Siga este enlace para ver otros tipos de publicaciones sobre el tema: Citrus.
Artículos de revistas sobre el tema "Citrus"
Crea una cita precisa en los estilos APA, MLA, Chicago, Harvard y otros
Consulte los 50 mejores artículos de revistas para su investigación sobre el tema "Citrus".
Junto a cada fuente en la lista de referencias hay un botón "Agregar a la bibliografía". Pulsa este botón, y generaremos automáticamente la referencia bibliográfica para la obra elegida en el estilo de cita que necesites: APA, MLA, Harvard, Vancouver, Chicago, etc.
También puede descargar el texto completo de la publicación académica en formato pdf y leer en línea su resumen siempre que esté disponible en los metadatos.
Explore artículos de revistas sobre una amplia variedad de disciplinas y organice su bibliografía correctamente.
1
Nafisah, Sarah Nur, Suharno Suharno, and Netti Tinaprilla. "SIKAP DAN PERSEPSI KONSUMEN TERHADAP JERUK LOKAL DAN JERUK IMPOR DI PASAR MODERN KOTA BOGOR." Forum Agribisnis 4, no. 1 (March 1, 2014): 71–84. http://dx.doi.org/10.29244/fagb.4.1.71-84.
Texto completoResumen
The trends within citrus consumption have shifted from consumption of local citrus to the imported citrus. The present research investigates th econsumer characteristics of citrus, the consumer purchasing decision process, and consumer attitude and perception towards local citruss and imported citruss. Adopting purposive sampling technique, 100 respondents were chosen among the population of citrus consumers in modern market in Bogor. The data was analyzed with descriptive analysis, multi attribute Fishbein model, and perceptual mapping. The results showed that the majority of consumers were productive age female ranging from 27 to 34 years, married, bachelor degree, housewife with 3-4 family members, and with more than Rp 4.000.000 income per month. For both citrus, taste and freshness are the most important attributes Local citrus’s attributes such as taste, size, juicy, availability, appearance, freshness, the level of maturity, and the texture of pulp, were believed as a good attribute. Meanwhile for imported citrus, the juicyness, appearance, freshness, the level of maturity, the texture of pulp,andthesalespromotion, were believedto be agoodattribute. The price of bothlocal citrus and imported citruswas not believed as a good attribute. The score of consumer attitude and perception toward local citrus were higher than that of imported citrus. This shows that generally the local citrus’ attribute in modern market Bogor City was perceived as good by the consumers. Due to that the local citrus agribusiness actors needs to maintain and improve the performance of local citrus’attribute in such a way that the consumer prefer local citrus than imported citrus.
2
Siva, Anderson Gonçalves da, Paulo Roberto Silva Farias, Arlindo Leal Boiça Junior, and Bruno Henrique Sardinha Souza. "Mosca-Negra-dos-Citros: Características Gerais, Bioecologia e Métodos de Controle dessa Importante Praga Quarentenária da Citricultura Brasileira." EntomoBrasilis 4, no. 3 (October 31, 2011): 85–91. http://dx.doi.org/10.12741/ebrasilis.v4i3.145.
Texto completoResumen
A mosca-negra-dos-citros, Aleurocanthus woglumi Ashby, é uma séria praga da cultura dos citros e de outras frutíferas de importância econômica. Constitui-se praga quarentenária presente ou A2 de alerta máximo, restringindo o comércio com outras regiões livres de sua presença. A partir de sua primeira ocorrência, no ano de 2001 na cidade de Belém, houve sua rápida disseminação para outros estados e regiões citrícolas do Brasil. Por ser uma praga exótica, conhecimentos básicos são escassos para se implementar o manejo adequado do inseto em território brasileiro. Desse modo, o objetivo do presente estudo é o de disponibilizar informações a respeito de aspectos importantes de A. woglumi, como: histórico e distribuição geográfica, bioecologia, plantas hospedeiras, métodos de controle adotados, dentre outros, a fim de se fornecer subsídios para futuras pesquisas sobre a mosca-negra-dos-citros no Brasil.
 Citrus Blackfly: General Aspects, Bioecology and Methods for the Control of this Important Quarantine Pest to Brazilian Citrus Production
 Abstract. Citrus blackfly, Aleurocanthus woglumi Ashby, is a serious pest of citrus culture and other economically important fruit crops. It is a present quarantine pest or A2 maximum alert restricting trades with other regions free of its presence. Since the first occurrence of the citrus blackfly in Belém in 2001 its dissemination was quickly to other States and regions of citrus production in Brazil. As an exotic pest, basic knowledge is scarce in order to establish the appropriate management to the insect in Brazil. Thus, the aim of the present study was to provide information about important aspects of A. woglumi, such as: history and geographical distribution, bioecology, host plants, appropriate control methods, among others, in order to provide subsidies for futures researches about the citrus blackfly in Brazil.
3
Freitas-Astúa, Juliana, André Luiz Fadel, Marinês Bastianel, Valdenice Moreira Novelli, Renata Antonioli-Luizon, and Marcos Antônio Machado. "Resposta diferencial de espécies e de híbridos de citros à leprose." Pesquisa Agropecuária Brasileira 43, no. 7 (July 2008): 809–14. http://dx.doi.org/10.1590/s0100-204x2008000700004.
Texto completoResumen
O objetivo deste trabalho foi buscar novas fontes de resistência à leprose-dos-citros, no Banco Ativo de Germoplasma do Centro APTA Citros Sylvio Moreira, Instituto Agronômico, em Cordeirópolis, SP. Foram utilizadas plantas obtidas por sementes de 26 acessos, infectadas com o vírus da leprose-dos-citros (Citrus leprosis virus - CiLV), por meio do seu vetor Brevipalpus phoenicis. O aparecimento de lesões, a partir de 21 dias após a inoculação, foi observado em 11 dos genótipos testados (42,3%). Quinze espécies, entre elas Citrus pennivesiculata e C. celebica, comportaram-se como altamente resistentes, enquanto outras, como C. keraji, foram mais suscetíveis que o padrão C. sinensis. Os dados mostraram grande variação de respostas de Citrus spp. à leprose, com elevado número de espécies resisentes, que podem ser utilizadas como fonte de resistência à doença em programas de melhoramento.
4
Girardi, Eduardo Augusto, Francisco de Assis Alves Mourão Filho, and Sônia Maria de Stefano Piedade. "Desenvolvimento vegetativo e custo de produção de porta-enxertos de citros em recipientes para fins de subenxertia." Pesquisa Agropecuária Brasileira 42, no. 5 (May 2007): 679–87. http://dx.doi.org/10.1590/s0100-204x2007000500010.
Texto completoResumen
O objetivo deste trabalho foi avaliar o desenvolvimento vegetativo e estimar o custo de produção de 11 porta-enxertos de citros para fins de subenxertia, em diferentes recipientes. Avaliaram-se limão 'Cravo' clone Limeira (Citrus limonia Osbeck); citrumelo 'Swingle' (Poncirus trifoliata (L.) Raf. x Citrus paradisi Macf.); tangerina 'Cleópatra' (Citrus reshni Hort. ex Tanaka); tangerina 'Sunki' (Citrus sunki Hort. ex Tanaka); limão 'Volkameriano' clone Catânia 2 (Citrus volkameriana Pasquale); laranja 'Caipira' clone DAC (Citrus sinensis L. Osbeck); limão 'Rugoso da África' clone Mazoe (Citrus jambhiri Lush.); Poncirus trifoliata 'Davis A'; tangerina 'Sun Shu Sha Kat' (Citrus sunki Hort. ex Tanaka); tangerina 'Sunki' clone 2506 ou Fruto Grande (Citrus sunki Hort. ex Tanaka) e Poncirus trifoliata 'Barnes'. Foram utilizados tubetes de 290 mL, sacolas de 1,7 L, e porta-enxertos transplantados de tubetes de 75 mL para sacolas de polietileno de 1,7 e 4,5 L. Porta-enxertos produzidos diretamente em sacolas de 1,7 L atingem ponto ideal de subenxertia em menor tempo, de 100 a 150 dias após a semeadura, e permitem a obtenção de plantas maiores e com sistema radicular adequado, porém com custo de produção superior ao sistema de produção em tubetes de 290 mL.
5
Pardo, Hagar, Abiola Owoyemi, Livnat Goldenberg, Yossi Yaniv, Ofir Benjamin, Adi Doron-Faigenboim, Ron Porat, and Nir Carmi. "Quality and Flavor of ‘Aliza’ Fruit: A Unique Pomelo × Mandarin Hybrid." Horticulturae 9, no. 4 (March 24, 2023): 420. http://dx.doi.org/10.3390/horticulturae9040420.
Texto completoResumen
‘Aliza’ is a new pomelo × mandarin hybrid (Citrus maxima, cv. Red Chandler × Citrus reticulata, cv. Ora) developed by the Israeli citrus breeding program at the Volcani Institute. Here, we aimed to characterize the quality and flavor of ‘Aliza’ fruit as compared to other commercial citrus fruit, specifically pomelo (C. maxima), grapefruit (Citrus paradisi), orange (Citrus sinensis) and mandarin (C. reticulata). ‘Aliza’ fruits have a similar size as grapefruits, but have a thinner peel and a unique yellowish/golden color. ‘Aliza’ fruits are completely seedless and have especially high juice contents. They also have a unique, highly preferred flavor, characterized by high sweetness and moderate bitterness and acidity, with strong citrusy and tropical fruity aromas. Sensory analyses conducted with the aid of a trained panel and an electronic tongue revealed that the flavor of ‘Aliza’ fruits is different from the flavors of other citrus species. Consumer acceptance and preference tests revealed that ‘Aliza’ fruit are highly appreciated and favored. The aroma volatile profile of ‘Aliza’ fruit was somewhat similar to those of pomelo and grapefruit, but very different from those of orange and mandarin. Overall, ‘Aliza’ fruits can be distinguished from other citrus fruits by their unique color, high juice content and exceptional, unique flavor.
6
Farias, Adriano Pimentel, Adenir Vieira Teodoro, Eliana Maria Dos Passos, Maria Clezia Dos Santos, Flaviana Gonçalves Da Silva, Shênia Santos Silva, and Luis Viteri Jumbo. "Dinâmica populacional e parasitismo natural de Diaphorina citri Kuwayama (Hemiptera: Liviidae) em pomares de citros em Sergipe." EntomoBrasilis 11, no. 1 (April 23, 2018): 20–25. http://dx.doi.org/10.12741/ebrasilis.v11i1.720.
Texto completoResumen
Resumo. O psilídeo, Diaphorina citri Kuwayama (Hemiptera: Sternorrhyncha: Liviidae), por ser vetor da bactéria causadora do Hunglongbing (HLB), tornou-se uma praga-chave dos citros no Brasil. Além dos citros, a planta ornamental conhecida como murta-de-cheiro, Murraya paniculata (L.) Jack, também é hospedeira do psilídeo. O presente trabalho teve como objetivo estudar a dinâmica populacional do psilídeo em pomares de citros e o seu parasitismo em citros e murta-de-cheiro no estado de Sergipe, o quarto maior produtor de citros do Brasil. As avaliações foram realizadas quinzenalmente durante onze meses em sete pomares de laranjeira Pera Citrus sinensis (L.) Osbeck localizados em dois municípios (Boquim, e Umbaúba). As populações de ovos, ninfas e adultos de D. citri foram comparadas entre todos os pomares e todas as fases de vida foram relacionadas com os fatores abióticos, temperatura, umidade relativa e precipitação de cada localidade. O psilídeo D. citri foi classificado como espécie acessória (pouco abundante) nos pomares de Sergipe, apresentando maior densidade populacional nos meses de novembro, dezembro e março. A precipitação foi o único fator abiótico que contribuiu para o aumento populacional de adultos do psilídeo. Altas taxas de parasitismo (55 %) de ninfas do psilídeo pelo parasitoide exótico Tamarixia radiata Waterston (Hymenoptera: Eulophidae) foram detectadas em plantas de murta-de-cheiro. Com base nos resultados, caso a bactéria seja detectada em Sergipe, para o manejo do vetor, amostragens de menor intervalo deverão ser realizadas nos meses da primavera e verão. Adicionalmente, o parasitoide T. radiata poderia ser liberado inundativamente em programas de manejo integrado do vetor.Population dynamics and natural parasitism of Diaphorina citri Kuwayama (Hemiptera: Liviidae) on citrus orchards in Sergipe stateAbstract. The Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Sternorrhyncha: Liviidae), which is the vector of the Hunglongbing (HLB) bacterium, has become a key citrus pest in Brazil. In addition to citrus, the ornamental plant known as Orange Jasmine, Murraya paniculata (L.) Jack, also hosts the psyllid. The present work aimed at studying the population dynamics of the psyllid in citrus orchards and its parasitism in citrus and M. paniculata in the state of Sergipe, the fourth largest citrus-producing state in Brazil. The evaluations were performed fortnightly for eleven months in seven Pera Citrus sinensis (L.) Osbeck orange orchards located in two municipalities of Sergipe state (Boquim, and Umbauba). The populations of eggs, nymphs and adults of D. citri were compared among all orchards and all developmental stages were related to the abiotic factors temperature, relative humidity and precipitation, in each locality. The psyllid was classified as an accessory species (not very abundant) in the orchards of Sergipe, showing a higher population density in November, December and March. Precipitation was the only abiotic factor that contributed to the population increase of adults of the psyllid. High rates of parasitism (55%) of psyllid nymphs by the exotic parasitoid Tamarixia radiata Waterston (Hymenoptera: Eulophidae) were detected in M. paniculata plants. Based on the results, if the HLB bacterium is detected in Sergipe, shorter samplings should be performed in the spring and summer months aiming at vector management. In addition, T. radiata could be released inundatively in integrated vector management programs.
