Artículos de revistas: "Cisplatin analogues"

1

Fram, Robert j. "Cisplatin and platinum analogues". Current Opinion in Oncology 4, n.º 6 (diciembre de 1992): 1073–79. http://dx.doi.org/10.1097/00001622-199212000-00012.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

2

Weiss, Raymond B. y Michaele C. Christian. "New Cisplatin Analogues in Development". Drugs 46, n.º 3 (septiembre de 1993): 360–77. http://dx.doi.org/10.2165/00003495-199346030-00003.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

3

&NA;. "New cisplatin analogues attempt to supersede cisplatin and carboplatin". Drugs & Therapy Perspectives 3, n.º 1 (enero de 1994): 7–8. http://dx.doi.org/10.2165/00042310-199403010-00003.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

4

Bednarska-Szczepaniak, Katarzyna, Damian Krzyżanowski, Magdalena Klink y Marek Nowak. "Adenosine Analogues as Opposite Modulators of the Cisplatin Resistance of Ovarian Cancer Cells". Anti-Cancer Agents in Medicinal Chemistry 19, n.º 4 (25 de junio de 2019): 473–86. http://dx.doi.org/10.2174/1871520619666190118113201.

Texto completo

Resumen

Background: Adenosine released by cancer cells in high amounts in the tumour microenvironment is one of the main immunosuppressive agents responsible for the escape of cancer cells from immunological control. Blocking adenosine receptors with adenosine analogues and restoring immune cell activity is one of the methods considered to increase the effectiveness of anticancer therapy. However, their direct effects on cancer cell biology remain unclear. Here, we determined the effect of adenosine analogues on the response of cisplatinsensitive and cisplatin-resistant ovarian cancer cells to cisplatin treatment. Methods: The effects of PSB 36, DPCPX, SCH58261, ZM 241385, PSB603 and PSB 36 on cisplatin cytotoxicity were determined against A2780 and A2780cis cell lines. Quantification of the synergism/ antagonism of the compounds cytotoxicity was performed and their effects on the cell cycle, apoptosis/necrosis events and cisplatin incorporation in cancer cells were determined. Results: PSB 36, an A1 receptor antagonist, sensitized cisplatin-resistant ovarian cancer cells to cisplatin from low to high micromolar concentrations. In contrast to PSB 36, the A2AR antagonist ZM 241385 had the opposite effect and reduced the influence of cisplatin on cancer cells, increasing their resistance to cisplatin cytotoxicity, decreasing cisplatin uptake, inhibiting cisplatin-induced cell cycle arrest, and partly restoring mitochondrial and plasma membrane potentials that were disturbed by cisplatin. Conclusion: Adenosine analogues can modulate considerable sensitivity to cisplatin of ovarian cancer cells resistant to cisplatin. The possible direct beneficial or adverse effects of adenosine analogues on cancer cell biology should be considered in the context of supportive chemotherapy for ovarian cancer.

Los estilos APA, Harvard, Vancouver, ISO, etc.

5

Aggarwal, S. K. "A histochemical approach to the mechanism of action of cisplatin and its analogues." Journal of Histochemistry & Cytochemistry 41, n.º 7 (julio de 1993): 1053–73. http://dx.doi.org/10.1177/41.7.8515048.

Texto completo

Resumen

The effects of cisplatin (CDDP), a potent anti-cancer agent, and its various analogues were analyzed for any biochemical changes involving Ca2+ and lysosomal and membrane-associated transport enzymes in rat kidney, liver, serum, urine, tissue homogenates, and isolated mitochondria. Correlation was made with any morphological changes observed by light and electron microscopy to gain an insight into the mechanism of action of various platinum coordination complexes. CDDP in its hydrolyzed state under conditions of low chloride ion concentrations causes uncoupling of oxidative phosphorylation, calcium efflux from the mitochondria, inhibits ATP synthesis, lowers membrane-associated calcium and various membrane transport enzymes, and induces an increase in the number of lysosomes. Enzymes such as alkaline phosphatase are stripped from the brush borders of the proximal tubule cells and are discharged in the urine. However, daily IV injections of calcium (1.1 ml of 1.3% CaCl2) supplementation protect the membrane-associated enzymes from cisplatin action. Carboplatin (CBDCA), an analogue of CDDP and the least nephrotoxic of all its analogues, shows little effect on the membrane-associated transport enzymes. Therefore, cisplatin and its various analogues seem to affect the membrane transport enzymes to varying degrees with related nephrotoxicity. Calcium supplementation seems to protect these enzymes and preserve kidney function.

Los estilos APA, Harvard, Vancouver, ISO, etc.

