Artículos de revistas: "Center of Concern (Washington, D.C.)"

1

Longstreth, Richard. "The Neighborhood Shopping Center in Washington, D. C., 1930-1941". Journal of the Society of Architectural Historians 51, n.º 1 (1 de marzo de 1992): 5–34. http://dx.doi.org/10.2307/990638.

Texto completo

Resumen

During the 1930s the neighborhood shopping center emerged as an important phenomenon in the development of retail facilities in the United States. Prior to that decade, the type was limited to a modest number of examples built as components of planned residential subdivisions for the well-to-do. By the eve of World War II, the neighborhood shopping center was seen as an advantageous means of meeting the routine needs of people in outlying urban areas generally. During the 1930s, the neighborhood center also became one of the first common building forms to experience a basic reconfiguration to accommodate patterns of widespread automobile usage. Washington, D. C., was the initial and by far the most intensive proving ground for this work at its formative stage. The results were influential nationwide in the shopping center's transformation from a novelty to a ubiquitous feature of the American landscape.

Los estilos APA, Harvard, Vancouver, ISO, etc.

2

Alpert, Eugene J. "Expanding the Beltway: Developing a Washington Resource Center". News for Teachers of Political Science 48 (1986): 1–6. http://dx.doi.org/10.1017/s0197901900003342.

Texto completo

Resumen

“Inside the Beltway” is the phrase most often used by observers of national politics to capital area. Apparently, according to critics, the only people who really follow or care about the “inside baseball” of Washington intrigue are the people who live within the 257 sq. miles of roadway. The rest of the country is either unconcerned or unaware, since a) the Washington Post is not available for home delivery in their area, b) they are not invited to Georgetown cocktail parties or intimate Chevy Chase dinners, c) they aren't in contact with the 40,000 plus lawyers in D.C. or d) all of the above.Despite the difficulty of following Washington politics on a daily basis, it is something that cannot be totally avoided.

Los estilos APA, Harvard, Vancouver, ISO, etc.

3

Herliana, Emmelia Tricia. "PENERAPAN KONSEP TRIAS POLITICA PADA MORFOLOGI DAN TIPOLOGI KOTA WASHINGTON, D. C. DAN CANBERRA". Jurnal Arsitektur KOMPOSISI 11, n.º 3 (1 de mayo de 2017): 267. http://dx.doi.org/10.24002/jars.v10i4.1101.

Texto completo

Resumen

Abstract: City planning is intended to create better living environment for its residents. A city is ‘a living laboratory’ that can be learned by people from different nations and cultures or even by the next generation, particularly by the next city planners. The morphology and typology of Washington, D.C. and Canberra, as federal capital cities of the central government, are determined by the early phase of planning, in which the planners interpreted the concept of the power system that each government has and implemented it to the structure of city. This study has an aim to oversee and compare the implementation of governmental power system in USA and Australia to the urban structure of their civic center. Both of them are democratic nations, which apply the concept of “Trias Politica”, and this concept is implemented within the morphological and typological structure of the capital cities. The method to discuss this topic is, firstly, by describe the history of city planning and design of the two cities. Secondly, the difference of the implementation of “Trias Politica” concept to the basic concept of planning and to the elements of morphology and typology of each city is analyzed. Thirdly, the conclusion of previous discussion is configured. The result of this study is a comparison of the implementation of the concept in differentiating power of legislative, executive, and judicative to the city planning which applied Baroque and Beaux-Arts ideas on Washington, D.C. and Canberra.Keywords: Morphology, typology, capital city, civic center, “Trias Politica”Abstrak: Perencanaan kota bertujuan untuk menciptakan lingkungan bermukim yang lebih baik bagi penduduk kota. Kota yang direncanakan dengan baik diharapkan akan dapat berfungsi dengan baik pula. Morfologi dan tipologi Kota Washington, D.C. dan Canberra, yang berfungsi sebagai ibukota pusat pemerintahan, sangat ditentukan oleh bagaimana para perencana dan perancang kota sejak awal menterjemahkan sistem kekuasaan yang dianut oleh pemerintah negara tersebut ke dalam struktur kota. Studi ini bertujuan untuk melihat dan membandingkan bagaimana konsep yang dianut oleh kedua negara, yaitu United State of America dan Australia, di dalam menjalankan kehidupan bernegara yang menerapkan paham demokrasi, yaitu konsep “Trias Politica”, diterapkan pada struktur morfologi dan tipologi ibukota kedua negara. Metoda pembahasan yang digunakan adalah dengan menguraikan sejarah perencanaan dan perancangan kota Washington, D. C. dan Canberra, menganalisis perbedaan penerapan konsep “Trias Politica” pada konsep dasar perancangan dan unsur-unsur morfologi dan tipologi masing-masing kota, serta menarik kesimpulan dari pembahasan tersebut. Hasil dari studi ini berupa perbandingan penerapan konsep pembagian kekuasaan pada paham demokrasi melalui perancangan kota yang menerapkan gagasan Baroque dan Beaux-Arts pada kota Washington, D.C. dan Canberra. Studi ini dapat dijadikan sebagai bahan pembelajaran dan dapat diambil maknanya apabila para perencana dan perancang kota dihadapkan pada permasalahan di dalam merencana dan merancang kota atau mengevaluasi perencanaan dan perancangan yang sudah ada.Kata kunci: Morfologi, tipologi, ibukota, pusat pemerintahan, “Trias Politica”

Los estilos APA, Harvard, Vancouver, ISO, etc.

4

Pfisterer, Valentin. "The Second SWIFT Agreement Between the European Union and the United States of America — An Overview". German Law Journal 11, n.º 10 (octubre de 2010): 1173–90. http://dx.doi.org/10.1017/s2071832200020174.

Texto completo

Resumen

The United States and other nations have taken numerous military, police and intelligence measures in order to counter terrorists’ threats in response to the September 11 attacks on the World Trade Center in New York City and the Pentagon in Virginia as well as the attempted attack on a target in Washington, D. C.

Los estilos APA, Harvard, Vancouver, ISO, etc.

5

Gomart, Thomas. "RUSSIA IN SEARCH OF ITSELF , James Billington, Washington D. C., Woodrow Wilson Center Press, 2004, 234 pages". Politique étrangère Été, n.º 2 (1 de junio de 2005): XII. http://dx.doi.org/10.3917/pe.052.0439l.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

6

Reagan, Timothy. "LANGUAGE POLICY AND PEDAGOGY: ESSAYS IN HONOR OF A. RONALD WALTON. Richard D. Lambert and Elana Shohamy (Eds.). Amsterdam: Benjamins, 2000. Pp. xii + 279. $65.00 cloth." Studies in Second Language Acquisition 24, n.º 1 (marzo de 2002): 122–23. http://dx.doi.org/10.1017/s0272263102221063.

Texto completo

Resumen

Language policy and pedagogy, as its subtitle suggests, is dedicated to A. Ronald Walton, who died quite young in 1996. Walton had served as the deputy director of the National Foreign Language Center (NFLC) in Washington, D.C., since its founding in 1986, and the contributors to this volume all have had direct or indirect connections to the NFLC. Further, the essays in this volume are all related to issues and areas that were of concern to Walton during the course of his career. All of that having been said, this work is considerably more than a typical Festschrift; it is in fact a timely and important contribution to the growing literature dealing with both language policy and planning studies and contemporary issues in U.S. foreign language education policy and practice.

