Acceder

Bibliografías temáticas / Grapevine, Magnesium / Artículos de revistas

Siga este enlace para ver otros tipos de publicaciones sobre el tema: Grapevine, Magnesium.

Artículos de revistas sobre el tema "Grapevine, Magnesium"

Autor: Grafiati

Publicado: 11 de marzo de 2023

Crea una cita precisa en los estilos APA, MLA, Chicago, Harvard y otros

Elija tipo de fuente:

Consulte los 43 mejores artículos de revistas para su investigación sobre el tema "Grapevine, Magnesium".

Junto a cada fuente en la lista de referencias hay un botón "Agregar a la bibliografía". Pulsa este botón, y generaremos automáticamente la referencia bibliográfica para la obra elegida en el estilo de cita que necesites: APA, MLA, Harvard, Vancouver, Chicago, etc.

También puede descargar el texto completo de la publicación académica en formato pdf y leer en línea su resumen siempre que esté disponible en los metadatos.

Explore artículos de revistas sobre una amplia variedad de disciplinas y organice su bibliografía correctamente.

1

Singh, Rupesh Kumar, Jessica Afonso, Marta Nogueira, Ana A. Oliveira, Fernanda Cosme y Virgílio Falco. "Silicates of Potassium and Aluminium (Kaolin); Comparative Foliar Mitigation Treatments and Biochemical Insight on Grape Berry Quality in Vitis vinifera L. (cv. Touriga National and Touriga Franca)". Biology 9, n.º 3 (20 de marzo de 2020): 58. http://dx.doi.org/10.3390/biology9030058.

Texto completo

Resumen

Grapevine physiology is influenced by several environmental factors, such as temperature, precipitation, potential evapotranspiration, and sunshine hours. Due to climatic changes, effects in grapevine physiology and consequently on the grape berry composition and quality have been observed. This work aims to make a comparative study of the effect of foliar mitigation treatment with kaolin (5%) and potassium silicates (0.1% and 0.05%) on the grape berry quality; namely on berry weight, pH, probable alcohol, total phenolics, tannins, total anthocyanins, monomeric anthocyanins, calcium, potassium, and magnesium composition from Portuguese grapevines (Vitis vinifera L. cv. Touriga Nacional and Touriga Franca). The results suggested that the phenolic composition and anthocyanin content differs between treatments while other parameters showed distinct behavior among the different applications. Qualitative parameters observed in the present study suggested non-significant changes upon both the applications.

Los estilos APA, Harvard, Vancouver, ISO, etc.

2

Gautier, Antoine, Sarah J. Cookson, Loïc Lagalle, Nathalie Ollat y Elisa Marguerit. "Influence of the three main genetic backgrounds of grapevine rootstocks on petiolar nutrient concentrations of the scion, with a focus on phosphorus". OENO One 54, n.º 1 (24 de enero de 2020): 1–13. http://dx.doi.org/10.20870/oeno-one.2020.54.1.2458.

Texto completo

Resumen

Background and aims: In most viticultural areas of the world, Vitis vinifera grapevines require grafting onto phylloxera-tolerant rootstocks of American origin. The species most commonly used in rootstock creation are Vitis berlandieri, V. riparia and V. rupestris. Rootstocks not only provide tolerance to phylloxera but also ensure the supply of water and mineral nutrients to the scion. The aim of the study was to investigate the extent to which rootstocks with different genetic backgrounds modify the mineral composition of the petioles of the scion.Methods and results: Vitis vinifera cv. Cabernet-Sauvignon grapevines were grafted onto rootstocks of 13 different genotypes and planted in a vineyard in three blocks. Petiolar concentrations of 13 mineral elements at veraison (berry softening) were determined. The genetic background of the rootstock had significant effects on the mineral composition of the petioles. Use of rootstocks with a genetic background including at least one Vitis riparia parent decreased the concentration of phosphorus and magnesium and increased the concentration of sulphur in the petioles of Cabernet-Sauvignon.Conclusion: Rootstocks with a Vitis riparia genetic background confer low petiolar concentrations of phosphorus and magnesium, and conversely, high petiolar concentration of sulphur.Significance of the study: The kind of rootstock onto which a grapevine has been grafted is known to influence the nutrient content of the scion. The results of the study show a significant relation between the genetic background of a rootstock and its ability to modify concentrations of phosphorus, magnesium and sulphur in the petioles of the scion under field conditions.

Los estilos APA, Harvard, Vancouver, ISO, etc.

3

Erez, A. "Defoliation of Deciduous Fruit Trees with Magnesium Chlorate and Cyanamide". HortScience 20, n.º 3 (junio de 1985): 452–53. http://dx.doi.org/10.21273/hortsci.20.3.452.

Texto completo

Resumen

Abstract Magnesium chlorate [(Mg(C103)2] and hydrogen cyanamide (H2CN2) sprays defoliated one-year-old nursery trees of ‘Golden Delicious’ apple, ‘Spadona’ pear, ‘Canino’ apricot, ‘Harry Pickstone’ plum, and ‘Cabernet Sauvignon’ grapevine, with no or minimal phytotoxicity. Bearing Maravilha peach trees were defoliated completely in autumn using Mg(C103)2 at 0.36%.

Los estilos APA, Harvard, Vancouver, ISO, etc.

4

Chang, Tae-Hyun. "Effect of Magnesium deficiency on Chlorosis and Fruit Quality of Grapevine". Korean Journal of Environmental Agriculture 28, n.º 4 (30 de diciembre de 2009): 347–55. http://dx.doi.org/10.5338/kjea.2009.28.4.347.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

5

Calzarano, Francesco, Giancarlo Pagnani, Michele Pisante, Mirella Bellocci, Giuseppe Cillo, Elisa Giorgia Metruccio y Stefano Di Marco. "Factors Involved on Tiger-Stripe Foliar Symptom Expression of Esca of Grapevine". Plants 10, n.º 6 (21 de mayo de 2021): 1041. http://dx.doi.org/10.3390/plants10061041.

Texto completo

Resumen

Esca of grapevine causes yield losses correlated with incidence and severity symptom expression. Factors associated with leaf symptom mechanisms are yet to be fully clarified. Therefore, in 2019 and 2020, macro and microelement analyses and leaf reflectance measurements were carried out on leaves at different growth stages in a vineyard located in Abruzzo, central Italy. Surveys were carried out on leaves of both never leaf-symptomatic vines and different categories of diseased vine shoots. Never leaf-symptomatic and diseased vines were also treated with a fertilizer mixture that proved to be able to limit the symptom expression. Results showed that untreated asymptomatic diseased vines had high calcium contents for most of the vegetative season. On the contrary, treated asymptomatic diseased vines showed higher contents of calcium, magnesium, and sodium, at berries pea-sized, before the onset of symptoms. These vines had better physiological efficiency showing higher water index (WI), normalized difference vegetation index (NDVI), and green normalized difference vegetation index (GNDVI) values, compared to untreated asymptomatic vines, at fruit set. Results confirmed the strong response of the plant to symptom expression development and the possibility of limiting this response with calcium and magnesium applications carried out before the symptom onset.

