Acceder

Bibliografías temáticas / High resolution melting analysi / Artículos de revistas

Siga este enlace para ver otros tipos de publicaciones sobre el tema: High resolution melting analysi.

Artículos de revistas sobre el tema "High resolution melting analysi"

Autor: Grafiati

Publicado: 10 de marzo de 2023

Crea una cita precisa en los estilos APA, MLA, Chicago, Harvard y otros

Elija tipo de fuente:

Consulte los 50 mejores artículos de revistas para su investigación sobre el tema "High resolution melting analysi".

Junto a cada fuente en la lista de referencias hay un botón "Agregar a la bibliografía". Pulsa este botón, y generaremos automáticamente la referencia bibliográfica para la obra elegida en el estilo de cita que necesites: APA, MLA, Harvard, Vancouver, Chicago, etc.

También puede descargar el texto completo de la publicación académica en formato pdf y leer en línea su resumen siempre que esté disponible en los metadatos.

Explore artículos de revistas sobre una amplia variedad de disciplinas y organice su bibliografía correctamente.

1

Carillo, Serge, Laurent Henry, Eric Lippert, François Girodon, Isabelle Guiraud, Céline Richard, Frédérique Dubois Galopin et al. "Nested High-Resolution Melting Curve Analysis". Journal of Molecular Diagnostics 13, n.º 3 (mayo de 2011): 263–70. http://dx.doi.org/10.1016/j.jmoldx.2010.12.002.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

2

Ro, Na Young, On Sook Hur, Ho Cheol Ko, Sang Gyu Kim, Ju Hee Rhee, Jae-Gyun Gwag, Jin-Kyung Kwon y Byoung-Cheorl Kang. "Evaluation of Resistance in Pepper Germplasm to Cucumber mosaic virus by High Resolution Melting Analysis". Research in Plant Disease 18, n.º 4 (30 de diciembre de 2012): 290–97. http://dx.doi.org/10.5423/rpd.2012.18.4.290.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

3

Zambounis, Antonios, Eleni Stefanidou, Panagiotis Madesis, Jovana Hrustić, Milica Mihajlović y Brankica Tanović. "Genotypic differentiation of Monilinia spp. populations in Serbia using a high-resolution melting (HRM) analysis". Plant Protection Science 57, No. 1 (3 de diciembre de 2020): 38–46. http://dx.doi.org/10.17221/35/2020-pps.

Texto completo

Resumen

Monilinia laxa, Monilinia fructicola and Monilinia fructigena are the three main causal agents of brown rot, which is one of the most important diseases of stone fruits in pre- and postharvest conditions. Nowadays, the need for the precise genotyping of these Monilinia species in terms of the genetic diversity of their populations or differences in their pathogenicity and host range is a prerequisite for any efficient disease management. In our study, the genetic structure of Monilinia populations in Serbia from three geographically distinct regions was investigated employing <br /> a high-resolution melting (HRM) analysis which is a sensitive and rapid molecular approach in fungal genotyping and diagnostics. Using species-specific primer pairs genotype-specific HRM melting curve profiles were generated allowing to efficiently decipher the genetic diversity of the Monilinia populations. The Monilinia genotypes could be easily distinguished according to their melting curves. The isolates from the northern region were assigned to distinct genotypes and grouped rather independently compared to the isolates of the other two regions among all three tested Monilinia spp. M. fructicola and M. fructigena showed a higher genetic diversity among their populations (44%) compared with the genetic diversity among the M. laxa populations (7%). In contrast, the genetic variance within the pathogen populations was higher in the case of M. laxa (93%). Our data revealed an absence of host specificity in the Monilinia spp. populations.

Los estilos APA, Harvard, Vancouver, ISO, etc.

4

Erali, Maria y Carl T. Wittwer. "High resolution melting analysis for gene scanning". Methods 50, n.º 4 (abril de 2010): 250–61. http://dx.doi.org/10.1016/j.ymeth.2010.01.013.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

5

Tong, S. Y. C. y P. M. Giffard. "Microbiological Applications of High-Resolution Melting Analysis". Journal of Clinical Microbiology 50, n.º 11 (8 de agosto de 2012): 3418–21. http://dx.doi.org/10.1128/jcm.01709-12.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

6

Zumaraga, Mark Pretzel, Marietta Rodriguez, Vanessa Joy Timoteo y Celeste Tanchoco. "Method Validation of a High Resolution Melting Analysis of a Candidate Genetic Marker of Hypertension". Journal of the ASEAN Federation of Endocrine Societies 30, n.º 1 (31 de mayo de 2015): 18–24. http://dx.doi.org/10.15605/jafes.030.01.01.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

7

Wittwer, Carl T., Gudrun H. Reed, Cameron N. Gundry, Joshua G. Vandersteen y Robert J. Pryor. "High-Resolution Genotyping by Amplicon Melting Analysis Using LCGreen". Clinical Chemistry 49, n.º 6 (1 de junio de 2003): 853–60. http://dx.doi.org/10.1373/49.6.853.

Texto completo

Resumen

Abstract Background: High-resolution amplicon melting analysis was recently introduced as a closed-tube method for genotyping and mutation scanning (Gundry et al. Clin Chem 2003;49:396–406). The technique required a fluorescently labeled primer and was limited to the detection of mutations residing in the melting domain of the labeled primer. Our aim was to develop a closed-tube system for genotyping and mutation scanning that did not require labeled oligonucleotides. Methods: We studied polymorphisms in the hydroxytryptamine receptor 2A (HTR2A) gene (T102C), β-globin (hemoglobins S and C) gene, and cystic fibrosis (F508del, F508C, I507del) gene. PCR was performed in the presence of the double-stranded DNA dye LCGreen, and high-resolution amplicon melting curves were obtained. After fluorescence normalization, temperature adjustment, and/or difference analysis, sequence alterations were distinguished by curve shape and/or position. Heterozygous DNA was identified by the low-temperature melting of heteroduplexes not observed with other dyes commonly used in real-time PCR. Results: The six common β-globin genotypes (AA, AS, AC, SS, CC, and SC) were all distinguished in a 110-bp amplicon. The HTR2A single-nucleotide polymorphism was genotyped in a 544-bp fragment that split into two melting domains. Because melting curve acquisition required only 1–2 min, amplification and analysis were achieved in 10–20 min with rapid cycling conditions. Conclusions: High-resolution melting analysis of PCR products amplified in the presence of LCGreen can identify both heterozygous and homozygous sequence variants. The technique requires only the usual unlabeled primers and a generic double-stranded DNA dye added before PCR for amplicon genotyping, and is a promising method for mutation screening.