Los estilos APA, Harvard, Vancouver, ISO, etc.

7

Oudiz, Ronald J., Robert Naeije, Virginia D. Steen, Hunter C. Champion y David Systrom. "Controversies and Consensus: Identifying the Key Issues in Exercise Testing". Advances in Pulmonary Hypertension 7, n.º 4 (1 de diciembre de 2008): 412–17. http://dx.doi.org/10.21693/1933-088x-7.4.412.

Texto completo

Resumen

This discussion was moderated by Ronald J. Oudiz, MD, Associate Professor of Medicine, UCLA School of Medicine and Director, Liu Center for Pulmonary Hypertension, Division of Cardiology, Los Angeles Biomedical Research Institute at Harbor-UCLA Medical Center, Torrance, California. Participants included: Hunter C. Champion, MD, PhD, Assistant Professor, Department of Medicine, Division of Cardiology, Johns Hopkins University School of Medicine, Baltimore, Maryland; Robert Naeije, MD, PhD, Professor and Chairman of the Department of Physiology and Pathophysiology at Erasme University Hospital, Brussels, Belgium; Virginia D. Steen, MD, Professor of Medicine and Director of the Rheumatology Fellowship Program, Georgetown University School of Medicine, Washington, DC; and David Systrom, MD, Director, Cardiopulmonary Exercise Lab, Department of Medicine, Pulmonary Critical Care, Massachusetts General Hospital, Boston, Massachusetts.

Los estilos APA, Harvard, Vancouver, ISO, etc.

8

Hamza, Waleed, Anna N. Neretina, Shamma Eisa Salem Al Neyadi, Khaled M. A. Amiri, Dmitry P. Karabanov y Alexey A. Kotov. "Discovery of a New Species of Daphnia (Crustacea: Cladocera) from the Arabian Peninsula Revealed a Southern Origin of a Common Northern Eurasian Species Group". Water 14, n.º 15 (29 de julio de 2022): 2350. http://dx.doi.org/10.3390/w14152350.

Texto completo

Resumen

The biodiversity distribution patterns and their formation history in continental waters are studied based on some model groups such as Daphnia O.F. Müller (Crustacea: Cladocera). Most publications on this genus concern the subgenus Daphnia (Daphnia) while representatives of the subgenus Daphnia (Ctenodaphnia), inhabiting mainly temporary waters, are poorly studied. We found a new species of the D. (C.) sinensis complex in the deserts of the Arabian Peninsula, and our discovery allows us to resolve some problems concerning the history of these daphniids in the northern hemisphere. A formal description, illustrations (including numerous SEM photos) and a differential diagnosis of D. (C.) arabica Neretina, Al Neyadi & Hamza sp. nov. are provided. Phylogeny of D. (C.) similis complex is reconstructed based on three mitochondrial genes (12S, 16S and COI); a haplotype network based on short 12S fragments is also constructed. A monophyletic D. (C.) sinensis within the D. (C.) similis complex includes three earlier-derived locally distributed members: D. (C.) similoides, D. (C.) inopinata and D. (C.) arabica sp. nov. Our data suggest an old (Late Mesozoic) Gondwanan origin of the D. (C.) sinensis group and its Caenozoic differentiation in North Africa and the Middle East. This region then became a center of subsequent dispersion of D. (C.) sinensis through the whole of Eurasia and Africa during the Miocene and subsequent epochs. Interestingly, our scheme of the D. sinensis group dispersion has a well-known analogue: it is comparable to that suggested for earlier human migration from Africa through the Arabian Peninsula and the Middle East to the rest of Eurasia.

Los estilos APA, Harvard, Vancouver, ISO, etc.

9

Brunner, J. F. y M. D. Doerr. "Bioassay, Effect of Commonly Applied Pesticides on C. Florus in North Central Washington, 1994". Arthropod Management Tests 20, n.º 1 (1 de enero de 1995): 337. http://dx.doi.org/10.1093/amt/20.1.337.

Texto completo

Resumen

Abstract Various insecticides were evaluated for direct toxicity and the effects of field-aged residues on adult females of the leafroller parasitoid Cf. The chemicals tested for direct toxicity were those listed in the “Predator Toxicity Guide-Apple” chart in the “1994 Crop Protection Guide for Tree Fruits in Washington.” B. thuringiensis products (Dipel, Javelin and MVP), growth regulators (Comply, Dimilin, RH-5992 and RH-2485) and M-Pede were tested at the full field rate and the neurotoxins at 10% of the field rate. Ten microliters of a wetting agent (Triton B-1956) were added to each of the B. thuringiensis formulations. Cf females were taken from a colony maintained at the WSU Tree Fruit Research and Extension Center for the assay. The age of Cf adults was standardized at 2-5 d after emergence from the pupal stage. Fifty females reared from at least five separate host larvae were selected for each of the chemicals tested. These females were anesthetized with CO2, placed on a piece of 11-cm filter paper and transferred to a Potter spray tower. The tower applied 4 ml of pesticide at 6 psi of pressure to the parasites. Cf were transferred to petri dishes with snap-on lids (Falcon 1006, 50 × 9 mm). Honey water and a small cube of artificial diet used to rear leafrollers were added to the petri dishes. The diet worked very well for controlling the moisture in the petri dishes, and honey water had been shown to extend Cf life span by providing nutrition. Five Cf were placed into 10 petri dishes for each of the chemicals (50 Cf per treatment) and kept at 75°F (±2°F) constant temperature and a photoperiod of 16:8 (L:D) h. Surviving parasites were counted at 24 and 48 h after treatment. Treatments with significant Cf survival at 10% field rate were then tested at 50% of the field rate. Treatments with survivors at 50% of the field rate were tested at the full field rate. The residue degradation test was conducted in an apple orchard at the Tree Fruit Research and Extension Center. The trees were 15-yr-old spur type ‘Red Delicious’ on dwarfing roots. The insecticides were applied at the recommended field rates (see below) with a handgun sprayer at 300 psi to the point of drip, simulating a dilute spray of approximately 400 gal/acre. Each treatment was replicated three times as a single tree. Ten mature leaves were collected from each tree (replicate). One punch (2.3 cm diameter) was taken from each leaf (10 total from each tree), and two were placed in a small petri dish (Falcon 1006, 50 × 9 mm). A small quantity of diluted honey water was smeared on the lid for a carbohydrate source, and a small piece of artificial diet used to rear leafrollers was placed in the petri dish to help keep humidity at acceptable levels. There were five petri dishes for each replicate (15 for each treatment). After the leaves were placed in the petri dish and each dish was labeled with a replicate and treatment code, one was chosen at random and five adult Cf females, age 2-3 d old, were placed inside (75 females per treatment). The petri dishes were placed inside a food storage container and kept at 20°C constant temperature and a photoperiod of 16:8 (L:D) h. The no. of survivors was counted at 24 and 48 h. This bioassay was repeated at 1, 3, 7, 14 and 21 d after treatment (DAT) for treatments where Cf mortality was significantly different than the untreated check.

Los estilos APA, Harvard, Vancouver, ISO, etc.

10

Shankaran, Veena, Shasank Chennupati, Hayley Sanchez, Qin Sun, Abdalla Aly, Healey Marcus y Brian S. Seal. "Healthcare utilization and costs in hepatocellular carcinoma (HCC) patients treated at a large referral center in Washington (WA) State." Journal of Clinical Oncology 39, n.º 15_suppl (20 de mayo de 2021): e16149-e16149. http://dx.doi.org/10.1200/jco.2021.39.15_suppl.e16149.