6

Murray, Vincent, Heather M. Campbell y Annette M. Gero. "Plasmodium falciparum: DNA sequence specificity of cisplatin and cisplatin analogues". Experimental Parasitology 128, n.º 4 (agosto de 2011): 396–400. http://dx.doi.org/10.1016/j.exppara.2011.05.002.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

7

Rodriguez-Fernandez, E., J. Manzano, A. Alonso, M. Almendral, M. Perez-Andres, A. Orfao y J. Criado. "Fluorescent Cisplatin Analogues and Cytotoxic Activity". Current Medicinal Chemistry 16, n.º 32 (1 de noviembre de 2009): 4314–27. http://dx.doi.org/10.2174/092986709789578169.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

8

Neumann, Wilma, Brenda C. Crews, Menyhárt B. Sárosi, Cristina M. Daniel, Kebreab Ghebreselasie, Matthias S. Scholz, Lawrence J. Marnett y Evamarie Hey-Hawkins. "Conjugation of Cisplatin Analogues and Cyclooxygenase Inhibitors to Overcome Cisplatin Resistance". ChemMedChem 10, n.º 1 (15 de octubre de 2014): 183–92. http://dx.doi.org/10.1002/cmdc.201402353.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

9

Riley, Christopher M. "Bioanalysis of cisplatin analogues — a selective review". Journal of Pharmaceutical and Biomedical Analysis 6, n.º 6-8 (enero de 1988): 669–76. http://dx.doi.org/10.1016/0731-7085(88)80078-5.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

10

Amptoulach, Sousana y Nicolas Tsavaris. "Neurotoxicity Caused by the Treatment with Platinum Analogues". Chemotherapy Research and Practice 2011 (27 de junio de 2011): 1–5. http://dx.doi.org/10.1155/2011/843019.

Texto completo

Resumen

Platinum agents (cisplatin, carboplatin, and oxaliplatin) are a class of chemotherapy agents that have a broad spectrum of activity against several solid tumors. Toxicity to the peripheral nervous system is the major dose-limiting toxicity of at least some of the platinum drugs of clinical interest. Among the platinum compounds in clinical use, cisplatin is the most neurotoxic, inducing mainly sensory neuropathy of the upper and lower extremities. Carboplatin is generally considered to be less neurotoxic than cisplatin, but it is associated with a higher risk of neurological dysfunction if administered at high dose or in combination with agents considered to be neurotoxic. Oxaliplatin induces two types of peripheral neuropathy, acute and chronic. The incidence of oxaliplatin-induced neuropathy is related to various risk factors such as treatment schedule, cumulative dose, and time of infusion. To date, several neuroprotective agents including thiol compounds, vitamin E, various anticonvulsants, calcium-magnesium infusions, and other nonpharmacological strategies have been tested for their ability to prevent platinum-induced neurotoxicity with controversial results. Further studies on the prevention and treatment of neurotoxicity of platinum analogues are warranted.

Los estilos APA, Harvard, Vancouver, ISO, etc.

11

Mitra, Raja, Richard Goddard y Klaus-Richard Pörschke. "9,9-Difluorobispidine Analogues of Cisplatin, Carboplatin, and Oxaliplatin". Inorganic Chemistry 56, n.º 11 (12 de mayo de 2017): 6712–24. http://dx.doi.org/10.1021/acs.inorgchem.7b00836.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

12

Shlebak, A. A., P. I. Clark y J. A. Green. "Hypersensitivity and cross-reactivity to cisplatin and analogues". Cancer Chemotherapy and Pharmacology 35, n.º 4 (1 de enero de 1995): 349–51. http://dx.doi.org/10.1007/s002800050246.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

13

Shlebak, A. A., P. I. Clark y J. A. Green. "Hypersensitivity and cross-reactivity to cisplatin and analogues". Cancer Chemotherapy and Pharmacology 35, n.º 4 (julio de 1995): 349–51. http://dx.doi.org/10.1007/bf00689458.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

14

Weller, Robert R., John R. Eyler y Christopher M. Riley. "Fourier transform mass spectrometry of cisplatin and analogues". Journal of Pharmaceutical and Biomedical Analysis 3, n.º 1 (enero de 1985): 87–94. http://dx.doi.org/10.1016/0731-7085(85)80010-8.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

15

Kilari, Rajagopal S., Asma’u I. J. Bashir, Andreue Devitt, Christopher J. Perry, Stephen T. Safrany y Iain D. Nicholl. "The Cytotoxicity and Synergistic Potential of Aspirin and Aspirin Analogues Towards Oesophageal and Colorectal Cancer". Current Clinical Pharmacology 14, n.º 2 (25 de octubre de 2019): 141–51. http://dx.doi.org/10.2174/1574884713666181112141151.

Texto completo

Resumen

Background:Oesophageal cancer (OC) is a deadly cancer because of its aggressive nature with survival rates that have barely improved in decades. Epidemiologic studies have shown that low-dose daily intake of aspirin can decrease the incidence of OC.Methods:The toxicity of aspirin and aspirin derivatives to OC and a CRC cell line were investigated in the presence and absence of platins.Results:The data in this study show the effects of a number of aspirin analogues and aspirin on OC cell lines that originally presented as squamous cell carcinoma (SSC) and adenocarcinoma (ADC). The aspirin analogues fumaryldiaspirin (PN517) and the benzoylsalicylates (PN524, PN528 and PN529), were observed to be more toxic against the OC cell lines than aspirin. Both quantitative and qualitative apoptosis experiments reveal that these compounds largely induce apoptosis, although some necrosis was evident with PN528 and PN529. Failure to recover following the treatment with these analogues emphasized that these drugs are largely cytotoxic in nature. The OE21 (SSC) and OE33 (ADC) cell lines were more sensitive to the aspirin analogues compared to the Flo-1 cell line (ADC). A non-cancerous oesophageal primary cells NOK2101, was used to determine the specificity of the aspirin analogues and cytotoxicity assays revealed that analogues PN528 and PN529 were selectively toxic to cancer cell lines, whereas PN508, PN517 and PN524 also induced cell death in NOK2101. In combination index testing synergistic interactions of the most promising compounds, including aspirin, with cisplatin, oxaliplatin and carboplatin against the OE33 cell line and the SW480 colorectal cancer (CRC) cell line were investigated. Compounds PN517 and PN524, and to a lesser extent PN528, synergised with cisplatin against OE33 cells. Cisplatin and oxaliplatin synergised with aspirin and PN517 when tested against the SW480 cell line.Conclusion:These findings indicate the potential and limitations of aspirin and aspirin analogues as chemotherapeutic agents against OC and CRC when combined with platins.