Los estilos APA, Harvard, Vancouver, ISO, etc.

6

Candar, Serkan, Bekir Açıkbaş, Mümtaz Ekiz, Damla Zobar, İlknur Korkutal y Elman Bahar. "Influence of water scarcity on macronutrients contents in young leaves of wine grape cultivars". Ciência e Técnica Vitivinícola 36, n.º 2 (2021): 104–15. http://dx.doi.org/10.1051/ctv/ctv20213602104.

Texto completo

Resumen

This study aimed to determine the variability of plant nutrition content in two-year old local and well-known wine grape cultivars under different water constraint scenarios. Own rooted and potted eight grapevine cultivars (cv. ‘Adakarası’, ‘Papazkarası’, ‘Karasakız’, ‘Karalahana’, ‘Yapıncak’, ‘Vasilaki’, ‘Cabernet Sauvignon’ and ‘Sauvignon Blanc’) were subjected to five irrigation treatments (100% daily irrigation of available water capacity (AWC), 75% irrigation of AWC, 50% irrigation of AWC, 25% irrigation of AWC, and no irrigation for 0% treatment) for two consecutive years during vegetative growth (May – late September). An increase in nitrogen, potassium and magnesium contents in leaf tissues with decreasing water amount was observed. Similar effect was found for phosphorus and calcium contents. The sulfur concentration in leaf tissues remained almost unchanged. In addition, the variability of genetic potential influenced the nutrient intake of the studied cultivars. The ability of grapevine cultivars to cope with the water deficit of the cultivars should definitely be assessed in adaptation strategies developed to make viticulture sustainable under the effects of the climate crisis.

Los estilos APA, Harvard, Vancouver, ISO, etc.

7

Rustioni, Laura, Daniele Grossi, Lucio Brancadoro y Osvaldo Failla. "Iron, magnesium, nitrogen and potassium deficiency symptom discrimination by reflectance spectroscopy in grapevine leaves". Scientia Horticulturae 241 (noviembre de 2018): 152–59. http://dx.doi.org/10.1016/j.scienta.2018.06.097.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

8

Downton, WJS. "Growth and mineral composition of the sultana grapevine as influenced by salinity and rootstock". Australian Journal of Agricultural Research 36, n.º 3 (1985): 425. http://dx.doi.org/10.1071/ar9850425.

Texto completo

Resumen

Sultana grapevine growing on its own root system, or else grafted to Dogridge, 1613, Harmony and Ramsey rootstocks, was irrigated with 0, 12.5, 25, 50 or 75 mM solutions of chloride salts under glasshouse conditions for three consecutive growing seasons. Cations accompanying chloride were sodium, magnesium and calcium in the ratio of 0.6:0.2:0.2 m.e./l. Growth was progressively suppressed by salinity in all vines, but scions on stocks of Vitis champini (Dogridge and Ramsey) showed linear decreases in growth, whereas self-rooted vines and scions on Harmony and 1613 stocks gave curvilinear responses in which the rate of decline in growth was greater at lower salinities than at higher salinities. Scions on 1613 rootstocks performed poorest, particularly when salt treatments were applied before budburst. With the exception of Dogridge, rootstocks growing under glasshouse conditions generally lowered the chloride concentration in leaves of scions below that of self-rooted vines. Canes on 1613 stock accumulated much higher concentrations of chloride than did the other vines. Rootstocks lowered sodium, particularly in petioles and raised potassium concentrations in all plant parts. Dogridge and Harmony stocks led to very high concentrations of potassium in petioles even in the absence of salt treatment. Salt treatment resulted in greatly elevated phosphorus concentrations within scions. Magnesium showed increases in leaves and canes with increasing external salinity, whereas calcium did not. Nitrogen concentrations did not change with rootstock or salt treatment. The results have relevance for irrigated horticultural areas along the River Murray, for which the ionic composition of the watering medium was formulated, and for situations where saline wastewater is to be reutilized.

Los estilos APA, Harvard, Vancouver, ISO, etc.

9

Provost, Caroline, Alexander Campbell y François Dumont. "Rootstocks Impact Yield, Fruit Composition, Nutrient Deficiencies, and Winter Survival of Hybrid Cultivars in Eastern Canada". Horticulturae 7, n.º 8 (10 de agosto de 2021): 237. http://dx.doi.org/10.3390/horticulturae7080237.

Texto completo

Resumen

Grafting cold-hardy hybrid grapevines may influence their attributes under different pedoclimatic conditions and may also contribute to cold-hardiness, influence plant physiology, and affect yield and fruit composition. In a six-year study, we evaluated bud survival, plant development, nutrient deficiencies, yield, and fruit composition for three cold-hardy grape varieties: Frontenac, Frontenac blanc, and Marquette. The grape varieties were grafted on four rootstocks: 3309C, SO4, Riparia Gloire, and 101-14. The final combinations were own-rooted. The six-year research period indicated that cold-hardy hybrids were affected differently by each rootstock. Magnesium deficiency was lower for grafted Frontenac and Frontenac blanc compared with own-rooted vines, but bud survival and grapevine development were not affected by rootstock. Moreover, results related to yield components showed that there are significant differences between rootstocks and own-rooted vines. Frontenac was the least affected grape variety compared to Frontenac blanc and Marquette, where only cluster weight and berry weight were impacted. Overall, for the two Frontenac varietals, we also observed a greater maturity for fruits of vines grafted on 101-14 and 3309C compared with own-rooted vines. Grafting affected fruit composition for Marquette differently, where the lowest grape maturity was observed for fruits on vines grafted on SO4. This study demonstrates that rootstocks affect cold-hardy hybrids, highlighting their potential under eastern North American conditions.

Los estilos APA, Harvard, Vancouver, ISO, etc.

10

Olego, Miguel A. "Influence of overliming vineyard acid soils on the macro-nutritional status of grapevines". Spanish Journal of Agricultural Research 19, n.º 3 (septiembre de 2021): e0903-e0903. http://dx.doi.org/10.5424/sjar/2021193-17639.