Texto completo

Resumen

e16149 Background: Though the treatment landscape for HCC has changed significantly in the last several years with the refinement of liver-directed therapy techniques and the introduction of multiple new drugs, few studies have investigated the impact of the changing treatment landscape on lifetime treatment costs, particularly in Barcelona Clinic Liver Cancer (BCLC) stage C disease. We therefore sought to investigate real-world clinical characteristics, treatment patterns, healthcare use, and costs in patients with HCC treated at a single high-volume institution in WA. Methods: We conducted a retrospective cohort study of patients diagnosed with HCC between 2007 and 2018 at a single clinical cancer center using a database containing abstracted data from the electronic medical record (EMR) linked to cancer registry data and health claims from commercial insurance plans, Medicare, and Medicaid. We described clinical characteristics, including BCLC stage and Child Pugh score, and treatment patterns. We investigated the mean per patient lifetime treatment costs by BCLC stage using Kaplan-Meier cost estimator methods. Results: The final cohort included 215 patients, majority white (71%), male (68%), and with underlying hepatitis C (61%). Most patients had either Child Pugh A (76%) or B (20%) liver disease and BCLC A (45%), B (20%), or C (19%) stage HCC. Only 40% of BCLC C patients received systemic chemotherapy. Mean per patient lifetime costs were highest in BCLC A ($289,318) and BCLC C ($255,430) patients and lowest in BCLC D ($123,701) patients (Table). Surgical costs, hospital costs, imaging, and outpatient visits were the major contributors to total lifetime costs in BCLC A patients. Chemotherapy costs were highest in BCLC C patients, but still were not the predominant area of spending. Conclusions: In a WA state cohort of HCC patients, mean lifetime costs were highest in patients with BCLC A disease, largely driven by surgery and hospital costs. As utilization of newer and less toxic therapies in BCLC C patients increases, mean lifetime costs in this group may surpass other stages.[Table: see text]

Los estilos APA, Harvard, Vancouver, ISO, etc.

11

Arundel, Cherinne, Jessica Logan, Ribka Ayana, Jacqueline Gannuscio, Jennifer Kerns y Rebecca Swenson. "Safe Medication Reconciliation: An Intervention to Improve Residents' Medication Reconciliation Skills". Journal of Graduate Medical Education 7, n.º 3 (1 de septiembre de 2015): 407–11. http://dx.doi.org/10.4300/jgme-d-14-00565.1.

Texto completo

Resumen

ABSTRACT Background Medication errors during hospitalization are a major patient safety concern. Medication reconciliation is an effective tool to reduce medication errors, yet internal medicine residents rarely receive formal education on the process. Objective We assessed if an educational intervention on quality improvement principles and effective medication reconciliation for internal medicine residents will lead to fewer medication discrepancies and more accurate discharge medication lists. Methods From July 2012 to May 2013, internal medicine residents from 3 academic institutions who were rotating at the Washington DC VA Medical Center received twice-monthly interactive educational sessions on medication reconciliation, using both institutional summary metrics and data from their own discharges. Sessions were led by a faculty member or chief resident. Accuracy of discharge instructions for residents in the intervention group was compared to the accuracy of discharge data from June 2012 for a group of residents who did not receive the intervention. We used χ2 analysis to assess for differences. Results The number of duplicate medications (23% versus 12%, P = .01); extraneous medications (14% versus 6%, P = .014); medications sorted by disease or indication (25% versus 77%, P < .001); and the number of discrepancies in discharge summaries (34% versus 11%, P < .001) statistically improved. No difference in the number of omissions was found between the 2 groups (17% versus 15%, P = .62). Conclusions An educational intervention targeting internal medicine residents can be implemented with reasonable staff and time costs, and is effective in reducing the number of medication discrepancies at discharge.

Los estilos APA, Harvard, Vancouver, ISO, etc.

12

Ahmed, Masood. "Asia’s Cauldron: The South China Sea and the end of a stable Pacific, 18‘ edition. By Robert D. Kaplan. Random House, New York. 2014. ISBN 978-0-8129-9906-8. 225pp. Paperback, $18." JISR management and social sciences & economics 12, n.º 2 (31 de diciembre de 2014): 103–4. http://dx.doi.org/10.31384/jisrmsse/2014.12.2.9.

Texto completo

Resumen

The ascending power of China has precipitated a glut of books on the role of China in the 21st Century among which Asia’s Cauldron by Robert D. Kaplan looks at the changing realities of the 21S' century as China rises after decades of slumber and the centre stage of the world moves towards the East. Robert D. Kaplan was chief geopolitical analysts for Stratfor, a private global intelligence firm. till December 2014. Presently, he is a Senior Fellow at the Center for New American Security in Washington D. C. In 2011 and 2012, he was named by Foreign Policy magazine as one of the world's top 100 global thinkers. The book represents an American perspective on the changing power dynamics of the globe as a result of ascending economic and military power of China. The focus of the book is on the South China Sea that holds oil reserves of several billion barrels and an estimated nine hundred trillion cubic feet of natural gas rendering it as the simmering pot of potential conflict hence the book is given the name Asia’s Cauldron. The title page shows a picture where top half consists of Junk, ancient Chinese sailing ship and the bottom half consists of modern cargo ship alluding to the centrality of maritime trade that gives South China Sea its global importance since ancient times.

Los estilos APA, Harvard, Vancouver, ISO, etc.

13

Borbély, Hajnalka. "Katalin Fábián: Contemporary Women’s Movements in Hungary: Globalization, Democracy, and Gender Equality (Woodrow Wilson Center Press–John Hopkins University Press, Washington D. C., 2009, pp. 379)". Társadalomkutatás 28, n.º 4 (diciembre de 2010): 479–82. http://dx.doi.org/10.1556/tarskut.28.2010.4.9.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

14

Smith, G. S. "Maurice Friedberg. Russian Culture in the 1980s. Washington. D. C.: Center for Strategie and International Studies. George town University, 1985. viii, 88 pp. No price (paper)." Canadian-American Slavic Studies 21, n.º 2 (1987): 147–48. http://dx.doi.org/10.1163/221023987x00321.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

15

Eastwell, K. C. y W. E. Howell. "Characterization of Cherry leafroll virus in Sweet Cherry in Washington State". Plant Disease 94, n.º 8 (agosto de 2010): 1067. http://dx.doi.org/10.1094/pdis-94-8-1067b.