Los estilos APA, Harvard, Vancouver, ISO, etc.

16

Yao, Sen, Biao Wei, Mingjun Yu, Xiaoming Meng, Meng He y Risheng Yao. "Design, synthesis and evaluation of PD176252 analogues for ameliorating cisplatin-induced nephrotoxicity". MedChemComm 10, n.º 5 (2019): 757–63. http://dx.doi.org/10.1039/c8md00632f.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

17

Rijal, Keshab, Xun Bao y Christine S. Chow. "Amino acid-linked platinum(ii) analogues have altered specificity for RNA compared to cisplatin". Chem. Commun. 50, n.º 30 (2014): 3918–20. http://dx.doi.org/10.1039/c3cc49035a.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

18

Fabijańska, Małgorzata, Magdalena Orzechowska, Agnieszka J. Rybarczyk-Pirek, Justyna Dominikowska, Alicja Bieńkowska, Maciej Małecki y Justyn Ochocki. "Simple Trans-Platinum Complex Bearing 3-Aminoflavone Ligand Could Be a Useful Drug: Structure-Activity Relationship of Platinum Complex in Comparison with Cisplatin". International Journal of Molecular Sciences 21, n.º 6 (19 de marzo de 2020): 2116. http://dx.doi.org/10.3390/ijms21062116.

Texto completo

Resumen

Following previous studies devoted to trans–Pt(3-af)2Cl2, in this paper, the molecular structure and intermolecular interactions of the title complex are compared with other cisplatin analogues of which the crystal structures are presented in the Cambridge Structural Database (CSD). Molecular Hirshfeld surface analysis and computational methods were used to examine a possible relationship between the structure and anticancer activity of trans–Pt(3-af)2Cl2. The purpose of the article was also to investigate the effect of hyperthermia on the anticancer activity of cisplatin, cytostatics used in the treatment of patients with ovarian cancer and a new analogue of cisplatin-trans–Pt(3-af)2Cl2. The study was conducted on two cell lines of ovarian cancer sensitive to Caov-3 cytostatics and the OVCAR-3 resistant cisplatin line. The study used the MTT (3-(4,5-dimethylthiazol-2,5-diphenyltetrazolium bromide) cell viability assay, LDH (lactate dehydrogenase), and the quantitative evaluation method for measuring gene expression, i.e., qPCR with TagMan probes. Reduced survivability of OVCAR-3 and Caov-3 cells exposed to cytostatics at elevated temperatures (37 °C, 40 °C, 43 °C) was observed. Hyperthermia may increase the sensitivity of cells to platinum-based antineoplastic drugs and paclitaxel, which may be associated with the reduction of gene expression related to apoptotic processes.

Los estilos APA, Harvard, Vancouver, ISO, etc.

19

Murray, Vincent, Joanne Whittaker, Mark D. Temple y W. David McFadyen. "Interaction of 11 cisplatin analogues with DNA: characteristic pattern of damage with monofunctional analogues". Biochimica et Biophysica Acta (BBA) - Gene Structure and Expression 1354, n.º 3 (noviembre de 1997): 261–71. http://dx.doi.org/10.1016/s0167-4781(97)00087-0.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

20

&NA;. "Corticotrophin analogues appear to protect against cisplatin-induced neurotoxicity". Reactions Weekly &NA;, n.º 500 (mayo de 1994): 3. http://dx.doi.org/10.2165/00128415-199405000-00007.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

21

Criado, Julio J., Emilio R. Fernández, Juan L. Manzano, Angel Alonso, Susana Barrena, Manuel Medarde, Rafael Pelaez, M. Dolores Tabernero y Alberto Orfao. "Intrinsically Fluorescent Cytotoxic Cisplatin Analogues as DNA Marker Molecules". Bioconjugate Chemistry 16, n.º 2 (marzo de 2005): 275–82. http://dx.doi.org/10.1021/bc049788r.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

22

Ferraro, Giarita, Ilaria De Benedictis, Annamaria Malfitano, Giancarlo Morelli, Ettore Novellino y Daniela Marasco. "Interactions of cisplatin analogues with lysozyme: a comparative analysis". BioMetals 30, n.º 5 (14 de agosto de 2017): 733–46. http://dx.doi.org/10.1007/s10534-017-0041-y.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

23

Azab, Belal, Anood Alassaf, Abdulrahman Abu-Humdan, Zain Dardas, Hashem Almousa, Mohammad Alsalem, Omar Khabour, Hana Hammad, Tareq Saleh y Abdalla Awidi. "Genotoxicity of cisplatin and carboplatin in cultured human lymphocytes: a comparative study". Interdisciplinary Toxicology 12, n.º 2 (1 de octubre de 2019): 93–97. http://dx.doi.org/10.2478/intox-2019-0011.