Los estilos APA, Harvard, Vancouver, ISO, etc.

8

Antonios, Zambounis, Samaras Anastasios, Xanthopoulou Aliki, Osathanunkul Maslin, Schena Leonardo, Tsaftaris Athanasios y Madesis Panagiotis. "Identification of Phytophthora species by a high resolution melting analysis: an innovative tool for rapid differentiation". Plant Protection Science 52, No. 3 (26 de mayo de 2016): 176–81. http://dx.doi.org/10.17221/179/2015-pps.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

9

Simko, Ivan. "High-Resolution DNA Melting Analysis in Plant Research". Trends in Plant Science 21, n.º 6 (junio de 2016): 528–37. http://dx.doi.org/10.1016/j.tplants.2016.01.004.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

10

Mader, Eduard, Joana Ruzicka, Corinna Schmiderer y Johannes Novak. "Quantitative high-resolution melting analysis for detecting adulterations". Analytical Biochemistry 409, n.º 1 (febrero de 2011): 153–55. http://dx.doi.org/10.1016/j.ab.2010.10.009.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

11

Janavicius, Ramunas, Dovile Matiukaite, Arturas Jakubauskas y Laimonas Griskevicius. "Microsatellite Instability Detection by High-Resolution Melting Analysis". Clinical Chemistry 56, n.º 11 (1 de noviembre de 2010): 1750–57. http://dx.doi.org/10.1373/clinchem.2010.150680.

Texto completo

Resumen

BACKGROUND Microsatellite instability (MSI) is an important marker for screening for hereditary nonpolyposis colorectal cancer (Lynch syndrome) as well as a prognostic and predictive marker for sporadic colorectal cancer (CRC). The mononucleotide microsatellite marker panel is a well-established and superior alternative to the traditional Bethesda MSI analysis panel, and does not require testing for corresponding normal DNA. The most common MSI detection techniques—fluorescent capillary electrophoresis and denaturing HPLC (DHPLC)—both have advantages and drawbacks. A new high-resolution melting (HRM) analysis method enables rapid identification of heteroduplexes in amplicons by their lower thermal stability, a technique that overcomes the main shortcomings of capillary electrophoresis and DHPLC. METHODS We investigated the straightforward application of HRM for the detection of MSI in 70 archival CRC samples. HRM analysis for 2 MSI markers (BAT25 and BAT26) was evaluated, and 2 different HRM-enabled instruments were compared—the LightCycler® 480 (Roche Diagnostics) and the LightScannerTM (Idaho Technology). We also determined the analytical sensitivity and specificity of the HRM assay on both instruments using 11 known MSI-positive and 54 microsatellite-stable CRC samples. RESULTS All MSI-positive samples were detected on both instruments (100% analytical sensitivity). The LightScanner performed better for analytical specificity, giving a combined specificity value of 99.1% compared with 92.3% on the LightCycler 480. CONCLUSIONS We expanded the application of the HRM analysis method as an effective MSI detection technique for clinical samples.

Los estilos APA, Harvard, Vancouver, ISO, etc.

12

Wittwer, Carl T. "High-resolution DNA melting analysis: advancements and limitations". Human Mutation 30, n.º 6 (junio de 2009): 857–59. http://dx.doi.org/10.1002/humu.20951.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

13

Knopkiewicz, M., M. Gawłowska y W. Święcicki. "The application of high resolution melting in the analysis of simple sequence repeat and single nucleotide polymorphism markers in a pea (Pisum sativum L.) population". Czech Journal of Genetics and Plant Breeding 50, No. 2 (12 de junio de 2014): 151–56. http://dx.doi.org/10.17221/113/2013-cjgpb.

Texto completo

Resumen

The aim of this study was to verify the high resolution melting (HRM) method in the analysis of single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers in pea (Pisum sativum L.). A recombinant inbred line population, Carneval × MP1401, was tested for three SNP and 103 SSR markers. HRM analysis was conducted on a LightScanner 96 instrument with LC Green dye. The melting curve shape permitted two polymorphic genotypes to be distinguished. The results were confirmed by gel electrophoresis. Three SSR markers were sequenced and analysed by the melting prediction software. The results confirmed the presence of one polymerase chain reaction (PCR) product with two melting domains. Sequence tagged site (STS) markers produced specific products: Psat_EST_00189_01_1 (300 bp), Pis_GEN_18_2_1 (400 bp), Pis_GEN_7_1-2_1 (600 bp). Amplicons contained one, four and seven single nucleotide polymorphisms, respectively. Melting curve differences enabled the population genotyping except for Psat_EST_00189_01_1 where resolution was too low. Primers for Psat_EST_00189_01_1 were redesigned to obtain a shorter (100 bp) PCR product which increased the resolution. The number of SNPs and amplicon length are crucial for HRM resolution. The HRM method is fast and has a high throughput. The melting analysis of 96 samples takes less than 10 min. Agarose gel analysis confirmed the reliability of HRM, which eliminates laborious post-PCR analysis.

Los estilos APA, Harvard, Vancouver, ISO, etc.

14

Laurie, Andrew D., Mark P. Smith y Peter M. George. "Detection of Factor VIII Gene Mutations by High-Resolution Melting Analysis". Clinical Chemistry 53, n.º 12 (1 de diciembre de 2007): 2211–14. http://dx.doi.org/10.1373/clinchem.2007.093781.

Texto completo

Resumen

Abstract Background: Single base-pair substitution mutations in the gene for coagulation factor VIII, procoagulant component (hemophilia A) (F8) account for approximately 50% of severe cases of hemophilia A (HA), and almost all moderate or mild cases. Because F8 is a large gene, mutation screening using denaturing HPLC or DNA sequencing is time-consuming and expensive. Methods: We evaluated high-resolution melting analysis as an option for screening for F8 gene mutations. The melting curves of amplicons heterozygous for known F8 gene mutations were compared with melting curves of the corresponding normal amplicons to assess whether melting analysis could detect these variants. We examined 2 platforms, the Roche LightCycler 480 (LC480) and the Idaho Technology LightScanner. Results: On both instruments, 18 (90%) of the 20 F8 gene variants we examined were resolved by melting analysis. For the other 2 mutations, the melting curves of the heterozygous amplicons were similar to the corresponding normal amplicons, suggesting these variants may not be detected by this approach in a mutation-scanning screen. Conclusion: High-resolution melting analysis is an appealing technology for F8 gene screening. It is rapid and quickly identifies mutations in the majority of HA patients; samples in which no mutation is detected require further testing by DNA sequencing. The LC480 and LightScanner platforms performed similarly.