Texto completo

Resumen

A visual survey in 1998 of a commercial block of 594 sweet cherry trees (Prunus avium) in Yakima County, WA, revealed three trees of cv. Bing growing on Mazzard rootstock that exhibited a progressive decline characterized by a premature drop of yellowed leaves prior to fruit maturity and small, late ripening cherries that were unsuitable for the fresh market. Many young branches of these trees died during the winter, resulting in a sparse, open canopy depleted of fruiting shoots. The budded variety of a fourth tree had died, allowing the F12/1 rootstock to grow leaves that showed intense line patterns. Prunus necrotic ringspot virus or Prune dwarf virus are common ilarviruses of cherry trees but were only detected by ELISA (Agdia, Elkhart, IN) in two of the Bing trees. A virus was readily transmitted mechanically from young leaves of each of the two ilarvirus-negative trees to Chenopodium quinoa and Nicotiana occidentalis strain ‘37B’, which within 5 days, developed systemic mottle and necrotic flecking, respectively. Gel analysis of double-stranded RNA (dsRNA) isolated from C. quinoa revealed two abundant bands of approximately 6.5 and 8.0 kbp. The C. quinoa plants and the four symptomatic orchard trees were free of Arabis mosaic virus, Blueberry leaf mottle virus, Peach rosette mosaic virus, Raspberry ringspot virus, Strawberry latent ringspot virus, Tobacco ringspot virus, Tomato black ring virus, and Tomato ringspot virus when tested by ELISA. However, C. quinoa leaf extracts reacted positively in gel double diffusion assays with antiserum prepared to the cherry isolate of Cherry leafroll virus (CLRV) (2). A CLRV-specific primer (3) was used for first strand synthesis followed by self-primed second strand synthesis to generate cDNAs from the dsRNA. A consensus sequence of 1,094 bp generated from three clones of the 3′-untranslated region (3′-UTR) of CLRV (GenBank Accession No. GU362644) was 98% identical to the 3′-UTR of CLRV isolates from European white birch (GenBank Accession Nos. 87239819 and 87239633) and 96% identical to European CLRV isolates from sweet cherry (GenBank Accession Nos. 87239639 and 8729640) (1). Reverse transcription (RT)-PCR using primers specific for the 3′-UTR (CGACCGTGTAACGGCAACAG, modified from Werner et al. [3] and CACTGCTTGAGTCCGACACT, this study), amplified the expected 344-bp fragment from the original four symptomatic trees and two additional symptomatic trees in the same orchard. Seventy-two nonsymptomatic trees were negative by the RT-PCR for CLRV. In 1999, CLRV was detected by RT-PCR in six of eight samples and seven of eight samples from declining trees in two additional orchards located 2.5 km and 23.3 km from the original site, respectively. Sequences of the 344-bp amplicons from these sites were 99.7% identical to those obtained from the first site. To our knowledge, this is the first report of the natural occurrence of CLRV in sweet cherry in the United States. Unlike other nepoviruses, CLRV appears not to be nematode transmitted; however, since this virus can be seed and pollen borne in some natural and experimental systems, its presence in independent orchards of a major production region raises concern about its long term impact on sweet cherry production. References: (1) K. Rebenstorf et al. J. Virol. 80:2453, 2006. (2) D. G. A. Walkey et al. Phytopathology 63:566, 1973. (3) R. Werner et al. Eur. J. For. Pathol. 27:309, 1997.

Los estilos APA, Harvard, Vancouver, ISO, etc.

16

Parks, C. G., C. M. Raley, K. B. Aubry y R. L. Gilbertson. "Wood Decay Associated with Pileated Woodpecker Roosts in Western Redcedar". Plant Disease 81, n.º 5 (mayo de 1997): 551. http://dx.doi.org/10.1094/pdis.1997.81.5.551c.

Texto completo

Resumen

The pileated woodpecker (Dryocopus pileatus) is a species of concern to forest managers because it uses cavities in large snags and decadent trees for nesting and roosting. A radio-telemetry study of pileated woodpeckers on the Olympic Peninsula of western Washington (1) found that large western redcedar (Thuja plicata Donn ex D. Don) were frequently used for roosting. These roost trees were partially hollow or softened by internal decay. Western redcedar is thought to be less susceptible to most fungal pathogens than are other conifers. This misconception probably arose because of the high resistance to decay of cedar heartwood under service conditions. Many heartwood fungi do, however, attack living redcedar during their lifespan (often over 1,000 years), and large western redcedar have a high incidence of heartwood decay (2). Two to four wood cores were removed below openings used by radio-tagged woodpeckers at heights of 7.5 to 10.5 m on each of 10 large (200 to 300 cm diameter at 1.4 m above ground), living western redcedars. Wood samples were cultured on malt extract agar. No pure cultures of wood-decay fungi were obtained from two trees, although the samples were visually decayed. Oligoporus sericeomollis (Romell) Bondartzeva (= Poria asiatica (Pilát) Overh.) was the only wood-decay fungus isolated from the remaining eight trees. O. sericeomollis causes a brown, cubical heartrot in living western redcedar. In late stages of decay, the rot column typically forms a piped or tubular shape, can extend 25 or more meters up the bole of the tree, and can spread out into large branches (2). Pileated woodpeckers often roost in large, longitudinal tree cavities having multiple openings that provide a means of escape from potential predators. The decay columns produced by O. sericeomollis may create optimal roosting conditions in western redcedar for pileateds. During the telemetry study, woodpeckers were observed entering redcedars at one opening, but exiting from another opening some distance away. Large western redcedars that contain heartrot before they die may be particularly important to pileated woodpeckers because these trees persist in the landscape and provide potential roost sites far longer than other tree species in western Washington, perhaps even for centuries. Information from this and similar studies may be useful for developing inoculation techniques that use fungi with specific decay characteristics to create habitat for woodpeckers. References: (1) K. B. Aubry and C. M. Raley. Northwest Env. J. 6:432, 1990. (2) D. C. Buckland. Can. J. Res. C. 24:158, 1946.

Los estilos APA, Harvard, Vancouver, ISO, etc.

17

Atwa, Mohamed A., Robert C. Smallridge, Henry B. Burch, Irene D. Gist, Rui Lu, Ekbal M. Abo-Hashem, Mohamed H. El-Kannishy y Kenneth D. Burman. "Immunoglobulins from Graves' disease patients stimulate phospholipase A2 and C systems in FRTL-5 and human thyroid cells". European Journal of Endocrinology 135, n.º 3 (septiembre de 1996): 322–27. http://dx.doi.org/10.1530/eje.0.1350322.

Texto completo

Resumen

Atwa MA, Smallridge RC, Burch HB, Gist ID, Lu R, Abo-Hashem EM, El-Kannishy MH, Burman KD. Immunoglobulins from Graves' disease patients stimulate phospholipase A2 and C systems in FRTL-5 and human thyroid cells. Eur J Endocrinol 1996;135:322–7. ISSN 0804–4643 We have studied the effects of immunoglobulin G from Graves' disease patients on phospholipase A2 (PLA2) and C (PLC) systems in FRTL-5 and human thyroid cells. Immunoglobulin G (IgG) from Graves' disease patients stimulated arachidonic acid (AA) release in a time- and dose-dependent manner. In FRTL-5 thyroid cells, removal of external calcium had no significant effect on the IgG (20 μg/ml)-induced AA release in FRTL-5 thyroid cells. U-73122 (3 μmol/l), a PLC inhibitor, and quinacrine (100 μmol/l) but not U-26384 (5 μmol/l), PLA2 inhibitors, blocked the IgG-induced (20 μg/ml) AA release in FRTL-5 thyroid cells. Immunoglobulin G (100 μg/ml) also stimulated accumulation of inositol-1,4,5-triphosphate (IP3) in a time- and dose-dependent (20–300 μg/ml) manner in FRTL-5 cells. Immunoglobulin G from Graves' disease patients induced a significant increase of IP3 production (p = 0.01) compared to IgG from normal subjects. Removal of external calcium had no significant effect on the IgG-induced IP3 production. The PLC inhibitor U-73122 completely blocked IgG-induced IP3 production from FRTL-5 thyroid cells. Also, in human thyroid cells, IgG from Graves' disease patients induced a significant increase of AA release (p = 0.001) and IP3 production (p = 0.004) compared to the IgG from normal subjects. These data indicate that IgG from Graves' disease patients induced PLA2 activity that was PLC dependent, a pattern referred to as sequential activation. Our studies suggest that IgG from Graves' disease patients activates PLA2 and PLC systems in FRTL-5 and human thyroid cells. These signal transduction pathways could be involved in the pathogenesis of Graves' disease and future studies are warranted to investigate this area. Kenneth D Burman, Endocrine Section, Washington Hospital Center, 110 Irving St. NW, Washington, DC 20010, USA

Los estilos APA, Harvard, Vancouver, ISO, etc.