Texto completo

Resumen

Aim of study: The main aim of this study was to evaluate the effect of overliming with dolomitic lime on the topsoil and grapevine macro-nutritional levels (both petiole and grape tissues), as well as on berry weight and must quality properties in grapevines growing on an acid soil. Area of study: The study was carried out in the viticultural region of El Bierzo (Spain), one of the main wine protected designation of origin in the northwest of Spain. Material and methods: The effects of overliming were studied in soil parameters, petiole and grape tissues, as well as in must quality during three years (2014-2016). Data analysis was performed using factorial ANOVA (both parametric and non-parametric tests have been used). Main results: The results found on the soil levels of magnesium and phosphorus were mirrored by those shown in petiole and grape tissues. Data suggest that insufficient Mg supply in vineyard acid soils could lead to a lower P vascular movement in vines. Additionally, our findings suggest that a great decrease of K levels in vine tissues as a consequence of overliming, could lead to changes in harvest quality. Research highlights: Overliming with dolomitic limestone in large quantities decreased soil exchangeable K, as well as improved supply of exchangeable Mg and available P. Additionally Mg and P levels in both petiole and grape tissues were significantly affected by overliming.

Los estilos APA, Harvard, Vancouver, ISO, etc.

11

Juang, Kai-Wei, Yu-Jin Lo y Bo-Ching Chen. "Modeling Alleviative Effects of Ca, Mg, and K on Cu-Induced Oxidative Stress in Grapevine Roots Grown Hydroponically". Molecules 26, n.º 17 (3 de septiembre de 2021): 5356. http://dx.doi.org/10.3390/molecules26175356.

Texto completo

Resumen

The aim of this study was to determine the pattern of alleviation effects of calcium (Ca), magnesium (Mg), and potassium (K) on copper (Cu)-induced oxidative toxicity in grapevine roots. Root growth, Cu and cation accumulation, reactive oxygen species (ROS) production, and antioxidant activities were examined in grapevine roots grown in nutrient solutions. The experimental setting was divided into three sets; each set contained a check (Hoagland solution only) and four treatments of simultaneous exposure to 15 μM Cu with four cation levels (i.e., Ca set: 0.5, 2.5, 5, and 10 mM Ca; Mg set: 0.2, 2, 4, and 8 mM Mg; K set: 0.6, 2.4, 4.8, and 9.6 mM K). A damage assessment model (DAM)-based approach was then developed to construct the dose-effect relationship between cation levels and the alleviation effects on Cu-induced oxidative stress. Model parameterization was performed by fitting the model to the experimental data using a nonlinear regression estimation. All data were analyzed by a one-way analysis of variance (ANOVA), followed by multiple comparisons using the least significant difference (LSD) test. The results showed that significant inhibitory effects on the elongation of roots occurred in grapevine roots treated with 15 μM Cu. The addition of Ca and Mg significantly mitigated phytotoxicity in root growth, whereas no significant effect of K treatment on root growth was found. With respect to oxidative stress, ROS and malondialdehyde (MDA) contents, as well as antioxidant (superoxide dismutase (SOD), catalase (CAT), and ascorbate peroxidase (APX)) activities, were stimulated in the roots after exposure to 15 μM Cu for three days. Moreover, H2O2 levels decreased significantly as Ca, Mg, and K concentrations increased, indicating that the coexistence of these cations effectively alleviated Cu-induced oxidative stress; however, alleviative effects were not observed in the assessment of the MDA content and antioxidant enzyme activities. Based on the DAM, an exponential decay equation was developed and successfully applied to characterize the alleviative effects of Ca, Mg, and K on the H2O2 content induced by Cu in the roots. In addition, compared with Mg and K, Ca was the most effective cation in the alleviation of Cu-induced ROS. Based on the results, it could be concluded that Cu inhibited root growth and Ca and Mg absorption in grapevines, and stimulated the production of ROS, lipid peroxidation, and antioxidant enzymes. Furthermore, the alleviation effects of cations on Cu-induced ROS were well described by the DAM-based approach developed in the present study.

Los estilos APA, Harvard, Vancouver, ISO, etc.

12

Dinis, Lia-Tânia, Sara Bernardo, Carlos Matos, Aureliano Malheiro, Rui Flores, Sandra Alves, Carina Costa et al. "Overview of Kaolin Outcomes from Vine to Wine: Cerceal White Variety Case Study". Agronomy 10, n.º 9 (18 de septiembre de 2020): 1422. http://dx.doi.org/10.3390/agronomy10091422.

Texto completo

Resumen

Kaolin protective effect was assessed in a white grapevine cultivar ‘Cerceal’ in ‘Alentejo’ Region (southeast Portugal) where plants face extreme conditions during the summer season. We addressed the hypothesis that kaolin effects lead to several changes in leaves, fruits, and wine characteristics on the primary and secondary metabolism. Results showed that kaolin reduces leaf temperature which provokes an improvement in physiological parameters such as net photosynthesis and water use efficiency. This protection interferes with berry color, leaving them more yellowish, and an increase in phenolic compounds were observed in all fruit tissues (skin, seed, and pulp). Additionally, both berry and wine characteristics were strongly affected, with an increase of tartaric and malic acid and consequently high total acidity, while the sugar concentration decreased 8.9% in berries provoking a low wine alcohol level. Results also showed that kaolin induces high potassium, magnesium, and iron, and low copper and aluminum concentrations. Moreover, the control wine showed higher content of esters related with hostile notes whereas wine from kaolin treated vines presented higher content of esters associated with fruity notes. Overall, the results strengthen the promising nature of kaolin application as a summer stress mitigation strategy protecting grapevine plants and improving fruit quality and creating more balanced wines.

Los estilos APA, Harvard, Vancouver, ISO, etc.

13

Pedò, Stefano, Maurizio Bottura y Duilio Porro. "Development, yield potential and nutritional aspects of resistant grapevine varieties in Trentino Alto Adige". BIO Web of Conferences 13 (2019): 02004. http://dx.doi.org/10.1051/bioconf/20191302004.

Texto completo

Resumen

The reduction of the environmental impact of agricultural activity has stimulated the evaluation of new cultivars tolerant/resistant to fungal diseases within the context of Trentino viticulture. In an alluvial soil, 15 varieties of resistant vines were planted: Aromera, Baron, Bronner, Cabernet Cantor, Cabernet Cortis, Cabernet Carbon, Cabino, Helios, Johanniter, Monarch, Muscaris, Prior, Regent, Solaris, and Souvignier gris. Since 2015 they have been evaluated for nutritional aspects, vegetative-productive balance, quantitative-qualitative parameters of musts and health status. Some cultivars (Cabernet Cortis, Cabino, Helios, and Prior) had an insufficient vegetative development, whilst other varieties presented a balanced or excessive behaviour. Regarding magnesium (Mg), some of these cultivars presented deficiencies, often confirmed by visual analysis, but not always highlighted by leaf analyses (Cabernet Cantor, Cabernet Cortis, and Monarch). For such varieties, Mg supply is recommended. Nonetheless, with the aim of new plantings, the choice of more suitable rootstock combinations should be done. Cabino always showed very highly susceptibility to Plasmopara viticola attack, with an ineffective resistance.

Los estilos APA, Harvard, Vancouver, ISO, etc.