Los estilos APA, Harvard, Vancouver, ISO, etc.

15

Vandersteen, Joshua G., Pinar Bayrak-Toydemir, Robert A. Palais y Carl T. Wittwer. "Identifying Common Genetic Variants by High-Resolution Melting". Clinical Chemistry 53, n.º 7 (1 de julio de 2007): 1191–98. http://dx.doi.org/10.1373/clinchem.2007.085407.

Texto completo

Resumen

Abstract Background: Heteroduplex scanning techniques usually detect all heterozygotes, including common variants not of clinical interest. Methods: We conducted high-resolution melting analysis on the 24 exons of the ACVRL1 and ENG genes implicated in hereditary hemorrhagic telangiectasia (HHT). DNA in samples from 13 controls and 19 patients was PCR amplified in the presence of LCGreen® I, and all 768 exons melted in an HR-1® instrument. We used 10 wild-type controls to identify common variants, and the remaining samples were blinded, amplified, and analyzed by melting curve normalization and overlay. Unlabeled probes characterized the sequence of common variants. Results: Eleven common variants were associated with 8 of the 24 HHT exons, and 96% of normal samples contained at least 1 variant. As a result, the positive predictive value (PPV) of a heterozygous exon was low (31%), even in a population of predominantly HHT patients. However, all common variants produced unique amplicon melting curves that, when considered and eliminated, resulted in a PPV of 100%. In our blinded study, 3 of 19 heterozygous disease-causing variants were missed; however, 2 were clerical errors, and the remaining false negative would have been identified by difference analysis. Conclusions: High-resolution melting analysis is a highly accurate heteroduplex scanning technique. With many exons, however, use of single-sample instruments may lead to clerical errors, and routine use of difference analysis is recommended. Common variants can be identified by their melting curve profiles and genotyped with unlabeled probes, greatly reducing the false-positive results common with scanning techniques.

Los estilos APA, Harvard, Vancouver, ISO, etc.

16

Zhang Tingting, 张婷婷, 侯梦迪 Hou Mengdi, 贾卓楠 Jia Zhuonan, 花双全 Hua Shuangquan, 王文杰 Wang Wenjie y 刘绍鼎 Liu Shaoding. "基于激光的G-四链体高分辨率熔解曲线分析". Laser & Optoelectronics Progress 59, n.º 7 (2022): 0717002. http://dx.doi.org/10.3788/lop202259.0717002.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

17

Cho, Michael H., Dawn Ciulla, Barbara J. Klanderman, Benjamin A. Raby y Edwin K. Silverman. "High-Resolution Melting Curve Analysis of Genomic and Whole-Genome Amplified DNA". Clinical Chemistry 54, n.º 12 (1 de diciembre de 2008): 2055–58. http://dx.doi.org/10.1373/clinchem.2008.109744.

Texto completo

Resumen

Abstract Background: High-resolution melting curve analysis is an accurate method for mutation detection in genomic DNA. Few studies have compared the performance of high-resolution DNA melting curve analysis (HRM) in genomic and whole-genome amplified (WGA) DNA. Methods: In 39 paired genomic and WGA samples, 23 amplicons from 9 genes were PCR amplified and analyzed by high-resolution melting curve analysis using the 96-well LightScanner (Idaho Technology). We used genotyping and bidirectional resequencing to verify melting curve results. Results: Melting patterns were concordant between the genomic and WGA samples in 823 of 863 (95%) analyzed sample pairs. Of the discordant patterns, there was an overrepresentation of alternate melting curve patterns in the WGA samples, suggesting the presence of a mutation (false positives). Targeted resequencing in 135 genomic and 136 WGA samples revealed 43 single nucleotide polymorphisms (SNPs). All SNPs detected in genomic samples were also detected in WGA. Additional genotyping and sequencing allowed the classification of 628 genomic and 614 WGA amplicon samples. Heterozygous variants were identified by non–wild-type melting pattern in 98% of genomic and 97% of WGA samples (P = 0.11). Wild types were correctly classified in 99% of genomic and 91% of WGA samples (P < 0.001). Conclusions: In WGA DNA, high-resolution DNA melting curve analysis is a sensitive tool for SNP discovery through detection of heterozygote variants; however, it may misclassify a greater number of wild-type samples.

Los estilos APA, Harvard, Vancouver, ISO, etc.

18

Li, Huaizhong, Ruiting Lan, Niancai Peng, Jing Sun y Yong Zhu. "High resolution melting curve analysis with MATLAB-based program". Measurement 90 (agosto de 2016): 178–86. http://dx.doi.org/10.1016/j.measurement.2016.04.057.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

19

Schmiderer, Corinna, Eduard Mader y Johannes Novak. "DNA-Based Identification ofHelleborus nigerby High-Resolution Melting Analysis". Planta Medica 76, n.º 16 (7 de mayo de 2010): 1934–37. http://dx.doi.org/10.1055/s-0030-1249908.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

20

Provaznikova, Dana, Tereza Kumstyrova, Roman Kotlin, Peter Salaj, Vaclav Matoska, Ingrid Hrachovinova y Simon Rittich. "High-resolution melting analysis for detection of MYH9 mutations". Platelets 19, n.º 6 (enero de 2008): 471–75. http://dx.doi.org/10.1080/09537100802140013.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

21

Slany, Michal, Martina Vanerkova, Eva Nemcova, Barbora Zaloudikova, Filip Ruzicka y Tomas Freiberger. "Differentiation of Staphylococcus spp. by high-resolution melting analysis". Canadian Journal of Microbiology 56, n.º 12 (diciembre de 2010): 1040–49. http://dx.doi.org/10.1139/w10-091.