18

Ahmed, Ayaz. "Joachim von Braun and Rajul Pandya-Lorch (eds.). Food Policy for the Poor: Expanding the Research Frontiers: Highlights from 30 Years of IFPRI Research. Washington, D. C.: IFPRI, 2005. 253 Pages. Price not given." Pakistan Development Review 44, n.º 3 (1 de septiembre de 2005): 321–23. http://dx.doi.org/10.30541/v44i3pp.321-323.

Texto completo

Resumen

The research of the past 30 years at the International Food Policy Research Institute (IFPRI) is highlighted in this volume. The topic is food and nutrition security. Of related concern are the development strategies that impact on technologies for agricultural production, resource management, conflicts and natural disasters, subsidies and safety nets, gender roles, and health. The book consists of nine chapters. The first chapter discusses a changing IFPRI in a changing world. The current and future world food situation is analysed and ways are suggested to increase agricultural production and to explore policies for improving production, trade, and distribution of food so that an increase in the quantity and quality of food would be available for all people. IFPRI has heightened its efforts to raise the awareness about emerging food security issues. In particular, its “2020 Vision for Food, Agriculture, and the Environment” initiative is aimed at promoting policy actions that will lead to food and nutrition security.

Los estilos APA, Harvard, Vancouver, ISO, etc.

19

Toit, L. J. du, D. A. Inglis y G. Q. Pelter. "Fusarium proliferatum Pathogenic on Onion Bulbs in Washington". Plant Disease 87, n.º 6 (junio de 2003): 750. http://dx.doi.org/10.1094/pdis.2003.87.6.750a.

Texto completo

Resumen

Fusarium oxysporum f. sp. cepae and an unidentified Fusarium species have been reported to cause bulb rot of onion (Allium cepa L.) in Washington (1). In August and September 2002, a salmon-pink discoloration was observed on the outer three to four layers of dry scales of approximately 20% of white onion bulbs of cv. Cometa F1, in each of two 20-acre fields in the Columbia Basin of central Washington. Isolations from the discolored areas of the dry scales onto water agar and potato dextrose agar (PDA) yielded fungal colonies characteristic of F. proliferatum (3). The isolates formed long, V-shaped chains of microconidia on polyphialides. Pathogenicity of the isolates of F. proliferatum was tested on white onion bulbs purchased at a local grocery store. The outermost dry scales of each bulb were removed, and the bulb was inoculated by one of three methods: (i) a 5-mm3 section of the fleshy scales was removed using a scalpel, the wound was filled with a 3-mm2 plug of PDA colonized by F. proliferatum, the plug was covered with the section of scale that had been removed, and the inoculation site was covered with Parafilm; (ii) the basal plate of the bulb was dipped into a suspension of 106 microconidia per ml; or (iii) the basal plate was dipped into the spore suspension after wounding by inserting a dissecting needle into the bulb to a depth of 1 cm. A noninoculated bulb provided a control treatment. Bulbs were incubated in a moist chamber at 13°C and examined for discoloration of the outer scales and development of bulb rot. After 2 weeks, salmon-pink discoloration of the outer scales was observed at the inoculation site for both methods of dip inoculation, but not for the plug inoculation method. After 3 weeks, water-soaked, tan to golden, shrunken, soft tissue was observed on the remainder of each dip inoculated bulb, but symptoms of basal rot did not develop. Symptoms were similar to those reported in Idaho for a bulb rot of stored onions caused by F. proliferatum (2). One of the nonwounded inoculated bulbs did not develop a bulb rot, but pinkish discoloration was observed beneath the outer scales and in the neck. F. proliferatum was reisolated from the inoculated bulb tissues. The discoloration observed on the white onions raised concern about the potential for infection to develop into bulb rot in storage. However, thorough curing of the bulbs immediately upon storage restricted infection to the outer dry scales. Similar symptoms were observed at harvest on the bulbs of other white onions in a cultivar trial located near Quincy, WA, although symptoms were not observed on yellow or red cultivars in the trial. The same symptoms were later observed on approximately 70% of bulbs harvested from a 32-acre fresh-market crop of the cv. Sterling in the Columbia Basin. These symptomatic bulbs were rejected for the fresh market. To our knowledge, this is the first report of infection of onion bulbs by F. proliferatum in Washington, which in 2001, had the third largest acreage of onions in the United States after California and Oregon (USDA National Agricultural Statistics Service). References: (1) D. F. Farr et al. Fungi on Plants and Plant Products in the United States. The American Phytopathological Society, St. Paul, MN, 1989. (2) S. K. Mohan et al. (Abstr.) Phytopathology 87:S67, 1997. (3) P. E. Nelson et al. Fusarium species: An Illustrated Manual for Identification. The Pennsylvania State University Press, University Park, 1983.

Los estilos APA, Harvard, Vancouver, ISO, etc.

20

Chen, W., F. M. Dugan y R. McGee. "First Report of Dodder (Cuscuta pentagona) on Chickpea (Cicer arietinum) in the United States". Plant Disease 98, n.º 1 (enero de 2014): 165. http://dx.doi.org/10.1094/pdis-03-13-0334-pdn.