14

Chen, Bo-Ching, Pei-Chi Ho y Kai-Wei Juang. "Alleviation effects of magnesium on copper toxicity and accumulation in grapevine roots evaluated with biotic ligand models". Ecotoxicology 22, n.º 1 (9 de noviembre de 2012): 174–83. http://dx.doi.org/10.1007/s10646-012-1015-z.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

15

SKINNER, P. W. y M. A. MATTHEWS. "A novel interaction of magnesium translocation with the supply of phosphorus to roots of grapevine (Vitis vinifera L.)*". Plant, Cell and Environment 13, n.º 8 (noviembre de 1990): 821–26. http://dx.doi.org/10.1111/j.1365-3040.1990.tb01098.x.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

16

Gerzhikova, V. G., T. A. Zhilyakova, A. V. Vesiutova, V. A. Oleinikova, M. V. Ermikhina y O. V. Ryabinina. "ANALYSIS OF CATION COMPOSITION OF CRIMEAN WINES FOR THE PURPOSE OF IDENTIFYING THEIR ORIGIN". Russian Vine 21 (septiembre de 2022): 46–54. http://dx.doi.org/10.32904/2712-8245-2022-21-46-54.

Texto completo

Resumen

An important direction of the long-term plan for the development of viticulture and wine-making in the Crimea is the production of products with a geographical status. One of the signs that determine the origin of wines is their mineral composition, which depends on soil and climatic conditions and agrotechnical methods of cultivation. The aim of the study was to use the ratios of mass concentrations of potassium, sodium, calcium, magnesium cati-ons to assess the geographical position of wines made from grapevine varieties growing in different regions of the Crimea and Ukraine. A comparative analysis of the ratios of К+/Na+, K+/Ca2+, K+/Mg2+, Ca2+/Mg2+ cati-ons and tartaric acid to the sum of cations was carried out. A significant difference in the mass concentration of the sodium cation and К+/Na+ ratios in these regions has been estab-lished. The ranges of ratio of К+/Na+ cations for some Crimean enterprises have been speci-fied.

Los estilos APA, Harvard, Vancouver, ISO, etc.

17

Fisarakis, I., N. Nikolaou, P. Tsikalas, I. Therios y D. Stavrakas. "Effect of Salinity and Rootstock on Concentration of Potassium, Calcium, Magnesium, Phosphorus, and Nitrate–Nitrogen in Thompson Seedless Grapevine". Journal of Plant Nutrition 27, n.º 12 (2 de enero de 2005): 2117–34. http://dx.doi.org/10.1081/pln-200034662.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

18

Nikolaou, Kleopatra-Eleni, Theocharis Chatzistathis, Serafeim Theocharis, Anagnostis Argiriou, Stefanos Koundouras y Elefteria Zioziou. "Effects of Salinity and Rootstock on Nutrient Element Concentrations and Physiology in Own-Rooted or Grafted to 1103 P and 101-14 Mgt Rootstocks of Merlot and Cabernet Franc Grapevine Cultivars under Climate Change". Sustainability 13, n.º 5 (25 de febrero de 2021): 2477. http://dx.doi.org/10.3390/su13052477.

Texto completo

Resumen

Under the current and future climate crisis, a significant rise in soil salinity will likely affect vine productivity in several Mediterranean regions. During the present research, the rootstock effects on salinity tolerance of Merlot and Cabernet Franc grapevine cultivars were studied. In a pot hydroponic culture, own-rooted Merlot and Cabernet Franc grapevine cultivars or grafted onto the rootstocks 1103 P and 101-14 Mgt were drip-irrigated with saline water. A completely randomized 3 × 2 × 2 factorial experiment was designed with two vine rootstocks or own-rooted vines, two scion cultivars, and 100 mM NaCl salinity or control treatments, with six replications. A significant effect of scion cultivar, rootstock, and salinity was observed for most of the measured parameters. At the end of salinity stress period, leaf, shoot, root, and trunk nutrient concentrations were measured. Salinity stress increased Chloride (Cl) and Sodium (Na) concentrations in all parts of the vines and decreased leaf concentrations of Potassium (K), Calcium (Ca), Magnesium (Mg), Nitrogen (N), and Iron (Fe). In contrast, salinity stress increased leaf Boron (B) concentrations, whereas that of Manganese (Mn) remained unaffected. Leaf chlorophyll concentration decreased from 42% to 40% after thirty and sixty days of salt treatment, respectively. A similar trend was observed for the CCM-200 relative chlorophyll content. Salinity significantly decreased steam water potential (Ws), net CO2 assimilation rate (A), and stomatal conductance (gs) in all cases of grafted or own-rooted vines. Sixty days after the beginning of salt treatment, total Phenolics and PSII maximum quantum yield (Fv/Fm) decreased significantly. The rootstock 1103 P seems to be a better excluder for Na and Cl and more tolerant to salinity compared to 101-14 Mgt rootstock.

Los estilos APA, Harvard, Vancouver, ISO, etc.

19

Moloinyane, Siphokazi y Felix Nchu. "The Effects of Endophytic Beauveria bassiana Inoculation on Infestation Level of Planococcus ficus, Growth and Volatile Constituents of Potted Greenhouse Grapevine (Vitis vinifera L.)". Toxins 11, n.º 2 (28 de enero de 2019): 72. http://dx.doi.org/10.3390/toxins11020072.

Texto completo

Resumen

Endophytic entomopathogenic fungi are being explored for the management of phytophagous insect pests. The effects of Beauveria bassiana (Hypocreales) inoculation of grape plants on the infestation level of P. ficus, tissue nutrient contents, and growth and volatile constituents of potted grape plants were assessed. Grapevine plants were individually inoculated with a suspension of 1 × 108 conidia mL−1 of B. bassiana by drenching before experimentally infesting each of them with thirty adult females of P. ficus. At four weeks post-treatment, the fungus was re-isolated from leaves of 50% of the fungus-exposed plants. However, no significant difference (p > 0.05) was observed in all the plant growth parameters measured in the fungus-treated and control plants. Plant tissue analysis revealed markedly higher contents of calcium (Ca) and magnesium (Mg) in the leaf tissue of plants exposed to the B. bassiana relative to the control. Gas chromatography mass spectrometry (GC-MS) analyses showed that a significantly (X2 = 5.1; p < 0.02) higher number of known anti-insect volatile compounds (nine) were present among fungus treated plants compared to the control plants (five). Naphthalene, which is toxic to insects and humans, was detected only in the volatiles of the fungus-exposed plants. B. bassiana did not have any significant effect on total polyphenol, alkaloid, and flavonoids. Overall, treatment with fungus did not inhibit the infestation by P. ficus. In conclusion, these findings shed light on some of the mechanisms involved in endophytic fungus-plant-insect interactions.

Los estilos APA, Harvard, Vancouver, ISO, etc.