7
MEISSNER FILHO, PAULO E., WALTER DOS S. SOARES FILHO, KARINNA V. C. VELAME, ELIZIO P. DIAMANTINO, and MARIA S. A. S. DIAMANTINO. "Reação de porta-enxertos híbridos ao Citrus tristeza virus." Fitopatologia Brasileira 27, no. 3 (June 2002): 312–15. http://dx.doi.org/10.1590/s0100-41582002000300014.
Texto completoResumen
A tristeza causada pelo vírus da tristeza dos citros (Citrus tristeza virus, CTV) é uma das principais viroses dos citros (Citrus spp.) no Brasil. Alguns autores têm utilizado a intensidade de caneluras produzidas nos ramos para selecionar plantas com resistência ao vírus. Neste trabalho foi avaliada a reação de porta-enxertos híbridos, provenientes do programa de melhoramento genético de citros da Embrapa Mandioca e Fruticultura ao CTV e elaboradas duas escalas, uma fotográfica e outra diagramática, para quantificação de resistência ao CTV. Entre os porta-enxertos avaliados, a maioria apresentou poucas caneluras, sendo portanto considerados resistentes à tristeza. Verificou-se a manutenção da resistência ao vírus nos híbridos produzidos a partir de progenitores que possuíam algum nível de resistência.
8
Bassan, Meire Menezes, Francisco de Assis Alves Mourão Filho, Beatriz Madalena Januzzi Mendes, Bruno Forli Schwartz Freire, Tatiana Eugenia Cantuarias-Avilés, and André Boldrin Beltrame. "Reação de híbridos somáticos de citros à infecção por Phytophthora nicotianae." Revista Brasileira de Fruticultura 32, no. 2 (June 25, 2010): 429–35. http://dx.doi.org/10.1590/s0100-29452010005000069.
Texto completoResumen
Este trabalho avaliou a resistência à infecção de tronco e de raízes por Phytophthora nicotianae em híbridos somáticos de citros com potencial para serem utilizados como porta-enxertos. Os híbridos somáticos avaliados foram laranja 'Hamlin' (Citrus sinensis) + toranja 'Indian Red' (Citrus grandis) (plantas 1 e 2) e laranja 'Hamlin' (C. sinensis) + toranja 'Singapura' (C. grandis). Plantas de limão 'Cravo' (Citrus limonia), laranja 'Caipira' (C. sinensis), laranja-azeda (C. aurantium) e Poncirus trifoliata 'Davis A' (Poncirus trifoliata) foram utilizadas como plantas-controle devido à reação conhecida à infecção pelo patógeno. Avaliações realizadas entre 30 e 60 dias após as inoculações com o patógeno incluíram o comprimento das lesões no tronco e a massa seca do sistema radicular nas plantas avaliadas. O híbrido somático laranja 'Hamlin' + toranja 'Indian Red' (planta 1) mostrou-se tolerante a P. nicotianae, indicando potencial para continuidade nas suas avaliações como porta-enxerto para citros.
9
FIGUEIREDO, JOSÉ ORLANDO DE, EDUARDO SANCHES STUCHI, LUIZ CARLOS DONADIO, JOAQUIM TEÓFILO SOBRINHO, FRANCISCO FERRAZ LARANJEIRA, ROSE MARY PIO, and OTÁVIO RICARDO SEMPIONATO. "Porta-enxertos para a lima-ácida-'Tahiti' na região de Bebedouro, SP." Revista Brasileira de Fruticultura 24, no. 1 (April 2002): 155–59. http://dx.doi.org/10.1590/s0100-29452002000100034.
Texto completoResumen
Foi instalado um experimento de seleção de porta-enxertos para a lima-ácida-'Tahiti' (Citrus latifolia Tanaka), em dezembro de 1988, na Estação Experimental de Citricultura de Bebedouro-SP, com o objetivo de conhecer seu comportamento e oferecer novas opções de plantio para as condições ecológicas semelhantes às daquela região. A variedade copa, originária do BAG-Citros do IAC, localizado no Centro de Citricultura Sylvio Moreira, Cordeirópolis-SP, é um clone nucelar de 'Tahiti', denominado IAC-5. Os porta-enxertos, que tiveram a mesma origem, foram: tangerinas-'Sunki' (Citrus sunki Hort. ex Tanaka); 'Cleópatra'(Citrus reshni Hort. ex Tan.); 'Batangas' e 'Oneco' (Citrus reticulata Blanco); trifoliata-EEL (Poncirus trifoliata Raf.); limão-'Cravo' (Citrus limonia Osbeck); limão-'Volkameriano Catania 2' (Citrus volkameriana Tan. & Pasq.); tangelo-'Orlando' (C. reticulata Blanco x Citrus paradisi Macf.); citrumelo-'Swingle' (P. trifoliata Raf. X C.paradisi Macf.); citrange-'Morton' (P. trifoliata Raf. X C. sinensis (L.) Osbeck) e laranja-'Caipira DAC' (C. sinensis (L.) Osbeck). Com relação à produção, avaliada no período de 1991 a 1998, os porta-enxertos de melhor comportamento foram o tangelo-'Orlando', citrange-'Morton' e citrumelo-'Swingle'. As mais baixas produções ocorreram nos porta-enxertos de tangerina e de laranja-'Caipira DAC'. O limão-'Cravo' apresentou produção intermediária e proporcionou curta vida útil às plantas.
10
Sulaymonov, Otabek Abdushukurovich, Guzal Tulaganovna Dusmurodova, and Bekzod Bekmurod Ugli Sobirov. "STUDYING THE EFFICACY OF ALLCHUNGKILL CYC.K. AGAINST CITRUS CITRUS WHITEFLY (DIALEURODES CITRI ASHM.) IN CULTURE LEMON." American Journal of Agriculture and Biomedical Engineering 04, no. 05 (May 1, 2022): 22–25. http://dx.doi.org/10.37547/tajabe/volume04issue05-07.
Texto completoResumen
This article provides data on the harmfulness, distribution and lifestyle of citrus citrus whitefly , which in recent years has been a harmful object in our republic. In order to determine the effectiveness of insecticides against citrus citrus The whitefly first introduced observational work based on lemon pheromones . On this basis, in three variants, tests were carried out on Allchungkill preparations. cyc .to . 0.35 - 0.4 l / ha . , (reference) Emaben, 5% SDG . 0.4 kg/ha. The highest efficiency was observed in the variant where Allchungkill was used. cyc .to . 0.35 - 0.4 l / ha . In this variant, the efficiency was 7-day 86.1-87.7% .
11
Jesus, Cristiane Ramos de, Luiza Rodrigues Redaelli, and Fábio Kessler Dal Soglio. "Flutuação populacional de Phyllocnistis citrella Stainton em Citrus deliciosa e no híbrido Murcott Citrus sinensis x Citrus reticulata." Ciência Rural 38, no. 3 (June 2008): 593–600. http://dx.doi.org/10.1590/s0103-84782008000300001.
Texto completoResumen
O objetivo desta pesquisa foi avaliar a dinâmica populacional de Phyllocnistis citrella Stainton, (Lepidoptera: Gracillariidae), o minador-dos-citros, em pomares de tangerineira Citrus deliciosa Tenore variedade Montenegrina e de tangoreiro híbrido "Murcott" Citrus sinensis L. Osbeck X Citrus reticulata Blanco, com manejo orgânico, em Montenegro (29° 68'S e 51° 46'O), Rio Grande do Sul. Foram realizadas amostragens quinzenais de julho de 2001 a junho de 2003. Os brotos coletados foram examinados em laboratório e submetidos à análise do número de folhas por broto, a da presença ou ausência de minas, do número de minas, dos ovos, das larvas e das pupas de P. citrella. Em ambos os pomares não houve registro de minas de P. citrella no primeiro fluxo de brotação, de agosto a outubro. No ano I, as maiores densidades de minas foram registradas em meados de novembro, início de janeiro e início de abril, em ambos os pomares. No ano II, constataram-se as maiores densidades de minas e larvas em janeiro e em abril, em C. deliciosa, e de dezembro a março em "Murcott". Embora o número médio de brotos registrado tenha sido sempre maior em C. deliciosa, a colonização e o estabelecimento do minador-dos-citros seguiram o mesmo padrão em ambos os pomares. A temperatura mínima e média e a umidade relativa do ar foram os fatores abióticos que apresentaram maior influência no número de minas e de larvas de P. citrella.
12
Cruz, Maria do Céu Monteiro da, Railene Hérica Carlos Rocha, Dalmo Lopes de Siqueira, and Luiz Carlos Chamhum Salomão. "Avaliação do potencial hídrico foliar, umidade do solo e temperatura do ar no período pré- florescimento dos citros." Ciência e Agrotecnologia 31, no. 5 (October 2007): 1291–96. http://dx.doi.org/10.1590/s1413-70542007000500003.
Texto completoResumen
O trabalho foi conduzido em um pomar de citros localizado no Setor de Fruticultura do Departamento de Fitotecnia da Universidade Federal de Viçosa-UFV/Viçosa-MG, no período de março a setembro de 2004. O objetivo foi avaliar a influência do potencial hídrico das folhas e do solo sobre o florescimento da tangerineira 'Poncã', laranjeira 'Serra d'Água'e limeira ácida 'Tahiti' nas condições climáticas de Viçosa-MG. A temperatura do ar (ºC) e a precipitação pluviométrica (mm) foram avaliadas diariamente durante o período experimental. O potencial hídrico no solo e nas folhas foi avaliado em dois horários (7:00 às 8:00 h manhã e 13:00 às 14:00 h tarde). As cultivares utilizadas foram laranjeira 'Serra d'Água'(Citrus sinensis (L.) Osb.), tangerina 'Poncã' (Citrus reticulata Blanco) e limeira ácida 'Tahiti' (Citrus latifolia Tanaka.), enxertadas sobre limoeiro 'Cravo' (Citrus limonia Osb.). Observou-se que o potencial hídrico foliar dos citros diminuiu sob condições de altas temperaturas e déficit hídrico no solo, entretanto, varia em função dos cultivares, observando-se os maiores valores para a limeira 'Tahiti'. O florescimento ocorreu após um período de baixas temperaturas seguido por uma redução do potencial hídrico do solo. A limeira ácida 'Tahiti' é mais precoce, quando comparada com a tangerineira 'Poncã' e a laranjeira 'Serra D'Água'.
13
Galbiatti, João Antonio, Italo Herbert Lucena Cavalcante, Sérgio Ademir Calzavara, Vanessa Lorencini da Silva, and Onã Da Silva Freddi. "SUBSTRATOS E LÂMINAS DE IRRIGAÇÃO EM DUAS ESPÉCIES CÍTRICAS." IRRIGA 10, no. 4 (December 22, 2005): 357–64. http://dx.doi.org/10.15809/irriga.2005v10n4p357-364.