Texto completo

Resumen

High-resolution melting analysis (HRMA) is a fast (post-PCR) high-throughput method to scan for sequence variations in a target gene. The aim of this study was to test the potential of HRMA to distinguish particular bacterial species of the Staphylococcus genus even when using a broad-range PCR within the 16S rRNA gene where sequence differences are minimal. Genomic DNA samples isolated from 12 reference staphylococcal strains ( Staphylococcus aureus , Staphylococcus capitis , Staphylococcus caprae , Staphylococcus epidermidis , Staphylococcus haemolyticus , Staphylococcus hominis , Staphylococcus intermedius , Staphylococcus saprophyticus , Staphylococcus sciuri , Staphylococcus simulans , Staphylococcus warneri , and Staphylococcus xylosus ) were subjected to a real-time PCR amplification of the 16S rRNA gene in the presence of fluorescent dye EvaGreen™, followed by HRMA. Melting profiles were used as molecular fingerprints for bacterial species differentiation. HRMA of S. saprophyticus and S. xylosus resulted in undistinguishable profiles because of their identical sequences in the analyzed 16S rRNA region. The remaining reference strains were fully differentiated either directly or via high-resolution plots obtained by heteroduplex formation between coamplified PCR products of the tested staphylococcal strain and phylogenetically unrelated strain.

Los estilos APA, Harvard, Vancouver, ISO, etc.

22

Rojo, Daniela, Manuel Zapata, Alejandro Maureira, Ricardo Guiñez, Cristian Wulff-Zottele y Mariella Rivas. "High-resolution melting analysis for identification of microalgae species". Journal of Applied Phycology 32, n.º 6 (11 de septiembre de 2020): 3901–11. http://dx.doi.org/10.1007/s10811-020-02240-y.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

23

Shestakova, Anna, Felipe Lorenzo, Tsewang Tashi, Lucie Lanikova, Carl T. Wittwer y Josef T. Prchal. "Tibetan PHD2D4E High Altitude Adapted Gene Can be Rapidly Detected By High Resolution Melting Assay". Blood 124, n.º 21 (6 de diciembre de 2014): 4875. http://dx.doi.org/10.1182/blood.v124.21.4875.4875.

Texto completo

Resumen

Abstract High altitude is accompanied by hypoxia. Acute and chronic hypoxia induces a number of compensatory physiological responses mediated by hypoxia-inducible factors (HIFs) that regulate erythropoiesis, iron and energy metabolism, and other essential organismal responses. Excessive HIF responses occurring at high altitude may be accompanied by morbidity (polycythemia and pulmonary hypertension) or mortality (brain and pulmonary edema). HIFs are down regulated by two principal factors, i.e. prolyl hydroxylases (PHDs) and von Hippel Lindau proteins (VHL). Tibetans have lived at 3,000-5,000 meters for approximately 20,000 years and have acquired a number of beneficial genetic adaptations which appear to prevent negative responses to hypoxia at high-altitude. Deciphering these genetic changes is crucial to improve our understanding of the underlying hypoxia-mediated response mechanisms and to develop targeted therapies. We recently identified the first Tibetan-specific mutation, PHD2D4E, caused by a missense mutation (rs186996510) in EGLN1. PHD2D4E has an allelic frequency of ~85% in Tibetans and a low Km for oxygen, accounting for the protection of Tibetans from high-altitude polycythemia. Other effects of PHD2D4E on HIF-regulated pathophysiology remain to be delineated. A 77% GC-rich area surrounds rs186996510, resulting in a low success rate of detecting the mutation by Sanger sequencing or next-generation sequencing. PHD2D4E was unreported in published whole-genome analyses of Tibetans (Xin Yi et. al. Science 2010). Here we describe a high-resolution melting assay of a small PCR product for targeted genotyping of rs186996510. The single base-pair change (G to C) is visualized by melting small amplicons in the presence of a fluorescent DNA-binding dye. Heterozygotes are differentiated from homozygous genotypes by a pronounced change in the shape of the melting curve caused by the formation of heteroduplexes. However, wild type and homozygous variants are difficult to distinguish by melting alone, and require an additional step of a second melting analysis after mixing with known wild type DNA. Upon melting these mixtures, homozygotes appear as heterozygous melting curves, while wild type genotypes will remain wild type (Figure 1). We developed and validated a high resolution melting assay for rapid genotyping of PHD2D4E suitable for population and disease association studies. In our ongoing analyses, we genotyped DNA from over 300 Tibetans residing at sea level, 1300 meters, 1730-2300 meters and 4320 meters, and are correlating the allelic frequency of PHD2D4E with hematocrit levels. The high resolution melting assay for genotyping PHD2D4E is a simple, accurate, rapid, and inexpensive approach to identify SNP-targeted mutations, especially suitable for a large number of samples such as needed for population studies, without the expense and time required for sequencing studies. Figure 1. High resolution melting analysis of rs186996510 using a 48-base a pair PCR product amplified with primers Forward 5Õ AACGCTCTCACGCCGCCATGGCCAATGA 3Õ and Reverse 5Õ GCCGGGCCCGCCGCT 3Õ. Rapid-cycle PCR amplification and melting analysis were performed in a LS32 real-time instrument. Amplicons from homozygous, heterozygous and wild-type genotypes, and a mixture of wild-type and homozygous products were melted in the presence of a saturating DNA dye (LCGreen). High resolution melting curves and derivative plot are shown. Heterozygotes, or mixed wild type and homozygous variant produce a large change in the shape of the melting curve (red) in comparison to wild-type and homozygous variant (black). Figure 1. High resolution melting analysis of rs186996510 using a 48-base a pair PCR product amplified with primers Forward 5Õ AACGCTCTCACGCCGCCATGGCCAATGA 3Õ and Reverse 5Õ GCCGGGCCCGCCGCT 3Õ. Rapid-cycle PCR amplification and melting analysis were performed in a LS32 real-time instrument. Amplicons from homozygous, heterozygous and wild-type genotypes, and a mixture of wild-type and homozygous products were melted in the presence of a saturating DNA dye (LCGreen). High resolution melting curves and derivative plot are shown. Heterozygotes, or mixed wild type and homozygous variant produce a large change in the shape of the melting curve (red) in comparison to wild-type and homozygous variant (black). Disclosures Wittwer: BioFire Diagnostics: Aspects of melting analysis Patents & Royalties, Membership on an entity's Board of Directors or advisory committees, Research Funding.

Los estilos APA, Harvard, Vancouver, ISO, etc.

24

Li, Mei, Luming Zhou, Robert A. Palais y Carl T. Wittwer. "Genotyping Accuracy of High-Resolution DNA Melting Instruments". Clinical Chemistry 60, n.º 6 (1 de junio de 2014): 864–72. http://dx.doi.org/10.1373/clinchem.2013.220160.