Texto completo

Resumen

Abstract Cisplatin and carboplatin are integral parts of many antineoplastic management regimens. Both platinum analogues are potent DNA alkylating agents that robustly induce genomic instability and promote apoptosis in tumor cells. Although the mechanism of action of both drugs is similar, cisplatin appears to be more cytotoxic. In this study, the genotoxic potential of cisplatin and carboplatin was compared using chromosomal aberrations (CAs) and sister-chromatid exchange (SCE) assays in cultured human lymphocytes. Results showed that cisplatin and carboplatin induced a significant increase in CAs and SCEs compared to the control group (p<0.01). Levels of induced CAs were similar in both drugs; however, the magnitude of SCEs induced by cisplatin was significantly higher than that induced by carboplatin (p<0.01). With respect to the mitotic and proliferative indices, both cisplatin and carboplatin significantly decreased mitotic index (p<0.01) without affecting the proliferative index (p>0.05). In conclusion, cisplatin was found to be more genotoxic than carboplatin in the SCE assay in cultured human lymphocytes, and that might explain the higher cytotoxicity of cisplatin.

Los estilos APA, Harvard, Vancouver, ISO, etc.

24

Panibrat, Olesya V., Vladimir N. Zhabinskii y Vladimir A. Khripach. "Eﬀect of combination of cisplatin with brassinosteroids on the growth of cancer cells". Doklady of the National Academy of Sciences of Belarus 63, n.º 4 (13 de septiembre de 2019): 437–44. http://dx.doi.org/10.29235/1561-8323-2019-63-4-437-444.

Texto completo

Resumen

In this work, the eﬀect of brassinosteroids on the antitumor activity of classical cytostatic cisplatin in tumor cell lines A549 (human lung carcinoma) and Hep G2 (human hepatocellular carcinoma) was evaluated. Natural brassinosteroids 24-epibrassinolide and 28-homocastasterone, as well as their synthetic analogues (22S,23S)-24-epibrassinolide and (22S,23S)-28-homocastasterone were used. All four compounds with cisplatin inhibited the growth of cancer cells more eﬀectively than cisplatin alone. Combinations with low concentrations of synthetic brassinosteroids were more eﬀecient, and at 1 µM decreased the IC50 of cisplatin by almost 2 times. The results suggest a possible benefit of combinations of classical antitumor drugs with brassinosteroids in overcoming the negative eﬀects of chemotherapy by reducing their eﬀective doses.

Los estilos APA, Harvard, Vancouver, ISO, etc.

25

Murray, Vincent, Joanne Whittaker y W. David McFadyen. "DNA sequence selectivity of cisplatin analogues in intact human cells". Chemico-Biological Interactions 110, n.º 1-2 (marzo de 1998): 27–37. http://dx.doi.org/10.1016/s0009-2797(97)00110-5.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

26

de Graeff, Alexander, Robert J. C. Slebos y Sjoerd Rodenhuis. "Resistance ot cisplatin and analogues: mechanisms and potential clinical implications". Cancer Chemotherapy and Pharmacology 22, n.º 4 (octubre de 1988): 325–32. http://dx.doi.org/10.1007/bf00254240.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

27

Pasini, Alessandro y Franco Zunino. "New Cisplatin Analogues—On the Way to Better Antitumor Agents". Angewandte Chemie International Edition in English 26, n.º 7 (julio de 1987): 615–24. http://dx.doi.org/10.1002/anie.198706151.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

28

Fantini, Manuela, Lorenzo Gianni, Carlotta Santelmo, Fabrizio Drudi, Cinzia Castellani, Alessandra Affatato, Mario Nicolini y Alberto Ravaioli. "Lipoplatin Treatment in Lung and Breast Cancer". Chemotherapy Research and Practice 2011 (29 de diciembre de 2011): 1–7. http://dx.doi.org/10.1155/2011/125192.

Texto completo

Resumen

The introduction of cisplatin in cancer treatment represents an important achievement in the oncologic field. Many types of cancers are now treated with this drug, and in testicular cancer patients major results are reached. Since 1965, other compounds were disovered and among them carboplatin and oxaliplatin are the main Cisplatin analogues showing similar clinical efficacy with a safer toxicity profile. Lipoplatin is a new liposomal cisplatin formulation which seems to have these characteristics. Lipoplatin was shown to be effective in NSCLC both in phase 2 and phase 3 trials, with the same response rate of Cisplatin, a comparable overall survival but less toxicity. A new protocol aiming to elucidate the double capacity of Lipoplatin to act as a chemotherapeutic and angiogenetic agent in triple-negative breast cancer patients is upcoming.

Los estilos APA, Harvard, Vancouver, ISO, etc.