Texto completoResumen
SUBSTRATOS E LÂMINAS DE IRRIGAÇÃO EM DUAS ESPÉCIES CÍTRICAS João Antonio Galbiatti1; Ítalo Herbert Lucena Cavalcante2; Sérgio Ademir Calzavara2; Vanessa Lorencini Da Silva3; Onã da Silva Freddi1[1] Departamento de Engenharia Rural, Universidade Estadual Paulista, Faculdade de Ciências Agrárias e Veterinária, Jaboticabal, SP, galbi@fcav.unesp.br2 Pós-graduandos da disciplina de irrigação, Universidade Estadual Paulista, Faculdade de Ciências Agrárias e Veterinária, Jaboticabal, SP 3 Aluna de iniciação cientifica, Universidade Estadual Paulista, Faculdade de Ciências Agrárias e Veterinária, Jaboticabal, SP 1 RESUMO O presente trabalho teve por objetivo verificar a influência do resíduo de bauxita e lâminas de irrigação na germinação e crescimento inicial de plantas de citros. O delineamento experimental adotado foi inteiramente casualisado em um esquema fatorial 2x6x3, sendo duas espécies de citrus limão cravo (Citrus limonia) e limão volkameriano (Citrus volkameriana), seis substratos: T - (testemunha) 100% casca de pinus; S1 – casca de pinus + calcário; S2 – casca de pinus + 1% de resíduo de bauxita; S3 – casca de pinus + 2% de resíduo de bauxita; S4 – casca de pinus + 5% de resíduo de bauxita; e S5 – casca de pinus + 10% de resíduo de bauxita e três lâminas de irrigação: 50% (L1), 100% (L2) e 150% (L3) da evaporação diária medida no atmômetro. Os parâmetros avaliados foram número de plântulas emergidas, altura de plântulas, matéria seca da raiz e da parte aérea. Irrigações abaixo da evaporação medida pelo atmômetro causaram diminuição na altura de plântulas de citrus. A reposição de água acima da evaporação diária causou efeito negativo sobre a emergência de plântulas de limão volkameriano. O limão Cravo apresentou maior desenvolvimento radicular com o aumento da irrigação em relação ao volkameriano. Com o acréscimo da dose de resíduo houve diminuição na altura de plântulas e no desenvolvimento radicular. Unitermos: citros, irrigação, resíduo e emergência. GALBIATTI, J. A.; CAVALCANTE, I. H. L.; CALZAVARA, S. A.; DA SILVA, V. L.; FREDDI, O. da S.. SUBSTRATE AND IRRIGATION LEVELS ON TWO CITRUS SPECIES 2 ABSTRACT The present study aimed to identify the influence of bauxite residue from the extraction process and irrigation levels on citrus plant germination and initial growth. A completely randomized factorial design was developed with two citrus species: Citrus limonia and Citrus volkameriana; six substrates: T (100% of pinus bark), S1 (pinus bark + calcarium), S2 (pinus bark +1% of bauxite residue), S3 (pinus bark +2% of bauxite residue), S4 (pinus bark +5% of bauxite residue) and S5 (pinus bark +10% of bauxite residue); 3 irrigation levels were calculated based on daily evaporation, obtained from an atmometer: 50%(L1), 100%(L2) and 150%(L3). The number of seeds that germinated, plant height, dry mass of root and plant were evaluated. 50% irrigation level reduced plant height. 150% irrigation level caused negative effect on Citrus volkameriana plant germination. Citrus limonia presented higher root development than Citrus volkameriana when irrigation level was increased. Height and root development of plants decreased when bauxite residue level was increased on substrate. Keywords: citrus, bauxite residue and plant germination.
14
Silva, Anderson Gonçalves da, Arlindo Leal Boiça Junior, Paulo Roberto Silva Farias, Nara Elisa Lobato Rodrigues, Bruno Silva Monteiro, and Naira Alencar Santos. "Influência de Fatores Abióticos na Infestação de Mosca-Negra-dos-Citros (Aleurocanthus woglumi Ashby) em Plantio de Citros em Sistema Agroflorestal no Estado do Pará." EntomoBrasilis 4, no. 1 (March 22, 2011): 01–06. http://dx.doi.org/10.12741/ebrasilis.v4i1.127.
Texto completoResumen
Importante parcela da produção de citros no estado Pará é plantada em Sistema Agroflorestal (SAF), que apresenta, dentre os principais problemas fitossanitários, a mosca-negra-dos-citros que em ataques severos acarretam redução estimada de 80% na produção. Além de se constitui praga quarentenária presente ou A2 de alerta máximo. Dada a relevância desse inseto sugador e a falta de conhecimentos básicos, bem como estudos da praga associados a plantios agroflorestais, objetivou-se com o presente trabalho avaliar a influência de fatores abióticos na infestação de mosca negra em plantio de citros em sistema agroflorestal no estado do Pará. O presente trabalho foi desenvolvido em área localizada no município de Capitão Poço, mesorregião do Nordeste Paraense. Fez-se 12 amostragens avaliando-se a presença ou ausência de ninfas e/ou adultos vivos de Aleurocanthus woglumi Ashby. Fez-se análise de correlação para avaliar os parâmetros abióticos (temperatura e precipitação) e mapas de Krigagem para avaliar o efeito do sombreamento das plantas de teca na infestação da praga em estudo. Dentre os principais resultados obtidos, verificou-se a infestação da praga em todos os meses avaliados; houve influência da temperatura na regulação da população de mosca-negra-dos-citros e precipitações elevadas reduziram o número de plantas com presença de A. woglumi. Ainda, pode-se inferir que às infestações da mosca-negra-dos-citros apresentam preferência por intensidade moderada de sombreamento, no entanto, as mudanças ocasionadas pela introdução de espécies florestais em cultivos agrícolas, devem ser melhor investigadas.
 Abiotic Factors Influence on Citrus Blackfly (Aleurocanthus woglumi Ashby) Infestation on Citrus Planting by Agroforestry System at Pará State.
 Abstract. An important part of citrus production at Pará state is planted by Agroforestry System (AFS), that presents, amongst major phytosanitary problems, the citrus blackfly, that by severe attacks cause estimated redution of 80% in its’ production. Beside that, it constitutes a quarentenary pest of maximun alert level A2. Given the relevance of this sucking insect and the lack of basic knowledge, as well pest studies associated to agroforestry planting, the objective of this study was to evaluate the abiotic factors influence on blackfly infestation in citrus planting by agroforestry planting at Pará state. This study was carried out at Capitão Poço county, northeast mesoregion of Pará. 12 samplings were made evaluating the presence or abscence of Aleurocanthus woglumi Ashby alive nymphs and/or adults. Correlation analisys was carried out to evaluate abiotic parameters (temperature and precipitation) and kriging maps to evaluate Teca plants shading effects on the pest under study infestation. Amongst the main results obtained, there was pest infestation in every evaluated moth; there was temperature influence onto citrus blackfly population regulation and high precipitations reduced the number of plants with A. woglumi presence. Still, it can be inferred that the citrus blackfly infestations present preference for moderate shading intensity. However, changes occuring by the forestry species introduction onto agricultural cultivations must be better investigated.
15
Leone, Jocarstea Aparecida Brinati, Jorge Ferreira de Souza, André Felipe Andrade dos Santos, and Paulo Sergio Torres Brioso. "Viróides em citros no Estado do Rio de Janeiro." Summa Phytopathologica 46, no. 2 (June 2020): 121–28. http://dx.doi.org/10.1590/0100-5405/231001.
Texto completoResumen
RESUMO Os viróides infectam plantas de grande importância econômica como os citros. Objetivando detectar a presença de viróides através de métodos moleculares em árvores cítricas, cinco propriedades em Araruama, no Estado do Rio de Janeiro foram avaliadas. Vinte e duas amostras foram coletadas a partir de plantas com nanismo, rachadura no tronco e epinastia, sendo realizada a extração de RNA das folhas e empregado a técnica de RT-PCR com primers específicos para cinco espécies de viróide que infectam citros. O resultado da eletroforese em gel de agarose mostrou-se positivo para os viróides Citrus exocortis viroid (CEVd); Citrus bent leaf viroid (CBLVd); Hop stunt viroid (HSVd) e Citrus dwarfing viroid (CDVd), sendo o último encontrado em todas as propriedades e na combinação com outros viróides, o HSVd e o CBLVd estavam presentes em duas propriedades e o CEVd isoladamente em apenas uma propriedade. Não foi detectada a presença do Citrus viroid IV (CVd-IV) nas amostras avaliadas. Foram observadas diferenças na expressão dos sintomas associados ao CEVd o que pode ter ocorrido devido a interferências entre as espécies de viróides que infectavam uma mesma planta. A transmissão pode ter sido mecanicamente através da poda das plantas cítricas ou através de mudas infectadas com viróide. A utilização de métodos moleculares mostrou-se eficiente na identificação da presença de viróides em plantas cítricas no Estado do Rio de Janeiro.
16
Haag, H. P., L. E. Gutierrez, A. R. Dechen, F. A. A. Mourão Filho, and C. S. Moreira. "Variação de matéria seca e de nutrientes nas folhas e nos frutos, produção de ácido ascórbico e suco, em seis cultivares de citros, durante um ciclo." Scientia Agricola 50, no. 2 (September 1993): 193–203. http://dx.doi.org/10.1590/s0103-90161993000200005.
Texto completoResumen
De uma plantação de citros, com os cultivares T. Cravo (Citrus reticulata Blanco), L.Hamlin (Citrus sinensis (L.) Osbeck), T. Murcott (Citrus reticulata Blanco x Citrus sinensis (L.) Osbeck), L. Natal (Citrus sinensis (L.) Osbeck, L. Valencia (Citrus sinensis (L.) Osbeck) e L. Pera (Citrus sinensis (L.) Osbeck), situada na "Fazenda Sete Lagoas", no município de Mogi-Guaçu (22° 22% 46° 56'W.Gr.), em Latossolo Vermelho amarelo, fase arenosa, foram coletados frutos 30 dias após florescimento, até a idade da coleta comercial. No material coletado, foram determinadas a variação da matéria seca, a concentração dos macro e micronutrientes nas folhas adjacentes ao fruto, a extração de macro e micronutríentes pelos frutos, a produção de suco (ml) por fruto e a concentração de ácido ascórbico (mg/100 ml de suco). Concluiu-se que: 1. O aumento da matéria seca, intensifica-se a partir do segundo mês apos o florescimento; 2. Com exceção da T. Cravo, ocorre uma diminuição na produção de matéria seca no final do ciclo; 3. A concentração dos macro e micronutrientes nas folhas apresenta oscilações durante o desenvolvimento do fruto; 4. A ordem decrescente de extração de nutrientes é: K, N, Ca, Mg, P = S, Fe, B, Zn, Mn, Cu; 5. A capacidade de exportação de nutrientes pelos cultivares é, em ordem decrescente: L. Pera, L. Hamlin = T. Cravo, T. Murcott, L. Valencia, L. Natal; 6. A quantidade de suco produzido por fruto, oscila entre 43 a 95 ml; 7. A concentração de ácido ascórbico (mg/100 ml de suco), varia entre 30 a 95.
17
Santos, Ronaldo Antonio dos, Horst Bremer Neto, Rubens Duarte Coelho, and Rodrigo Otávio Câmara Monteiro. "ANÁLISE ECONÔMICA DA IMPLANTAÇÃO DE SISTEMAS DE IRRIGAÇÃO NA CITRICULTURA DO ESTADO DE SÃO PAULO." IRRIGA 11, no. 1 (March 16, 2006): 66–77. http://dx.doi.org/10.15809/irriga.2006v11n1p66-77.