Texto completo

Resumen

Abstract BACKGROUND High-resolution DNA melting is a closed-tube method for genotyping and variant scanning that depends on the thermal stability of PCR-generated products. Instruments vary in thermal precision, sample format, melting rates, acquisition, and software. Instrument genotyping accuracy has not been assessed. METHODS Each genotype of the single nucleotide variant (SNV) (c.3405–29A>T) of CPS1 (carbamoyl-phosphate synthase 1, mitochondrial) was amplified by PCR in the presence of LCGreen Plus with 4 PCR product lengths. After blinding and genotype randomization, samples were melted in 10 instrument configurations under conditions recommended by the manufacturer. For each configuration and PCR product length, we analyzed 32–96 samples (depending on batch size) with both commercial and custom software. We assessed the accuracy of heterozygote detection and homozygote differentiation of a difficult, nearest-neighbor symmetric, class 4 variant with predicted ΔTm of 0.00 °C. RESULTS Overall, the heterozygote accuracy was 99.7% (n = 2141), whereas homozygote accuracy was 70.3% (n = 4441). Instruments with single sample detection as opposed to full-plate imaging better distinguished homozygotes (78.1% and 61.8%, respectively, χ2P < 0.0005). Custom software improved accuracy over commercial software (P < 0.002), although melting protocols recommended by manufacturers were better than a constant ramp rate of 0.1 °C with an oil overlay. PCR products of 51, 100, 272, and 547 bp had accuracies of 72.3%, 83.1%, 59.8%, and 65.9%, respectively (P < 0.0005). CONCLUSIONS High-resolution melting detects heterozygotes with excellent accuracy, but homozygote accuracy is dependent on detection mode, analysis software, and PCR product size, as well as melting temperature differences between, and variation within, homozygotes.

Los estilos APA, Harvard, Vancouver, ISO, etc.

25

Zhou, Luming, Lesi Wang, Robert Palais, Robert Pryor y Carl T. Wittwer. "High-Resolution DNA Melting Analysis for Simultaneous Mutation Scanning and Genotyping in Solution". Clinical Chemistry 51, n.º 10 (1 de octubre de 2005): 1770–77. http://dx.doi.org/10.1373/clinchem.2005.054924.

Texto completo

Resumen

Abstract Background: High-resolution DNA melting analysis with saturation dyes for either mutation scanning of PCR products or genotyping with unlabeled probes has been reported. However, simultaneous PCR product scanning and probe genotyping in the same reaction has not been described. Methods: Asymmetric PCR was performed in the presence of unlabeled oligonucleotide probes and a saturating fluorescent DNA dye. High-resolution melting curves for samples in either capillaries (0.3 °C/s) or microtiter format (0.1 °C/s) were generated in the same containers used for amplification. Melting curves of the factor V Leiden single-nucleotide polymorphism (SNP) and several mutations in exons 10 and 11 of the cystic fibrosis transconductance regulator gene were analyzed for both PCR product and probe melting transitions. Results: Independent verification of genotype for simple SNPs was achieved by either PCR product or probe melting transitions. Two unlabeled probes in one reaction could genotype many sequence variants with simultaneous scanning of the entire PCR product. For example, analysis of both product and probe melting transitions genotyped ΔF508, ΔI507, Q493X, I506V, and F508C variants in exon 10 and G551D, G542X, and R553X variants in exon 11. Unbiased hierarchal clustering of the melting transitions identified the specific sequence variants. Conclusions: When DNA melting is performed rapidly and observed at high resolution with saturating DNA dyes, it is possible to scan for mutations and genotype at the same time within a few minutes after amplification. The method is no more complex than PCR and may reduce the need for resequencing.

Los estilos APA, Harvard, Vancouver, ISO, etc.

26

Sovová, Tereza, Barbora Křížová, Ladislav Kučera y Jaroslava Ovesná. "Detecting soybean and milk in dairy and soy products with post-PCR high resolution melting assays". Czech Journal of Food Sciences 38, No. 4 (31 de agosto de 2020): 209–14. http://dx.doi.org/10.17221/125/2020-cjfs.

Texto completo

Resumen

We have developed and validated post-PCR (polymerase chain reaction) high resolution melting (HRM) based assays that allow identifying the presence of two major allergenic foods – soybean and bovine milk – in food products. A new set of primers for PCR was developed for detection of the gene encoding the soybean protein lectin. The assay was validated using reference samples and used for the analysis of artificially prepared mixed samples of dairy and soy products of different matrices, as well as of real products available in the market (spray creams). The limits of detection (LODs) of the soybean (8 copies) and bovine milk (4 copies) assays were lower compared to LODs of other previously published PCR-based assays. The analysis of several commercial spray creams revealed an undeclared presence of soybean in one of the samples. The newly developed HRM assays are precise and robust alternatives for the control of food composition and falsification by competent authorities.

Los estilos APA, Harvard, Vancouver, ISO, etc.

27

Margraf, Rebecca L., Rong Mao, W. Edward Highsmith, Leonard M. Holtegaard y Carl T. Wittwer. "Mutation Scanning of the RET Protooncogene Using High-Resolution Melting Analysis". Clinical Chemistry 52, n.º 1 (1 de enero de 2006): 138–41. http://dx.doi.org/10.1373/clinchem.2005.052951.

Texto completo

Resumen

Abstract Background: Single-base pair missense mutations in exons 10, 11, 13, 14, 15, and 16 of the RET protooncogene are associated with the autosomal dominant multiple endocrine neoplasia type 2 (MEN2) syndromes: MEN2A, MEN2B, and familial medullary thyroid carcinoma. The current widely used approach for RET mutation detection is sequencing of the exons. Methods: Because RET mutations are rare and the majority are heterozygous mutations, we investigated RET mutation detection by high-resolution amplicon melting analysis. This mutation scanning technique uses a saturating double-stranded nucleic acid binding dye, LCGreen®, and the high-resolution melter, HR-1™, to detect heterozygous and homozygous sequence variations. Mutant genotypes are distinguished from the wild-type genotype by an altered amplicon melting curve shape or position. Results: Samples of 26 unique RET mutations, 4 nonpathogenic polymorphisms, or the wild-type genotype were available for this study. The developed RET mutation-scanning assay differentiated RET sequence variations from the wild-type genotype by altered derivative melting curve shape or position. A blinded study of 80 samples (derived from the 35 mutant, polymorphism, or wild-type samples) demonstrated that 100% of RET sequence variations were differentiated from wild-type samples. For exons 11 and 13, the nonpathogenic polymorphisms could be distinguished from the pathogenic RET mutations. Some RET mutations could be directly genotyped by the mutation scanning assay because of unique derivative melting curve shapes. Conclusion: RET high-resolution amplicon melting analysis is a sensitive, closed-tube assay that can detect RET protooncogene sequence variations.