Texto completo

Resumen

Chickpea (Cicer arietinum L.) is an important rotational and an emerging specialty crop in the Pacific Northwest of the United States, in California, and in the Northern Great Plains of the United States and Canada. Dodders (Cuscuta spp.) are widespread parasitic weeds on many crops worldwide. Several Cuscuta species (primarily C. campestris Yuncker) have been reported to parasitize chickpea, and dodder is important on chickpea in the Indian subcontinent, the Middle East, and recently in Australia (4), but has previously not been reported from North America. On 28 July 2012, a chickpea field near Walla Walla, WA, was found parasitized by dodder. The chickpea was at late flowering and early pod filling stages and there were no other visible green weedy plants as observed from the canopy. There were about 15 dodder colonies varying in size from 2 to 15 meters in diameter in the field of about 500 acres. Chickpea plants in the center of the dodder colonies were wilting or dead. The colonies consisted of orange leafless twining stems wrapped around chickpea stems and spreading between chickpea plants. Haustoria of the dodder penetrating chickpea stems were clearly visible to the naked eye. Flowers, formed abundantly in dense clusters, were white and five-angled, with capitate stigmas, and lobes on developing calyxes were clearly overlapping. The dodder keyed to C. pentagona Engelm. in Hitchcock and Cronquest (3) and in Costea (1; and www.wlu.ca/page.php?grp_id=2147&p=8968 ). Specimens of dodder plants wrapping around chickpea stems with visible penetrating haustoria were collected on 28 July 2013 and vouchers (WS386115, WS386116, and WS386117) were deposited at the Washington State University Ownbey Herbarium. All dodder colonies in the field were eradicated before seed formation to prevent establishment of dodder. Total genomic DNA was isolated from dodder stems, and PCR primers ITS1 (5′TCCGTAGGTGAACCTGCGG) and ITS4 (5′TCCTCCGCTTATTGATATGC) were used to amplify the internal transcribed spacer (ITS) region of the nuclear rDNA. The ITS region was sequenced. BLAST search of the NCBI nucleotide database using the ITS sequence as query found that the most similar sequence was from C. pentagona (GenBank Accession No. DQ211589.1), and our ITS sequence was deposited in GenBank (KC832885). Dodder (C. approximata Bab.) has been historically a regional problem on alfalfa (Washington State Noxious Weed Control Board 2011). Another species stated to be “mainly” associated with legumes is C. epithymum Murr., and C. pentagona is “especially” associated with legumes (3). The latter species has sometimes been considered a variety (var. calycina) of C. campestris Yuncker (1,3). Although chickpea has been cultivated in the Walla Walla region for over 20 years, to our knowledge, this is the first time dodder has been observed on chickpea in North America. The likely source is from nearby alfalfa or other crop fields, with transmission by farm machinery or wild animals. Some chickpea germplasm exhibits partial resistance to C. campestris (2). References: (1) M. Costea et al. SIDA 22:151, 2006. (2) Y. Goldwasser et al. Weed Res. 52:122, 2012. (3) C. L. Hitchcock and A. Cronquist. Flora of the Pacific Northwest: An Illustrated Manual. University of Washington Press, Seattle, 1973. (4) D. Rubiales et al. Dodder. Page 98 in: Compendium of Chickpea and Lentil Diseases and Pests. W. Chen et al., eds. APS Press, St. Paul, Minnesota, 2011.

Los estilos APA, Harvard, Vancouver, ISO, etc.

21

Tith, Solina, Garinder Bining y Laurent A. Bollag. "Management of eight labor and delivery patients dependent on buprenorphine (Subutex™): A retrospective chart review". F1000Research 7 (3 de enero de 2018): 7. http://dx.doi.org/10.12688/f1000research.13350.1.

Texto completo

Resumen

Background: Opioid use during pregnancy is a growing concern in the United States. Buprenorphine has been recommended by “The American College of Obstetrics and Gynecology” as an alternative to methadone to decrease risks associated with the use of illicit opioids during pregnancy. The partial μ-opioid agonists’ unique pharmacology, including its long half time and high affinity to the μ-opioid receptor, complicates patient management in a highly kinetic, and often urgent field like obstetric anesthesia. We reviewed our management and outcomes in this medically complex population. Methods: An Institutional Review Board (IRB) approved retrospective chart review was conducted of women admitted to the University of Washington Medical Center Labor and Delivery unit from July 2012 to November 2013 using buprenorphine. All deliveries, including intrauterine fetal demise, were included. Results: Eight women were admitted during this period to our L&D floor on buprenorphine. All required peri-partum anesthetic management either for labor and/or cesarean delivery management. Analgesic management included dilaudid or fentanyl PCA and/or continued epidural infusion, and in one instance ketamine infusion, while the pre-admission buprenorphine regimen was continued. Five babies were viable, two women experienced intrauterine fetal death at 22 and 36 weeks gestational age (GSA), respectively, and one neonate died shortly after delivery due to a congenital diaphragmatic hernia. Conclusions: This case series illuminates the medical complexity of parturients using buprenorphine. Different treatment modalities in the absence of evidence-based guidelines included additional opioid administration and continued epidural analgesia. The management of post-cesarean pain in patients on partial μ-opioid agonists remains complex and variable, and evidence-based guidelines could be useful for clinicians to direct care.

Los estilos APA, Harvard, Vancouver, ISO, etc.

22

Tith, Solina, Garinder Bining y Laurent A. Bollag. "Management of eight labor and delivery patients dependent on buprenorphine (Subutex™): A retrospective chart review". F1000Research 7 (14 de febrero de 2018): 7. http://dx.doi.org/10.12688/f1000research.13350.2.

Texto completo

Resumen

Background: Opioid use during pregnancy is a growing concern in the United States. Buprenorphine has been recommended by “The American College of Obstetrics and Gynecology” as an alternative to methadone to decrease risks associated with the use of illicit opioids during pregnancy. The partial μ-opioid agonists’ unique pharmacology, including its long half time and high affinity to the μ-opioid receptor, complicates patient management in a highly kinetic, and often urgent field like obstetric anesthesia. We reviewed our management and outcomes in this medically complex population. Methods: An Institutional Review Board (IRB) approved retrospective chart review was conducted of women admitted to the University of Washington Medical Center Labor and Delivery unit from July 2012 to November 2013 using buprenorphine. All deliveries, including intrauterine fetal demise, were included. Results: Eight women were admitted during this period to our L&D floor on buprenorphine. All required peri-partum anesthetic management either for labor and/or cesarean delivery management. Analgesic management included dilaudid or fentanyl PCA and/or continued epidural infusion, and in one instance ketamine infusion, while the pre-admission buprenorphine regimen was continued. Five babies were viable, two women experienced intrauterine fetal death at 22 and 36 weeks gestational age (GSA), respectively, and one neonate died shortly after delivery due to a congenital diaphragmatic hernia. Conclusions: This case series illuminates the medical complexity of parturients using buprenorphine. Different treatment modalities in the absence of evidence-based guidelines included additional opioid administration and continued epidural analgesia. The management of post-cesarean pain in patients on partial μ-opioid agonists remains complex and variable, and evidence-based guidelines could be useful for clinicians to direct care.

Los estilos APA, Harvard, Vancouver, ISO, etc.

23

Machemer, P. L. "Reviews: Books: The American Planning Tradition: Culture and Policy edited by Robert Fishman. Washington, D. C.: The Woodrow Wilson Center Press, 2000. ix + 328 pages, $24.95 paperback. ISBN 0-943875-95-X". Landscape Journal 20, n.º 2 (1 de enero de 2001): 191–92. http://dx.doi.org/10.3368/lj.20.2.191.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

24

Okoro, O. Ike y Nduka Lucas Oluka. "Weapons of Mass Destruction and Modern Terrorism: Implications for Global Security". Asian Social Science 15, n.º 3 (28 de febrero de 2019): 1. http://dx.doi.org/10.5539/ass.v15n3p1.

Texto completo

Resumen

The hazard of biological, chemical and nuclear materials, regarded as Weapons of Mass Destruction (WMD), intercalating the arsenal of terrorists is the biggest crime and challenge against humanity. Every such crime and challenge ought to be named appropriately; and state actors experiencing such owe it to their citizens to act speedily and with certainty against terrorists. Even with the on-going war on terrorism, there has been a surge in terrorist activities in some parts of the world. Terrorists in our contemporary age have also embraced startling trends in their operational mode since the 11 September 2001 fanatic attacks in New York and Washington D. C. The devastating effect of these twin attacks has raised global concern about the potential use of WMD by Al-Qaeda, the Islamic State of Iran and Syria (ISIS), and their affiliate groups. One major issue of great concern in recent times, apart from the propensity of the terrorist organizations to acquire WMD, is the involvement of state actors that secretly acquire or claim to have acquired them for the purposes of electricity generation. Notably, too, is the trend in modern scientific and technological improvement which has increased the nature of, and access to, WMD. This research, therefore, attempts to access the implication and impact of WMD as terrorists put them to use. The study also examines the concept of terrorism and WMD. Also examined is the general implication of the use of WMD and the challenges this might pose to the international community, considering the current trends in their acquisition by some states and non-state actors. The investigation suggests appropriate counter-measures to thwart terrorists’ effort to acquire WMD. The study also adopted the qualitative approach of research to analyse the sophistication adopted by new terrorist groups particularly by the ISIS terrorist network; the al-Qaeda group and other splinter groups. Thus, historical research is most appropriate for this study, and secondary source of data was adopted as its methodology.

