Performance Outcomes After Metacarpal Fractures in National Basketball Association Players". HAND 11, n.º 4 (8 de julio de 2016): 427–32. http://dx.doi.org/10.1177/1558944716628500.

Texto completo
Resumen
Background: The aim was to determine whether players in the National Basketball Association (NBA) who sustain metacarpal fractures demonstrate decreased performance upon return to competition when compared with their performance before injury and that of their control-matched peers. Methods: Data for 32 NBA players with metacarpal fractures incurred over 11 seasons (2002-2003 to 2012-2013) were obtained from injury reports, press releases, and player profiles ( www.nba.com and www.basketballreference.com ). Player age, body mass index (BMI), position, shooting hand, number of years in the league, and treatment (surgical vs nonsurgical) were recorded. Individual season statistics for the 2 seasons immediately prior to injury and the 2 seasons after injury, including player efficiency rating (PER), were obtained. Thirty-two controls matched by player position, age, and performance statistics were identified. A performance comparison of the cohorts was performed. Results: Mean age at the time of injury was 27 years with an average player BMI of 24. Players had a mean 5.6 seasons of NBA experience prior to injury. There was no significant change in PER when preinjury and postinjury performances were compared. Neither injury to their shooting hand nor operative management of the fracture led to a decrease in performance during the 2 seasons after injury. When compared with matched controls, no significant decline in performance in PER the first season and second season after injury was found. Conclusion: NBA players sustaining metacarpal fractures can reasonably expect to return to their preinjury performance levels following appropriate treatment.
Los estilos APA, Harvard, Vancouver, ISO, etc.
50

CROSET, Martine, Nicole BROSSARD, Anne POLETTE y Michel LAGARDE. "Characterization of plasma unsaturated lysophosphatidylcholines in human and rat". Biochemical Journal 345, n.º 1 (17 de diciembre de 1999): 61–67. http://dx.doi.org/10.1042/bj3450061.

Texto completo
Resumen
Unsaturated lysophosphatidylcholines (lysoPtdCho) bound to albumin circulate in blood plasma and seem to be a novel transport system for carrying polyunsaturated fatty acids (PUFA) to tissues that are rich in these fatty acids, such as the brain. The potential of these lysoPtdCho as a significant source of PUFA for cells has been assessed by comparing their plasma concentration with that of unsaturated non-esterified fatty acids (NEFA) bound to albumin. In humans, the PUFA concentration was 25.9±3.1 nmol/ml for these lysoPtdCho, compared with 33.4±9.6 nmol/ml for NEFA; in rats the equivalent values are 14.2±0.6 and 13.1±1.1 nmol/ml respectively (means±S.E.M.). The lysoPtdCho arachidonic acid content was 2-fold (human) and 5-fold (rat) higher than that of NEFA. In human and rat plasma, unsaturated lysoPtdCho were associated mainly with albumin rather than lipoproteins. The rate and extent of the acyl group shift from the sn-2 to sn-1 position of these lysoPtdCho were studied by the incubation of 1-lyso,2-[14C]C18:2n-6-glycerophosphocholine (GPC) with plasma. The rapid isomerization of this lipid occurred at pH 7 (20% isomerization within 2 min) and was not prevented by its association with albumin. The position of the acyl group in the lysoPtdCho circulating in plasma was studied by collecting blood directly in organic solvents containing 1-lyso,2-[14C]C18:2n-6-GPC as a marker of isomerization that occurred during sampling and analysis. Approx. 50% of the PUFA was located at the sn-2 position, demonstrating that substantial concentrations of 2-acyl-lysoPtdCho are present in plasma and are available for tissue uptake, where they can be reacylated at the sn-1 position to form membrane phospholipids.
Los estilos APA, Harvard, Vancouver, ISO, etc.
Ofrecemos descuentos en todos los planes premium para autores cuyas obras están incluidas en selecciones literarias temáticas. ¡Contáctenos para obtener un código promocional único!

Pasar a la bibliografía