29

Mohammadifar, Ehsan, Ali Nemati Kharat y Mohsen Adeli. "Polyamidoamine and polyglycerol; their linear, dendritic and linear–dendritic architectures as anticancer drug delivery systems". Journal of Materials Chemistry B 3, n.º 19 (2015): 3896–921. http://dx.doi.org/10.1039/c4tb02133a.

Texto completo

Resumen

This review covers the latest advances in the conjugation of chemotherapeutics such as doxorubicin, paclitaxel, methotrexate, fluorouracil and cisplatin to dendritic polymers, including polyamidoamine dendrimers, hyperbranched polyglycerols and their linear analogues, with a focus on their cytotoxicity, biodistribution and biodegradability.

Los estilos APA, Harvard, Vancouver, ISO, etc.

30

Köberle, Beate y Sarah Schoch. "Platinum Complexes in Colorectal Cancer and Other Solid Tumors". Cancers 13, n.º 9 (25 de abril de 2021): 2073. http://dx.doi.org/10.3390/cancers13092073.

Texto completo

Resumen

Cisplatin is one of the most commonly used drugs for the treatment of various solid neoplasms, including testicular, lung, ovarian, head and neck, and bladder cancers. Unfortunately, the therapeutic efficacy of cisplatin against colorectal cancer is poor. Various mechanisms appear to contribute to cisplatin resistance in cancer cells, including reduced drug accumulation, enhanced drug detoxification, modulation of DNA repair mechanisms, and finally alterations in cisplatin DNA damage signaling preventing apoptosis in cancer cells. Regarding colorectal cancer, defects in mismatch repair and altered p53-mediated DNA damage signaling are the main factors controlling the resistance phenotype. In particular, p53 inactivation appears to be associated with chemoresistance and poor prognosis. To overcome resistance in cancers, several strategies can be envisaged. Improved cisplatin analogues, which retain activity in resistant cancer, might be applied. Targeting p53-mediated DNA damage signaling provides another therapeutic strategy to circumvent cisplatin resistance. This review provides an overview on the DNA repair pathways involved in the processing of cisplatin damage and will describe signal transduction from cisplatin DNA lesions, with special attention given to colorectal cancer cells. Furthermore, examples for improved platinum compounds and biochemical modulators of cisplatin DNA damage signaling will be presented in the context of colon cancer therapy.

Los estilos APA, Harvard, Vancouver, ISO, etc.

31

Wangoli, Panyako Asman y Grace Kinunda. "The effect of alkyl chain tethers on the kinetics and mechanistic behaviour of bifunctional dinuclear platinum(ii) complexes bearing N,N′-dipyridylamine ligands". New Journal of Chemistry 42, n.º 1 (2018): 214–27. http://dx.doi.org/10.1039/c7nj03021e.

Texto completo

Resumen

This study reports on non-classical dinuclear platinum(ii) complexes, with the ability to bind to DNA strands in a different manner from cisplatin and its analogues. This is an effort to design dinuclear Pt(ii) complexes that target DNA and are bifunctional.

Los estilos APA, Harvard, Vancouver, ISO, etc.

32

Rea, Samantha, Alexia Smith, Brooke Hornberger, Grace Fillmore, Jeremy Burkett y Timothy Dwyer. "Stabilization of Cisplatin via Coordination of Ethylenediamine". American Journal of Undergraduate Research 19, n.º 3 (30 de diciembre de 2022): 37–45. http://dx.doi.org/10.33697/ajur.2022.067.

Texto completo

Resumen

While the chemotherapeutic cisplatin is used to treat a variety of cancers, metal toxicity and cisplatin resistance via genetic and epigenetic changes limits its use and calls for alternative therapies. To combat the observed toxicities and create a more stable compound, which avoids isomerization into a trans configuration, three cisplatin analogues including cispalladium, dichloro-(ethylenediamine)-platinum(II), and dichloro-(ethylenediamine)-palladium(II) were synthesized as potential cisplatin alternatives. Each compound was evaluated for cytotoxicity on SK-OV-3 cells against cisplatin. Synthesis of dichloro-(ethylenediamine)-platinum(II) yielded 20.5% of the theoretical yield, while dichloro-(ethylenediamine)-palladium(II) yielded 49.1%. Results from the cytotoxicity trial revealed that cispalladium was not effective against SK-OV-3 cells, and dichloro-(ethylenediamine)-palladium had minimal effects. The dichloro-(ethylenediamine)-platinum(II) was the most efficacious with an IC50 value of 0.77 µg/ml compared to the IC50 of 0.61 µg/ml for cisplatin. With a similar IC50 to cisplatin, these results suggest that dichloro-(ethylenediamine)-platinum(II) has the potential to serve as a cisplatin alternative for cancer patients who develop resistance following their clinical course of cisplatin. Future studies on the cytotoxicity of dichloro-(ethylenediamine)-platinum(II) to induce cell death on cisplatin-resistance cell lines are necessary to determine the ability of the compound to be utilized as a cisplatin alternative. KEYWORDS: Cisplatin; Ovarian Cancer; SK-OV-3; Drug Resistance; Stability; Palladium; Ethylenediamine; Cispalladium; Dichloro-(ethylenediamine)-platinum(II); Dichloro-(ethylenediamine)-palladium(II)

Los estilos APA, Harvard, Vancouver, ISO, etc.