Los estilos APA, Harvard, Vancouver, ISO, etc.

25

Drieu, Michael, Patrick Lynch, Pete Jensen, Chris Doane, John Brolin y Chris Zukowski. "Lessons Learned from 2002 Spill of National Significance (SONS) Exercise Gulf of Mexico". International Oil Spill Conference Proceedings 2003, n.º 1 (1 de abril de 2003): 1269–73. http://dx.doi.org/10.7901/2169-3358-2003-1-1269.

Texto completo

Resumen

ABSTRACT The U.S. Coast Guard (USCG) hosted the 2002 SONS Gulf National Incident Commander (NIC) Exercise in New Orleans, Louisiana on 23–25 April 2002 and the 2002 SONS Gulf Executive Seminar in Washington, D. C. on 26 April 2002. This massive effort was accomplished through almost two years of planning by a government/industry workgroup representing the USCG, Texas General Land Office (TGLO), Louisiana Oil Spill Coordinator's Office, ExxonMobil, Stolt-Nielsen Transportation Group, and Environmental Protection Agency Region VI. The original SONS exercise was scheduled to exercise the Nation's ability to respond to a SONS in a two-part format. The terrorist attacks at the Pentagon and the World Trade Center in September 2001 required that the original SONS exercise plans be delayed and amended. The final SONS exercise format was a three-part series. The first part involved tabletop discussions with port-level responders to determine what actions and issues would result from the exercise scenarios. The second part was a multi-day NIC tabletop exercise to understand the roles and responsibilities of the NIC by exploring the NIC's reactions to the scenarios and the issues raised by the affected ports. The third part was an executive-level seminar attended by senior federal government and industry executives as well as elected officials to discuss reactions to national-level issues identified by the NIC and to enhance interagency communication at the headquarters level.

Los estilos APA, Harvard, Vancouver, ISO, etc.

26

Gibbons, Dick. "Energy efficiency in cleanrooms and separative devices: ISO 14644-16, outreach article". Journal of the IEST 63, n.º 1 (1 de diciembre de 2020): 91–95. http://dx.doi.org/10.17764/1557-2196-63.1.

Texto completo

Resumen

Abstract The ISO 14644 family of cleanroom standards has been at the center of international cleanroom standards development for many years and covers most facets of cleanroom activity and cleanroom types from large ballroom cleanrooms to isolators and clean tunnels. The series is under constant review and is still expanding. Recent documents that have been released concern the quantification of airborne and surface chemical concentrations, nanoparticles and the selection and testing of equipment used within these rooms. However, apart from some misleading information in the original Part 4 design document, questions concerning the energy demands from air purification processing have been overlooked. Nationally, institutions such as the BSI in UK, DIN- VDI in Germany and IEST in the USA have produced limited information on the topic, but Part 16 is the first standard to be internationally agreed upon. The key new features of the standard are a) the preparation of an accurate User Requirement Specification (URS), b) a practical method for estimating the volume of supply air needed to maintain the specified ISO room classifications in operation, c) tuning and d) benchmarking. An informative annex develops three useful metrics for benchmarking: power intensity for contamination removal (PICR), fan energy intensity for contamination removal (EICR) and energy intensity (EI).

Los estilos APA, Harvard, Vancouver, ISO, etc.

27

Aparicio, Thomas, Pierre-Luc Etienne, Olivier Bouche, Laurent Mineur, Sandrine Hiret, Jean Martin, Romain Desgrippes et al. "PRODIGE 34 ADAGE: Adjuvant chemotherapy in elderly patients with resected stage III colon cancer—A randomized phase III trial." Journal of Clinical Oncology 35, n.º 15_suppl (20 de mayo de 2017): TPS3628. http://dx.doi.org/10.1200/jco.2017.35.15_suppl.tps3628.

Texto completo

Resumen

TPS3628 Background: Colon cancer (CC) occurs in around 50% of the patients after 70 years. Adjuvant chemotherapy (CT) has demonstrated a benefit on disease-free survival (DFS) and overall survival after a stage III CC resection. Nevertheless, adjuvant CT is poorly used in elderly patients. There is still concern about the efficacy of doublet CT with oxaliplatin in fit elderly patients and the usefulness of fluoropyrimidine monotherapy in unfit elderly patients. The selection of patients that should be treated remains a challenge. Geriatric evaluation and tumor biology should be explored to help for patient selection. Methods: ADAGE is a multicenter, randomized phase III study comparing 3-years DFS of 2 therapeutic strategies in 2 groups of patients aged over 70 with completely resected stage III CC. Patients are included in one of the 2 groups after a multidisciplinary team evaluation; Group 1 (arm A and B) is defined as “able” to be treated with doublet CT; Group 2 (arm C and D) is defined as “unable” to be treated with doublet CT. In each group, patients are randomized according to a 1:1 ratio. Randomization is stratified according to center, gender, stage (IIIA vs IIIB vs IIIC), occlusion and/or perforation (yes vs no) and independent activity of daily living score (IADL: normal vs abnormal). Arm A and D receive LV5FU2 or capecitabine, arm B FOLFOX4 or XELOX and arm C is an observation arm. The treatment is planned for 6 months. Adjuvant CT should start within 12 weeks after surgery. Geriatric questionnaires and Lee score must be completed before randomization. Radiological assessment is performed every 6 months for 3 years after randomization and then annually for 2 years. Hypotheses (α two-sided = 5%, power = 80%) are to improve 3-years DFS from 65% (arm A) to 72% (arm B) in group 1 (756 patients required) and from 40% (arm C) to 55% (arm D) in group 2 (226 patients required). Safety is evaluated based on laboratory and clinical tests before each cycle. Exploratory analysis are planned to determine geriatric prognostic factors for DFS. A biological ancillary study is planned to allow prognostic evaluation of mismatch repair status and other molecular signatures. At the 1stof February 2017 the accrual was 246 patients. Clinical trial information: NCT02355379.

Los estilos APA, Harvard, Vancouver, ISO, etc.

28

Retnosari, Dewi y Prima Apriwenni. "OPINI AUDIT GOING CONCERN: FAKTOR-FAKTOR YANG MEMENGARUHI". Jurnal Akuntansi 10, n.º 1 (28 de febrero de 2021): 28–39. http://dx.doi.org/10.46806/ja.v10i1.797.