Texto completoResumen
ANÁLISE ECONÔMICA DA IMPLANTAÇÃO DE SISTEMAS DEIRRIGAÇÃO NA CITRICULTURA DO ESTADO DE SÃO PAULO Ronaldo Antonio dos Santos; Horst Bremer Neto; Rubens Duarte Coelho; Rodrigo Otávio Câmara MonteiroDepartamento de Engenharia Rural, Escola Superior de Agricultura "Luiz de Queiroz", Universidade de São Paulo, Piracicaba, SP, santosra@esalq.usp.br. 1 RESUMO A consolidação da citricultura brasileira nas últimas décadas trouxe muitos benefícios para o país, tanto econômicos como sociais. Para o contínuo fortalecimento desta atividade, torna-se necessário o investimento em tecnologia. Umadelas é a da irrigação visando reduzir os riscos de adversidades climáticas. Além disso, são bastante animadores os relatos bibliográficos sobre os incrementos de produtividade proporcionados pela utilização desta tecnologia na cultura do citros. Todavia, antes da irrigação ser introduzida no sistema de produção, a relação custo/benefício deve ser considerada. Este trabalho teve como objetivo estudar a viabilidade econômica da irrigação em citros no estado de São Paulo a partir de informações coletadas in locu. Dados primários obtidos indicaram que os sistemas de irrigação com motor elétrico tiveram maior custo fixo anual, enquanto que com motor diesel, o dispêndio foi maior com o custo variável e total anual. Dentre as variáveis estudadas, as que mais influenciaram o incremento de produtividade necessário para viabilizar a irrigação foram o preço de venda do produto, o comprimento da rede elétrica, a vida útil do projeto, número anual de meses em que se realiza a irrigação e preço de aquisição do sistema de irrigação. UNITERMOS: Sistemas de irrigação, Fontes de energia, Citros, Viabilidade Econômica SANTOS, R. A. dos; BREMER NETO, H.; COELHO, R. D.; MONTEIRO, R. O. C. AN ECONOMIC ANALYSIS OF IRRIGATION SYSTEM IMPLEMENTATION IN CITRUS CULTURE IN SÃO PAULO STATE, BRAZIL 2 ABSTRACT The consolidation of the Brazilian citrus industry in the last decades resulted in economic and social benefits for the country. However, the investment in new technologies is necessary to the updated maintenance of this activity. Irrigation systems are an option to reduce climatic adversities risks. In addition, some reports in literature about productivity increase due to the use of this technology in citrus culture are very encouraging. However, the benefit/cost relation must be considered in each situation to justify the investment. This paper presented an economic analysis for citrus irrigation in São PauloStatefrom in locu data collection. The obtained results indicated that citrus irrigation based using electric engine presented higher annual fixed cost, while diesel engine presented higher variable and total costs. The identified variables that mostly influenced necessary productivity increase to make irrigation viable were: Citrus price, length of the electric line to be installed in the field, equipment lifetime, total time of irrigation during the year and acquisition price of irrigation system. KEYWORDS: Irrigation system, Sources of energy, Citrus, Economic Viability
18
Astuti, Yoni, and Aulia Primasari. "Ethanolic Extract of Citrus reticulata Peel Inhibits the Migration of WiDr Colon Cancer Cells." Indonesian Journal of Cancer Chemoprevention 11, no. 2 (July 24, 2020): 60. http://dx.doi.org/10.14499/indonesianjcanchemoprev11iss2pp60-66.
Texto completoResumen
Colorectal cancer is third rank on the cancer cases in Indonesia. To cure the cancer needs big cost and lot of effort. On the other side, the side effect of medicine or chemotherapy on patient need to reduce. Cancer cell spread to other tissue based on its migration and invasion ability. Citrus reticulata peel contains flavonoid such as Tangeretin and Nobiletin, both of this compounds have anticancer activity. The aims of this study is to reveals the potency of ethanol extract of Citrus reticulata peel on the inhibition of migration on WiDr colon cancer cells. The toxicity of ethanol extract of Citurs reticulata peel on WiDr colon cancer line was measured using 3-(4,5-dimethyltiazol-2-il)-2,5-diphenyltrazolium bromide (MTT) assay and investigate the cell migration was using scratch wound healing assay. The ethanol extract of Citrus reticulata peel showed the value of inhibitory concentration 50 (IC50) was 184.5 μg/mL, this result categorize as moderate cytotoxic. Meanwhile the migration assay showed that the deceleration of migration occurred on 0.5 IC50, 0.33 IC50 and 0.25 IC50 during 24 h and 36 h incubation, event thought there were not significant different (p>0.05). The ethanol extract of Citrus reticulata peel has a potential migration inhibition on WiDr cell line.Keywords: Citrus reticulata, WiDr cell line, migration
19
Santos, Carlos Henrique dos, Jaime Duarte Filho, Junior Cesar Modesto, Hélio Grassi Filho, and Gisela Ferreira. "Adubos foliares quelatizados e sais na absorção de boro, manganês e zinco em laranjeira ‘Pera’." Scientia Agricola 56, no. 4 (October 1999): 999–1004. http://dx.doi.org/10.1590/s0103-90161999000400031.
Texto completoResumen
O presente trabalho teve como objetivo comparar a eficiência de formulações de adubos foliares quelatizados na absorção dos micronutrientes boro, manganês e zinco, com a aplicação convencional de sais em plantas de laranjeira ‘Pera’ (Citrus sinensis (L.) Osbeck). Para tanto foi conduzido experimento nas dependências do Departamento de Ciência do Solo da Faculdade de Ciências Agronômicas UNESP/Campus de Botucatu, Estado de São Paulo. Utilizaram-se plantas de laranjeira ‘Pera’ (Citrus sinensis (L.) Osbeck) enxertadas sobre limoeiro ‘Cravo’ (Citrus limonia Osbeck), com 2 anos de idade, plantadas em caixas de 250 litros. Os adubos foliares utilizados foram: Grex Citros na dose de 1,0 mL L-1; Copas citros 2,0 mL L-1; Plantin Citros 1,0 mL L-1; Citrolino 2,0 mL L-1; Fertamin Citros 1,75 mL L-1; Yogen Citros 2,0 mL L-1; MS-2 1,0 mL L-1; Sais, Sais + 1,0 g L-1 de KCl e Sais substituindo o ZnSO4 pelo ZnCl2. O volume de aplicação, foi de 1 litro de calda planta-1. Em todos os tratamentos adicionou-se o espalhante adesivo do grupo químico dos alquifenoletoxilados a 0,03%. A amostragem das folhas foi realizada 30 dias após a aplicação dos tratamentos, coletando-se a 3a ou 4a folha de ramos vegetativos no início do florescimento, dos 4 quadrantes, localizados na região mediana da planta, totalizando 10 folhas por planta. A aplicação foliar de micronutrientes, favoreceu a absorção e resultou no aumento do teor foliar de Mn e Zn mas não de B, sendo que a presença de cloreto aumentou os teores de Zn na folhas de laranjeira ‘Pera’, proporcionando maior absorção do que o sulfato e sulfato adicionado ao cloreto de potássio. Os resultados mostram, também, que os produtos quelatizados Yogen e MS-2, para as condições deste estudo, não foram eficientes como fontes fornecedoras de Mn.
20
CARVALHO, SÉRGIO A., FRANCISCA A. SANTOS, and MARCOS A. MACHADO. "Eliminação de vírus do complexo sorose dos citros por microenxertia associada a termoterapia." Fitopatologia Brasileira 27, no. 3 (June 2002): 306–8. http://dx.doi.org/10.1590/s0100-41582002000300012.
Texto completoResumen
A microenxertia de ápices caulinares tem sido utilizada com 100% de sucesso na eliminação do vírus da tristeza (Citrus tristeza virus) e dos viróides da exocorte (Citrus exocortis viroid - CEVd) e cachexia-xiloporose de materiais do Banco Ativo de Germoplasma de Citros do Centro de Citricultura Sylvio Moreira CCSM-IAC. Para o complexo da sorose, entretanto, esta técnica tem apresentado somente 60% de eficiência, indicando a necessidade de sua associação com termoterapia para garantir a eliminação viral. Para tanto, mudas originadas de borbulhas infetadas com sorose foram mantidas em câmara climática com 16 h de luz a 38 ºC e 8 h no escuro a 32 ºC e utilizadas para a obtenção dos ápices caulinares empregados na microenxertia. Após o pegamento, o conjunto micro porta-enxerto e brotação foi sobre-enxertado em limoeiro (Citrus limonia) 'Cravo' com sete meses de idade e mantido em condições de casa de vegetação. Clones de laranjeiras doces (Citrus sinsensis) 'Lima', 'Rubi', 'Piralima', 'Salustiana', 'João Nunes', 'Rosa' e 'Pêra Caire' tratados desta maneira, comprovaram eficiência de 100% de eliminação do complexo sorose, conforme indexação realizada empregando-se laranjeira 'Do Céu' como planta indicadora.
21
Padya, Inka Rizki, Ferry Putrawansyah, and Anggia Martiana. "Pemanfaatan Limbah Jeruk Gerga menjadi Nata de Citrus Gerga (NAGA) pada Kelompok Tani Mangku Anom, Desa Muara Siban Baru, Kecamatan Dempo Utara, Kota Pagar Alam." Jurnal SOLMA 13, no. 3 (December 31, 2024): 2435–41. https://doi.org/10.22236/solma.v13i3.16647.
Texto completoResumen
Background: Peningkatan luas areal perkebunan jeruk gerga memiliki permasalahan utama yaitu meningkatnya limbah jeruk pada proses pasca panen. Limbah jeruk yang dihasilkan memiliki jumlah yang cukup tinggi, dan penangan limbah ini hanya dibuang oleh petani sehingga akan memberikan dampak negatif pada lingkungan. Tujuan dari kegiatan pengabdian masyarakat adalah untuk memberikan sosialisasi tentang pengolahan limbah jeruk menjadi Nata de citrus dan pelatihan proses produksi Nata de citrus sebagai upaya meningkatkan pendapatan petani dan mengurangi limbah. Metode: Pengabdian ini dilakukan pada kelompok Tani Mangku Anom, Desa Muara Siban Baru, Kecamatan Dempo Utara Kota Pagar Alam sebanyak 40 peserta. Metode yang digunakan adalah sosialisai, diskusi dan pelatihan pembuatan serta pengujian sensori dengan uji hedonic (Tingkat kesukaan) pada minuman nata de citrus. Hasil: Hasil kegiatan ini memberikan pemahaman tentang Nata de citrus sebagai solusi pemanafaatan jeruk sisa sortasi yang biasanya dibuang sebagai limbah. Sisa jeruk gerja dapat diolah menjadi minuman yang memiliki manfaat kesehatan dan selain itu anggota Kelompok Tani telah berhasil memproduksi produk nata de citrsu dengan kemasan yang menarik. Kesimpulan: Produk nata siap saji dan produk minuman nata siap saji memiliki sifat sensori (penampilan, aroma, rasa, dan tekstur) yang diterima dan disukai oleh panelis.
22
Gerhardt, Carin, José Maria Wiest, Giovani Girolometto, Magnólia Aparecida Silva da Silva, and Simone Weschenfelder. "Aproveitamento da casca de citros na perspectiva de alimentos: prospecção da atividade antibacteriana." Brazilian Journal of Food Technology 15, spe (November 22, 2012): 11–17. http://dx.doi.org/10.1590/s1981-67232012005000033.
Texto completoResumen
Os citros são as frutas mais produzidas e consumidas no mundo. O Brasil ocupa primeiro lugar na produção mundial e na exportação de suco de laranja, sendo o Estado do Rio Grande do Sul um importante produtor. Ao longo do cultivo e do processamento dos citros, são geradas toneladas de resíduos de baixo valor comercial, mas com grande potencial de aproveitamento dentro da indústria de alimentos. Esses resíduos possuem elevados teores de nutrientes, pigmentos e componentes bioativos, bem como possuem baixa toxicidade e baixo custo. Há evidências de que a casca de diferentes espécies de citros possui princípios ativos antibacterianos e antifúngicos. O objetivo deste trabalho, portanto, foi verificar a atividade antibacteriana de extratos alcoólicos da casca de citros na perspectiva da desinfecção e da conservação de alimentos, propondo alternativas sustentáveis e naturais voltadas a consumidores cada vez mais preocupados com sua saúde. Foram obtidos extratos alcoólicos da casca crua de bergamota-ponkan (Citrus reticulata Blanco), pomelo (Citrus maxima (Burm.) Merr.) e limão-bergamota (Citrus limonia Osbeck ou limão-cravo) maduros, provenientes de cultivo agroecológico, cujas atividades antibacterianas foram avaliadas quanto à Concentração Inibitória Mínima (CIM) e à Concentração Bactericida Mínima (CBM) frente a cinco diferentes bactérias. O extrato de limão-bergamota apresentou a melhor atividade antibacteriana, apresentando CIM em torno de 24 mg.mL-1 e CBM de 42 mg.mL-1 para as bactérias mais resistentes. A bactéria mais sensível a todos os extratos foi Pseudomonas aeruginosa, com CIM entre 16 e 36 mg.mL-1 e CBM entre 28 e 49 mg.mL-1. Os extratos inibiram ou inativaram na sua totalidade as bactérias testadas, indicando a possibilidade de se tornarem alternativas naturais na desinfecção e na conservação de alimentos.
23
Aparicio-Durán, Lidia, Frederick G. Gmitter Jr., Juan M. Arjona-López, Rocío Calero-Velázquez, Áurea Hervalejo, and Francisco J. Arenas-Arenas. "Water-Stress Influences on Three New Promising HLB-Tolerant Citrus Rootstocks." Horticulturae 7, no. 10 (September 24, 2021): 336. http://dx.doi.org/10.3390/horticulturae7100336.