20

Rupp, D., R. Fox y L. Tränkle. "FOLIAR APPLICATION OF MAGNESIUM FERTILIZER IN GRAPEVINES: EFFECTS ON WINE QUALITY". Acta Horticulturae, n.º 594 (noviembre de 2002): 149–55. http://dx.doi.org/10.17660/actahortic.2002.594.14.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

21

Rogiers, Suzy Y., Dennis H. Greer, Francesca J. Moroni y Tintu Baby. "Potassium and Magnesium Mediate the Light and CO2 Photosynthetic Responses of Grapevines". Biology 9, n.º 7 (28 de junio de 2020): 144. http://dx.doi.org/10.3390/biology9070144.

Texto completo

Resumen

Potassium (K) and magnesium (Mg) deficiency are common stresses that can impact on grape yield and quality, but their effects on photosynthesis have received little attention. Understanding the diffusional and biochemical limitations to photosynthetic constraints will help to guide improvements in cultural practices. Accordingly, the photosynthetic response of Vitis vinifera cvs. Shiraz and Chardonnay to K or Mg deficiency was assessed under hydroponic conditions using miniature low-nutrient-reserve vines. Photosynthesis was at least partly reduced by a decline in stomatal conductance. Light and CO2-saturated photosynthesis, maximum rate of ribulose 1.5 bisphospate (RuBP) carboxylation (Vcmax) and maximum rate of electron transport (Jmax) all decreased under K and Mg deficiency. Likewise, chlorophyll fluorescence and electron transport were lower under both nutrient deficiencies while dark respiration increased. K deficiency drastically reduced shoot biomass in both cultivars, while root biomass was greatly reduced under both Mg and K deficiency. Taken together, these results indicate that the decrease in biomass was likely due to both stomatal and biochemical limitations in photosynthesis. Optimising photosynthesis through adequate nutrition will thus support increases in biomass with carry-on positive effects on crop yields.

Los estilos APA, Harvard, Vancouver, ISO, etc.

22

Shahin, S. M., H. E. B. Moustafa, Abla H. Dorgham, A. M. Hegazy, A. A. Kassem, A. E. Hassan y G. M. El Hagen. "IMPROVING PRODUCTIVITY OF BANATY GRAPEVINES BY FOLIAR APPLICATION OF BORON, MAGNESIUM AND ZINC". Menoufia Journal of Plant Production 3, n.º 3 (1 de junio de 2018): 239–49. http://dx.doi.org/10.21608/mjppf.2018.123623.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

23

Hegazy, A. M., A. A. Kasem y A. E. Hassan. "IMPROVING PRODUCTIVITY OF BANATY GRAPEVINES BY FOLIAR APPLICATION OF BORON, MAGNESIUM AND ZINC". Menoufia Journal of Plant Production 3, n.º 6 (1 de diciembre de 2018): 425–26. http://dx.doi.org/10.21608/mjppf.2018.123968.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

24

Hegazy, A. M., A. A. Kasem y A. E. Hassan. "IMPROVING PRODUCTIVITY OF BANATY GRAPEVINES BY FOLIAR APPLICATION OF BORON, MAGNESIUM AND ZINC". Menoufia Journal of Plant Production 3, n.º 6 (1 de diciembre de 2018): 425–26. http://dx.doi.org/10.21608/mjppf.2018.175865.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

25

Hegazy, A. M., A. A. Kassem, A. E. Hassan y G. M. El-Hagen. "IMPROVING PRODUCTIVITY OF BANATY GRAPEVINES BY FOLIAR APPLICATION OF BORON, MAGNESIUM AND ZINC". Menoufia Journal of Plant Production 3, n.º 3 (1 de junio de 2018): 239–49. http://dx.doi.org/10.21608/mjppf.2018.175461.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

26

Juang, Kai-Wei, Yung-I. Lee, Hung-Yu Lai y Bo-Ching Chen. "Influence of magnesium on copper phytotoxicity to and accumulation and translocation in grapevines". Ecotoxicology and Environmental Safety 104 (junio de 2014): 36–42. http://dx.doi.org/10.1016/j.ecoenv.2014.02.008.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

27

Naegele, Rachel P., Jason P. Londo, Cheng Zou y Peter Cousins. "Identification of SNPs associated with magnesium and sodium uptake and the effect of their accumulation on micro and macro nutrient levels in Vitis vinifera". PeerJ 9 (8 de febrero de 2021): e10773. http://dx.doi.org/10.7717/peerj.10773.

Texto completo

Resumen

Macro and micro nutrient accumulation affects all stages of plant growth and development. When nutrient deficiencies or excesses occur, normal plant growth is altered resulting in symptoms such as leaf chlorosis, plant stunting or death. In grapes, few genomic regions associated with nutrient accumulation or deficiencies have been identified. Our study evaluated micro and macro nutrient concentrations in Vitis vinifera L. to identify associated SNPs using an association approach with genotype by sequencing data. Nutrient concentrations and foliar symptoms (leaf chlorosis and stunting) were compared among 249 F1 Vitis vinifera individuals in 2015 and 2016. Foliar symptoms were consistent (≥90%) between years and correlated with changes in nutrient concentrations of magnesium (r = 0.65 and r = 0.38 in 2015 and 2016, respectively), aluminum (r = 0.24 and r = 0.49), iron (r = 0.21 and r = 0.49), and sodium (r = 0.32 and r = 0.21). Single nucleotide polymorphisms associated with symptoms, sodium, and magnesium were detected on each chromosome with the exception of 5, 7 and 17 depending on the trait and genome used for analyses explaining up to 40% of the observed variation. Symptoms and magnesium concentration were primarily associated with SNPs on chromosome 3, while SNPs associated with increased sodium content were primarily found on chromosomes 11 and 18. Mean concentrations for each nutrient varied between years in the population between symptomatic and asymptomatic plants, but relative relationships were mostly consistent. These data suggest a complex relationship among foliar symptoms and micro and macro nutrients accumulating in grapevines.

Los estilos APA, Harvard, Vancouver, ISO, etc.

