Artículos de revistas sobre el tema "Latvian Primers"
Siga este enlace para ver otros tipos de publicaciones sobre el tema: Latvian Primers.
Crea una cita precisa en los estilos APA, MLA, Chicago, Harvard y otros
Consulte los 50 mejores artículos de revistas para su investigación sobre el tema "Latvian Primers".
Junto a cada fuente en la lista de referencias hay un botón "Agregar a la bibliografía". Pulsa este botón, y generaremos automáticamente la referencia bibliográfica para la obra elegida en el estilo de cita que necesites: APA, MLA, Harvard, Vancouver, Chicago, etc.
También puede descargar el texto completo de la publicación académica en formato pdf y leer en línea su resumen siempre que esté disponible en los metadatos.
Explore artículos de revistas sobre una amplia variedad de disciplinas y organice su bibliografía correctamente.
1
Tubelyte, Vaida, Saulius Švažas, Aniolas Sruoga, Dalius Butkauskas, Algimantas Paulauskas, Vykintas Baublys, Janis Viksne, Gennady Grishanov y Alexander Kozulin. "Genetic diversity of tufted ducks (Aythya fuligula, Anatidae) in Eastern Europe". Open Life Sciences 6, n.º 6 (1 de diciembre de 2011): 1044–53. http://dx.doi.org/10.2478/s11535-011-0083-z.
Texto completoResumen
AbstractThe tufted duck (Aythya fuligula, Anatidae) is widespread in the Palaearctic across Northern Eurasia. Birds breeding in Northern and Eastern Europe are highly migratory, while populations from Western Europe are partially migratory or resident. The aim of this study is to explore genetic variation within and between ducks breeding in Latvia and migrants sampled in North West Russia and Belarus. The technique of random amplified polymorphic DNA was applied using five random primers (ol-1, ol-9-12). Genetic variability was measured for all tufted ducks investigated and for different sub-populations from various regions. Individual genetic structure and genetic variability was higher in ducks collected from Latvia. Gene diversity of amplified DNA bands in birds of Latvian origin was 24% with 80% polymorphism. Means of gene diversity and polymorphism for tufted ducks sampled in other countries varied from 12 to 14% and from 27 to 40%, respectively. A high number of unique bands characterized ducks breeding in Latvia. The oligonucleotide primers used in this study were suitable to analyze differences among tufted ducks of different origin. Possible explanations for the variation observed among the studied ducks are discussed.
2
Buka, Arnis y Edmunds Broks. "Application of the EU law in Latvian courts". Strani pravni zivot, n.º 4 (2021): 569–77. http://dx.doi.org/10.5937/spz65-34937.
Texto completoResumen
This article outlines the main changes that the system of Latvian courts faced after Latvia's accession to the EU. In the legislative field Latvia has added in its procedural laws general provisions that incorporate EU law into Latvia's legal system, as well as the possibility of national courts to apply preliminary rulings procedure. During Latvia's EU membership, Latvian courts have adapted to their role in the application of the EU law, especially in the area of administrative law. Latvian courts have referred to the Court of Justice of the EU for preliminary rulings in over 100 cases, mostly from administrative courts. This corresponds with general tendencies in other new EU Member States. However, the fact that there are very few requests for preliminary rulings from courts that are not the courts of the last instance in Latvia, suggests that Latvian courts of first instances are somewhat unwilling to make use of the preliminary rulings procedure and do not see the benefits in its use.
3
Apsītis, Allars y Osvalds Joksts. "Abigeatus – mājlopu zādzība jeb aizdzīšana – kā noziedzīgs nodarījums pret īpašumu romiešu tiesībās". SOCRATES. Rīgas Stradiņa universitātes Juridiskās fakultātes elektroniskais juridisko zinātnisko rakstu žurnāls / SOCRATES. Rīga Stradiņš University Faculty of Law Electronic Scientific Journal of Law 1, n.º 19 (2021): 67–75. http://dx.doi.org/10.25143/socr.19.2020.1.067-075.
Texto completoResumen
Rakstā atspoguļoti atsevišķi rezultāti no autoru realizētās romiešu tiesību pirmavotu izpētes saistībā ar tajos atrodamo informāciju par noziedzīgiem nodarījumiem pret īpašumu, kas mūsdienu Latvijā kriminalizēti Krimināllikuma 175. pantā “Zādzība”, 176. pantā “Laupīšana” un 179. pantā “Piesavināšanās”. Apskatīta un analizēta tiesiskā reglamentācija attiecībā uz abigeatus – mājlopu zādzību jeb aizdzīšanu, kas tika uzskatīta par bīstamāku un smagāku nodarījumu nekā parasta zādzība (lat. furtum) un tāpēc bargāk sodīta. Aplūkoti arī minētā noziedzīgā nodarījuma kvalifikācijas un sodīšanas politikas legālie kritēriji romiešu tiesībās. Saskaņā ar autoru informāciju Latvijas pētnieki šo tematiku visai maz apskatījuši, un pētījums varētu dot zināmu ieguldījumu nacionālās tiesību zinātnes attīstībā, īpaši jautājumā par romiešu tiesību principu ietekmi uz Latvijas Republikas normatīvajos aktos ietvertajiem mūsdienu tiesību institūtiem. The article deals with the results of research performed on the primary sources of the Roman Law regarding offences against property contemporaneity criminalised in the Criminal Law (Sections 175. Theft, 176. Robbery, 179. Misappropriation) of modern-day Latvia. It describes and analyses the Roman Law legal regulation regarding abigeatus – the offence of cattle stealing or “rustling” which was considered as a more dangerous and serious offense than ordinary theft (furtum) and therefore more severely punishable. According to the information in the possession of the authors, Latvian researchers have not yet in particular studied the current theme, and the publications in the Latvian language have not been detected yet. Accordingly, the current article could provide certain contributions to the development of the national field of law, especially regarding the impact of Roman legal principles on the development of modern legal institutes incorporated in the law of the Republic of Latvia.
4
Čistjakovs, Maksims, Alina Sultanova, Olga Jermakova, Svetlana Čapenko, Baiba Lesiņa-Korne, Rafails Rozentāls, Modra Murovska y Ieva Ziediņa. "High-Risk Human Papillomavirus Infection in Latvian Male Kidney Transplant Recipients / Augsta Riska Cilvēka Papilomas Vīrusa Infekcija Vīriešu Dzimuma Nieru Transplantāta Saņēmējiem Latvijā". Proceedings of the Latvian Academy of Sciences. Section B. Natural, Exact, and Applied Sciences. 70, n.º 4 (1 de agosto de 2016): 193–97. http://dx.doi.org/10.1515/prolas-2016-0030.
Texto completoResumen
Abstract Kidney transplant recipients have higher incidence of human papillomavirus (HPV)-related malignancies, but studies on the natural history of HPV infection are insufficient, especially regarding in male recipients. The aim of this study was to evaluate the course of high-risk HPV (HR-HPV) infection after kidney allograft transplantation in male recipients: to estimate frequency and activity of HR-HPV infection under immune system suppression. Twenty male renal recipients (age 20 - 68) were enrolled in this investigation and examined in dynamics. Peripheral EDTA-blood samples and urine samples were collected from each patient 2 weeks, 6 months and 12 months after transplantation. Polymerase chain reaction (PCR) with consensus primers was used for initial detection of high range HPV types, a commercial qPCR kit for detection of HR-HPV load in urine samples and ELISA for detection of serum IgG class antibodies to HR-HPV L1-capsid protein. Overall, combining molecular (HR-HPV genomic sequences detected by real-time PCR) and serological studies (IgG class antibodies to HR-HPV L1-capsids’ protein), high frequency of HRHPV infection among male kidney transplant recipients (9/20; 45%) was showed. However, the majority of HR-HPV positive recipients (7/9; 78%) showed signs of infection clearance. It means that, despite the applied immune suppressive therapy, the host’s immune system is capable of dealing with HR-HPV infection up to the 12th month after transplantation. However, the sample size should be increased to enable through statistical analysis before final conclusions are made.
5
Gailite, Linda, Olga Sterna, Maija Konika, Aleksejs Isakovs, Jekaterina Isakova, Ieva Micule, Signe Setlere, Mikus Diriks y Madara Auzenbaha. "New-Born Screening for Spinal Muscular Atrophy: Results of a Latvian Pilot Study". International Journal of Neonatal Screening 8, n.º 1 (14 de febrero de 2022): 15. http://dx.doi.org/10.3390/ijns8010015.
Texto completoResumen
New disease-modifying treatments have recently been approved for 5q spinal muscular atrophy (SMA) and early treatment has been associated with a better clinical outcome. Accordingly, new-born screening (NBS) for SMA should be implemented to ensure early diagnosis of affected individuals. The aim of this study was to determine the feasibility and usefulness of NBS for SMA in Latvia. Between February and November of 2021, 10,411 parents consented to participation in the study. DNA testing for the SMN1 exon 7 homozygous deletion was conducted using qPCR with fluorescent locked nucleic acid primers. In the first month of testing, reporting of results took up to a maximum of 17 days after samples arrived in the laboratory. However, following familiarisation with the procedure, the median report time was reduced to 11 days after birth. Forty cases required samples to be taken again due to poor quality of the isolated DNA transpiring from either the quality of the blood punch or manual mistakes during DNA isolation. The SMN1 exon 7 homozygous deletion was identified in two individuals, which was subsequently confirmed by multiplex ligation-dependent probe amplification. When a NBS sample is taken 48 to 72 h after birth and transported to the laboratory within two working days after collection according to legal requirements, DNA test results can be reported to healthcare professionals before the 12th day of life. Expansion of our SMA 5q NBS procedure to the whole of Latvia is feasible and would facilitate early diagnosis and result in more effective treatment. We strongly advocate that SMA is added to the national Latvia Recommended Uniform Screening Panel.
6
Gaveika, Arturs y Ilona Bulgakova. "ASYLUM LAW REGULATION AND CURRENT EVENTS OF ITS APPLICATION IN LATVIA". BORDER SECURITY AND MANAGEMENT 1, n.º 6 (10 de mayo de 2016): 53. http://dx.doi.org/10.17770/bsm.v1i6.1700.
Texto completoResumen
The development of the regulatory framework of Latvia’s Asylum and external border is determined by international regulatory framework, the EU's regulatory framework and influence of Latvian bilateral relationship as well as the need to balance the free movement of persons which is essential part of human rights in order to ensure the legislation in relation to Latvian external border regime within international and national legal framework. This is evidenced as a problematic issue in regulatory framework, law practices and border control both in Latvia and other EU countries. It is necessary to explore international, EU and national legal framework within the EU's external borders functioning in Latvia by detecting problems in the EU's Asylum determination in the context of border regime and border control regulatory framework, by exploring legislation, legal concepts, incompleteness of terminology and eventually to develop suggestions for improving laws and regulations. The primary method is Analytical method - the analysis of international, EU, the Schengen Acquis and the national regulatory framework and administrative practice.