33

Daly, Helen L., Matthew D. Hall, Timothy W. Failes, Mei Zhang, Garry J. Foran y Trevor W. Hambley. "Stabilization of Triam(m)inechloridoplatinum Complexes by Oxidation to PtIV". Australian Journal of Chemistry 64, n.º 3 (2011): 273. http://dx.doi.org/10.1071/ch11041.

Texto completo

Resumen

PtIV analogues of the active end groups {PtClN3} of multinuclear Pt anticancer drugs have been investigated. The crystal structure of trans,mer-[PtCl(OH)2(dien)]Cl shows that the bond lengths are similar to those in the dihydroxidoplatinum(iv) analogue of cisplatin. The axial ligands are shown to be the predominant influence on reduction potentials with the dihydroxido complex trans,mer-[PtCl(OH)2(NH3)3]Cl being the most resistant to reduction. X-ray absorption near-edge spectroscopy is shown to be suitable for monitoring the oxidation state of these complexes and reveals that trans,mer-[PtCl(OH)2(NH3)3]+ survives for more than 2 h in cancer cells.

Los estilos APA, Harvard, Vancouver, ISO, etc.

34

Xiao, Fangxing, Xiaobin Yao, Qianhong Bao, Danzhen Li y Yi Zheng. "Sensitive Marker of the Cisplatin-DNA Interaction: X-Ray Photoelectron Spectroscopy of CL". Bioinorganic Chemistry and Applications 2012 (2012): 1–10. http://dx.doi.org/10.1155/2012/649640.

Texto completo

Resumen

The development of cisplatin and Pt-based analogues anticancer agents requires knowledge concerning the molecular mechanisms of interaction between such drugs with DNA. However, the binding dynamics and kinetics of cisplatin reactions with DNA determined by traditional approaches are far from satisfactory. In this study, a typical 20-base oligonucleotide (CGTGACAGTTATTGCAGGCG), as a simplified model representing DNA, was mixed with cisplatin in different molar ratios and incubation time. High-resolution XPS spectra of the core elements C, N, O, P, and Cl were recorded to explore the interaction between cisplatin and DNA. From deconvoluted Cl spectra we could readily differentiate the covalently bound chlorine from ionic chloride species in the cisplatin-oligo complexes, which displayed distinct features at various reaction times and ratios. Monitoring the magnitude and energy of the photoelectron Cl 2p signal by XPS could act as a sensitive marker to probe the interaction dynamics of chemical bonds in the reaction of cisplatin with DNA. At 37°C, the optimum incubation time to obtain a stable cisplatin-oligo complex lies around 20 hrs. This novel analysis technique could have valuable implications to understand the fundamental mechanism of cisplatin cytotoxicity and determine the efficiency of the bonds in treated cancer cells.

Los estilos APA, Harvard, Vancouver, ISO, etc.

35

Hardie, Megan, Hieronimus Kava y Vincent Murray. "Cisplatin Analogues with an Increased Interaction with DNA: Prospects for Therapy". Current Pharmaceutical Design 22, n.º 44 (13 de enero de 2017): 6645–64. http://dx.doi.org/10.2174/1381612822666160831101529.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

36

Cui, Huiling, Richard Goddard, Klaus-Richard Pörschke, Alexandra Hamacher y Matthias U. Kassack. "Bispidine Analogues of Cisplatin, Carboplatin, and Oxaliplatin. Synthesis, Structures, and Cytotoxicity". Inorganic Chemistry 53, n.º 7 (25 de marzo de 2014): 3371–84. http://dx.doi.org/10.1021/ic402737f.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

37

Sze, Chak Ming, George N. Khairallah, Zhiguang Xiao, Paul S. Donnelly, Richard A. J. O’Hair y Anthony G. Wedd. "Interaction of cisplatin and analogues with a Met-rich protein site". JBIC Journal of Biological Inorganic Chemistry 14, n.º 2 (26 de noviembre de 2008): 163–65. http://dx.doi.org/10.1007/s00775-008-0452-x.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

38

Kinunda, Grace y Deogratius Jaganyi. "Kinetic and mechanistic studies of cisplatin analogues bearing 2,2′-dipyridylalkylamine ligands". Transition Metal Chemistry 41, n.º 2 (17 de diciembre de 2015): 235–48. http://dx.doi.org/10.1007/s11243-015-0015-2.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

39

Galea, Anne M. y Vincent Murray. "The interaction of cisplatin and analogues with DNA in reconstituted chromatin". Biochimica et Biophysica Acta (BBA) - Gene Structure and Expression 1579, n.º 2-3 (diciembre de 2002): 142–52. http://dx.doi.org/10.1016/s0167-4781(02)00535-3.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

40

HANESSIAN, S., J. Y. GAUTHIER, K. OKAMOTO, A. L. BEAUCHAMP y T. THEOPHANIDES. "ChemInform Abstract: Synthesis of Diaminodideoxyalditol Analogues as Cisplatin as Antitumor Agents." ChemInform 24, n.º 49 (20 de agosto de 2010): no. http://dx.doi.org/10.1002/chin.199349239.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