Texto completoResumen
Drought and flooding conditions are increasingly common abiotic factors that affect citrus crops in both the Mediterranean Basin and Florida. Furthermore, emerging diseases, such as Huanglongbing (HLB), are a potential risk for these crops in those producing areas. This study aimed to evaluate the behavior under water-stress treatments of three new citrus rootstocks (UFR-6, B11R5T60, and 2247 x 6070-02-2) with reported tolerance of HLB, comparing them with a common commercial citrus rootstock (Carrizo citrange). Four water conditions were established: Control, Medium Water Stress (MWS), Drought, and Flooding. Chlorophyll index (SPAD), growth in height, relative growth rate, biomass (fresh and dry weight) and plant water status were evaluated. Citru rootstock response were different for each genotype; Carrizo citrange was negatively affected by all water treatments in the chlorophyll index (SPAD) and biomass production. By contrast, UFR-6 showed a positive response in SPAD and growth under MWS and Drought, B11R5T60 displayed similar behavior to Control under all water stresses, and the response of 2247 x 6070-02-2 under MWS treatment was adequate but was not under Drought or Flooding conditions. Our study describes the behavior of these promising new citrus rootstocks against water stress; B11R5T60 exhibiting the best performance. These results can be useful for the citrus industry to address water-stress problems in these crops.
24
Applequist, Wendy. "Citrus. The Genus Citrus." Economic Botany 58, no. 4 (December 2004): 749. http://dx.doi.org/10.1663/0013-0001(2004)058[0749:bredfa]2.0.co;2.
Texto completo
25
Azevedo, Ruberval Leone, and Marcel Faria Lima. "Cigarrinhas dos Citros, Vetoras da Bactéria Xylella fastidiosa Wells et al.: Pragas Potenciais para a Citricultura Sergipana." EntomoBrasilis 8, no. 1 (April 13, 2015): 01–07. http://dx.doi.org/10.12741/ebrasilis.v8i1.403.
Texto completoResumen
A citricultura no Brasil exerce um papel de grande importância econômica, social, gerando empregos, renda e desenvolvimento. O Brasil é o maior produtor mundial de citros, o Estado de Sergipe destaca-se em 5º lugar nacional em produção. Dentre os vários problemas fitossanitários enfrentados pela citricultura brasileira está a Clorose Variegada dos Citros (CVC), conhecida como amarelinho, causada pela bactéria Xylella fastidiosa Wells et al. A CVC foi identificada oficialmente no Brasil, em 1987, em pomares do Triângulo Mineiro e do Norte e Noroeste do Estado de São Paulo. No Nordeste, foi constatada em 1996 em Sergipe no município de Boquim, e em 1997 na Bahia, nos municípios de Rio Real e Itapicuru. O objetivo foi revisar a literatura sobre as espécies de cigarrinhas vetores da CVC, e verificar se ocorrem no estado de Sergipe. Os primeiros sintomas são vistos nas folhas, passam posteriormente para os frutos e acabam afetando toda a planta, e para serem percebidos pode levar entre 5 meses e 2 anos. Os principais vetores da X. fastidiosa em citros são as cigarrinhas da família Cicadellidae. No Brasil já foram confirmadas 12 espécies de cigarrinhas vetoras. Para o estado de Sergipe, são escassas a informações sobre Cicadellidae vetoras, os dados são limitados ao Litoral Norte da Bahia, com exceção de vaga citação sobre quatro gêneros (Oncometropia, Acrogonia, Dilobopterus e Homolodisca) e três espécies (Homolodisca ignorata Melichar, Acrogonia sp. e Homolodisca spottii Takiya, Cavichioli & McKamey).
 Citrus leafhoppers, Vectors of of Bacterium Xylella fastidiosa Wells et al.: Potential Pest of Citrus Crops in Sergipe State
 Abstract. The citrus industry in Brazil plays a role of great economic, social, generating jobs, income and development. Brazil is the largest producer of citrus, the State of Sergipe stands out in 5th place in national production. Among the many pest problems faced by Brazilian citrus is Citrus Variegated Chlorosis (CVC), known as the yellowing caused by the bacterium Xylella fastidiosa Wells et al. The CVC was officially identified in Brazil in 1987, in orchards of “Triângulo Mineiro” and North and northwest of the state of São Paulo. In the Northeast Region of Brazil, was found in 1996 in the municipality of Boquim Sergipe, and Bahia in 1997, the municipalities of Rio Real and Itapicuru. The aim was to review the literature on the species of leafhoppers vectors of CVC, and verify that occur in the state of Sergipe. The first symptoms are seen in the leaves, then go for the fruits and end up affecting the entire plant, and to be perceived can take between five months and two years. The main vectors of X. fastidiosa in citrus are the sharpshooters of the family Cicadellidae. In Brazil 12 sharpshooters species have already been confirmed. For the state of Sergipe, is scarce information about the Cicadellidae vectors, the data are limited to the northern coast of Bahia, except for vague quote about four genus (Oncometropia, Acrogonia, Dilobopterus and Homolodisca) and three species (Homolodisca ignorata Melichar, Acrogonia sp. and Homolodisca spottii Takiya, Cavichioli & McKamey).
26
Brandão, Henrique Cardoso Batista, Ana Laura Santos Anjos, Cristiane de Jesus Barbosa, Walter dos Santos Soares Filho, and Alessandra Selbach Schnadelbach. "Porta-enxertos híbridos de citros tolerantes ao Citrus tristeza vírus (CTV) / Hybrid Citrus Rootstocks Tolerant to Citrus Tristeza Virus (CTV)." Brazilian Journal of Animal and Environmental Research 4, no. 2 (June 25, 2021): 2714–16. http://dx.doi.org/10.34188/bjaerv4n2-093.
Texto completoResumen
A citricultura brasileira lidera o mercado de exportação mundial. A tristeza dos citros é uma doença endêmica causada pelo Citrus tristeza virus (CTV), que é transmitido pelo pulgão preto dos citros, Toxoptera citricida (Kirkaldy). O controle da tristeza é feito, principalmente, pela utilização de porta-enxertos tolerantes ao CTV. Este trabalho teve como objetivo avaliar o comportamento de 50 híbridos de porta-enxerto de citros, gerados pelo Programa de Melhoramento Genético de Citros da Embrapa Mandioca e Fruticultura, quanto à infecção natural pelo CTV. Amostras de cada híbrido foram coletadas no campo experimental e casas teladas da Embrapa em Cruz das Almas. A mostra estava composta por 10 ramos novos, coletados em diferentes quadrantes da planta, que foram avaliados quanto à presença de caneluras por escala de notas: 1. Ausência de caneluras; 2. Presença de caneluras esparsas; 3. Número intermediário de caneluras; 4. Várias caneluras superficiais ou poucas caneluras profundas; 5. Toda a superfície do ramo coberta por caneluras superficiais ou profundas. A avaliação da infecção pelo CTV foi realizada no Laboratório de Biologia Molecular do Campo Avançado da Embrapa no CETAB/Seagri-BA. As amostras inicialmente foram avaliadas por sorologia, utilizando a técnica de ELISA indireto, com antissoro policlonal contra o CTV. Entretanto, as amostras que apresentaram resultados negativos no teste sorológico, foram também avaliadas por RT-PCR. Para tanto, foi realizada a extração de dsRNA a partir da casca de ramos de cada amostra. A extração de dsRNA foi feita com nitrogênio líquido e o precipitado final foi ressuspendindo em 50ul de água livre de RNAse, tratados com DNAse (Promega®). Na reação de transcrição reversa (RT) foi utilizada a enzima M-MLV (Promega®), de acordo com as recomendações do fabricante. Utilizou-se nessa etapa 5ul do dsRNA obtido, primer randômico (250ng/ul), dNTP (10mM), tampão M-MLV, RNase out e M- MLV, totalizando um volume de 25ul. Para PCR, utilizou-se 3ul do DNA obtido na RT, dNTP (2,5mM), tampão Tris/KCl (10x), MgCl2 (50mM), Taq polimerase (5U/ul) e os primers específicos para o CTV F- CN119 (5’ AGATCTACCATGGACGACGAAACAAAG3’) e R-CN120 (5’ GAATTCGCGGCCGCTCAACGTGTGTTAAATTTCC 3’), para um volume final de 25ul. O ciclo de reação adotado foi de 94°C/2min, 55°C/30seg e 72°C/1min, respectivamente. A maioria dos híbridos avaliados foi suscetível ao CTV, mas não desenvolveram os sintomas de canelura, sendo considerados tolerantes ao patógeno. Significado e impacto do trabalho: Apesar de atualmente controlada, a tristeza dos citros constitui ainda uma ameaça aos produtores de citros, já que é endêmica no Brasil. Diante desse fato, a avaliação do comportamento de híbridos gerados pelo Programa de Melhoramento Genético de Citros da Embrapa em relação ao CTV, é uma etapa determinante na seleção de novas variedades.
27
Weiler, Roberto Luis, Eduardo Cesar Brugnara, Sergio Francisco Schwarz, Marinês Bastianel, Marcos Antônio Machado, and Maria Teresa Schifino-Wittmann. "Caracterização molecular de uma progênie de tangerineira 'Clementina Fina' e 'Montenegrina'." Ciência Rural 40, no. 7 (July 23, 2010): 1523–29. http://dx.doi.org/10.1590/s0103-84782010005000104.
Texto completoResumen
Os citros apresentam uma taxonomia muito complexa, principalmente com relação ao número de espécies que constituem o gênero Citrus e os gêneros afins. Genótipos classificados como espécies podem ter sido originados por hibridação interespecífica e preservados por meio da embrionia nucelar. O presente trabalho teve como objetivo caracterizar uma população de tangerineiras híbridas oriundas do cruzamento das tangerineiras 'Clementina Fina' (Citrus clementina Hort. ex Tan.), genitor feminino, e 'Montenegrina' (Citrus deliciosa Ten.), genitor masculino, utilizando marcadores do tipo microssatélites (SSR). Com 12 pares de primers, foi possível diferenciar 93 acessos do estudo e agrupar a F1 em indivíduos mais próximos do genitor feminino e do genitor masculino. O PIC (Conteúdo de Informação de Polimorfismo) dos primers variou de 0,27 a 0,65. Toda a progênie do cruzamento entre 'Clementina Fina' e 'Montenegrina' analisada neste estudo é híbrida, e os SSRs foram eficientes para identificar híbridos com maior similaridade genética em relação aos genitores, mostrando a existência de variabilidade genética entre as plantas da população estudada.
28
Richardson, Matthew L., Catherine J. Westbrook, David G. Hall, Ed Stover, Yong Ping Duan, and Richard F. Lee. "Abundance of Citrus Leafminer Larvae on Citrus and Citrus-related Germplasm." HortScience 46, no. 9 (September 2011): 1260–64. http://dx.doi.org/10.21273/hortsci.46.9.1260.
Texto completoResumen
The citrus leafminer, Phyllocnistis citrella Stainton (Lepidoptera: Gracillariidae), is a key pest in most citrus-growing regions worldwide. Adult citrus leafminers oviposit primarily on young elongating flush of Citrus as well as other Rutaceae and some ornamental plants. Larvae feed on the epidermal cell layer of developing leaves and injury to leaves provides a pathway for infection by the bacterium Xanthomonas citri subsp. citri (Hasse), the causal agent of Asiatic citrus canker. In this study, we quantified abundance of citrus leafminer larvae on progeny of 87 seed parent genotypes of Citrus and Citrus relatives (family Rutaceae) in the field in East–central Florida to identify those that have low abundance of leafminers. Progeny from the 87 parent genotypes varied in abundance of the leafminer. Progeny of 15 parent genotypes had a high mean abundance of more than six leafminers per flush shoot. All but one of these genotypes were in the Citrus genus. Progeny of 16 parent genotypes had zero, or nearly zero, leafminers, but none were from the Citrus genus. However, many of these 16 genotypes were from genera closely related to true citrus (subtribe Citrinae) and are sexually compatible with Citrus. Progeny of two parent genotypes in the subfamily Toddalioideae and Glycosmis pentaphylla (Retz.) Corr. also had a low abundance of leafminer. Glycosmis pentaphylla also is a poor host for the Asian citrus psyllid, Diaphorina citri Kuwayama, and has biochemical resistance to the citrus weevil, Diaprepes abbreviatus (L.), so this genotype as well as others identified as poor hosts for the leafminer may prove useful in breeding programs aimed at reducing the abundance of multiple insect pests on citrus.
29
Toffano, Leonardo, Ivan Herman Fischer, Silvia Blumer, and Sérgio Florentino Pascholati. "Potencial do flavedo (epicarpo) de Citrus aurantifolia cv. Tahiti no controle do bolor verde e da antracnose em citros." Summa Phytopathologica 38, no. 1 (March 2012): 61–66. http://dx.doi.org/10.1590/s0100-54052012000100010.