7
Melece, Ligita. "DEVELOPMENT AND FUTURE PERSPECTIVES OF ORGANIC FARMING IN LATVIA". Latgale National Economy Research 1, n.º 2 (30 de junio de 2010): 247. http://dx.doi.org/10.17770/lner2010vol1.2.1789.
Texto completoResumen
Nowadays the organic farming as method and organic food takes important role for the sustainable and environmental friendly agricultural and food production. The paper analyzes the development and issues of future perspectives of organic farming in the Latvia. Some findings of organic agriculture development are given, estimating the primary information on organic farming in Latvia regarding the trends of the organic farms’ number, utilized organic agricultural and share of organic land in the total agricultural land. Besides, the state policy and support for organic farming have analyzed and compared with European Union (EU) and it’s Member States. The influence of Latvia’s accession to the EU on the organic farming development is assessed. Some issues of further perspectives of development of Latvian organic agriculture are evaluated.
8
Bela, Baiba y Inta Mierina. "Diaspora engagement for development: multinational networking by diaspora professionals". Folia Geographica 20, n.º 2 (2023): 102–11. http://dx.doi.org/10.22364/fg.20.2.11.
Texto completoResumen
The paper investigates diaspora engagement in Latvia’s development, by analysing diaspora professionals’ multinational and multilevel networking and cooperation practices with Latvian public administration. The main questions addressed in this paper are: 1) what type of support is provided by diaspora professionals? 2) are there any links between geographical location, institutional affiliation, and networking and cooperation practices at the individual and organisational level? The study was carried out using parallel mixed methods research design. The main results show that Latvian diaspora professionals working at international organisations are willing to cooperate with representatives of Latvia. Even though respondents evaluate existing cooperation opportunities as being rather good, just 56% of respondents have had some cooperation with representatives of Latvia over the last five years. An important key finding on factors contributing to or hindering cooperation and networking at an institutional level was that it is not geographical location itself, but an institutional culture of cooperation and strategic vision on the part of the state or institution responsible for this cooperation that matters the most. Today, cooperation and networking take place primary at the individual level – as a result of pro-active searching for cooperation possibilities on the part of diaspora professionals, and as a result of specific interests, openness, motivation and strategic vision on the part of employees of Latvian public administration.
9
Jasinskis, Vladislavs, Oksana Koļesova, Aleksandrs Koļesovs, Baiba Rozentāle, Inga Ažiņa, Ksenija Kramiča, Ludmila Vīksna y Jeļena Eglīte. "Human Leukocyte Antigens Class II Alleles Affecting the Response to 5–7 Year Antiretroviral Therapy in A Latvian Cohort". Proceedings of the Latvian Academy of Sciences. Section B. Natural, Exact, and Applied Sciences. 73, n.º 2 (1 de mayo de 2019): 84–88. http://dx.doi.org/10.2478/prolas-2019-0014.
Texto completoResumen
Abstract Antiretroviral therapy (ART) aims at suppressing viral replication and strengthening immune system in patients with HIV-1. Human Leukocyte Antigens (HLA) are among factors responsible for effectiveness of ART. The aim of this study was to determine the effect of HLA Class II alleles on the response to long-time ART, assessed by a change in CD4+ T-cell count in relation to viral load. The sample included 69 patients (17 females and 52 males) aged 20 to 50 with HIV-1 infection, who were undergoing ART in the Latvian Centre of Infectious Diseases. The median period of observation was 5.7 years. CD4+ T-cell count and viral load were analysed at the baseline and end of the period of observation. HLA typing was performed by polymerase chain reaction with low resolution sequence specific primers. Multiple hierarchical linear regression analysis confirmed that an increase in HIV-1 viral load was associated with a decrease in the level of CD4+ T-cell count. In addition, HLA-DRB1*04 and HLA-DQB1*06:01 alleles contributed negatively to the level of CD4+ T-cell count.
10
Odinokova, Tatyana. "Tourism cluster as a form of innovation activity". Economics ecology socium 3, n.º 2 (20 de junio de 2019): 1–11. http://dx.doi.org/10.31520/2616-7107/2019.3.2-1.
Texto completoResumen
Introduction. At the moment, innovation development is among key priorities in the development of Latvian economy. According to European Innovation Scoreboard assessment, Latvia joined the group of Moderate Innovators in 2016. However, its level of innovation effectiveness only reached 54% of the average EU index. That said, it has to be noted that enterprises that are innovation active in the service industry only account for 23.4%. In view of this, diverse forms of innovation activity and clusters in particular, have become more and more relevant. In 2006 European Competitiveness Council defined clusters as one of nine priorities aimed to promote and develop innovations. According to the European Commission, clustering is a key factor for successful innovation and enhanced competitiveness.
Aim and tasks. The subject matter of this article are tourism clusters as a type of innovation activity.
Results. Scientific research as well as practical experience of a number of countries have shown that cluster approach in tourism business is an effective instrument to enhance competitiveness both nationwide and at the level of an industry.At the present time, entrepreneurs are facing serious difficulty in converting ideas into new products and services. This is true of the national economy as a whole as well as particular industries. That said, the primary objective is the development and implementation of a program aimed at the cooperation of a wide range of social partners involved in innovation activity, who are capable of facilitating the enhancement of economic effectiveness.
Conclusions. The development of tourism sectoris regarded as a priority of Latvian economy. According to Central Statistical Bureau of Latvia, tourism is a major factor of Latvia’s economic development, an important source of export revenue, and a key factor of GDP growth. The development of Latvian tourism industry is part and parcel of global tourism market. Latvia has a strong potential for the development of business and health tourism. However, Latvia’s climate, its geographic position and the lack of world-famous architecture have an unfavorable effect on its tourism development opportunities. This is the reason why it is essential for Latvia to spur innovative activity in tourism industry with a focus on clustering. Creation of new clusters in tourism industry, such as business tourism cluster as an example, as well as the implementation of formerly declared goals related to the existing clusters, will help to meet some of the objectives.
11
Markus, Dace, Tija Zīriņa y Kārlis Markus. "Language Policy Implementation in Latvian Pre-School: Latvian Language Skills of Minority Children". Sustainable Multilingualism 22, n.º 1 (1 de junio de 2023): 74–93. http://dx.doi.org/10.2478/sm-2023-0004.
Texto completoResumen
Summary Latvian is the only official language in Latvia and one of the symbols of an independent state. The article provides a brief insight into the history of its reinforcement, which has not been easy. Education is one of the areas in which it is very important to develop multilingualism, while not forgetting to strengthen state language skills and their application. As the education system continues to reveal shortcomings in the process of Latvian language acquisition, Cabinet Regulations adopted in 2018 “Regulations Regarding the State Guidelines for Pre-school Education and the Model Pre-school Education Programmes” update the need for a successful transition from pre-school education to primary education at school, from pre-school education to bilingual primary school education or education carried out in Latvian. In minority families with a dominant Russian language, children acquire Russian well before pre-school age, and it is time to start learning the state language at pre-school age if this has not already been done. Taking these requirements into account, the article analyses the Latvian language skills of children of pre-school age, using 375 child speech recordings made by researchers in 2019 and 2020 in three regions – Kurzeme (Western Latvia), Latgale (Eastern Latvia), and Riga (capital). The materials are divided into three groups in each of the territories: recordings of Latvian children, recordings of minority children in groups with the Latvian language on a daily basis, and recordings of minority children in groups with the Russian language on a daily basis. The main problem is that regardless of the region, the Latvian language skills of minority children who attend pre-school education groups with a dominant Russian language on a daily basis are still insufficient and do not comply with the requirements set in Cabinet Regulation No. 716 of 2018 that the children should be prepared to start school with the Latvian as the learning language or bilingually. This suggests that the legislative provisions are not fully implemented and improvements are necessary for the Latvian language training system for minority children.
12
Zverev, Kirill A. "LATVIAN POLICY REGARDING RUSSIAN-LANGUAGE EDUCATION". RSUH/RGGU Bulletin. Series Political Sciences. History. International Relations, n.º 3 (2021): 134–46. http://dx.doi.org/10.28995/2073-6339-2021-3-134-146.
Texto completoResumen
The article considers the development of Russian-language school education in independent Latvia from 1992 to 2020, as well as the process of reforming the system by official authorities. At the time of declaration of indepen- dence and withdrawal from the USSR, a bilingual education system which was formed in Latvia, made it possible to get education at all levels (from kindergarten to technical school and university) in both Latvian and Russian languages. The rise to power in the 1990s of nationalist politicians and the perception of the Soviet period as a period of “occupation”, made it impossible to keep the Russian- speaking school unchanged. The transformations were not long in coming – al - ready in 1995 amendments to the law on the primary school and gymnasium were adopted, proclaiming the need to introduce several subjects teaching in the Lat- vian language in schools for national minorities. The largest reforms were carried out in 2004, when high school link in Russian-language schools (grades 10–12) was required to study in a 60/40 ratio — at least 60% of subjects in Latvian and no more than 40% in Russian. The second set of reforms began to be implemented in 2017, when the high school (of national minorities) completely switched to the Latvian language of instruction, and the secondary school was only partly switched to the Latvian language. The Latvian authorities explain the need for these reforms by the desire to increase the level of knowledge of the state language among national minorities, primarily Russian-speaking. The reform continues and will be completed only in 2021. The article is the first attempt at understand- ing the reform of the Russian school of Latvia with taking into account the latest transformations. The work uses statistical data from public organizations and the Ministry of Education of Latvia, as well as sources in the Latvian language, which are introduced into scientific circulation for the first time.
13
Soms, Henrihs. "Daugavpils – „Sarkanā Verdena”: 1919–1920". Sabiedrība un kultūra: rakstu krājums = Society and Culture: conference proceedings, n.º XXII (6 de enero de 2021): 77–85. http://dx.doi.org/10.37384/sk.2020.22.077.