41

HARSTRICK, A., J. CASPER y H. J. SCHMOLL. "Comparative antitumour activity of cisplatin and two new cisplatin-analogues JM8 and JM9 in human testicular carcinoma xenografts". International Journal of Andrology 10, n.º 1 (febrero de 1987): 139–45. http://dx.doi.org/10.1111/j.1365-2605.1987.tb00175.x.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

42

Stojic, Isidora M., Vladimir I. Zivkovic, Ivan M. Srejovic, Tamara R. Nikolic, Nevena S. Jeremic, Jovana N. Jeremic, Dragan M. Djuric et al. "Cisplatin and cisplatin analogues perfusion through isolated rat heart: the effects of acute application on oxidative stress biomarkers". Molecular and Cellular Biochemistry 439, n.º 1-2 (1 de agosto de 2017): 19–33. http://dx.doi.org/10.1007/s11010-017-3132-8.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

43

Islam, Mohammad Shahidul, Abdullah Mohammed Al-Majid, Fardous F. El-Senduny, Farid A. Badria, A. F. M. Motiur Rahman, Assem Barakat y Yaseen A. M. M. Elshaier. "Synthesis, Anticancer Activity, and Molecular Modeling of New Halogenated Spiro[pyrrolidine-thiazolo-oxindoles] Derivatives". Applied Sciences 10, n.º 6 (23 de marzo de 2020): 2170. http://dx.doi.org/10.3390/app10062170.

Texto completo

Resumen

A one-pot, single-step, and an atom-economical process towards the synthesis of highly functionalized spirooxindoles analogues was efficiently conducted to produce a satisfactory chemical yields (70–93%) with excellent relative diastereo-, and regio-selectivity. An in vitro antiproliferative assay was carried out on different cancer cell lines to evaluate the biological activity of the synthesized tetrahydro-1’H-spiro[indoline-3,5’-pyrrolo[1,2-c]thiazol]-2-one 5a–n. The prepared hybrids were then tested in vitro for their antiproliferative effects against three cancer cell lines, namely, HepG2 (liver cancer), MCF-7 (breast cancer), and HCT-116 (colon cancer). The spirooxindole analogue 5g exhibited a broad activity against HepG2, MCF-7, and HCT-116 cell lines of liver, breast, and colorectal cancers when compared to cisplatin. Modeling studies including shape similarity, lipophilicity scores, and physicochemical parameters were calculated. The results of this study indicated that spirooxindole analogue 5g retained a good physiochemical parameters with acceptable lipophilicity scores.

Los estilos APA, Harvard, Vancouver, ISO, etc.

44

Novokmet, Slobodan, Isidora Stojic, Katarina Radonjic, Maja Savic y Jovana Jeremic. "Toxic Effects of Metallopharmaceuticals". Serbian Journal of Experimental and Clinical Research 18, n.º 3 (26 de octubre de 2017): 191–94. http://dx.doi.org/10.1515/sjecr-2016-0082.

Texto completo

Resumen

Abstract Discovery of the metallopharmaceutical cisplatin and its use in antitumour therapy has initiated the rational design and screening of metal-based anticancer agents as potential chemotherapeutics. In addition to the achievements of cisplatin and its therapeutic analogues, there are significant drawbacks to its use: resistance and toxicity. Over the past four decades, numerous transition metal complexes have been synthesized and investigated in vitro and in vivo. The most studied metals among these complexes are platinum and ruthenium. The key features of these investigations is to find novel metal complexes that could potentially exert less toxicity and equal or higher antitumour potency and to overcome other pharmacological deficiencies. Ru complexes have a different mode of action than cisplatin does, some of which are under clinical trials for treating metastatic or cisplatin-resistant tumours. This review consists of the current knowledge, published and unpublished, related to the toxicity of metallopharmaceuticals, and special attention is given to platinum [Pt(II) and Pt(IV)] and ruthenium [Ru(II) and Ru(III)] complexes.

Los estilos APA, Harvard, Vancouver, ISO, etc.

45

Trump, D. L., J. L. Grem, K. D. Tutsch, J. K. Willson, K. J. Simon, D. Alberti, B. Storer y D. C. Tormey. "Platinum analogue combination chemotherapy: cisplatin and carboplatin--a phase I trial with pharmacokinetic assessment of the effect of cisplatin administration on carboplatin excretion." Journal of Clinical Oncology 5, n.º 8 (agosto de 1987): 1281–89. http://dx.doi.org/10.1200/jco.1987.5.8.1281.