Los estilos APA, Harvard, Vancouver, ISO, etc.

28

HARA, Masayuki, Kazuyoshi YANO y Etsuko UTAGAWA. "Rapid High-throughput Development on High-resolution Melting (HRM) Analysis for Noroviruses". Kansenshogaku Zasshi 84, n.º 3 (2010): 315–16. http://dx.doi.org/10.11150/kansenshogakuzasshi.84.315.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

29

Towler, William I., Maria M. James, Stuart C. Ray, Lei Wang, Deborah Donnell, Anthony Mwatha, Laura Guay et al. "Analysis of HIV Diversity Using a High-Resolution Melting Assay". AIDS Research and Human Retroviruses 26, n.º 8 (agosto de 2010): 913–18. http://dx.doi.org/10.1089/aid.2009.0259.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

30

Bignell, Patricia A., David M. Keeling y Paul Giangrande. "Detection of F8 Mutations by High Resolution Melting (HRM) Analysis." Blood 112, n.º 11 (16 de noviembre de 2008): 1226. http://dx.doi.org/10.1182/blood.v112.11.1226.1226.

Texto completo

Resumen

Abstract Approximately 50% of severe and all moderate or mild haemophilia A (HA) mutations are single base substitutions, small insertions or deletions with over 900 different mutations having been described. The usual way to screen these HA cases is by DNA sequencing of all 26 exons which is time consuming and expensive. We have developed the technique of HRM analysis using the Corbett Rotor Gene 6000 for successful high throughput screening of HA mutations. A target sequence was first amplified in the presence of a dsDNA intercalating fluorescent dye followed by in-tube melting analysis. Initially fluorescence is high, but diminishes as the temperature is raised and DNA dissociates into single strands. The observed ‘melting’ behaviour is characteristic of a particular DNA mutation. In our study we looked at HA mutations in 23 exons,(exons 3–26). Genomic DNA samples from 100 HA patients and carriers were amplified using primers targeting the specific exons. We detected all of the mutations by HRM analysis and each had a distinct ‘melt’ curve which enabled the carriers to be successfully screened. We detected all the HAMSTerS known mutations and our 26 novel mutations in our cohort of patients. Our results show that HRM could be used as the initial screening method followed by DNA sequencing of the amplicon where a different ‘melt’ curve was observed. It could also be used to rescreen ‘negative’ mutation patients very quickly. This technique is simpler, cheaper and quicker than DNA sequencing method. This method may therefore be particularly useful for prenatal diagnosis and carrier diagnosis.

Los estilos APA, Harvard, Vancouver, ISO, etc.

31

DANG, XIAO‐DONG, COLIN T. KELLEHER, EMMA HOWARD‐WILLIAMS y CONOR V. MEADE. "Rapid identification of chloroplast haplotypes using High Resolution Melting analysis". Molecular Ecology Resources 12, n.º 5 (11 de julio de 2012): 894–908. http://dx.doi.org/10.1111/j.1755-0998.2012.03164.x.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

32

Langaee, Taimour, Lynda Stauffer, Cheryl Galloway, Mohamed H. Solayman y Larisa Cavallari. "Cross-Validation of High-Resolution Melting Analysis-Based Genotyping Platform". Genetic Testing and Molecular Biomarkers 21, n.º 4 (abril de 2017): 259–64. http://dx.doi.org/10.1089/gtmb.2016.0317.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

33

Issa, Rahizan, Hatijah Abdul, Siti Hasmah Hashim, Valentinus H. Seradja, Nurul ‘Aishah Shaili y Nurul Akma Mohd Hassan. "High resolution melting analysis for the differentiation of Mycobacterium species". Journal of Medical Microbiology 63, n.º 10 (1 de octubre de 2014): 1284–87. http://dx.doi.org/10.1099/jmm.0.072611-0.

Texto completo

Resumen

A quantitative real-time PCR (qPCR) followed by high resolution melting (HRM) analysis was developed for the differentiation of Mycobacterium species. Rapid differentiation of Mycobacterium species is necessary for the effective diagnosis and management of tuberculosis. In this study, the 16S rRNA gene was tested as the target since this has been identified as a suitable target for the identification of mycobacteria species. During the temperature gradient and primer optimization process, the melting peak (Tm) analysis was determined at a concentration of 50 ng DNA template and 0.3, 0.4 and 0.5 µM primer. The qPCR assay for the detection of other mycobacterial species was done at the Tm and primer concentration of 62 °C and 0.4 µM, respectively. The HRM analysis generated cluster patterns that were specific and sensitive to distinguished small sequence differences of the Mycobacterium species. This study suggests that the 16S rRNA-based real-time PCR followed by HRM analysis produced unique cluster patterns for species of Mycobacterium and could differentiate the closely related mycobacteria species.

Los estilos APA, Harvard, Vancouver, ISO, etc.

34

Everman, Steven y Shiao Y. Wang. "Rapid differentiation of bacterial communities using high resolution melting analysis". Journal of Microbiological Methods 140 (septiembre de 2017): 77–81. http://dx.doi.org/10.1016/j.mimet.2017.07.006.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

35

Kim, Jaai y Changsoo Lee. "Rapid fingerprinting of methanogenic communities by high-resolution melting analysis". Bioresource Technology 174 (diciembre de 2014): 321–27. http://dx.doi.org/10.1016/j.biortech.2014.10.037.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

36

Li, Jian-Hong, Yue-Ping Yin, He-Ping Zheng, Ming-Ying Zhong, Rui-Rui Peng, Baoxi Wang y Xiang-Sheng Chen. "A high-resolution melting analysis for genotyping urogenital Chlamydia trachomatis". Diagnostic Microbiology and Infectious Disease 68, n.º 4 (diciembre de 2010): 366–74. http://dx.doi.org/10.1016/j.diagmicrobio.2010.07.013.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

37

Vaughn, Cecily P. y Kojo S. J. Elenitoba-Johnson. "High-Resolution Melting Analysis for Detection of Internal Tandem Duplications". Journal of Molecular Diagnostics 6, n.º 3 (agosto de 2004): 211–16. http://dx.doi.org/10.1016/s1525-1578(10)60512-0.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

38

Montgomery, Jesse L., Lindsay N. Sanford y Carl T. Wittwer. "High-resolution DNA melting analysis in clinical research and diagnostics". Expert Review of Molecular Diagnostics 10, n.º 2 (marzo de 2010): 219–40. http://dx.doi.org/10.1586/erm.09.84.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