Texto completoResumen
The battles near Daugavpils had an important role during the war for Latvia’s independence. Since 1918, the Soviet literature predominantly offered a version about Daugavpils as “Red Verdun” which had fought defence battles (for 129 days) against “the joint forces of Polish and Latvian white guards”. Objectively evaluating the historic events, the primary sources – Latvian press publications play an essential role. In this article, the materials from seven press editions have been employed. Regarding the press development, a new feature was the foundation of the Latvian Press Bureau (LPB) in March, 1919, and later – of Latvian Telegraph Agency (LETA). The task of the bureau was to inform the world’s news agencies and local media about the events happening in the territory of Latvia. The Soviet literature does not mention anything about the Red Terror which was carried out by so called commissioners for maintaining the order. On March 28, 98 people were shot dead near Daugavpils Fortress. This was the bloodiest crime committed by the Bolsheviks during the time of P. Stuchka’s Soviet government. These crimes became known to the wider society from the publications in the press only after Daugavpils was set free. The fight for Daugavpils took place in three phases: fights on the left bank of the river Daugava, capturing the outskirts of the town (August, 1919); the use of French tanks, Polish and Bolshevik armoured train, capturing the fortress bridgehead (September, 1919); Daugavpils occupation by Polish army and arrival of Latvian army (January 3, 1920). The press regularly published reports from the General Headquarters of Latvian, Lithuanian and Polish armies. When Daugavpils was set free, there were special correspondents of several newspapers who informed about the situation in the town. Though maintaining a lively interest in the events taking place in Daugavpils, in some cases the newspapers published unverified and false information, then trying to correct it or call it off.
14
Mustafayev, E. S., L. Svanella-Dumas, S. G. Kumari, Z. I. Akparov y T. Candresse. "First Report of Barley yellow dwarf virus and Cereal yellow dwarf virus Affecting Cereal Crops in Azerbaijan". Plant Disease 97, n.º 6 (junio de 2013): 849. http://dx.doi.org/10.1094/pdis-07-12-0656-pdn.
Texto completoResumen
A field survey was conducted during the 2010/2011 growing season at the Absheron experimental station of the Genetic Resources Institute of Azerbaijan. A total of 49 cereal samples with yellowing and reddening symptoms were obtained from 12 bread wheats (Triticum aestivum), 25 durum wheats (T. durum), 11 wild or cultivated wheat relatives (T. dicoccoides, T. beoticum, T. monococcum, and T. turgidum), and one oat (Avena sativa). Samples were tested by tissue-blot immunoassay (2) using antisera against 7 cereal-infecting viruses: Barley stripe mosaic virus (BSMV), Wheat dwarf virus (WDV), Wheat streak mosaic virus (WSMV), Barley yellow mosaic virus (BaYMV), Barley yellow striate mosaic virus (BYSMV), Maize streak virus (MSV), and Barley yellow dwarf virus (BYDV). Strong positive reactions against the BYDV-PAV polyclonal antiserum were shown by 43 samples. To confirm, total RNAs from 10 of the positive samples (three bread wheat, three durum wheat, the oat, and one sample each of T. beoticum, T. turgidum, and T. dicoccoides) were submitted to RT-PCR with two primer pairs adapted in part from (3). Primers Luteo1F 5′TTCGGMSARTGGTTGTGGTCCA 3′ and YanR-new 5′TGTTGAGGAGTCTACCTATTTNG 3′ (adapted from primer YanR (3)) allow the specific amplification of viruses of the genus Luteovirus (including BYDV) while primers Luteo2F 5′TCACSTTCGGRCCGWSTYTWTCAG 3′ (adapted from primer Shu2a-F (3)) and YanR-new are specific for the genus Polerovirus (including Cereal yellow dwarf virus, CYDV). All 10 tested samples gave a positive amplification at the expected size (~545 bp) with the first primer pair, while only two samples, one from oat and one from the wild wheat relative T. dicoccoides, gave a positive amplification of the expected size (~383 bp) with the second primer pair. Sequencing of amplification products obtained with the Luteo1F/YanR-new primer pair confirmed the presence of BYDV-PAV in all samples (GenBank JX275850 to JX275857). The Azeri isolates were all similar (0 to 1.7% nucleotide divergence) except for one isolate (JX275855, from T. turgidum, 2.4 to 3.2% divergence). An Azeri BYDV-PAV isolate (JX275851, from bread wheat) showed 100% identity with a Latvian isolate (AJ563414) and with two isolates from Morocco (AJ007929 and AJ007918). These isolates belong to a group of widespread PAV isolates and are 99% identical with isolates from Sweden, the United States, China, France, and New Zealand. Sequencing of products obtained with the Luteo2F/YanR-new primers (JX294311 and JX294312) identified CYDV-RPV. The two Azeri sequences show ~3% nucleotide divergence and their closest relatives in GenBank are a range of CYDV-RPV isolates mostly from the United States, including EF521848 and EF521830, with ~4 to 5% divergence. Presence of CYDV was also confirmed using amplification with a CYD-specific primer pair (CYDV-fw-New 5′TTGTACCGCTTGATCCACGG 3′ et CYDV-rev-New 5′GTCTGCGCGAACCATTGCC 3′, both adapted from (1)) and sequencing of the amplification products. This is, to our knowledge, the first report of BYDV-PAV and CYDV-RPV infecting cultivated cereals and wild or cultivated wheat relatives in Azerbaijan. These viruses are responsible for serious disease losses in cereal crops worldwide (4). Their full impact on crops in Azerbaijan is yet to be seen. References: (1) M. Deb and J. M. Anderson. J. Virol. Meth. 148:17, 2008. (2) K. M. Makkouk and A. Comeau. Eur. J. Plant Pathol. 100:71, 1994. (3) C. M. Malmstrom and R. Shu. J. Virol. Meth. 120:69, 2004. (4) W. A. Miller and L. Rasochovà. Ann. Rev. Phytopathol. 35:167, 1997.
15
Vulāne, Anna y Elita Stikute. "LATGALIAN COMPONENT IN THE LEARNING OF LATVIAN LANGUAGE AND LITERATURE: FROM PRESCHOOL TO SECONDARY SCHOOL (1990–2015)". Via Latgalica, n.º 8 (2 de marzo de 2017): 88. http://dx.doi.org/10.17770/latg2016.8.2229.
Texto completoResumen
The conditions of language development and preservation are the quality of its acquisition in the early childhood, in-depth usage and study in the educational process and formation of positive and responsible attitude towards language and national literary heritage. The quality of the development of child’s Latvian language is determined by several environmental factors: the language environment in the family, the language environment in preschool, basic and secondary educational institutions and the language environment in public space.In Latgale most children learn Latvian in heterogeneous sociolinguistic environment. Child’s acquisition of the Latvian language in the family occurs in one of the following ways: in the native dialect (variant of dialect), if all the family members communicate only in one of our dialects, the High Latvian dialect; in the Latvian standard language, if the family members communicate in the standard language; in the so-called “third variant”, if the communication is in the Latvian standard language with a strong dialectal influence; or bilingually (dialect – Latvian standard language, dialect – Lithuanian, Polish, Russian, Belarusian or some other language, Latvian standard language – Lithuanian, Polish, Russian, Belarusian or some other language).Experience acquired during the project “Latvian Language in Monolingual and Bilingual Acquisition: tools, theories and applications” (LAMBA) shows that a part of our High Latvian dialect-speaking parents found it difficult to answer MacArthur-Bate Communicative development test questions, which were formed according to the Latvian standard language system. As communication with children takes place only in their native dialect, there are differences between child’s speech and the standard language at phonological and morphological level. At the same time, parents, after consultation on how to complete the test, noted that the quality of learning Latvian at school is better than learning at home where incorrect colloquial Latvian is used. Latvian language users in other parts of Latvia faced a similar problem, but in general it did not seriously affect the performance of the test. Students emphasize that more knowledge about interrelation between the Latvian dialectal and standard language would make the Latvian language acquisition process easier and help avoid interference of the native dialect. Language learning at school takes place in a monolingual environment, but some schools offer optional courses also in the Latgalian written (standard) language and literature. Outside the classroom, communication goes on in both, standard Latvian and native dialect and other languages.Language environment of the public space is heterogeneous; children hear different High Latvian variants as well as the so-called “third variant” which causes the most harm, both to Latgalian and Latvian standard languages and other languages. Taking into consideration the fact that two traditions of the written language have historically developed in Latvia – the Latvian standard language, and the Latgalian standard language tradition – and the Latgalian standard language is a very important component of Latgale regional and cultural identity and significant cultural value of Latvia, State Language Law 3 (4) determines that “the State ensures the preservation, protection and development of the Latgalian standard language as a historical option of the Latvian language”. Language knowledge, its usage in the learning process and the knowledge of literary and cultural heritage in close connection with national values are preconditions of language development and retention. Therefore, it is important that the school curricula and literature contain both Latvian and Latgalian. This report focuses, firstly, on how the school curricula and learning standards reflect the necessity to form and develop the Latgalian standard language and literature, secondly, how these issues are revealed in the text books of the Latvian language and literature developed from 1990 to 2015 and thirdly, it deals with secondary school students’ survey results on the knowledge of the Latgalian standard language and literature. Analysis of the standards and curricula of the primary school and secondary school subject “Latvian language” and “Literature” reveals that neither the Latgalian standard language as an option of the Latvian language, nor fiction written in the Latgalian standard language are reflected in text books. The text books developed during the last 20 years deal with these thematic issues only sporadically.
16
Miļūna, Ieva. "Latvian Tradition in State Responsibility". Baltic Yearbook of International Law Online 19, n.º 1 (9 de septiembre de 2021): 8–26. http://dx.doi.org/10.1163/22115897_01901_003.
Texto completoResumen
This Chapter examines the role of the law of state responsibility in the practice of the Latvian State. The author elaborates on Latvian state creation and practice in the 1920s and 1930s which present a solid ground for the newly founded State’s participation in the legal affairs of the international community. Latvian state practice contributes to the law of state responsibility by elaborating on the concepts of rule of law, international wrongful acts and the necessity to comply with Latvia’s internationally binding legal obligations. Special attention is devoted to the concept of State continuity, and the author claims that in Latvian history the rules of state responsibility predetermined enforcement of the primary rules of state continuity. The author also examines the Latvian state practice since 1990 by examples, which show the application of international law and thus its normative effect as well as arguably refer to a violation of international law, thereby elaborating on the crucial functions of the rule of law.
17
Jegere, Sarmite. "CERTIFICATION CRITERIA MATRIX FOR EXPERT RATING OF PROFESSIONAL SERVICES". SOCIETY. INTEGRATION. EDUCATION. Proceedings of the International Scientific Conference 6 (25 de mayo de 2018): 223. http://dx.doi.org/10.17770/sie2018vol1.3346.
Texto completoResumen
In the Latvian certification system of individuals, there is necessary to ensure appropriate process realization in the interests of public protection and government needs, which gets incorporated into the EU common structure. An assessment of the certification system and its institutional structure is done with the aim to develop proposals for the improvement of the Latvian certification system for reducing costs, while ensuring both high system efficiency and recipients services and the public interest. To achieve its goals, the research study provided a summary of the situation in Latvia, as well as in the neighbouring countries: Lithuania, Poland, Estonia and Finland. During the research study, there were used both the secondary and the primary sources of information. Primary research was carried out in Latvia and consisted of two parts: expert interviews and focus groups. The results of the research are guidance to the overall approach and the criteria by which to guide one in the future, for setting which professional service providers require a mandatory certification. A matrix was made in the process of the research, which helps to define a certified profession, taking into account the need to protect the public interest and the level of national involvement in the regulation of specific areas of professional services.