Texto completo

Resumen

Cisplatin (NSC 119875) and carboplatin (NSC 241240) are platinum (II) analogues with very different spectra of toxicity. Cisplatin dose is limited by nausea and vomiting, renal dysfunction, and dose-related peripheral neuropathy, whereas carboplatin is myelosuppressive. There are also clinical and laboratory data that suggest that these drugs may not be completely cross-resistant. Therefore, the following phase I trial of combination therapy with cisplatin and carboplatin was undertaken. Since carboplatin toxicity is enhanced in the presence of renal impairment, carboplatin excretion was also evaluated in selected patients at the maximum tolerated dose. Thirty-three patients received 50 mg/m2 cisplatin and doses of carboplatin between 160 mg/m2 and 400 mg/m2. Sequential 20-minute infusions of carboplatin and then cisplatin were able to be administered at the standard doses of carboplatin (320 and 400 mg/m2) with thrombocytopenia to the degree expected if carboplatin alone had been given. However, 280 mg/m2 carboplatin followed by 25 mg/m2 cisplatin/d X 3 caused unexpectedly severe thrombocytopenia in seven of eight patients (median platelet nadir 45,000/microL; range, 12 to 321,000/microL; nadir was less than 90,000 in seven of eight patients). In three patients treated with 280 mg/m2 carboplatin plus 25 mg/m2/d X 3 cisplatin, pharmacokinetics of carboplatin were compared during consecutive monthly cycles without and with cisplatin. Modestly increased areas under the curve (AUC) for carboplatin (15% and 35%) with cisplatin were seen in the two patients who experienced more pronounced platelet suppression with combination therapy. No other limiting or unusual toxicity was seen with this combination. Responses, primarily in "platinum responsive" tumors, were seen. The combination of cisplatin plus carboplatin is feasible and merits further study.

Los estilos APA, Harvard, Vancouver, ISO, etc.

46

De Pascali, Sandra Angelica, Antonella Muscella, Santo Marsigliante, Maria Grazia Bottone, Graziella Bernocchi y Francesco Paolo Fanizzi. "Cisplatin-related drugs for nongenomic targets: Forcing the reactivity with nucleobases". Pure and Applied Chemistry 85, n.º 2 (31 de diciembre de 2012): 355–64. http://dx.doi.org/10.1351/pac-con-12-08-07.

Texto completo

Resumen

The products obtained by forcing the reaction with nucleosides (guanosine, Guo, and adenosine, Ado) of potential anticancer drugs for nongenomic targets [PtCl(O,O'-acac)(L)] (L = dimethyl sulfoxide, DMSO; dimethyl sulfide, DMS), closely related to their very powerful organometallic analogues [Pt(O,O'-acac)(γ-acac)(L)], have been studied. [PtCl(O,O'-acac)(L)] and [Pt(O,O'-acac)(γ-acac)(L)] complexes were reported unreactive toward nucleobases. Aquo species [Pt(O,O'-acac)H2O(L)]+, obtained from [PtCl(O,O'-acac)(L)] by Ag+ driven coordinated Cl– removal, gave access to [Pt(O,O'-acac)(L)(nucleoside)]+ ([Pt(O,O'-acac)(DMSO)(Guo)]+, [Pt(O,O'-acac)(DMS)(Guo)]+, [Pt(O,O'-acac)(DMSO)(Ado)]+). The effect of the chelate oxygen donor acac (with respect to a chelate diammine), the role of the sulfur ligand (DMSO, DMS), and the influence of the purinic nucleoside itself on the coordinated Guo or Ado dynamic motions in [Pt(O,O'-acac)(L)(nucleoside)]+ complexes have been investigated by NMR spectroscopy. Interestingly, a slow rotation of nucleobase around the Pt–N(7) bond with formation of two rotamers was observed already at room temperature only in the case of [Pt(O,O'-acac)(DMSO)(Guo)]+. On the other hand, no hindered rotation at room temperature was detected in the analogous [Pt(O,O'-acac)(DMS)(Guo)]+ and [Pt(O,O'-acac)(DMSO)(Ado)]+ complexes. Data suggest that rotation of the nucleoside in [Pt(O,O'-acac)(L)(nucleoside)]+ is very different with respect to the analogous [Pt(diammine)(L)(nucleoside)]2+ systems, due to specific interactions between the acac chelate ligand, the DMSO, and the nucleobase.

Los estilos APA, Harvard, Vancouver, ISO, etc.

47

Roden, M. D., K. B. Dillon y J. A. K. Howard. "Crystallographic studies of phosphorus cisplatin analogues with possible links to anticancer activity". Acta Crystallographica Section A Foundations of Crystallography 52, a1 (8 de agosto de 1996): C320. http://dx.doi.org/10.1107/s0108767396086692.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

48

Zhang, Yong, Zijian Guo y Xiao-Zeng You. "Hydrolysis Theory for Cisplatin and Its Analogues Based on Density Functional Studies". Journal of the American Chemical Society 123, n.º 38 (septiembre de 2001): 9378–87. http://dx.doi.org/10.1021/ja0023938.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

49

Pollak, David, Richard Goddard y Klaus-Richard Pörschke. "Synthesis and Structures of 9-Oxabispidine Analogues of Cisplatin, Carboplatin, and Oxaliplatin". Inorganic Chemistry 55, n.º 18 (7 de septiembre de 2016): 9424–35. http://dx.doi.org/10.1021/acs.inorgchem.6b01690.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

50

Kasparkova, Jana, Olga Novakova, Yousef Najajreh, Dan Gibson, Jose-Manuel Perez y Viktor Brabec. "Effects of a Piperidine Ligand on DNA Modification by Antitumor Cisplatin Analogues". Chemical Research in Toxicology 16, n.º 11 (noviembre de 2003): 1424–32. http://dx.doi.org/10.1021/tx034128g.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

Artículos de revistas sobre el tema "Cisplatin analogues"

Crea una cita precisa en los estilos APA, MLA, Chicago, Harvard y otros