Texto completoResumen
O Brasil é considerado o maior produtor de citros e o maior exportador de suco de laranja. Doenças de pós-colheita representam uma grande perda para a citricultura, sendo que para a exportação de frutos são rígidas as exigências com relação a isenção de resíduos químicos nos mesmos. Patógenos de importância em pós-colheita de citros incluem o Penicillium digitatum, agente causal do bolor-verde e o Colletotrichum gloeosporioides, agente causal da antracnose. Dada a importância econômica que representam estas doenças dos frutos cítricos, tanto em termos de comprometimento da qualidade e dificuldade de controle, a busca de alternativas adicionais que possam viabilizar a capacidade produtiva e garantir a obtenção de frutos com excelentes padrões de qualidade torna-se imprescindível. Portanto, estudou-se os efeitos dos extratos aquosos do flavedo de Citrus aurantifolia var. Tahiti, Lentinula edodes, Agaricus subrufescens (syn. Agaricus brasiliensis), albedo de Citrus sinensis var. Valência e do ácido jasmônico no controle póscolheita do bolor verde e da antracnose e na indução de resistência em frutos de laranjeira Valência (Citrus sinensis). Foi possível observar que o extrato aquoso do flavedo (C. aurantifolia) apresentou efeito inibitório sobre os patógenos, quando tratados em pós-colheita, em função da redução dos sintomas e esporulação. Porém, os extratos de albedo (C. sinensis), L. edodes, A. subrufescens e o ácido jasmônico não apresentaram efeitos sobre P. digitatum e C. gloeosporioides.
30
Sari, Rinti Mutiara, Afifatul A. Achyar, Yuni Ahda, and Dwi Hilda Putri. "Genotyping of Sumatera local variety of citrus using random amplified polymorphism DNA (RAPD) technique." Tropical Genetics 2, no. 2 (December 26, 2022): 56–65. http://dx.doi.org/10.24036/tg.v2i2.29.
Texto completoResumen
Indonesia has local varieties of citrus that are no less than imported citrus, especially in terms of fruit freshness. However, people are more interested in the color of citrus peel so people prefer imported citrus to local citrus, especially in Sumatera. Therefore, it is necessary to carry out efforts to conserve and improve the characteristics of these citrus to improve their quality through plant breeding. This study aims to optimize DNA isolation methods for citrus fruit samples with Chelex-TE and to determine the genetic profile of local Sumatera citrus and imported citrus using the genotyping RAPD. The samples used were several local citrus in Sumatera (Citrus Siam Mountain Omeh, Citrus Madu, Citrus Keprok Maga, Citrus Keprok Brastepu and Citrus Pasaman) and imported Citrus (Citrus Sunkist, Citrus Clemengold, Citrus Murkot and Citrus Wokam). DNA was isolated using the 10% Chelex-TE method which was optimized for several parameters such as grain size, fruit skin and leaves. RAPD was performed using 10 RAPD primers. The results showed that the optimum 10% Chelex Chelex-TE isolation method was a sample size of 1 grain. The amplification of local Sumatran citrus and imported citrus using 10 single primers produced polymorphic bands. The value of jaccard's similarity indicates that the five samples of Sumatera local variety of citrus and imported citrus have high genetic variation. Indonesia has local varieties of citrus that are no less than imported citrus, especially in terms of fruit freshness. However, people are more interested in the color of citrus peel so people prefer imported citrus to local citrus, especially in Sumatera. Therefore, it is necessary to carry out efforts to conserve and improve the characteristics of these citrus to improve their quality through plant breeding. This study aims to optimize DNA isolation methods for citrus fruit samples with Chelex-TE and to determine the genetic profile of local Sumatera citrus and imported citrus using the genotyping RAPD. The samples used were several local citrus in Sumatera (Citrus Siam Mountain Omeh, Citrus Madu, Citrus Keprok Maga, Citrus Keprok Brastepu and Citrus Pasaman) and imported Citrus (Citrus Sunkist, Citrus Clemengold, Citrus Murkot and Citrus Wokam). DNA was isolated using the 10% Chelex-TE method which was optimized for several parameters such as grain size, fruit skin and leaves. RAPD was performed using 10 RAPD primers. The results showed that the optimum 10% Chelex Chelex-TE isolation method was a sample size of 1 grain. The amplification of local Sumatran citrus and imported citrus using 10 single primers produced polymorphic bands. The value of jaccard's similarity indicates that the five samples of Sumatera local variety of citrus and imported citrus have high genetic variation.
31
Batool, Faiza. "Structural Characterization, Antioxidant, Antidiabetic and Antimicrobial Activities of Citrus Limettarisso, Citrus Nobilis X Citrus Deliciosa and Citrus Maxima." Journal of Health and Rehabilitation Research 3, no. 2 (December 15, 2023): 607–11. http://dx.doi.org/10.61919/jhrr.v3i2.187.
Texto completoResumen
Background: The pharmacological properties of citrus fruits have long been recognized in traditional medicine, with recent scientific studies corroborating their potential as sources of natural bioactive compounds. Citrus limettarisso, Citrus nobilis x Citrus deliciosa, and Citrus maxima, in particular, have garnered attention for their antioxidant, antidiabetic, and antimicrobial properties. Prior research has highlighted these species' capabilities, with various studies reporting on their significant health benefits. Objective: This study aims to evaluate and compare the antioxidant, antidiabetic, and antimicrobial activities of essential oils extracted from the peels of Citrus limettarisso, Citrus nobilis x Citrus deliciosa, and Citrus maxima, thereby contributing to the understanding of their potential therapeutic applications. Methods: Essential oils were extracted from the peels of the three citrus species using hydro distillation. The antioxidant activity was assessed through Total Phenolic Content (TPC), Total Flavonoid Content (TFC), and DPPH Radical Scavenging Assay. Antiglycation potential and alpha-amylase inhibition were evaluated for antidiabetic properties, while antimicrobial activity was determined using the Agar Well Diffusion Method. Results: Citrus limettarisso showed the highest TPC (301.4474 ± 2.930402 mg GAE/100g) and significant antioxidant activity (68.26347% DPPH scavenging). Citrus maxima exhibited a high TFC (143.8727 ± 5.454545 mg CE/100g) but lower TPC (115.8333 ± 3.553444 mg GAE/100g). Citrus nobilis x Citrus deliciosa demonstrated considerable TPC (244.1667 ± 5.862774 mg GAE/100g) and TFC (50.17576 ± 0.457566 mg CE/100g). Antiglycation and alpha-amylase inhibition assays revealed Citrus limettarisso as the most potent antidiabetic agent with the highest inhibition percentages. All three species showed significant antimicrobial activity. Conclusion: The study confirms the substantial pharmacological potential of Citrus limettarisso, Citrus nobilis x Citrus deliciosa, and Citrus maxima, particularly in terms of their antioxidant and antidiabetic properties. Citrus limettarisso emerged as the most potent in most assays, underscoring its potential for therapeutic use. These findings support the use of these citrus species as natural sources of bioactive compounds for health and medical applications. It carries special importance for public health advancements.
32
Castro, P. R. C., A. C. Pacheco, and C. L. Medina. "EFEITOS DE STIMULATE E DE MICRO-CITROS NO DESENVOLVIMENTO VEGETATIVO E NA PRODUTIVIDADE DA LARANJEIRA `PÊRA' (Citrus sinensis L. Osbeck)." Scientia Agricola 55, no. 2 (May 1998): 338–41. http://dx.doi.org/10.1590/s0103-90161998000200026.
Texto completoResumen
Estudou-se o efeito de aplicações do estimulante vegetal Stimulate e do fertilizante foliar Micro-Citrus no número de ramos, comprimento dos ramos, número e caracterização de frutos na colheita da laranjeira `Pêra' (Citrus sinensis L. Osbeck) sobre limoeiro `Cravo'. O experimento foi realizado em condições de campo, num Latossolo Vermelho-Escuro Álico, em Holambra (S.P.), sendo que em 13/02, 22/04 e 17/06/96 foram efetuadas pulverizações com Stimulate (1 L.ha-1, 2L. ha-1 e 4L. ha-1), Stimulate 2L. ha-1 + Micro-Citros e Micro-Citros, além do controle. Realizaram-se seis tratamentos distribuídos em dez árvores inteiramente casualizadas em um pomar uniforme com seis anos de idade. Foram demarcadas quatro ramificações em diagonal, nas quais efetuaram-se determinações biométricas em 22/04 e 23/09/96. Observou-se que Stimulate (1 L. ha-1) aumentou o número de ramos 69 dias após a primeira aplicação, além de incrementar o peso médio dos frutos por árvore, em relação ao controle, na colheita.
33
Souza, Jorge Ferreira de, Silvana Aparecida da Silva Souza, Elen de Lima Aguiar - Menezes, Fernando Antônio Abrantes Ferrara, Stenilson Araújo Nascimento, William Costa Rodrigues, and Paulo César Rodrigues Cassino. "Diversidade de moscas-das-frutas em pomares de citros no município de Araruama, RJ." Ciência Rural 38, no. 2 (April 2008): 518–21. http://dx.doi.org/10.1590/s0103-84782008000200035.
Texto completoResumen
O objetivo deste estudo foi determinar as espécies de Tephritidae e Lonchaeidae (Diptera: Tephritoidea) de ocorrência em pomares de laranja doce (Citrus sinensis Osbeck) e tangerina (Citrus reticulata Blanco), no município de Araruama, RJ, durante o período de dezembro de 2002 a novembro de 2003. Os espécimes foram coletados em armadilhas McPhail contendo solução aquosa de proteína hidrolisada a 5% e em amostras de frutos de seis variedades de citros. Nas armadilhas, o total de 2.543 adultos de Tephritoidea (1.430 fêmeas e 1.023 machos) foi capturado, sendo dez espécies de Tephritidae, quatro espécies e dois morfotipos de Lonchaeidae. Dos Tephritidae e capturados nas McPhail, quatro espécies (Anastrepha fraterculus, A. obliqua, A. sororcula e Ceratitis capitata) infestaram frutos cítricos, enquanto que, dos Lonchaeidae, somente os morfotipos não infestaram as amostras de citros. Os resultados demonstram que a densidade populacional das moscas-das-frutas pode ser superestimada, quando baseada no número de moscas por armadilha, devido à captura de espécies que não infestam os frutos de interesse comercial.
34
Santos, J. P. dos, F. K. Dal Soglio, and L. R. Redaelli. "PLANTAS HOSPEDEIRAS DE DÍPTEROS MINADORES EM POMAR DE CITROS EM MONTENEGRO, RS." Arquivos do Instituto Biológico 73, no. 2 (June 2006): 235–41. http://dx.doi.org/10.1590/1808-1657v73p2352006.
Texto completoResumen
RESUMO Este trabalho teve como objetivo verificar a associação do "minador-das-folhas-dos-citros", Phyllocnistis citrella Stainton, 1856 (Lepidoptera: Gracillariidae), com outras plantas hospedeiras, presentes em pomar de citros, a fim de esclarecer aspectos da sua sobrevivência fora dos fluxos de brotação de Citrus spp. e fazer um levantamento de insetos minadores que habitam o pomar. O trabalho foi conduzido em Montenegro, RS, em um pomar orgânico de tangoreiro Murcott. Realizaram-se amostragens quinzenais, de maio de 2003 a maio de 2004, coletando-se em cada ocasião, todas as folhas com minas, contidas na área delimitada por um aro de 0,28 m2, que era jogado nas linhas e nas entrelinhas de 30 árvores sorteadas. Durante o estudo, não foi registrada a presença de P. citrella nas plantas espontâneas do pomar, comprovando-se a sua preferência por espécies de Citrus. Entretanto, registraram-se 15 espécies de dípteros minadores e 15 espécies de plantas hospedeiras, distribuídas em três famílias.
35
Yang, Jiyoon, and Mi-Jin Park. "Antioxidant Effects of Essential Oils from the Peels of Citrus Cultivars." Molecules 30, no. 4 (February 11, 2025): 833. https://doi.org/10.3390/molecules30040833.