18
Štaube, Tatjana y Ineta Geipele. "Scientific Aspects of Spatial Economic Allocation of Entrepreneurial Activities". Baltic Journal of Real Estate Economics and Construction Management 5, n.º 1 (27 de noviembre de 2017): 76–100. http://dx.doi.org/10.1515/bjreecm-2017-0007.
Texto completoResumen
AbstractThe paper includes results of economic calculation until 2020 regarding adaptations of the algorithm model of forecasting supply of spatial economic objects for planning the development of the Latvian high-end industrial market space. Scientific discussion concerns the average temperature increase as a determinant ratio and the definition of spatial economics developed by the authors The research focuses on the changes in climatic conditions, which may have an impact on the country’s economic development priorities. The paper also reflects on assessment of regional specialization of the leading entrepreneurial activities in Latvia and the Baltic States. It is mainly based on the empirical study of scientific literature. The authors apply the following methods: decision-making, analysis of primary and secondary sources, the Gini coefficient of Regional Specialization, the Gini coefficient of Geographical Concentration, logical approach and comparisons, systems and dynamic factor analysis, expert analysis, mathematical statistical methods. Main conclusions state that Latvia would continue regional development, maintain division of industrial capacities and decrease of Riga’s industrial agglomeration. Agriculture will develop intensively. Increase in high-class industrial property stock is partly conditioned by the high-quality manufacturing needs, as well as logistics and service needs. The calculated level of that stock is 772,300 sq.m until 2020. In fact, Latvia demonstrates low regional specialization rates for agriculture and manufacturing. The authors stress importance of development of the appropriate infrastructure in creating competitive local business environment in the Latvian cities.
19
Murinska, Sandra y Inga Kaļva-Miņina. "TOPICS OF MEDIA LITERACY IN THE CONTENT OF PRIMARY AND SECONDARY EDUCATION IN THE SUBJECT OF THE LATVIAN LANGUAGE". SOCIETY. INTEGRATION. EDUCATION. Proceedings of the International Scientific Conference 5 (28 de mayo de 2021): 588–98. http://dx.doi.org/10.17770/sie2021vol5.6395.
Texto completoResumen
People are facing the growth and access of information, as well as the various forms of communication. While some part of society experience a lack of information, others are flooded with printed, broadcast and digital content. UNESCO argues that media and information literacy can provide answers to questions related to our culture of information and critical thinking. Media literacy must be discussed through education, because teachers are the key person to literacy of the society. An important way to update media literacy among teachers and students is to introduce it in the curriculum. The topic of media literacy is currently included in the curriculum based on the new competency approach in Latvia. When evaluating the curriculum of the subject of the Latvian language, the aim of the paper is to determine which topics and aspects of media literacy are included in the curriculum of the Latvian language and what pupils' skills and knowledge they promote.
20
Зверев, К. А. "Russian Education in Independent Latvia: Reforms of the 1990s–2010s". Вестник Рязанского государственного университета имени С.А. Есенина, n.º 1(70) (17 de marzo de 2021): 80–89. http://dx.doi.org/10.37724/rsu.2021.70.1.009.
Texto completoResumen
В статье рассматривается развитие русскоязычного школьного образования в независимой Латвии с 1992 по 2020 год, а также процесс реформирования данной системы официальными властями. На момент провозглашения независимости и выхода из состава СССР в Латвии сложилась билингвальная система образования, позволявшая пройти обучение всех уровней (от детского сада до техникума и университета) как на латышском, так и на русском языках. Приход к власти в 1990-е годы националистических кругов и восприятие советского периода как периода «оккупации», сделал невозможным сохранение русскоязычной школы в неизменном виде. Преобразования не заставили себя долго ждать: уже в 1995 году были приняты поправки к закону об основной школе и гимназии, провозглашавшие необходимость введения в школах для национальных меньшинств нескольких предметов с преподаванием на латышском языке. Наиболее крупные реформы были осуществлены в 2004 году, когда старшее звено русскоязычных школ (10–12 классы) было обязано обучаться в пропорции 60/40, то есть не менее 60 % предметов на латышском языке, не более 40 % — на русском. Второй комплекс реформ начал реализовываться в 2017году, когда старшая школа (национальных меньшинств) целиком перешла на латышский язык обучения, а средняя школа лишь частично. Латвийские власти объясняют необходимость данных реформ стремлением повысить уровень знания государственного языка среди национальных меньшинств, в первую очередь русскоязычных. Реформа продолжается и будет завершена лишь в 2021 году. Данное исследование направлено на осмысление реформы русской школы Латвии с учетом последних преобразований. В работе используются статистические данные общественных организаций и Министерства образования Латвии, а также источники на латышском языке. The article treats the development of Russian minority schools in independent Latvia from 1992 to 2020. It also focuses on education reforms promoted by the Latvian government. When Latvia gained independence from the Soviet Union, the country had the system of bilingual education which enabled people to acquire primary, secondary and tertiary education in both the Latvian and Russian languages. When in the 1990s nationalists rose to power and the Soviet occupation was denounced, Russian minority schools underwent some changes. First amendments to the Elementary and Secondary Education Act were introduced in 1995. It was stipulated that Russian minority schools should teach some of the subjects in Latvian. More profound reforms were introduced in 2004. The new law stipulated that in secondary schools a minimum of 60 percent of teaching hours should be in Latvian. 2017 saw another wave of reforms. Senior schoolchildren were expected to get their education in Latvian, while middle-school students were expected to study only some of the subjects in Latvian. The Latvian authorities claim that the reforms, which will be completed in 2021, are expected to motivate ethnic minority groups to learn the state language. The present research is aimed at the examination of the reform of minority education. The article analyzes statistical data provided by public organizations and the Latvian Ministry of Education and some other sources in the Latvian language.
21
Vinogradova, V. V., A. Kivite-Urtane, J. Vrublevska y E. Rancans. "Prevalence of suicidal behaviours and its correlates in latvian general population: 2019-2020". European Psychiatry 64, S1 (abril de 2021): S591—S592. http://dx.doi.org/10.1192/j.eurpsy.2021.1578.
Texto completoResumen
IntroductionSuicide is a challanging problem for a global public health and Latvia remains in the list of European countries with the highest rates of suicide deaths. Information about the epidemiology of suicidal behavior is required for suicide prevention strategy development.ObjectivesTo determine the prevalence of suicidal behavior (suicidal ideation, plan, and attempts) and associated factors in Latvian general population.MethodsComputer assisted face-to-face interviews were carried out between November 2019 and March 2020 to gather information on a representative sample of the Latvian adult population (n=2687). The study sample was selected using a stratified random sampling method. The Mini-International Neuropsychiatric Interview (MINI; version 7.0.2) was used to assess suicidality. Multinomial logistic regression was applied.ResultsThere were 1238 males (46.1%) and 1449 females (53.9%) recruited. Mean age of respondents was 49.9 (SD 18.2). According to the MINI, 10.6% (n=285) of respondents reported at least some level of suicidal behaviour during the last month before interview and 7.1% (n=191) had shown current suicidal behaviour at the moment of interview, 4.0% (n=108) of respondents reported about previous suicide attempts. Non-cohabitation status, unfinished primary education and economical inactivity were statistically significant associated factors for suicidal behaviour among men, but only lower level of education was for women.ConclusionsComprehensive national suicide prevention strategy is required for reducing suicidality in Latvia. Special attention should be paid to women with lower education, and economically inactive, unmarried or non-cohabitant men, as well as man with unfinished primary education.
22
Grauda, Dace, Kalvis Avotiņš, Oksana Fokina, Agnese Kolodinska-Brantestam y Isaak Rashal. "Genetic Diversity of White Clover (Trifolium Repens L.) from the Urban Area of Rīga Baltā Āboliņa (Trifolium Repens L.) Ģenētiskā Daudzveidība Rīgas Pilsētvidē". Proceedings of the Latvian Academy of Sciences. Section B. Natural, Exact, and Applied Sciences. 69, n.º 3 (1 de agosto de 2015): 132–34. http://dx.doi.org/10.1515/prolas-2015-0018.
Texto completoResumen
Abstract White clover (Trifolium repens L.) is well represented in the urban environment and wide areas. The goal of this study was to compare the genetic features and to determine the genetic distances and similarities between some populations of white clover using iPBS (inter primer binding sites) technique in a retrotransposon-based method in samples from ecologically different areas in Latvia. Comparisons were made between three plant groups: urban environment (different areas in Rīga), Latvian countryside territory (four different localities), and the commercial variety ‘Daile’. The Shannon diversity index was not high (0.2974 for Rīga, 0.3079 in countryside territories, and 0.3367 for the variety ‘Daile’), but the polymorphic bands present in all evaluated plant sets were higher than 89%. Using principal coordinates analysis the white clover formed three clusters. One cluster included plants from the variety ‘Daile’. The plants from Rīga urban area and different sites of Latvia formed two clusters.
23
Kiitam, Urmo, Lilita Voitkevica, Saima Timpmann, Inese Pontaga, Jaan Ereline, Eve Unt y Vahur Ööpik. "Pre-Practice Hydration Status in Soccer (Football) Players in a Cool Environment". Medicina 54, n.º 6 (5 de diciembre de 2018): 102. http://dx.doi.org/10.3390/medicina54060102.
Texto completoResumen
Background and Objectives: Only a few studies have reported the pre-practice hydration status in soccer players (SPs) who train in a cool climate. The primary purpose of this study was to examine the hydration status of male semiprofessional SPs immediately before their regular training session in winter. The secondary purpose was to compare the urinary indices of the hydration status of Estonian and Latvian SPs. Materials and Methods: Pre-training urine samples were collected from 40 Estonian (age 22.1 ± 3.4 years, soccer training experience 13.7 ± 3.9 years) and 41 Latvian (age 20.8 ± 3.4 years, soccer training experience 13.3 ± 3.0 years) SPs and analyzed for urine specific gravity (USG). The average outdoor temperature during the sample collection period (January–March) was between −5.1 °C and 0.2 °C (Estonia) and −1.9 °C and −5.0 °C (Latvia). Results: The average pre-training USG of Estonian and Latvian SPs did not differ (P = 0.464). Pooling the data of Estonian and Latvian SPs yielded a mean USG value of 1.021 ± 0.007. Hypohydration (defined as a USG ≥ 1.020) was evident altogether in fifty SPs (61.7%) and one of them had a USG value greater than 1.030. Conclusions: Estonian and Latvian SPs do not differ in respect of USG and the prevalence of pre-training hypohydration is high in this athletic cohort. These findings suggest that SPs as well as their coaches, athletic trainers, and sports physicians should be better educated to recognize the importance of maintaining euhydration during the daily training routine in wintertime and to apply appropriate measures to avoid hypohydration.