39

Yimniam, Walaiporn y Sumalee Jindadamrongwech. "Scanning for α-Hemoglobin Variants by High-Resolution Melting Analysis". Journal of Clinical Laboratory Analysis 30, n.º 5 (18 de febrero de 2016): 633–40. http://dx.doi.org/10.1002/jcla.21914.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

40

Shi, Minglan, Xiqing Li, Jiao Feng, Shulin Jia, Xing Xiao, Chunmei Chen, Cindy Fransisca, Liyan Xi y Junmin Zhang. "High-resolution melting analysis assay for identification of Fonsecaea species". Journal of Clinical Laboratory Analysis 32, n.º 2 (22 de mayo de 2017): e22257. http://dx.doi.org/10.1002/jcla.22257.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

41

Chang, Chun-Chi, Pei-Chin Lin, Ching-Hsiung Lin, Kun-Tu Yeh, Hsiao-Yu Hung y Jan-Gowth Chang. "Rapid identification of CYP2C8 polymorphisms by high resolution melting analysis". Clinica Chimica Acta 413, n.º 1-2 (enero de 2012): 298–302. http://dx.doi.org/10.1016/j.cca.2011.10.005.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

42

Wu, Shu-Biao, Michelle G. Wirthensohn, Peter Hunt, John P. Gibson y Margaret Sedgley. "High resolution melting analysis of almond SNPs derived from ESTs". Theoretical and Applied Genetics 118, n.º 1 (10 de septiembre de 2008): 1–14. http://dx.doi.org/10.1007/s00122-008-0870-8.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

43

Funayama, Manabu, Hiroyuki Tomiyama, Ruey-Meei Wu, Kotaro Ogaki, Hiroyo Yoshino, Yoshikuni Mizuno y Nobutaka Hattori. "Rapid screening of ATP13A2 variant with high-resolution melting analysis". Movement Disorders 25, n.º 14 (25 de octubre de 2010): 2434–37. http://dx.doi.org/10.1002/mds.23106.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

44

Cheng, Ju-Chien, Chien-Ling Huang, Chung-Ching Lin, Chi-Ching Chen, Yi-Chih Chang, Shy-Shin Chang y Ching-Ping Tseng. "Rapid Detection and Identification of Clinically Important Bacteria by High-Resolution Melting Analysis after Broad-Range Ribosomal RNA Real-Time PCR". Clinical Chemistry 52, n.º 11 (1 de noviembre de 2006): 1997–2004. http://dx.doi.org/10.1373/clinchem.2006.069286.

Texto completo

Resumen

Abstract Background: Broad-range PCR provides valuable information for detecting bacterial infections. This study assesses the combined use of broad-range real-time PCR and high-resolution melting analysis for rapid detection and identification of clinically important bacteria. Methods: We subjected 46 bacterial culture colonies representing 25 clinically important bacterial species to LightCycler real-time PCR amplification of the 16S rRNA gene in the presence of LCGreen I fluorescent dye. We performed high-resolution melting analysis of the PCR products with the HR-1 instrument and used melting profiles as molecular fingerprints for bacterial species identification. We validated this method via assessment of 54 consecutive bacteria culture colonies obtained from a clinical microbiology laboratory. Results: The 16S rRNA gene of all 25 bacterial species was amplifiable by this method, with PCR product lengths of 216 or 217 bp. Of the 25 bacterial species, we identified 11 via a 1-step post-PCR high-resolution melting analysis. The remaining bacterial species were identified via the high-resolution melting plots obtained by heteroduplex formation between the PCR products of the tested and reference bacterial species or by a 2nd real-time PCR targeting a different region of the 16S rRNA gene. A high-resolution melting database and a working protocol were established for identifying these 25 bacterial species. In the validation assay, a 94% accuracy rate was achieved when the bacterial species were in the high-resolution melting database. Conclusions: This assay requires no multiplexing or hybridization probes and provides a new approach for bacterial species identification in a molecular diagnostic laboratory.

Los estilos APA, Harvard, Vancouver, ISO, etc.

45

Tungphatthong, Chayapol, Jutharat Somnuek, Thatree Phadungcharoen, Kornkanok Ingkaninan, Jessada Denduangboripant y Suchada Sukrong. "DNA barcoding of species of Bacopa coupled with high-resolution melting analysis". Genome 61, n.º 12 (diciembre de 2018): 867–77. http://dx.doi.org/10.1139/gen-2018-0059.

Texto completo

Resumen

In Thailand, there are three species of Bacopa, namely, B. monnieri, B. caroliniana, and B. floribunda. Among these species of Bacopa, B. monnieri is the only medicinal species, used for the treatment of cognitive impairment and improvement of cognitive abilities because of its bioactive constituents, bacoside A and B. However, because of the similar characteristics of these species, it is difficult to differentiate among related species, resulting in confusion during identification. For this reason, and to ensure therapeutic quality for consumers, authentication is important. In this study, the three abovementioned species of Bacopa were evaluated using barcoding coupled with high-resolution melting (Bar-HRM) analysis based on primers designed for the trnL–F sequences of the three species. The melting profiles of the trnL–F amplicons of B. caroliniana and B. floribunda were clearly different from the melting profile of the trnL–F amplicon from B. monnieri; thus, the species could be discriminated by Bar-HRM analysis. Bar-HRM was then used to authenticate commercial products in various forms. The melting curves of the six commercial samples indicated that all the tested products contained genuine B. monnieri species. This method provides an efficient and reliable authentication system for future commercial herbal products and offers a reference system for quality control.

Los estilos APA, Harvard, Vancouver, ISO, etc.

46

Ney, Jasmin Teresa, Stefanie Froehner, Angelika Roesler, Reinhard Buettner y Sabine Merkelbach-Bruse. "High-Resolution Melting Analysis as a Sensitive Prescreening Diagnostic Tool to Detect KRAS, BRAF, PIK3CA, and AKT1 Mutations in Formalin-Fixed, Paraffin-Embedded Tissues". Archives of Pathology & Laboratory Medicine 136, n.º 9 (1 de septiembre de 2012): 983–92. http://dx.doi.org/10.5858/arpa.2011-0176-oa.