Texto completoResumen
Essential oils from citrus cultivars are widely used in food, cosmetic, and pharmaceutical industries, and they have been extensively studied in the last decades. This study investigates the antioxidant activities of essential oils from 21 citrus cultivars and the active antioxidant constituents of the oils. Essential oils are extracted from the peels of citrus cultivars via hydrodistillation, and their chemical compositions are analyzed by gas-chromatography–mass-spectroscopy. The antioxidant activities of the citrus cultivars are determined using 2,2-diphenyl-1-picrylhydrazyl (DPPH), 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid (ABTS), and ferric-reducing antioxidant potential (FRAP) assays. Based on the results, the major constituent of the oils is d-limonene (50.88–97.19%). The essential oil from Citrus junos shows the highest phenolic content (360.04 ± 24.75 mg GAE/100 g), followed by that from Citrus × latifolia (339.42 ± 31.14 mg GAE/100 g), [(Citrus unshiu × Citrus sinensis) × Citrus reticulata] × Citrus reticulata (327.05 ± 14.29 mg GAE/100 g), and [(Citrus unshiu × Citrus sinensis) × Citrus reticulata] × Citrus reticulata (322.92 ± 21.43 mg GAE/100 g). The essential oil from [(Citrus unshiu × Citrus sinensis) × Citrus reticulata] × Citrus reticulata shows the highest DPPH and ABTS radical scavenging activity, with an EC50 of 86.17 ± 4.87 and 0.16 ± 0.06 mg/mL, respectively. The essential oil from Citrus reticulata and [(Citrus unshiu × Citrus sinensis) × Citrus reticulata] × Citrus reticulata shows the highest ferric-reducing activities (2302.55 ± 237.26 and 2213.12 ± 35.54 mg/100 g, respectively). These results indicate that the essential oil from [(Citrus unshiu × Citrus sinensis) × Citrus reticulata] × Citrus reticulata has a higher antioxidation effect than that from other cultivars. By comparing the chemical compositions of the essential oils, 12 compounds are selected as the major contributors to the antioxidant activities of the oils, and α-phellandrene and α-terpinene are the most active constituents of the oils.
36
Spósito, Marcel B., Renato B. Bassanezi, and Lilian Amorim. "Resistência à mancha preta dos citros avaliada por curvas de progresso da doença." Fitopatologia Brasileira 29, no. 5 (October 2004): 532–37. http://dx.doi.org/10.1590/s0100-41582004000500010.
Texto completoResumen
A mancha preta dos citros (Citrus spp.), causada por Guignardia citricarpa, vem causando sérios prejuízos à citricultura paulista. O parque citrícola está alicerçado em praticamente quatro variedades de copa de laranja doce (Citrus sinensis): 'Hamlin', 'Pera', 'Valência' e 'Natal'. A literatura cita as variedades tardias ('Valência' e 'Natal') como as mais suscetíveis, em razão da elevada severidade da doença nos frutos dessas variedades por ocasião da colheita, mas não há informações sobre o progresso temporal da doença no campo. A resistência das variedades 'Hamlin' (precoce), 'Pera' (meia estação) e 'Valência' (tardia) à mancha preta dos citros foi avaliada em pomar comercial, sob infecção natural. Avaliaram-se a severidade e a incidência da doença em 100 frutos de 100 plantas de cada variedade, a cada 15 dias, desde a primeira observação dos sintomas no campo até o momento da colheita. O modelo monomolecular foi ajustado às curvas de progresso da incidência e da severidade da doença para as três variedades. As três variedades apresentaram a mesma taxa de progresso da doença (r). Concluiu-se que as variedades 'Hamlin', 'Pera' e 'Valência' possuem o mesmo nível de suscetibilidade à mancha preta dos citros.
37
Burrow, Jamie D., and Ariel Singerman. "Children's Citrus Activity: Citrus Counting." EDIS 2019, no. 4 (July 22, 2019): 1. http://dx.doi.org/10.32473/edis-4h402-2019.
Texto completoResumen
Florida is well known for its citrus industry, valued at over eight billion dollars, and is one of the top citrus-producing states in the United States. This new one-page children’s activity sheet about Florida citrus includes an activity for students learning to count and match. Written by Jamie D. Burrow and Ariel Singerman and published by the UF/IFAS Extension 4-H Youth Development Program. https://edis.ifas.ufl.edu/4h402
38
Kumari, Sony, Rabbul Ibne A. Ahad, Mobina Ahmed, Dhanapriya Moirangthem, and Drishtirupa Phukan. "Effect of Cooking Temperature on Biochemical Characteristics, Antioxidant Activity and Antimicrobial Potential of Seed Extracts of Assam, India." Biosciences, Biotechnology Research Asia 16, no. 2 (May 24, 2019): 451–62. http://dx.doi.org/10.13005/bbra/2760.
Texto completoResumen
The present study investigated the effects of cooking temperature on the biochemical characteristics, antioxidant and antimicrobial activity of three different seeds of Citrus fruits (Citrus limon, Citrus limetta, Citrus maxima and Citrus aurantifolia) collected from Assam, India. Total soluble sugar (72 mg/mL) were highest in Citrus maxima hydro 2-propanol seed extract before heating and 50 mg/mL in Citrus limon hydro-methanol, Citrus limetta hydro-methanol and Citrus maxima hydro-methanol seed extract after heating. Total soluble proteins before and after heating were highest 82 mg/mL and 88 mg/mL in Citrus limon 2 propanol seed extract. Free amino acid contents before and after heating were highest (62 µg/mL in Citrus limon hydro-propanol) and (40 µg/mL in Citrus limon hydro-methanol) and free fatty acids were 29.2 µg/mL and 23 µg/mL in Citrus maxima methanol extract, respectively. H2O2 scavenging activity before and after heating were highest in Citrus aurantifolia propanol (59%) and in Citrus limon (67%), respectively. Total antioxidant capacity was found highest in Citrus maxima hydro propanol (92.5%) before heating and in Citrus aurantifolia 2-propanol (65%) after heating. Antimicrobial activity of the seed extracts was studied on B. subtilis, E. coli and P. aeruginosa and minimum inhibitory concentration of the four Citrus fruits was determined. MIC of the different seed extracts was observed for 100% (v/v), 75% (v/v), 50% (v/v) and 25% (v/v) against three test microbes viz. Bacillus subtilis, Pseudomonas aeruginosa and Escherichia coli. For Bacillus subtilis, the MIC was found to be at 100%, 100%, 75%, and 75% to the extract of Citrus aurantifolia hydro 2-propanol, Citrus limon methanol, Citrus limetta hydro 2 propanol and Citrus maxima hydro 2-propanol, respectively. For E. coli, the MIC was found to be at 100%, 75%, 100% and 100% for Citrus aurantifolia hydro 2-propanol, Citrus limon hydro 2-propanol, Citrus maxima hydro 2-propanol and Citrus limetta hydro 2 propanol, respectively. For Pseudomonas aeruginosa, the MIC was found to be at 100%, 100%, 75% and 50% for Citrus aurantifolia methanol, Citrus limon methanol, Citrus maxima hydro 2-propanol and Citrus limetta hydro 2 propanol, respectively.
39
Ashok, Kumar Sharma, Sharma Mukesh, Lal Soni Shankar, Singh Charanjeet, Agarwal Dilip, and Mal Yadav Sanwar. "COMPARATIVE PHYTOCHEMICAL AND PHARMACOLOGICAL ACTIVITIES OF TRADITIONALLY USED CITRUS SPECIES: CITRUS LIMON, CITRUS AURANTIUM, CITRUS MEDICA." International Journal of Current Pharmaceutical Review and Research 14, no. 03 (December 30, 2022): 73–78. https://doi.org/10.5281/zenodo.12658665.
Texto completoResumen
Plants are very rich and important source of various therapeutic compounds which aretremendiously using in pharmaceutical industry. Several studies confirmed that the presenceof phytochemicals contribute medicinal as well as physiological properties to the plants.Citrus fruits, which belong to Rutaceae Family, accumulate a great variety of phytochemicalsincluding low molecular phenolics, acetophenones, terpenoids, flavanoids, stilbenes andtannins. Citrus Limon, Citrus Aurantium, Citrus Medica possess antimicrobial, antibacterialand antioxidant properties or agents which boost up the individuals immune system. Thetraditional medicine practice is recommended strongly for citrus plants/ fruits and it issuggested that further work should be carried out to isolate the various active constituentsresponsible for therapeutic activity of such plants which belongs to Rutaceae family. In thepresent review, various materials and methodologies are studied and comparative analysis ofphytochemicals and phytoconstituents such as alkaloids, carbohydrates, flavoinds, tannins,proteins etc. are screened of Citrus Limon, Citrus Aurantium, Citrus medica.
40
Baraiya, Khodidash, Virendra Kumar Yadav, Nisha Choudhary, Daoud Ali, Daya Raiyani, Vibhakar A. Chowdhary, Sheena Alooparampil, et al. "A Comparative Analysis of the Physico-Chemical Properties of Pectin Isolated from the Peels of Seven Different Citrus Fruits." Gels 9, no. 11 (November 16, 2023): 908. http://dx.doi.org/10.3390/gels9110908.
Texto completoResumen
In the present research work, pectin was isolated from the peels of seven citrus fruits (Citrus limon, Citrus limetta, Citrus sinensis, Citrus maxima, Citrus jambhiri, Citrus sudachi, and Citrus hystrix) for a comparison of its physicochemical parameters and its potential use as a thickening agent, gelling agent, and food ingredient in food industries. Among the seven citrus fruits, the maximum yield of pectin was observed from Citrus sudachi, and the minimum yield of pectin was observed from Citrus maxima. The quality of each pectin sample was compared by using parameters such as equivalent weight, anhydrouronic acid (AUA) content, methoxy content, and degree of esterification. It was observed that all seven pectin samples had a high value of equivalent weight (more than 1000), suggesting that all the pectin samples had a high content of non-esterified galacturonic acid in the molecular chains, which provides viscosity and water binding properties. The methoxy content and degree of esterification of all the pectins was lower than 50%, which suggests that it cannot easily disperse in water and can form gel only in presence of divalent cations. The AUA content of all isolated pectins samples was above 65%, which suggests that the pectin was pure and can be utilized as a food ingredient in domestic foods and food industries. From the FTIR analysis of pectin, it was observed that the bond pattern of Citrus maxima, Citrus jambhiri, and Citrus hystrix was similar. The bond pattern of Citrus limon, Citrus limetta, and Citrus sinensis was similar. However, the bond pattern of Citrus sudachi was different from that of all other citrus fruits. The difference in the bond pattern was due to the hydrophobic nature of pectin purified from Citrus limon, Citrus limetta, Citrus sudachi, and Citrus sinensis and the hydrophilic nature of pectin purified from Citrus maxima, Citrus jambhiri, and Citrus hystrix. Hence, hydrophobic pectin can be utilized in the preparation of hydrogels, nanofibers, food packaging material, polysoaps, drug delivery agents, and microparticulate materials, whereas hydrophilic pectin can be utilized for the preparation of gelling and thickening agents.
41
Okunlola, Banke Mary, Udeme Joshua Josiah Ijah, Jonathan Yisa, and Olabisi Peter Abioye. "Phytochemicals and phyto-disinfectant properties of citrus species (Citrus limon, Citrus aurantifolia and Citrus sinensis) for pond water purification." GSC Biological and Pharmaceutical Sciences 8, no. 2 (August 30, 2019): 034–44. https://doi.org/10.5281/zenodo.4284575.
Texto completoResumen
The health concern associated with the use of chemical disinfectant in water purification has necessitated the search of safe and effective water treatment agents from natural sources. The leaf, stem, seed and bark of <em>Citrus limon</em>, <em>Citrus aurantifolia</em> and <em>Citrus sinensis</em> were investigated for phytochemicals and disinfectant properties on contaminated pond water at concentrations of 0.1, 0.2, 0.3, 0.4 and 0.5 g/L. Microbial quality of the water sample was investigated at 12 hrs interval. The leaf and bark of C. <em>aurantifolia</em> and the bark of <em>C. limon</em> contains all the phytochemicals tested. Steroids and alkaloids were present in all parts of the plant. Cardiac glycosides and terpenes were present in all parts of Citrus <em>sinensis</em>. A total of 10 different bacteria isolates were identified from ponds water sample. The stem of <em>Citrus aurantifolia</em> completely eliminated the total viable count, total coliform count, fecal coliform count after 12 h. The leaf, bark and seed of C. <em>aurantifolia</em> at 0.3, 0.4 and 0.5 g/L, leaf and bark of <em>C. limon</em> and <em>C. sinensis</em> at 0.1-0.5 g/L eliminated the various bacteria after 24 hours. However, the stem and seed of <em>C. limon</em> were less active; only concentrations of 0.4 and 0.5g/L eliminated the organism after 24 h of treatment. The plant materials had minimum inhibitory concentration in the ranged of 16 and 128 mg/g and minimum bactericidal concentrations in the ranged 16 and 256 mg/g against all the isolates. It is concluded that the leaf, stem bark and seed of citrus species contains various phytochemicals and have the potentials to serve as a disinfectant for water treatment.