24
Krumina-Konkova, Solveiga. "Recruitment of KGB Agents in the Roman Catholic and Lutheran Churches of the Latvian SSR (Overview and Examples)". ISTORIYA 13, n.º 6 (116) (2022): 0. http://dx.doi.org/10.18254/s207987840021873-9.
Texto completoResumen
The presented article reviews the tasks and methods of recruiting KGB agents among the clergy and laity of the Roman Catholic and Evangelical Lutheran Church in the Latvian SSR from 1944 to 1991. The primary sources of the author’s research are the documents from the archive of the KGB of the LSSR, which have become available for scientific research since December 2018 by the Law of the Republic of Latvia “On the preservation, use of documents of the former State Security Committee and establishing the fact of cooperation of persons with the KGB”. The most significant is the alphabetic file of active agents and the electronic database of operational data “Delta Latvia”. Besides, documents from archives of the Commissar of the Council for Religious Affairs and the Council on Religious Affairs under the Council of Ministers of the USSR in the LSSR, the criminal cases of some convicted priests, stored in the State Archives of Latvia and the author’s interviews with some former KGB agents are used. The review also considers examples that characterise the recruitment methods and the agency’s tasks.
25
Usca, Svetlana, Oleksandr Malykhin y Nataliia Aristova. "STUDENTS’ VIEWS ON HIGHER EDUCATION TRANSFORMATIONS CAUSED BY THE COVID-19 PANDEMIC: A COMPARATIVE STUDY FOR LATVIA AND UKRAINE". SOCIETY. INTEGRATION. EDUCATION. Proceedings of the International Scientific Conference 1 (3 de julio de 2023): 210–21. http://dx.doi.org/10.17770/sie2023vol1.7110.
Texto completoResumen
The study’s primary purpose was to compare Latvian and Ukrainian students’ views on transforming traditional learning process connected with implementing infection control measures aimed at preventing the spread of coronavirus and their consequences on higher education in both countries. In this study, the total number of respondents consisted of 207 undergraduate, graduate and postgraduate students from Latvia and Ukraine. Latvian research sample was presented by 109 students including 11 male students (10.09%) and 98 female students (89.91%). Ukrainian research sample consisted of 98 students including 16 male students (16.33%) and 82 female students (83.67%). A convenience sampling technique was used for selecting the research sample. The survey was conducted in October 2020 - March 2021. The current research is carried out within the project of National Academy of Educational Sciences of Ukraine “Organization of Educational Process in the Content of Unpredicted Changes (the Covid-19 Pandemic): Comparative Analysis (Ukraine – EU countries)”, No. 0121U108690.
26
Pošeiko, Solvita. "THE LINGUISTIC LANDSCAPE OF PRINT ADVERTISEMENTS IN DAUGAVPILS: 1920–1930". Via Latgalica, n.º 7 (22 de marzo de 2016): 40. http://dx.doi.org/10.17770/latg2015.7.1210.
Texto completoResumen
<p><em>The theme described in the title is connected with public advertising texts from two informational sources: newspapers printed in Daugavpils („Daugavas Vēstnesis” ‘The Daugava Herald’, „Daugavas Vārds” ‘The Daugava’s Word’, „Latgales Ziņas” ‘Latgalian News’ and „</em><em>Latgales Vēstnesis”</em><em> ‘The Latgale Herald”) and the linguistic landscape of the city, which characterizes the public information space. Commercial discourse is essential to this space, as a large part of public texts have the representation and promotion of establishments, companies and societies as a primary goal, in addition to the exhibition of offered goods and services.</em></p><p><em>The aim of the article is to define and characterize from the perspective of linguistic landscape the tools and techniques used to represent businesses and establishments in Latvian print advertisements in the 1920s and 30s. In fulfillment of this goal, content analysis and the diachronic linguistic landscape approach has been used for data analysis and interpretation (Backhaus 2005, Pavlenko 2010, Pavlenko, Mullen 2015, Pošeiko 2015). For summarization of obtained results, the descriptive method has been used.</em></p><p><em>Latvia is characterized in the interwar period by a unified language policy – including policies with mechanisms for the management of specific languages – highlighting the role of the Latvian language as the state language in the organization of public life and in nationalist ideology, and facilitating its use in all sociolinguistic functions. However, the interwar period in Latvia also marks the beginning of a period of Westernization – especially in the economic and cultural spheres – detectible in cinema, theater and concert posters; print advertisements for shops and consumer services, and business names in the urban environment.</em></p><em>During this period newspapers were printed in Latvian, but some papers, calendars and journals were printed in Latgalian, Russian and Polish. Company names, advertisements and partially-legible posters are visible in period photographs of the linguistic landscape. Advertising information at the beginning of the 1920s is only to be found in Russian, or with bilingual Russian-Latvian texts. Monolingual language signs in Latvian – noticeably missing diacritic marks and appropriate word endings – only begin to be seen from the 1930s.</em>
27
Lūsēna-Ezera, Inese, Gunta Siliņa-Jasjukeviča, Oskars Kaulēns, Inga Linde y Diāna Līduma. "The Relationship between the School as a Learning Organisation and Teacher Job Satisfaction in General Education in Latvia". Education Sciences 13, n.º 12 (22 de noviembre de 2023): 1171. http://dx.doi.org/10.3390/educsci13121171.
Texto completoResumen
The purpose of the study was to examine the relationship between the school as a learning organisation (SLO) and teacher job satisfaction in general education in Latvia. This study also examined teacher job satisfaction depending on the school type (primary, elementary and secondary school), school size, the geographical location of the school, the teacher’s work experience, the teacher’s workload and whether the teacher’s has one or more jobs. A structured questionnaire on the eight dimensions of the Latvian SLO model was used, which was developed within the project, “A model and tool to support the implementation of the approach school as a learning organisation in educational institutions”. The study sample included 478 teachers from 62 general educational institutions in Latvia. A significant relationship was found between all SLO dimensions and teacher job satisfaction in general education in Latvia. A significant relationship was not found between teacher job satisfaction and the school type, the school size, the geographical location of the school and the teacher’s work experience and workload; however, the data reveal that teachers who have almost full-time or full-time employment at school and those who work in only one school are more satisfied with their work.
28
Rozukalne, Anda. "‘All the Necessary Information is Provided by Russia’s Channels’. Russian-language Radio and TV in Latvia: Audiences and Content". Baltic Screen Media Review 4, n.º 1 (1 de diciembre de 2016): 106–24. http://dx.doi.org/10.1515/bsmr-2017-0006.
Texto completoResumen
Abstract After the Maidan events in Kiev and the annexation of Crimea in March 2014, discussions in Latvia expanded regarding the extent to which the Russian-speaking population in Latvia, whose daily information is obtained mainly from Russia’s TV channels, can get well-balanced and objective information. Opinion polls showed that a large proportion (41%) of the non-Latvians supported the annexation of Crimea and Russia’s President Vladimir Putin’s policy (SKDS 2014a). The aim of this article is to analyse the structure of the audiovisual media in the Russian language and media usage habits of the Russian-speaking audience using secondary and primary data. And thereby assess whether diversified information is available in the Russian language to this societal group. The research results show that the Russian-speaking population in Latvia does not feel a need for additional information channels, because they believe that the variety of information obtained from Russia’s TV and radio channels is sufficient.
29
Lukichev, B. A. y S. G. Alexeev. "The Production of a Forensic Examination and the Procedural Status of Knowledgeable Persons in Criminal Proceedings in Russia and Latvia". Siberian Law Review 19, n.º 1 (25 de abril de 2022): 68–90. http://dx.doi.org/10.19073/2658-7602-2022-19-1-68-90.
Texto completoResumen
The article provides a comparative analysis of legal acts regulating the organization of forensic activities, as well as the legal status of knowledgeable persons in criminal proceedings in Russia and Latvia. Comparative legal analysis of normative acts consists in comparing the prescriptions of legal norms, legislative terms and definitions, allowing one to see the general and special, typical and unique in the regulation of forensic activities, as well as the rights and obligations, the volume and nature of the procedural functions of knowledgeable persons in criminal proceedings Russia and Latvia. The study is carried out on the basis of a comprehensive comparative legal analysis of the latest editions of criminal procedure laws (codes), laws in the field of organizing forensic activities in Russia and Latvia, by-laws, as well as other primary sources, including foreign ones, in the original language. Knowledgeable persons, i.e. persons applying special knowledge in criminal proceedings in Russia, are experts and specialists, in Latvia – experts, auditors and specialists. The legal status of knowledgeable persons in criminal proceedings in Russia and Latvia is largely comparable, but not identical. And, despite the transformation of the criminal procedural legislation of Latvia, in accordance with international legal norms and standards of the European Union, the provision of Soviet law on the use by knowledgeable persons of special knowledge in legal proceedings was preserved in the Latvian criminal process. The Code of Criminal Procedure of Russia classifies an expert and a specialist as other participants in criminal proceedings, that is, persons performing the function of promoting justice. Whereas the Latvian Criminal Procedure Law refers an expert and an auditor to persons having powers in criminal proceedings, a specialist – to other persons involved in criminal proceedings. And, if the expert and the auditor in the Criminal Procedure Law of Latvia are considered as independent participants in the criminal process, then the role of a specialist in legal proceedings is reduced to the level of “auxiliary personnel”. An expert and an auditor, according to the requirements of the Criminal Procedure Law of Latvia, are involved in criminal proceedings to give an opinion and fulfill the obligation to provide evidence, that is, as “means of ensuring judicial evidence”. Specialist – to assist officials performing procedural actions in fixing the progress and results of their conduct, using technical means to identify circumstances relevant to the case, but without conducting practical research in search of traces of a criminal act. The results of the comparative legal analysis of the normative acts regulating the rights, obligations, scope and nature of the procedural functions of knowledgeable persons in the criminal proceedings of Russia and Latvia allow us to expand our understanding of the application of special knowledge in the criminal proceedings of foreign states, as well as to critically assess the national criminal procedure legislation for the purpose of its further improvement and optimization. Based on the results of the study of the normative acts of Russia and Latvia, certain problematic aspects of the legal regulation of the procedural status of knowledgeable persons in the Russian criminal procedure legislation is noted, and generalizing conclusions are made.
30
Krivins, Anatolijs. "HIGHER EDUCATION OF LAWYERS: THE CENTRALIZED QUALIFICATION EXAM". SOCIETY. INTEGRATION. EDUCATION. Proceedings of the International Scientific Conference 1 (3 de julio de 2023): 40–49. http://dx.doi.org/10.17770/sie2023vol1.7063.