Texto completo

Resumen

Context.—As the availability of targeted therapies for several tumor types increases, the need for rapid and sensitive mutation screening is growing. KRAS mutations constitutively activate the RAS/RAF/mitogen-activated protein kinase (MAPK) pathway and therefore play an important role in anti–epidermal growth factor receptor therapy for patients with colorectal cancers. Mutationally activated PIK3CA and AKT1 genes are promising therapeutic targets in breast cancer. In 60% to 70% of malignant melanomas, a mutation in BRAF can be found. Thus, the blocking of the oncogenic signaling induced by this mutation is now used as treatment approach. Objective.—To establish high-resolution melting assays for routinely used predictive analyses of KRAS, AKT1, PIK3CA, and BRAF mutations. Design.—High-resolution melting assays were developed by using specifically designed primers and genomic DNA isolated either from cell lines or formalin-fixed paraffin-embedded tissues, oligonucleotides, or plasmids. Melting curve analyses were performed on the LightCyler platform and mutation analyses were additionally confirmed by Sanger sequencing. Results.—We developed high-resolution melting assays by using genomic DNA containing the desired mutation, which enabled us to detect percentages of mutated DNA (3.1% to 12.5%) mixed in a wild-type background. Assays were evaluated by hybridization probes and/or Sanger sequencing to exclude pseudogene amplification. The high-resolution melting assays were validated with genomic DNA from different tumor entities. The concordance between Sanger sequencing and high-resolution melting was 99% for KRAS exon 2 and PIK3CA exon 20 and 100% for the remaining assays. Conclusions.—High-resolution melting provides a valid and powerful tool for detecting genomic mutations efficiently.

Los estilos APA, Harvard, Vancouver, ISO, etc.

47

Ng, Jacklyn W. S., Deborah C. Holt, Patiyan Andersson y Philip M. Giffard. "DNA Concentration Can Specify DNA Melting Point in a High-Resolution Melting Analysis Master Mix". Clinical Chemistry 60, n.º 2 (1 de febrero de 2014): 414–16. http://dx.doi.org/10.1373/clinchem.2013.215582.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

48

Kennerson, Marina L., Trent Warburton, Eva Nelis, Megan Brewer, Patsie Polly, Peter De Jonghe, Vincent Timmerman y Garth A. Nicholson. "Mutation Scanning the GJB1 Gene with High-Resolution Melting Analysis: Implications for Mutation Scanning of Genes for Charcot-Marie-Tooth Disease". Clinical Chemistry 53, n.º 2 (1 de febrero de 2007): 349–52. http://dx.doi.org/10.1373/clinchem.2006.080010.

Texto completo

Resumen

Abstract Background: X-linked Charcot-Marie-Tooth type 1 disease has been associated with 280 mutations in the GJB1 [gap junction protein, beta 1, 32kDa (connexin 32, Charcot-Marie-Tooth neuropathy, X-linked)] gene. High-resolution melting analysis with an automated instrument can be used to scan DNA for alterations, but its use in X-linked disorders has not been described. Methods: A 96-well LightScanner for high resolution melting analysis was used to scan amplicons of the GJB1 gene. All mutations reported in this study had been confirmed previously by sequence analysis. DNA samples were amplified with the double-stranded DNA-binding dye LC Green Plus. Melting curves were analyzed as fluorescence difference plots. The shift and curve shapes of melting profiles were used to distinguish controls from patient samples. Results: The method detected each of the 23 mutations used in this study. Eighteen known mutations provided validation of the high-resolution melting method and a further 5 mutations were identified in a blind study. Altered fluorescence difference curves for all the mutations were easily distinguished from the wild-type melting profile. Conclusion: High-resolution melting analysis is a simple, sensitive, and cost-efficient alternative method to scan for gene mutations in the GJB1 gene. The technology has the potential to reduce sequencing burden and would be suitable for mutation screening of exons of large multiexon genes that have been discovered to be associated with Charcot Marie Tooth neuropathy.

Los estilos APA, Harvard, Vancouver, ISO, etc.

49

De Leeneer, Kim, Ilse Coene, Bruce Poppe, Anne De Paepe y Kathleen Claes. "Rapid and Sensitive Detection of BRCA1/2 Mutations in a Diagnostic Setting: Comparison of Two High-Resolution Melting Platforms". Clinical Chemistry 54, n.º 6 (1 de junio de 2008): 982–89. http://dx.doi.org/10.1373/clinchem.2007.098764.

Texto completo

Resumen

Abstract Background: High-resolution melting is an emerging technique for detection of nucleic acid sequence variations. Developments in instrumentation and saturating intercalating dyes have made accurate high-resolution melting analysis possible and created opportunities to use this technology in diagnostic settings. We evaluated 2 high-resolution melting instruments for screening BRCA1 and BRCA2 mutations. Methods: To cover the complete coding region and splice sites, we designed 112 PCR amplicons (136–435 bp), amplifiable with a single PCR program. LCGreen® Plus was used as the intercalating dye. High-resolution melting analysis was performed on the 96-well Lightscanner™ (Idaho Technology Inc.) and the 96-well LightCycler® 480 (Roche) instruments. We evaluated sensitivity by analyzing 212 positive controls scattered over almost all amplicons and specificity by blind screening of 22 patients for BRCA1 and BRCA2. In total, we scanned 3521 fragments. Results: All 212 known heterozygous sequence variants were detected on the Lightscanner by analysis on normal sensitivity setting. On the LightCycler 480, the standard instrument sensitivity setting of 0.3 had to be increased to 0.7 to detect all variants, decreasing the specificity to 95.9% (vs 98.7% for the Lightscanner). Conclusions: Previously, we screened BRCA1/2 by direct sequencing of the large exon 11 and denaturing gel gradient electrophoresis (DGGE) for all other coding exons. Since the introduction of high-resolution melting, our turnaround time has been one third of that with direct sequencing and DGGE, as post-PCR handling is no longer required and the software allows fast analyses. High-resolution melting is a rapid, cost-efficient, sensitive method simple enough to be readily implemented in a diagnostic laboratory.

Los estilos APA, Harvard, Vancouver, ISO, etc.

50

Thomas, Holly R., Stefanie M. Percival, Bradley K. Yoder y John M. Parant. "High-Throughput Genome Editing and Phenotyping Facilitated by High Resolution Melting Curve Analysis". PLoS ONE 9, n.º 12 (11 de diciembre de 2014): e114632. http://dx.doi.org/10.1371/journal.pone.0114632.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

Ofrecemos descuentos en todos los planes premium para autores cuyas obras están incluidas en selecciones literarias temáticas. ¡Contáctenos para obtener un código promocional único!