28

El-Sayed M. Qaoud, Mostafa A. A. Mohamed. "Using Boron, Magnesium and some Amino Acids to Improve Yield and Fruit Quality of Roomy Red Grapevines". Hortscience Journal of Suez Canal University 8, n.º 1 (26 de diciembre de 2019): 79–86. http://dx.doi.org/10.21608/hjsc.2019.66419.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

29

Rizk -Alla,, Mervat, V. Girgis y A. Abd El —- Ghany. "EFFECT OF FOLIAR APPLICAHON OF MINERAL OR CHELATED CALCIUM AND MAGNESIUM ON THOMPSON SEEDLESS GRAPEVINES GROWN IN A SANDY SOIL: A- Vegetative growth. nutritional status and yield". Journal of Plant Production 31, n.º 5 (1 de mayo de 2006): 3067–77. http://dx.doi.org/10.21608/jpp.2006.236009.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

30

Kilany,, A., F. El-Morsi y Ola Ahmed. "EFFECT OF MINERAL OR CHELATED CALCIUM AND MAGNESIUM ON GROWTH AND BUNCH AND BERRY CHARACTERISTICS OF FLAME SEEDLESS GRAPEVINES GROWN IN SANDY SOILS II- EFFECT ON BUNCH AND BERRY CHARACTERISTICS". Journal of Plant Production 25, n.º 11 (1 de noviembre de 2000): 7049–56. http://dx.doi.org/10.21608/jpp.2000.260095.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

31

Rizk - Alla., Mervat, V. Glrgls y A. Abd El - Ghany. "EFFECT OF FOLIAR APPLICATION OF MINERALOR CHELATED CALCIUM AND MAGNESIUM ON THOMPSON SEEDLESS GRAPEVINES GROWN IN A SANDY SOIL B — Fruit quality and keeping quality during storage at room temperature '". Journal of Plant Production 31, n.º 5 (1 de mayo de 2006): 3079–88. http://dx.doi.org/10.21608/jpp.2006.236010.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

32

Kilany,, A., F. El–Morsi y Ola Ahmed. "EFFECT OF MINERAL OR CHELATED CALCIUM AND MAGNESIUM ON GROWTH AND BUNCH AND BERRY CHARACTERISTICS OF FLAME SEEDLESS GRAPEVINES GROWN IN SANDY SOILS 1- EFFECT ON GROWTH AND CHEMICAL COMPOSITION OF LEAVES AND CANES". Journal of Plant Production 25, n.º 11 (1 de noviembre de 2000): 7039–47. http://dx.doi.org/10.21608/jpp.2000.260093.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

33

Olego, Miguel A. "Influence of overliming vineyard acid soils on the macro-nutritional status of grapevines". Spanish Journal of Agricultural Research 19, n.º 3 (septiembre de 2021). http://dx.doi.org/10.5424/sjar/2021193-17638.

Texto completo

Resumen

Aim of study: The main aim of this study was to evaluate the effect of overliming with dolomitic lime on the topsoil and grapevine macro-nutritional levels (both petiole and grape tissues), as well as on berry weight and must quality properties in grapevines growing on an acid soil. Area of study: The study was carried out in the viticultural region of El Bierzo (Spain), one of the main wine protected designation of origin in the northwest of Spain. Material and methods: The effects of overliming were studied in soil parameters, petiole and grape tissues, as well as in must quality during three years (2014-2016). Data analysis was performed using factorial ANOVA (both parametric and non-parametric tests have been used). Main results: The results found on the soil levels of magnesium and phosphorus were mirrored by those shown in petiole and grape tissues. Data suggest that insufficient Mg supply in vineyard acid soils could lead to a lower P vascular movement in vines. Additionally, our findings suggest that a great decrease of K levels in vine tissues as a consequence of overliming, could lead to changes in harvest quality. Research highlights: Overliming with dolomitic limestone in large quantities decreased soil exchangeable K, as well as improved supply of exchangeable Mg and available P. Additionally Mg and P levels in both petiole and grape tissues were significantly affected by overliming.

Los estilos APA, Harvard, Vancouver, ISO, etc.

34

Bortolami, Giovanni, Nathalie Ferrer, Kendra Baumgartner, Sylvain Delzon, David Gramaje, Laurent J. Lamarque, Gianfranco Romanazzi, Gregory A. Gambetta y Chloé E. L. Delmas. "Esca grapevine disease involves leaf hydraulic failure and represents a unique premature senescence process". Tree Physiology, 23 de noviembre de 2022. http://dx.doi.org/10.1093/treephys/tpac133.

Texto completo

Resumen

Abstract Xylem anatomy may change in response to environmental or biotic stresses. Vascular occlusion, an anatomical modification of mature xylem, contributes to plant resistance and susceptibility to different stresses. In woody organs, xylem occlusions have been examined as part of the senescence process, but their presence and function in leaves remain obscure. In grapevine, many stresses are associated with premature leaf senescence inducing discolorations and scorched tissue in leaves. However, we still do not know whether the leaf senescence process follows the same sequence of physiological events and whether leaf xylem anatomy is affected in similar ways. In this study, we quantified vascular occlusions in midribs from leaves with symptoms of the grapevine disease esca, magnesium deficiency, and autumn senescence. We found higher amounts of vascular occlusions in leaves with esca symptoms (in 27% of xylem vessels on average), whereas the leaves with other symptoms (as well as the asymptomatic controls) had far fewer occlusions (in 3% of vessels). Therefore, we assessed the relationship between xylem occlusions and esca leaf symptoms in four different countries (California in the US, France, Italy, and Spain) and eight different cultivars. We monitored the plants over the course of the growing season, confirming that vascular occlusions do not evolve with symptom age. Finally, we investigated the hydraulic integrity of leaf xylem vessels by optical visualization of embolism propagation during dehydration. We found that the occlusions lead to hydraulic dysfunction mainly in the peripheral veins compared to the midribs in esca symptomatic leaves. These results open new perspectives on the role of vascular occlusions during the leaf senescence process, highlighting the uniqueness of esca leaf symptoms and its consequence on leaf physiology.

Los estilos APA, Harvard, Vancouver, ISO, etc.

35

Livigni, Sonia, Luigi Lucini, Davide Sega, Oriano Navacchi, Tiziana Pandolfini, Anita Zamboni y Zeno Varanini. "The different tolerance to magnesium deficiency of two grapevine rootstocks relies on the ability to cope with oxidative stress". BMC Plant Biology 19, n.º 1 (16 de abril de 2019). http://dx.doi.org/10.1186/s12870-019-1726-x.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

36

Garcia, M., P. Gallego, C. Daverède y H. Ibrahim. "Effect of Three Roots tocks on Grapevine (Vitis vinifera L.) CV. Négrette, Grown Hydroponically. I. Potassium, Calcium and Magnesium Nutrition". South African Journal of Enology & Viticulture 22, n.º 2 (mayo de 2017). http://dx.doi.org/10.21548/22-2-2202.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

37

Karimi, Rouhollah, Abbas Saberi y Ali Khadivi. "Effects of foliar spray of agricultural grade mineral oil in springtime, in combination with potassium and calcium sulfates on the phenological and biophysical indices of clusters, and foliar nutritional levels in grapevine (Vitis vinifera L.) cv. Sultana (Id. Thompson seedless, Sultanina)". Biological Research 54, n.º 1 (8 de septiembre de 2021). http://dx.doi.org/10.1186/s40659-021-00353-3.