Texto completoResumen
The research analyses the current situation of legal education in Latvia, Germany and United Kingdom. The current changes in the Latvian higher legal education system are mainly related to the introduction of the centralized lawyer qualification exam. The research aim is to find out the strengths and weaknesses of the centralized lawyer qualification exam, to offer practical solutions for improving the quality of higher education. The following primary methods have been used in the study: in order to assess the applicability of the new solutions in Latvia, the study analyzed the materials for the development of normative legal acts, opinions of lawyers and scientific literature. A summative content analysis was performed. In addition, the study is based on an analysis of the historical and contemporary experiences of United Kingdom and Germany. As a result of the analysis, it has been concluded that it is necessary to transform legal education programs not only at the master's level, but also at the bachelor's level. The future work will include the implementation of empirical studies in the field of analysis of training programs in Latvia. The research novelty: the research covers the challenges of implementing new measures and assesses the role of different actors in the transformation process.
31
Ābeltiņa, Anna, Rosita Zvirgzdiņa y Juris Ozols. "Endogenous factors in Latvian regional development". Problems and Perspectives in Management 14, n.º 3 (29 de julio de 2016): 21–30. http://dx.doi.org/10.21511/ppm.14(3).2016.02.
Texto completoResumen
The aim of this paper is to explore what endogenous factors dominate in the regional development of Latvia. To achieve the aim, the following tasks were established: to examine the theoretical background of regional development; to analyze the endogenous factors of regional development in Latvia; to evaluate the significance of the endogenous development factors of regions by using expert evaluation method. The following research methodology was used: literature review, graphical method, expert evaluation method and logically constructive approach – for data evaluation and result analysis; synthesis method – to combine the elements in a unified system; social research methods – to obtain the primary information and to carry out its verification. For expert evaluation data processing the statistical and data analysis methods were used, including the data parametric grouping and correlation calculations, and the average calculations of the factors corresponding to each group. The analysis of the statistical data and the independent expert evaluation results allow concluding that the most important factors influencing regional development are the government decisions and the existing infrastructure, as well as the influence of migration, the distance from the centre and the availability of investment. These findings on regional development apply particularly to a small country where geographically and historically has formed a single highly-developed economic and political centre – the capital, and where does not exist a secondary centre. The research findings confirm the thesis that the endogenous development factors are the primary in the regional development
32
Antonovičs, Kaspars. "Analysis of foreign scientific relations and business trips of the Riga Medical Institute from 1950 to 1991". Scientific Herald of Uzhhorod University Series Physics, n.º 55 (7 de febrero de 2024): 510–18. http://dx.doi.org/10.54919/physics/55.2024.51lf0.
Texto completoResumen
Relevance. The relevance of the study lies in the fact that the role of foreign scientific contacts and professors' trips from 1950 to 1991 in the context of bibliographic sources underlines the tasks of the teaching character of the Riga Medical Institute. Since one of the least studied periods in the history of Latvian medicine with its ideological specificity is the period from 1950 to 1991, only individual studies can be found, including the history of the Riga Medical Institute and the Latvian State University in the monograph “From University to University”. The 60-year presence of Latvia in the USSR is often interpreted and idealized in two ways. Purpose. The purpose of the research is to consider the analysis of foreign scientific relations and business trips of the faculty of the Riga Medical Institute in the period from 1950 to 1991 in terms of bibliographic sources. For trips of scientific and teaching staff of the Riga Medical Institute outside the USSR, in the period from the establishment of the RSU until the restoration of the independence of the Republic of Latvia in 1991, is characterized by connection with the political situation of the USSR system in international scientific relations. Methodology. The modern world has great opportunities for international cooperation and freedom of movement. Results. Students and Western scientists lack an understanding of the complex possibilities of scientific and academic staff of the Riga Medical Institute for scientific communication with researchers outside the USSR. Therefore, this topic has already attracted the attention of other European researchers. Conclusions. Practical significance lies in the updating of problems of foreign scientific relations and business trips of professors and teachers of the Riga Medical Institute in the period from 1950 to 1991 on the basis of new primary sources.
33
Apse, Diāna. "Legal Thinking in the Interwar Latvian Senate". Journal of the University of Latvia. Law 14 (2021): 223–40. http://dx.doi.org/10.22364/jull.14.14.
Texto completoResumen
In this article, the author researches and analyses the legal thinking created by Senators A. Lēbers and M. Čakste, aspects of interdisciplinary interaction of subsidiary sources and branches of law in the interwar Latvian Senate. The findings made by the senators of interwar Latvia (in the capacity of rapporteurs on a case, members of the court’s composition) help to explore the historical events and the legal culture of the respective age by reading the primary sources. In the conditions of contemporary legal system, the described cases and legal institutions mostly have similar regulation and could be useful for the development of the case law on the respective matter. Interaction of subsidiary sources, in particular, the used findings of the doctrine build bridges across ages and promote the continuity of uniform case law and understanding of law. The range of resolved legal matters pertained to a broad area of law – branches of law, interdisciplinary aspects of the legal system. The scientific contribution by Senators A. Lēbers and M. Čakste is universal and significant in the context of European and global thinking. Notwithstanding the circumstances, they remained loyal to democratic Latvia.
34
Ozoliņa, Liene. "Raspberries, Tablecloths, and Critical Thinking". East European Politics and Societies: and Cultures 24, n.º 4 (26 de marzo de 2010): 572–94. http://dx.doi.org/10.1177/0888325409358607.
Texto completoResumen
This article looks at three different sites in post-Soviet Latvia that have all been subject to liberal democratic reforms: the State Audit Office, a local municipality, and civic education classes in primary schools. These sites exemplify an introduction to the kind of accountability relations that are expected to exist in a liberal democracy. Through the lens of accountability, this article exposes how the democratic reform initiatives are taken up by Latvian citizens, in what has been called a “secondary production of knowledge,” to become part of their own tactics of survival and adjustment. The article reveals a sharp, morally charged juxtaposition of the “old” and the “new,” prevailing in the Latvian everyday reality. Governance reforms carry symbolic and moral urgency that stems from annihilation of the Soviet past. The reforms in this context serve as gestures to be made about one’s “modernness.” However, reorganization of governance practices on the ground reveals profound tensions when the new practices are endowed with locally relevant meanings. In this article, I attempt to demonstrate how the secondary production of knowledge coalesces into a sense of “cultural intimacy,” since often the individual’s deep commitment to the symbolic “new” has to coexist with awareness of one’s own incongruence with the new order.
35
Kalniņa, Ieva. "Ceļš uz savu valsti Annas Brigaderes romānā “Kvēlošā lokā”". Aktuālās problēmas literatūras un kultūras pētniecībā rakstu krājums, n.º 29 (22 de febrero de 2024): 87–94. http://dx.doi.org/10.37384/aplkp.2024.29.087.
Texto completoResumen
Anna Brigadere’s (1861–1933) novel “The Glowing Circle” (Kvēlošā lokā, 1928) is the writer’s only novel. The article examines how Brigadere recreated the path to the state’s founding in the novel and how she interpreted the events of that time. The aim of the article is to show in which aspects Brigadere creates the novel as the historical memory and cultural basis of the nation and in which aspects she expresses the views of her social group. The article uses materials in Latvian and German from the collections of the Museum of Literature and Music. The article uses case analysis – primary research case analysis and explanatory case analysis – to look at museum materials and their relationship to the text of the novel, as well as discourse analysis. Brigadere emphasises in the novel that the Republic of Latvia was established at a time when two countries (Russia and Germany) were trying to include it in their circle of interests, when people were involved in the war, and when it gradually became clear that only their own country could save the nation. In the novel, Brigadere opposes social-democratic and communist views. With the final solution of the novel, she joins the positivist tradition of Latvian literature.
36
Tocelovska, Natalja, Biruta Sloka y Karlis Purmalis. "Financial Companies in Latvia: Why are they Coming to the Bond Market?" European Integration Studies, n.º 13 (29 de octubre de 2019): 70–79. http://dx.doi.org/10.5755/j01.eis.0.13.23500.
Texto completoResumen
In the period 2013-2017 Latvian corporate bond market had experienced the abrupt growth of the number of public Latvian corporate bond issues outstanding. The base of the expansion was formed by the financing activity of Latvian financial sector issuers (FSIs) with their weight in the pool of corporate bond issues listed in Nasdaq Riga at 85%. In 2019, FSIs remain the main issuer in Latvian corporate bond market (64% of the number of issues (Nasdaq Baltic, 2019)). The financing needs and preferences of the FSIs not only shape the segment profitability but also build Latvian corporate bond market sustainability.
Academic papers provide broad motivation for corporate debt issuing: an efficient competition to bank funding, long-term financing, improvement of the cash flow by decreasing the cost of debt, optimization of the financial structure, and efficient ownership structure. The existing academic research is modest on the analysis of the FSI segment as the issuer segment in the debt market where academics do analyse the corporate bonds issuance by the FSIs where motivating factors stimulating FSIs to come to the public debt market are seldom separated while size and characteristics of the issuers are mostly scrutinised.
The aim of this article is to analyse the determinant of the development of the FSI segment of the corporate bond market in Latvia by defining the factors stimulating the bond issuing decision as made by the FSI segment. This article provides primary data analysis of both survey and in-depth interviews with Latvian FSI segment representatives run in the period June-August 2017. The results of the analysis indicate that bank borrowing is not treated as the funding alternative for FSIs where issuing debt and equity funding are the recognised funding sources of the FSI segment. The growing role of the peer-to-peer platform financing is recognised and will further influence the FSI segment alternative financing. The main factors motivating FSIs to come to the debt market are reputation a company gets as the result of the bond issue, strategical ambition to be present in the public market, cost of funding in the long-term (more than 3 years). The methods used in this article are scientific publication analysis, document analysis, expert survey, in-depth interviews, and statistical data analysis.
37
Mons, Arturs y Velga Vevere. "BEHAVIORAL ECONOMICS PERSPECTIVE ON ASSESSMENT OF RECRUITMENT AND SELECTION PRACTICES IN LATVIA". Acta Prosperitatis, n.º 11 (22 de abril de 2020): 128–39. http://dx.doi.org/10.37804/1691-6077-2020-11-128-139.
Texto completoResumen
The aim of the current paper is to evaluate the current Human Resource Management evolution in Latvia with respect to employee recruitment and selection practices. The focus is set on the used methods of selection process in organizations, when they are hiring personnel on different organization levels. The authors of the current paper applied several empirical methods to research the recruitment and selection processes. The study was executed in two stages: (1) discussion with Latvia’s recruitments practitioners (Delphi method), and (2) quantitative study performed in Latvia. The research questions were the following. Question 1: Which recruitment methods are used in their represented organizations? Question 2: Which of selection methods are used in their organization? To collect primary data an online survey form was created which was completely self‐administrative. A sample of 16 businesses from different industries in Latvia, was selected. The sampling was conducted during the whole month of January 2020 and data is reflected in the findings. The survey results demonstrate that the employee selection methods applied in Latvia are not that various. Most of the respondents holds on to the traditional methods such as panel interviews and one to one interviews.