42
Yang, Jiyoon, Su-Yeon Lee, Soo-Kyeong Jang, Ki-Joong Kim, and Mi-Jin Park. "Inhibition of Melanogenesis by Essential Oils from the Citrus Cultivars Peels." International Journal of Molecular Sciences 24, no. 4 (February 20, 2023): 4207. http://dx.doi.org/10.3390/ijms24044207.
Texto completoResumen
Citrus is one of the most popular and widely grown fruit crops in the world. However, the bioactivity of only certain species of citrus cultivars is studied. In this study, the effects of essential oils from 21 citrus cultivars on melanogenesis were investigated in an effort to identify active anti-melanogenesis constituents. The essential oils from the peels of 21 citrus cultivars obtained by hydro-distillation were analyzed using gas chromatography–mass spectrometry. Mouse melanoma B16BL6 cells were used in all assays conducted in this study. The tyrosinase activity and melanin content were determined using the lysate of α-Melanocyte-stimulated B16BL6 cells. In addition, the melanogenic gene expression was determined by quantitative reverse transcription-polymerase chain reaction. Overall, the essential oils of (Citrus unshiu X Citrus sinensis) X Citrus reticulata, Citrus reticulata, and ((Citrus unshiu X Citrus sinensis) X Citrus reticulata) X Citrus reticulata provided the best bioactivity and comprised five distinct constituents compared to other essential oils such as limonene, farnesene, β-elemene, terpinen-4-ol, and sabinene. The anti-melanogenesis activities of the five individual compounds were evaluated. Among the five essential oils, β-elemene, farnesene, and limonene showed dominating properties. The experimental results indicated that (Citrus unshiu X Citrus sinensis) X Citrus reticulata, Citrus reticulata, and ((Citrus unshiu X Citrus sinensis) X Citrus reticulata) X Citrus reticulara are potential candidates with anti-melanogenesis activity for use as cosmetics and pharmaceutical agents against skin hyperpigmentation.
43
Mueller, Tobias G., Hanna M. Kahl, Bodil N. Cass, Elizabeth E. Grafton-Cardwell, and Jay A. Rosenheim. "Differential Impacts of Citrus Thrips Across Sweet Orange and Mandarin Species." Journal of Economic Entomology 112, no. 6 (July 1, 2019): 2767–73. http://dx.doi.org/10.1093/jee/toz178.
Texto completoResumen
Abstract Several domesticated Citrus species are grown as major commercial crops in California. Despite this, farmers currently use a single set of management practices, originally created for sweet oranges (Citrus sinensis (L.) Osbeck [Sapindales: Rutaceae]), for both sweet oranges and all mandarin species. Mandarins, primarily Citrus reticulata Blanco, Citrus clementina hort. ex Tanaka, and Citrus unshiu Marcovitch, comprise almost 25% of California citrus acreage, and little work has been done to assess host–pest interactions for these species. Citrus thrips (Scirtothripscitri Moulton [Thysanoptera: Thripidae]) are one of the main pests in California citrus and are major targets for early spring, “petal fall” insecticide applications. We used mixed species citrus blocks to test the influence of Citrus species, including C. sinensis, C. reticulata, C. clementina, and C. unshiu, on 1) citrus thrips densities following petal fall; 2) citrus thrips-induced scarring on both the calyx and stylar ends of fruit; and 3) fruit deformation. Citrus sinensis and C. unshiu had relatively high citrus thrips densities and scarring levels, whereas C. reticulata had lower densities of citrus thrips and scarring levels. The age structure of citrus thrips populations also varied across Citrus species. Fruit deformity associated with citrus thrips scarring was found on all Citrus species examined. Scarring on the stylar-end of fruit, a previously largely ignored location of citrus thrips scarring, was found to be common in C. reticulata. It is clear from our work that species-specific management guidelines for citrus thrips are needed in sweet oranges and mandarins.
44
ul Rehman, Muhammad Shah Nawaz. "First report of Xanthomonas citri Subsp. Citri causing citrus canker on grape fruit (Citrus paradisi), washington naval (Citrus sinensis), kaghzi limon (Citrus aurantifolia Swingle), lemon (Citrus lim." Pakistan Journal of Agricultural Sciences 58, no. 04 (September 1, 2021): 1373–77. http://dx.doi.org/10.21162/pakjas/21.9701.
Texto completoResumen
Citrus fruit production is largely affected by different bacterial and fungal pathogens. In Pakistan bacterial diseases like citrus bacterial canker (CBC) pose severe risk to citrus economy. Diagnoses of such diseases could be helpful to avoid the epidemics in nurseries or orchids. In 2011-12, citrus canker symptoms i.e., callus-like outgrowths on leaves and fruits of grape fruit (Citrus paradisi), Washington naval (Citrus sinensis), Kaghzi Limon (Citrus aurantifolia swingle), lemon (Citrus Limon) and pomelo (Citrus maxima) were noticed in Sargodha district of Punjab, Pakistan. Bacteria i.e., yellow mucoid, Xanthomonas- like isolates, were isolated from these lesions. Bacteria isolated from these lesions were cultured and total DNA was isolated. A diagnostic fragment of 581 bp based on rpf genes of Xanthomonas citri pv. citri was amplified, cloned and completely sequenced. BLAST and evolutionary analysis revealed that these isolates show 100% sequence similarity and group with Xanthomonas citri subsp. citri from Argentina (CP023285) and Reunion (CP018858), (CP018854). To our knowledge, this is the first formal report of X. campestris pv. citri pathotypes A on Citrus paradise, Citrus sinensis, Citrus maxima, Citrus Limon and Citrus aurantifolia swingle in Pakistan
45
Corazza-Nunes, Maria Júlia, Marcos Antonio Machado, Dagmar Ruth Stach-Machado, William Mário Carvalho Nunes, Sérgio Alves de Carvalho, and Gerd Walter Müller. "Characterization of Citrus tristeza virus isolates from grapefruit (Citrus paradisi Macf.) accessions of Citrus Active Germplasm Bank." Summa Phytopathologica 32, no. 4 (September 2006): 322–27. http://dx.doi.org/10.1590/s0100-54052006000400002.
Texto completoResumen
Citrus tristeza virus (CTV) isolates from 35 grapefruit accessions belonging to Citrus Active Germplasm Bank of the "Instituto Agronômico de Campinas" located at the "Centro APTA Citros Sylvio Moreira", Cordeirópolis, São Paulo state, Brazil, were characterized and evaluated through symptoms in the trees, biological indexing, immunological diagnosis with different monoclonal antibodies and SSCP analysis (single-strand conformation polymorphism) of the coat protein gene. Symptomatology indicated that, in general, the group of plants with smaller canopy volume and severe stem pitting differed significantly from the group that presented greater vegetative development and mild to moderate stem pitting. However, the isolates from most of the accessions induced mild reaction on Mexican lime. The serological evaluation through the DAS-ELISA using monoclonal antibodies did not reveal any association between virus titer in the plant tissue and symptoms. The reaction with different monoclonal antibodies and the distinct electrophoresis patterns obtained through SSCP showed that there is a high degree of diversity among the isolates that infect these grapefruit accessions. High complexity within the same isolate was also observed in the SSCP profiles. This finding indicates that the CTV isolates from these plants are a complex mixture of CTV haplotypes. Similar SSCP banding patterns were observed among some plants with strong stem pitting symptoms, and among some plants with weak or moderate stem pitting symptoms.
46
Yu, Xiaoyue, Cheryl M. Armstrong, Mingguo Zhou, and Yongping Duan. "Bismerthiazol Inhibits Xanthomonas citri subsp. citri Growth and Induces Differential Expression of Citrus Defense-Related Genes." Phytopathology® 106, no. 7 (July 2016): 693–701. http://dx.doi.org/10.1094/phyto-12-15-0328-r.
Texto completoResumen
Citrus canker, caused by Xanthomonas citri ssp. citri, is a serious disease that causes substantial economic losses to the citrus industry worldwide. The bactericide bismerthiazol has been used to control rice bacterial blight (X. oryzae pv. oryzae). In this paper, we demonstrate that bismerthiazol can effectively control citrus canker by both inhibiting the growth of X. citri ssp. citri and triggering the plant’s host defense response through the expression of several pathogenesis-related genes (PR1, PR2, CHI, and RpRd1) and the nonexpresser of PR genes (NPR1, NPR2, and NPR3) in ‘Duncan’ grapefruit, especially at early treatment times. In addition, we found that bismerthiazol induced the expression of the marker genes CitCHS and CitCHI in the flavonoid pathway and the PAL1 (phenylalanine ammonia lyase 1) gene in the salicylic acid (SA) biosynthesis pathway at different time points. Moreover, bismerthiazol also induced the expression of the priming defense-associated gene AZI1. Taken together, these results indicate that the induction of the defense response in ‘Duncan’ grapefruit by bismerthiazol may involve the SA signaling pathway and the priming defense and that bismerthiazol may serve as an alternative to copper bactericides for the control of citrus canker.
47
Ozaki, Yoshihiko, Masaki Miyake, Hisao Maeda, Yasushi Ifuku, Raymond D. Bennett, Zareb Herman, Chi H. Fong, and Shin Hasegawa. "Ichangensin glucoside in Citrus junos, Citrus sudachi and Citrus sphaerocarpa." Phytochemistry 30, no. 8 (January 1991): 2659–61. http://dx.doi.org/10.1016/0031-9422(91)85118-j.
Texto completo
48
Rani, Shikha, and Naresh Singh Gill. "A Phytopharmacological Review on a Medicinal Plant: Citrus Medica L. (Citron)." International Journal of Science and Research (IJSR) 10, no. 9 (September 27, 2021): 1285–89. https://doi.org/10.21275/sr21919165014.
Texto completo
49
PRO, Edogbanya, Suleiman MO, Olorunmola JB, and Oijagbe IJ. "Comparative study on the antimicrobial effects of essential oils from peels of three citrus fruits." MOJ Biology and Medicine 4, no. 2 (2019): 49–54. http://dx.doi.org/10.15406/mojbm.2019.04.00113.
Texto completoResumen
The use of Essential Oils as antimicrobial agents have become popular over the years in an attempt to find alternative ways of dealing with strains of bacteria that have become resistant to conventional antibiotics. This study was carried out to compare the antimicrobial effects of Citrus peel essential oils obtained from Okene Main Market, 7'33'4.39'' N 6'14'9.20'' E, Kogi State, Nigeria, on the clinical isolates of some microorganisms (Escherichia coli, Pseudesomonas aeruginosa, Staphylococcus aureus, and Aspergillus niger). The oils were extracted from the peels using the cold maceration method with n-hexane as the solvent. The agar diffusion method was used to test the susceptibility of the micro-organism strains using ciprofloxacin as the standard positive control. The experiment was carried out in duplicates and obtained data was analysed using one-way analysis of variance (ANOVA) and Duncan Multiple Range Test (DMRT), with P<0.05 considered significant. The results revealed that Orange (Citrus sinensis) exhibited the inhibitoriest effect on the test isolates followed by lime (Citus aurantifolia) and Lemon (Citrus Limon) with the least significant effect.
50
Tazima, Zuleide Hissano, Pedro Antonio Martins Auler, Carmen Silvia Vieira Janeiro Neves, Inês Fumiko Ubukata Yada, and Rui Pereira Leite Junior. "Comportamento de clones de laranja 'Valência' na região norte do Paraná." Revista Brasileira de Fruticultura 30, no. 4 (December 2008): 970–74. http://dx.doi.org/10.1590/s0100-29452008000400022.
Texto completoResumen
Este trabalho teve como objetivo avaliar os clones de laranjas-doces [Citrus sinensis (L.) Osbeck] 'Valência', acesso I-93; 'Valência 718', acesso I-94, e 'Valência Late 1138', acesso I-105, enxertados sobre o limão 'Cravo' (Citrus limonia Osbeck), em relação à produção e às características físico-químicas dos frutos (acidez, sólidos solúveis totais, 'ratio', rendimento em suco, índice tecnológico e massa). As plantas estudadas fazem parte do Banco Ativo de Germoplasma de Citros (BAG-Citros) do Instituto Agronômico do Paraná - IAPAR, em Londrina. Foram utilizadas três plantas por clone, em espaçamento de 7,0 m x 6,0 m (238 plantas/hectare), conduzidas sem irrigação. As produções acumuladas das laranjas 'Valência' e 'Valência Late 1138', durante nove safras (1985 a 1994), foram significativamente superiores à da 'Valência 718'. Todos os clones apresentaram características aceitáveis de frutos, em relação à acidez, sólidos solúveis totais, 'ratio', rendimento em suco e massa do fruto, exceto para o índice tecnológico, que foi inferior na 'Valência Late 1138', não sendo observadas diferenças significativas durante o período avaliado (1986 a 1997).