Texto completo

Resumen

Abstract Background Improving the nutritional condition of grapevine in spring to regulate bloom, fruit set, and yield is among the management goals of vineyards. Methods In the present study, the early season spray of calcium sulfate (C; 0.00 and 2.00%), potassium sulfate (K; 0.00 and 3.00%), and agricultural grade mineral oil (V; 0.00 and 1.00%) on flower and fruit phenology, nutrient concentration, and cluster biophysical indices and yield of Sultana grapevine (Vitis vinifera L.) were investigated for two consecutive years. Results Based on the results, the spray of this nutrient combined with mineral oil significantly affected all the treatments except cluster length, berry length, and phosphorus concentration. The highest concentrations of potassium, calcium, and magnesium were obtained in the vines treated with V0K1C1, and the highest concentrations of zinc and iron were obtained only in the vines treated with mineral oil. In treatments containing mineral oil, especially in combination with the second level of calcium and potassium (V1K1C1), bloom time, berries pea-sized time, and harvest time were delayed by 3, 3, and 6 days compared with control vines. While in vines treated with a combination of the second level of potassium and calcium (V0K1C1), bloom time, berries pea-sized time, and harvest time were advanced by 5, 4, and 1.50 days, respectively, compared with control vines. Regarding the biophysical indices of the cluster, it was found that the vines treated with V1K1C1 had higher cluster weight, berry weight, fruit, and raisins yield than other treatments. Also, the highest berry quality, including total soluble solids, titratable acidity, and total phenol content, were obtained in the vines treated with V0K1C1. However, the lowest berry quality was observed in the vines treated with mineral oil. Conclusions Therefore, the combination of nutrients with mineral oil can alleviate the adverse effect of mineral oil solely on some phenological indices and berry quality-related traits in vineyards.

Los estilos APA, Harvard, Vancouver, ISO, etc.

38

Gąstoł, Maciej, Iwona Domagała-Świątkiewicz, Maciej Gąstoł y Adam Kiszka. "Effect of nitrogen and potassium fertilization on the magnesium content in vineyard soil, and in the leaves and berries of Bianca and Sibera grapevine cultivars". Journal of Elementology, n.º 2/2019 (11 de febrero de 2019). http://dx.doi.org/10.5601/jelem.2018.23.3.1714.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

39

Nikolaeva, N. "DETECTION OF VIRUSES OF THE RUGOSE WOOD COMPLEX ON VINEYARDS OF THE ODESSA REGION". 3(97) 2022, n.º 3 (2022). http://dx.doi.org/10.31548/dopovidi2022.03.001.

Texto completo

Resumen

Introduction. Among these viruses, the most harmful are viruses that are part of the wood furrow complex (Rugose wood complex), namely: wood furrow Rupestris - Rupestris stem pitting (RSPaV); Grapevine virus B (GVB); Grapevine virus A (GVA) - Grapevine virus A (GVA); pitted wood LN 33 - LN 33 stem grooving. These viruses are part of the European Community certification system and must be tested for the presence of these viruses in the production of seedlings. Grape viruses cause great damage to vineyards in the south of Ukraine, especially viruses of the wood complex of the furrow complex (Rugose wood complex) (eng. - RWC). The purpose of the research was to identify the presence of symptoms of viruses of this complex on vineyards in Odessa region and their identification. Methods. To conduct these studies, phytosanitary examination for the presence of wood furrow complex viruses was used, and real-time polymerase chain reaction (RT- -PCR) was used to identify viruses. Materials and methods research. The work used phytosanitary survey of vineyards in Ovidiopol, Bolgrad and Izmail districts of Odessa region, with a total area of 500 hectares. Samples with and without symptoms of virus infection were taken for real-time PCR diagnosis with hybridization-fluorescence detection (Real time PCR). To identify viruses of the RWC complex, the selection, storage and preparation of samples of grape plants was performed according to ISO 16578: 2013. Samples for RT-PCR were prepared according to the method of the authors, leaves or scrapes of woody shoots, in the amount of 100 mg, placed in a homogenizer (Tube-mill control, IKA, China) carefully ground, poured 2 ml of extraction GGB) buffer: Na2CO3 - 1.59 g / l, NaHCO3 - 2.93 g / l, 2% PVP-40, 0.2% BSA, 0.5 g / l Tween-20, 10 g / l Na2S2O5 ( pH 9.0) and incubated at 95 ºC for 10 minutes in the thermostat "Dry block" TDB-120 (Biosan, Latvia). After that, the samples were kept in the refrigerator for 3 hours at +4 ºC. Isolation of RNA viruses was performed according to the method, namely: 2 μl of the sample was added to 23 μl of the reaction mixture (H2O - 12.0 μl; 10 × PCR buffer - 2.5 μl; sucrose + cresol - 2.5 μl; 4 mm dNTP - 1.25 μl (1.76 mm -2.84 μl), DTT (dithiothreitol) - 1.24 μl, pr1 (10 pmol) - 1.25 μl, pr2 (10 pmol) - 1.25 μl, Taq polymerase (2.5 u / µl) (Pfu DNA, Fermentas, Lithuania) - 0.25 μl, revertase (200 u / µl) (RevertAidTM M-MuLV, Fermentas, Lithuania) - 0.04 μl, Mg2 + (50mM) - 0.75 μl, covered with a layer of oil for PCR and performed RT-PCR. RT-PCR in real time was performed using forward and reverse primers, fluorescently labeled DNA probes, the reaction mixture in the amount of 20 μl (H2O - 8.5 μl; 10 × PCR buffer - 2.5 μl; sucrose + cresol - 2.5 μl, 4 mm dNTP - 2.5 μl (1.76 mm - 2.84 μl), DTT - 1.24 μl, pr1 - 0.5 μm, pr2 - 0.5 μm, fluorescent probe - 0 , 1 μM, Taq polymerase (2.5 u / µl) (Pfu DNA, Fermentas, Lithuania) - 0.25 μl, revertase (200 u / µl) (RevertAidTM M-MuLV, Fermentas, Lithuania) - 0.04 μg; Mg2 + - 3.0 mm and 5 μl of NС, or PС, or internal control, or test sample (at the bottom of the tube). Concentrations of forward, reverse primers, fluorescent DNA probes were selected empirically. used a negative control sample (NCS) - 1xPLR buffer and a positive control sample (PCR) - biomaterial from the test system for ELISA (Agritest, Italy). NC from grape mitochondria. The following primers and labeled probes (Fermentas, Lithuania) were used to identify RT-PCR viruses in real time according to]: for grape wood furrow complex A (GVA) virus: GVA-77 f - CGACCGAAATATGTACCTGAATACTC - direct; GVA-192 r1 - TTTGCTAGCTTTAGGACCTACTATATCTACCT - reverse; GVA-192 r2 - CTTGCTAGCcTTAGGtCCTACTATATCTACCT - reverse; GVA-104 p - CTTCGGGTACATCGCCTTGGTCG - probe. To the virus B of the grape wood furrow complex (GVB): GVB-92 f1 - CTAGGAGTGCGGCTAAACGAA - direct; GVB-95 f2 - GGAGTGCGGCCAAACGA - direct; GVB-202 r1 - CCTTAACCTCGTCCTGTGATATGGT - reverse; GVB-119p2 - ACCGTTACGGCCGTTGTTACTGTTGTGGTAG - probe Reverse transcription and amplification included the following cycles: at 50 ° C for 2 minutes, 95 ° C for 15 minutes and 45 cycles of 95 ° C for 15 sec. and 57 ° C - 1 min. Amplification was performed in a programmable thermal cycler Rotor-Gene 6000 (Corbett Research Pty Ltd., Australia). Accounting for analysis results, calculation of threshold cycles was performed using Rotor-Gene 6000 Series Software 1.7. The sample was considered positive, in the analysis of which there is an increase in the fluorescent signal on one of the color channels of the amplifier. Results. As a result of optimizing the conditions of real-time RT-PCR, a successful concentration of MgCl2 was selected for the highest fluorescence signal intensity and it was found that the fluorescent signal curve was more optimal at MgCl2 concentration in the range 3.0 - 2.5 mm. As a result of the conducted researches only the virus B of a complex of furrowing of grapes was identified, other viruses were not revealed As a result of phytosanitary inspection of vineyards of Bolgrad, Izmiil and Ovidiopol districts of Odessa region, symptoms of viral damage to grape plants were revealed. For the first time, grape viruses were identified by a modified RT- PCR method, and diagnostic conditions were selected. Conclusions and prospects. As a result of phytosanitary inspection, grape viruses belonging to the furrow complex were found. The lesions of grape bushes by viruses of the wood furrow complex on the vineyards of the Bolgrad district of Odessa region were detected and identified. During the diagnosis, the PCR parameters were optimized, namely, the annealing temperature and magnesium concentration were tested. The obtained data will allow timely detection of viruses of the grape furrow complex, which can lead to a significant reduction in yield and prevent their spread. As a result of phytosanitary inspection of vineyards of Ovidiopol, Bolgrad and Izmail districts of Odessa region, 2 grape bushes with symptoms of viral disease of the grape furrow complex were found. For the first time in Ukraine, the method of real-time polymerase chain reaction with hybridization-fluorescence detection was used to diagnose viral disease, and the reaction conditions were selected and optimized. As a result of identification of the causative agent of the wood furrow complex by the RT-RF-PCR method, it was established that the vines were affected by the B complex virus (GVB).