38
Badjanova, JeĮena. "Primary school teachers' views on a holistic approach to facilitating the acquisition of musical cultural values". Journal of Teacher Education for Sustainability 15, n.º 2 (1 de diciembre de 2013): 78–90. http://dx.doi.org/10.2478/jtes-2013-0013.
Texto completoResumen
Abstract Recent tendencies in education highlight the need to align the system of general education in Latvia with the tenets of sustainability. In keeping with this broad target orientation, this paper re-examines international and Latvian experiences and perspectives on the application of a holistic approach to the content of primary education. This review of good practice is set against the backdrop of different theories and approaches concerned with the essence and principles of holism. More specifically, the paper addresses the issue of ensuring successful acquisition of musical cultural values in primary school via a holistic approach. In this regard, the latter is construed as movement towards the new that facilitates positive attitudes towards musical cultural values among learners and is both physically and spiritually nurturing. The paper proposes a theoretically and empirically grounded model for the usage of a holistic approach with a view to enabling acquisition of musical cultural values in primary school. The gradual development of the model is traced in the course of theoretical and empirical inquiry, the latter involving a survey and an interview with five experts
39
Ostrowski, Norbert. "Old Latvian Comparative Constructions". Baltu Filoloģija 30, n.º 1/2 (2021): 93–99. http://dx.doi.org/10.22364/bf.30.05.
Texto completoResumen
What functioned as the primary comparative construction in seventeenth-century Latvian was a construction with the conjunction nekā ‘than’ (literally: ‘not like’), which typologically represents the so-called conjoined comparative in Stassen’s terminology (Stassen 1985). This is consistent with the state of affairs evidenced in sixteenth-century Lithuanian, where, as primary comparative constructions of inequality (COI), we find constructions with conjunctions comprising negation: neg(i), nei(gi), neng, nekaip, net, nent ‘than’ (Ostrowski 2018).
40
Kozachenko, Jekaterina, Anda Kivite-Urtane, Frederika Berzina, Ieva Evelina Stolcere y Gunta Lazdane. "The Association of Longer Breastfeeding Duration and Socioeconomic, Pregnancy, Childbirth and Postpartum Characteristics". Medicina 60, n.º 5 (10 de mayo de 2024): 792. http://dx.doi.org/10.3390/medicina60050792.
Texto completoResumen
Background and Objectives: Breastmilk is the safest and most suitable food for an infant, playing the role of their first vaccine and containing all the essential nutrients for the first months of life. The World Health Organisation recommends exclusive breastfeeding for the first 6 months of life and continued breastfeeding while introducing a child to complementary foods until 2 years and beyond. According to Latvian statistics from 2022, only 27.4% of babies were breastfed for 12 months. The aim of this study was to determine the socio-economic factors and factors related to pregnancy, childbirth and postpartum that influence breastfeeding for more than 6 months in Latvia. Materials and Methods: Data were used from the cross-sectional survey “Research on factors and behaviours affecting the sexual and reproductive health of the population of Latvia”, which was conducted in 2023. A study sample was randomised and stratified by gender and five age groups. The analyses in this study are based on a sample of women who had given birth at least once (n = 1407), and the dependent variable was the duration of breastfeeding their last child. Binary logistic regression was conducted to identify the associated factors. Results: The point prevalence of longer duration of breastfeeding for the last child was 47.9% (n = 674). The odds of longer breastfeeding duration were higher among mothers who did not smoke during pregnancy (vs. smokers, aOR 2.1, p < 0.001), of Latvian nationality (vs. Russian, aOR 1.3, p = 0.03), who had two childbirth (vs. one, aOR 1.5, p = 0.003), who had the highest level of education (vs. primary education, aOR 2.0, p = 0.03), started breastfeeding immediately after the birth (vs. later than the first day, aOR 1.7, p = 0.01) or on the first day (vs. later, aOR 1.6, p = 0.01). Conclusions: We documented socio-demographic pregnancy and childbirth factors associated with longer breastfeeding durations. Efforts to promote breastfeeding practices should target mothers from the most vulnerable groups.
41
Kuzmina, Jekaterina. "FINANCIAL SUSTAINABILITY OF HIGHER EDUCATION INSTITUTIONS". SOCIETY. INTEGRATION. EDUCATION. Proceedings of the International Scientific Conference 6 (28 de mayo de 2021): 324–35. http://dx.doi.org/10.17770/sie2021vol6.6399.
Texto completoResumen
Since the beginning of the XXI century, there have been clear modifications in the sector of higher education, when the institutions have moved near to the economic sector. These changes were primary introduced as the consecutive response to the transformation processes within the society, which should be embedded in the following construct: there was a clear move towards a more competitive and market-based system. Due to the changes in the operating environment financial sustainability and its management for the higher education institutions became one of the core elements. The main objective of the current paper is to discuss the practical application of the methodology for the management of higher education institutions based on the example of Latvian private higher education institutions. The author would like to argue that the paper contributes to the fundamental discussion of financial sustainability in the field of higher education institution management. Moreover, it has got practical implications for the management of the organizations not only in Latvia but also in other countries when efficiency and effectiveness are primary issues.
42
Korsak, A. I. "Military Burials of the Great Patriotic War on the Territory of the Belarusian-Latvian- Russian Border in the Soviet Practice of Immortalization of Memory". Modern History of Russia 11, n.º 1 (2021): 174–83. http://dx.doi.org/10.21638/11701/spbu24.2021.111.
Texto completoResumen
Using archival materials from the National Archive of the Republic of Belarus, the State Archive of Vitebsk region, the Polotsk Zonal State Archive, and the Daugavpils Zonal State Archive of the National Archive of Latvia, as well as published documents of Russian archives and works of historians, this article examines the process of preserving the memory of the fallen soldiers of the Red (Soviet) Army on the territory of the Belarusian- Latvian-Russian border in the post-war Soviet period. The main conclusion is the correctness (incorrectness) of decision making by Soviet authorities at the level of districts and cities in relation to immortalization of the memory of fallen soldiers of the Red (Soviet) Army and partisans. One example of the primary analysis of a common grave in the village of Shevelevo in the Palkinskiy district of the Pskov region. The comparative analysis of the policy of preserving the memory of those who died during the Great Patriotic War, by taking into account military burials and their further memorialization at the Belarusian-Latvian-Russian border in the post-war period, gives us the opportunity to ascertain the specifics of the Soviet republics in this direction. The actions of the Soviet leadership depended on the time of liberation of the territory from the Nazis, as well as the quality of work of the “funeral teams” that were to perform the function of burial of the bodies of the Red (Soviet) Army soldiers after the end of the battle.
43
Homutiņins, Aleksejs, Viktorija Šipilova y Ludmila Aleksejeva. "Human Capital at the Regional Level: Population Forecast Insights into Latvia from a Long-Term Perspective". Academic Journal of Interdisciplinary Studies 13, n.º 3 (5 de mayo de 2024): 32. http://dx.doi.org/10.36941/ajis-2024-0063.
Texto completoResumen
To remain prosperous and competitive, modern regions must meet the challenge of becoming smart and sustainable, and human capital has a key role in this context. Depopulation increases risks of human capital availability and emigration is a primary reason. Regions that are experiencing a decreased population must develop strategic sustainable regional development policies that consider scientifically based population forecasts. The youth population characterises regional potential for long-term human capital availability. First, children represent a region’s future employees and entrepreneurs. Second, children require availability of educational services at regional level, which promotes regional vitality. Third, the youth population indirectly demonstrates a region’s socio-economic attractiveness for living and working. This study employs the system dynamic method to forecast different population change scenarios at the regional level in Latvia. The results reveal a declining, long-term population tendency for working age and youth populations in Latvian regions. Overall, Latvian regions will remain extremely homogeneous in the long term, with minor differences in the short term. In conclusion, despite regional disparities in terms of quality of life with some leading examples, all regions will experience high emigration loss. Regional social, economic and environmental characteristics demonstrate a need to assess population change trends in a complex manner. This study provides data for understanding short- and long-term perspectives that must be addressed through sustainable regional development policies. Received: 27 October 2023 / Accepted: 24 March 2024 / Published: 5 May 2024
44
Jurgelāne-Kaldava, Ingūna y Agnese Batenko. "Assessment of Data Security Implementation in the Supply Chain Enterprises in Latvia". WSB Journal of Business and Finance 57, n.º 1 (1 de enero de 2023): 21–27. http://dx.doi.org/10.2478/wsbjbf-2023-0003.
Texto completoResumen
Abstract The importance of data security in the supply chain has increased in the last few years. The study identifies recent trends and shortcomings in data security, assessing enterprises operating in Latvia’s transport and storage industry. The research aims to study and identify the current trends in data security in the Transport and Storage industry to develop recommendations for improving data security in the supply chain. The research focuses on studying data security in the supply chain in Latvia. The theoretical literature review was used to learn the main aspects of the supply chain concept and the data security measures applied. Statistical and content analysis shows the industry’s primary data security trends and issues. The results of the research concluded that in Latvia, enterprises providing supply chain operations are focusing on something other than mandatory education about the data security of their employees; thus, they need to apply sophisticated measures to protect data through all supply chain processes.
45
Matisone, Anita y Natalja Lace. "The Impact of Public Interventions on Self-Sustainable Venture Capital Market Development in Latvia from the Perspective of VC Fund Managers". Journal of Open Innovation: Technology, Market, and Complexity 6, n.º 3 (24 de julio de 2020): 53. http://dx.doi.org/10.3390/joitmc6030053.
Texto completoResumen
This paper presents the results of a study on the impact of EU structural funds on the development of a self-sustainable venture capital (VC) market in Latvia from the perspective of VC fund managers. The study had two objectives. The first was to assess the contribution of European Union (EU) structural funds (SF) programmes toward the development of a self-sustainable VC industry in Latvia. The second was to identify ways by which the structural fund support could be better exploited for the development of the VC industry in Latvia. During three SF planning periods, the stated primary goal of the programmes to support high-growth SMEs was attained—to date, 294 VC investments have been made by publicly supported hybrid VC funds. During the 2004–2006 planning period, the first generation of professional VC fund managers in Latvia emerged in response to the opportunity to manage publicly supported hybrid VC funds. During the subsequent programmes, a high continuation rate by the established managers was observed. Nevertheless, Latvian VC fund managers are not yet capable of raising private funds and still encounter difficulties in attracting the necessary level of private capital for the publicly supported hybrid VC funds. The novelty of the study is the finding that improvements in the SF programme designs did not significantly decrease the impact of factors identified as limiting the success of the operations of VC managers. This suggests and confirms conclusions of other studies that argue that public policies aimed at creating healthy and supporting conditions for VC activity are necessary in addition to public financial support for VC funds. Regarding the next planning period, the suggestion regarding programme design is to continue with already started improvements: increasing the volume of funds, widening the geographic area eligible for investments, reducing restrictions on the types of financial instruments that may be used, lowering the administrative burden for VC fund managers and avoiding micromanagement of VC funds by governmental agency. The observation that the influence of investments in VC funds on the governmental agency’s responsible for VC investments financial statements may be partly responsible for the tendency to micromanage VC funds could be useful not only in Latvia but also in other countries.