Los estilos APA, Harvard, Vancouver, ISO, etc.

40

Santos, Márcio da Silva, Luciano Gebler y Elódio Sebem. "Correlation between vegetation indexes generated at Vitis Vinifera L. and soil, plant and production parameters for emergency application in decision making". Ciência Rural 52, n.º 2 (2022). http://dx.doi.org/10.1590/0103-8478cr20201037.

Texto completo

Resumen

ABSTRACT: Correlation between proximal sensing techniques and laboratory results of qualitative variables plus agronomic attributes was evaluated of a 3,0 ha vineyard in the county of Muitos Capões, Northeast of Rio Grande do Sul State, Brazil, in Vitis vinifera L. at 2017/2018 harvest, aiming to evaluate the replacement of conventional laboratory analysis in viticulture by Vegetation Indexes, at situations were laboratory access are unavailable. Based on bibliographic research, looking for vegetative indexes developed or used for canopy reflectance analysis on grapevines and whose working bands were within the spectral range provided by the equipment used, a total of 17 viable candidates were obtained. These chosen vegetation indices were correlated, through Pearson (5%), with agronomic soil attributes (apparent electrical conductivity, clay, pH in H2O, phosphorus, potassium, organic matter, aluminum, calcium, magnesium, effective CTC, CTC at pH 7.0, zinc, copper, sulfur and boron) for depths 0 -20 cm and 20-40 cm, and plant tissue (Nitrogen, phosphorus, potassium, calcium, magnesium, sulfur, copper, zinc, iron, manganese and boron) , in addition to some key oenological and phytotechnical parameters for the quantification of wine production and quality. One hundred and thirty ninesignificant correlations were obtained from this cross, with 36 moderate coefficients between 19 parameter variables versus 12 of the indexes. We concluded that in cases where access or availability of laboratory analyzes is difficult or impracticable, the use of vegetation indices is possible if the correlation coefficients reach, at least, the moderate magnitude, serving as a support to decision making until the lack analytical structure to be remedied.

Los estilos APA, Harvard, Vancouver, ISO, etc.

41

Comin, Jucinei José, Vítor Gabriel Ambrosini, Daniel José Rosa, Alex Basso, Arcângelo Loss, George Wellington Bastos de Melo, Paulo Emílio Lovato, Cledimar Rogério Lourenzi, Felipe Klein Ricachenevsky y Gustavo Brunetto. "Liming as a means of reducing copper toxicity in black oats". Ciência Rural 48, n.º 4 (16 de abril de 2018). http://dx.doi.org/10.1590/0103-8478cr20170278.

Texto completo

Resumen

ABSTRACT: Soils which are cultivated with grapevines have high available copper (Cu) content, which can be toxic to cover crops cohabiting vineyards, such as black oats. This study aimed to assess the effect of liming in reducing Cu toxicity in black oats grown in sandy soils. Samples of a Typic Hapludalf were collected at 0-20cm, dried and subjected to the addition of Cu (0 to 50Mg kg-1) and limestone (0, 1.5, and 3.0Mg ha-1). The soil was placed in a rhizobox and black oats were grown for 30 days. We assessed root and shoot dry matter production, copper (Cu), calcium (Ca) and magnesium (Mg) contents in the tissues; Cu content in the root symplast and apoplast, as well as Cu, carbon and pH values in the rhizosphere and bulk soil. Liming reduced Cu toxicity in black oats. Cu was preferentially accumulated in the roots, mostly in the apoplast, which may be the result of a plant tolerance mechanism to prevent the transport of Cu to the shoots.

Los estilos APA, Harvard, Vancouver, ISO, etc.

42

"EFFECT OF SUMMER PRUNING AND MAGNESIUM SPRAY ON THE MICROCLIMATE AND BERRY QUALITY OF FLAME SEEDLESS GRAPEVINES AND CARBOHYDRATE EXPORT". Egyptian Journal of Applied Science 34, n.º 11 (1 de noviembre de 2019): 272–89. http://dx.doi.org/10.21608/ejas.2019.96363.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

43

El-Sharkawy, Hany H. A., Younes M. Rashad, Mosaad A. El-kenawy y Doaa A. Galilah. "Magnesium carbonate elicits defense-related genes in King Ruby grapevines against downy mildew and improves its growth, yield, and berries quality". Pesticide Biochemistry and Physiology, marzo de 2022, 105075. http://dx.doi.org/10.1016/j.pestbp.2022.105075.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

Ofrecemos descuentos en todos los planes premium para autores cuyas obras están incluidas en selecciones literarias temáticas. ¡Contáctenos para obtener un código promocional único!