46
Dolacis, J., E. Tomsons y J. Hrols. "Fuelwood Comparison with Other Kinds of Fuel". Environment. Technology. Resources. Proceedings of the International Scientific and Practical Conference 1 (26 de junio de 2006): 67. http://dx.doi.org/10.17770/etr2003vol1.1982.
Texto completoResumen
A part of Latvia’s forest resources, namely, branches, stumps, small stump top ends, firewood, slabs, sawdust, etc. remains unutilised both in the felling sites and woodworking plants. All this can be successfully utilised for production of heat energy, thereby replacing a part of the imported natural gas, coal and liquid fuel. To assess the utilisation of a definite type of primary energy, not only its accessibility and costs, but also calorific value should be known. The rational utilisation of energy resources in Latvia is urgent, since less than 30% from the consumption is obtained in this country. Thus, in 2000, the Latvia’s energy balance showed the total consumption of different types of primary energy resources to be 159 145 TJ (T = 1012). Utilising firewood, woodworking waste and chips, 34 250 TJ of energy was produced, or 21.5 % from the total primary energy consumed in Latvia. In the present study, fuel wood is compared with other types of fuel. If the equivalent value of one ton of coal (tce) is 29.308 MJ/kg, then the calorific value of natural gas and dry wood is 1.507 and 0.644, respectively. If 18.883 MJ of heat is obtained from 1 kg of oven dry wood, then 1.3 kg of wood with the relative moisture (Wr) content 20% and about 2.0 kg of freshly cut wood are necessary. To replace 1 ton of sawdust pellets or granules, 2.44 steres of birch firewood with the moisture content Wr = 20% or 2.63 steres with Wr = 40% are necessary. The above-mentioned amount of pellets or granules can be replaced by 3.47 steres of spruce firewood with Wr = 20% or 3.76 steres with Wr = 40%. The production of 1 kWh of heat from natural gas yields 0.224 kg of carbon dioxide, but in the case of fully combusted wood, from 0.35 to 0.4 kg of carbon dioxide.
47
McKenzie, Brent y Emily Hunter. "A case study of a non-profit organization in an emerging economy: O fonds in Latvia". Baltic Journal of Management 16, n.º 1 (3 de noviembre de 2020): 155–72. http://dx.doi.org/10.1108/bjm-02-2020-0039.
Texto completoResumen
PurposeThe focus of this research is to present a case study of a small Latvian-based non-profit organization (NPO), O fonds (Oncology Foundation), and how they are an exemplar of the challenges facing NPOs in countries that do not have a strong history of NPO success. The research is supported through primary data collection of multiple interviews and correspondence with the key informant of O fonds, the CEO. These insights were supported with secondary data analysis of the history of NPOs in emerging markets, as well as the history of cancer screening in Latvia.Design/methodology/approachIn order to address the gap in the existing research literature, a single firm case analysis was selected to provide the context of the study. A series of semi-structured questions focused on O fonds branding and rebranding activities were posed to the CEO of the firm. Subsequent personal interviews were conducted to analyze and interpret the original results. This primary data were linked to secondary data about the practices of O fonds, NPOs in Latvia and the roles and challenges of NPOs in emerging markets.FindingsThe analysis of the findings from the primary data collection found that O fonds' rebranding effort helped to achieve a more stable and significant place for NPOs in the healthcare sector in Latvia and of equal importance with the Latvian general public. Tangible results included more financial support from donors, with an added benefit of increased joint marketing activities with corporate donors. Furthermore, active involvement with O fonds and medical professionals resulted from the rebrand. Also, there was an increase in referral patients to O fonds so they could attempt to get these people support for cancer screening.Research limitations/implicationsQuestions as to issues of validity from the use of a single case study, and greater issues with a single case, single interview method are acknowledged. This potential limitation, with respect to this study, was deemed to be lessened based on the use of multiple interviews and sourcing of secondary company material with the CEO of O fonds. Further support by way of sharing of a secondary data, and organizational insights helped to address any major limitations in the research methodology, as helpful information and materials that might not have been readily available, or unavailable without this level of trust, could be obtained.Practical implicationsExploring how NPOs can rebrand their firm to better meet the needs of society and be most impactful will contribute to both managerial practice and academic literature. By examining how a non-profit rebranding process occurs, in an emerging economy, and determining how effective rebranding can be utilized as a turnaround strategy, is a contribution of this research. Given the limited non-profit rebranding literature, particularly in emerging markets, this study provides exploratory insights within a new context to help propel the field of knowledge.Social implicationsNPOs have been shown to play a valuable role in communities across many regions of the world as NPOs enable citizens to come together to collectively work toward a common goal with the purpose of bettering society. With respect to the focus on O fonds their aim of increasing early detection of cancer continues to rise, but more positively, the incidents of treatable cancer are also rising as the result of the former. Regrettably, this positive trend in increased cancer screening does not equate to lower mortality rates across all countries, particularly countries in emerging markets such as Latvia.Originality/valueThis is one of the first known studies of an NPO in the emerging market of Latvia, in general, and in the Latvian healthcare sector specifically. As there is a dearth of research in this field of study, and the fact that NPO growth is a critical component of society growth in emerging markets, there is an important contribution to be made to both practice, and society, from the findings from this research.
48
Sondore, Anita, Elfrīda Krastiņa, Elga Drelinga y Pēteris Daugulis. "IMPROVING MATHEMATICAL COMPETENCE IN PRIMARY SCHOOL TO ENABLE SKILL TRANSFERS IN NEW SITUATIONS". SOCIETY. INTEGRATION. EDUCATION. Proceedings of the International Scientific Conference 2 (26 de mayo de 2017): 208. http://dx.doi.org/10.17770/sie2017vol2.2256.
Texto completoResumen
Mathematical competence is one of the basic competences defined in the EU. Results of international studies in recent years show that the percentage of pupils in Latvia with high level (5.,6.) of mathematical competence has decreased from 8% (PISA, 2012) to 5,2% (PISA, 2015). Observations of mathematical lessons show that individualization of studies is not a popular everyday feature, nonstandard problems are rarely used in the work with primary school pupils. Sustainable education can not be envisioned without creative thinking necessary for solving various nonstandard problems. Mathematical competitions also require creative applications of knowledge. The goal of this study was to analyze problems of Latvian mathematical contests for grades 4-6 of the last 3 years according to categories of mathematical content. The most important cognitive and metacognitive strategies necessary for their solution are shown. It is important to turn attention of teachers to much wider inclusion of contest problems into study process of primary school. It will enable to individualize studies and stimulate skill transfer to new situations for gifted pupils. The authors encourage teachers to use nonstandard (contest) problems as an indivisualization tool which will give opportunity for pupils to master knowledge and skill transfer. It will provide regular training of mind and positive emotions for pupils who are bored with solving standard problems.
49
Margevica-Grinberga, Ieva y Ilze Šūmane. "THE ADVANTAGES AND DISADVANTAGES OF INCLUSIVE EDUCATION FROM THE PERSPECTIVE OF FUTURE TEACHERS". SOCIETY. INTEGRATION. EDUCATION. Proceedings of the International Scientific Conference 1 (28 de mayo de 2021): 432–41. http://dx.doi.org/10.17770/sie2021vol1.6352.
Texto completoResumen
In Latvia, inclusive education is relevant as seen in the past several decades, during which time society has developed a more comprehensive understanding of and made significant progress towards implementing inclusive education. Nevertheless, there is still a gap between the priorities of education policy and reality in educational institutions. The quality of education accorded to students is informed by the knowledge, understanding and experience of teachers in the implementation of concepts of inclusive education. The current study aimed at identifying the visions of prospective teachers (already working in schools) concerning inclusive education. To explore the experiences of future teachers, this qualitative study used narratives (i.e., written answers to open-ended discussion questions) of prospective teachers as a research strategy. The study team recruited participants at the University of Latvia, which included 61 students in the work-based teacher education study programme and 46 future pre-school and primary school teachers. Therefore, the current study offers insight into how comprehensive education is implemented in Latvian schools. The results reveal a positive attitude on the concept of inclusive education among most prospective teachers. However, they have concerns about the quality of its implementation, which come as a consequence of limited resources (human, time and financial) and the underdeveloped teachers’ professional competence in the implementation of diversity solutions. Therefore, improving the study process of future teachers enhances the development of their competencies in the provision and promotion of solutions regarding inclusive education.
50
Tālberga, Gunita y Andra Fernāte. "SPIRITUALITY IN HIGHER EDUCATION: VIEWS OF THE TEACHING STAFF". SOCIETY. INTEGRATION. EDUCATION. Proceedings of the International Scientific Conference 1 (26 de mayo de 2017): 390. http://dx.doi.org/10.17770/sie2017vol1.2335.
Texto completoResumen
Spirituality is an integral part of a holistic education (Miller, 2005) and a holistic development of personality (Chandler et al. 1992; Myers et al. 2008). Although various definitions of spirituality are used, several authors recognize the importance of spirituality in higher education (Dillard, 2006; Love & Talbot, 1999; Tisdel, 2001). Christian values have shaped the identity of Latvia since ancient times but the atheistic history of Latvia during the Soviet occupation has affected people's thinking. Therefore, the aim of this research was to find answers to the following questions – how do the teaching staff of the Latvian Academy of Sport Education (LASE) understand spirituality? What are the teaching staff's views on the enhancement of students' spirituality during their study process? What is the teaching staff's attitude regarding Biblical spirituality? This paper is based on a qualitative study (voluntary semi-structured interviews and qualitative content analysis were used) that examined 14 LASE teaching staff (7 women and 7 men, 27-68 years old). Spirituality is perceived as the multifaceted inner life of a person which determines a person's understanding of the universe and connection to God and other people. The common human and family responsibility, leadership and teaching staff responsibility, an institutional environment, and God's work in the hearts of students were mentioned as primary to enhancing spirituality in students. We observed that according to the Biblical understanding of spirituality most of the teaching staff appear to be in a stage of pre-spirituality and not spirituality.