Texto completo

Resumen

Going Concerned is one of the considerations seen by investors before making an investment. Going concern audit opinion is an audit opinion issued by the auditor to determine whether the entity can maintain its life within a certain period of time. The object of research used in this study is the infrastructure sector companies listed on the Indonesia Stock Exchange (IDX) in the period 2018 - 2020. The sample of this study consisted of 44 companies so that the observation data obtained 132 data. The sampling technique used the purposive sampling method. The data analysis method used is the descriptive statistical test, classical assumption test of normality, multicollinearity, autocorrelation, regression model feasibility test, overall model fit test, coefficient of determination test, logistic regression model test, partial model significance test, and simultaneous test with SPSS application. version 25. The conclusion of this study shows that the profitability ratio has a negative effect on going-concern audit opinion. While the ratio of liquidity and solvency has no effect ongoing concern audit opinion. Keywords: Profitability, Liquidity, Solvency, Audit Opinion, Going Concern. References: Ghozali, I. (2018). Aplikasi Analisis Multivariate Dengan Program IBM SPSS 25. Edisi 9.Semarang: Badan Penerbit Universitas Diponnegoro. Hery. (2015). Analisis Laporan Keuangan: Pendekatan Rasio Keuangan. Yogyakarta : CAPS (Center for Academic Publishing Service). Ikatan Akuntan Indonesia. (2011). PSA 29 Seksi 508: Laporan Auditor Independen Atas Laporan Keuangan. 29, 1–23. Indriyani (Akademi Maritim Nusantara), & Pandasari, T. (Universitas M. P. (2019). Pengaruh Current Ratio Dan Return On Asset (ROA) Terhadap Opini Audit Going Concern Perusahaan Pelayaran Yang Go Publik Periode 2012-2016. Jurnal Manajemen Dan Bisnis media ekonomi, XIX(1), 182–189. Institut Akuntan Publik Indonesia. (2011). PSA No. 30 SA Seksi 341. Standar Profesional Akuntan Publik, 30, 2. Investasi.kontan (2018), Ini yang jadi penyebab Turba alam manunggal (TRUB) didelisting, https://investasi.kontan.co.id/news/ini-yang-jadi-penyebab truba-alam-manunggal-trub-didelisting Irwanto, F., & Tanusdjaja, H. (2020). Pengaruh Profitabilitas, Likuiditas, dan Solvabilitas terhadap Opini Audit Terkait Going Concern (Studi pada Perusahaan Manufaktur yang Terdaftar di BEI Periode 2015-2017). Jurnal Multiparadigma Akuntansi Tarumanagara, 2(1), 298–307. Jensen, Michael C. dan W.H. Meckling. (1976). Theory of The Firm: Managerial Behavior, Agency Cost and Ownership Structure, Journal of Financial Economics 3. Hal 305-360. Kasmir. (2017). Analisis Laporan Keuangan. Jakarta: PT Rajagrafindo Persada. Miraningtyas, A. S. A., & Yudowati, S. P. (2019). Pengaruh Likuiditas, Reputasi Auditor dan Disclossure terhadap pemberian Opini Audit Going Concern (Studi Pada Perusahaan Properti dan Real Estate yang Terdaftar di Bursa Efek Indonesia Periode 2013-2017) Anindya. Jurnal Ilmiah MEA (Manajemen, Ekonomi, & Akuntansi), 3(3), 76–85. Mutsanna, H., & Sukirno, S. (2020). Faktor Determinan Opini Audit Going Concern Pada Perusahaan Manufaktur Yang Terdaftar Di Bursa Efek Indonesia Tahun 2016-2018. Nominal: Barometer Riset Akuntansi Dan Manajemen, 9(2), 112–131. Petronela, T. A. (2004). Pertimbangan going concern perusahaan dalam pemberian opini audit. Fakultas Ekonomi Universitas Katolik Indonesia Atma Jaya, 1(1996), 46–55. Rahmadona, S., Sukartini, & Djefris, D. (2019). Faktor-Faktor Yang Mempengaruhi Opini Audit Going Concern (Studi Empiris pada Perusahaan Pertambangan yang Terdaftar di Bursa Efek Indonesia Periode 2015-2017). Akuntansi Dan Manajemen, 14(1), 15–42. Rahman, M. A., & Ahmad, H. (2018). Pengaruh Likuiditas, Profitabilitas, dan Solvabilitas Terhadap Opini Audit Going Concern. Jurnal Akuntansi, 1(2), 44–55. Riyadi, T. (2019). Analisis Pengaruh Rasio Profitabilitas, Likuiditas, Solvabilitas dan Arus Kas Terhadap Opini Audit (Studi Empiris pada Perusahaan Manufaktur yang Terdaftar di Bursa Efek Indonesia). Jurnal Renaissance, 4(1), 465–478. Sahamok,net (2018), Saham delisting 2018 di BEI, akses 21 Januari 2020, Sartono, Agus. 2010. Menejemen Keuangan Teori dan Aplikasi. Edisi 4. BPFE Yogyakarta Spence, M., 1973. Job market signaling. Quarterly Journal of Economics, 87: 355-374 Wijaya, S., Dewi, K., Monica, M., Tendatio, C., Sitepu, W. R. B., & Dinarianti, R. (2019). Pengaruh Audit Committee, Audit Quality, Solvability, dan Sales Growth terhadap Going Concern Audit Opinion pada Perusahaan Industri Dasar dan Kimia yang terdaftar di Bursa Efek Indonesia periode 2014-2017. Jesya (Jurnal Ekonomi & Ekonomi Syariah), 2(2), 17–38.

Los estilos APA, Harvard, Vancouver, ISO, etc.

29

Márquez Roa, Ubaldo. "ACERCAMIENTO AL TERRORISMO (AN APPROACH TO TERRORISM)". Universos Jurídicos, n.º 18 (8 de junio de 2022): 75–140. http://dx.doi.org/10.25009/uj.vi18.2626.

Texto completo

Resumen

Resumen: El presente artículo se encuentra dividido en cinco apartados que permiten que su lectura y comprensión sea mucho más amigable. Es interesante y entender que el tema del terrorismo es un tema de naturaleza dinámica y cambiante, en el artículo se estudiara los diferentes tipos de terrorismo que existe y el impacto que ha tenido en el establecimiento de los estados de seguridad pública, así como la afectación a los derechos humanos de las personas y los regímenes jurídicos en los cuales se tipifica esta figura. Abstract: This article is divides into five sections that allow its reading and understanding to be much more user-friendly. It is interesting to understand that the issue of terrorism is a dynamic and changing issue, the article will study the different types of terrorism that exist and the impact it has had on the establishment of states of publica security as well as the impact to the human rights of persons and the legal regimes in which this figure is typified. Fuentes de consulta: Arendt H. (2006) Sobre la revolución, Madrid: Alianza. Báez Corona, J. F. (2015). El realismo mágico jurídico (recreación legal de una ficción literaria con especial referencia a Latinoamérica). Justicia. (28), 15-31. doi:http://dx.doi.org/10.17081/just.20.28.1032 Báez, J. (2021). Tradición contra innovación en los modelos de formación jurídica universitaria en México. Revista de Derecho. (56). 137-153. https://dx.doi.org/10.14482/dere.56.340 Bakke E. (2015) Terrorism and Conterterrorism studies, comparing theory and practice, Netherlands, Leiden University Press. Bobbio N. (2004) Estado, Gobierno y Sociedad por una teoría general de la política, México, Fondo de Cultura Económica. Caillois R. (1973) La cuesta de la guerra (trad.) Rufina Bórquez, México, Fondo de Cultura Económica. Coteño Muñoz A. (2018) “Terrorismo individual los atentados perpetrados por actores solitarios” Eunomía. Revista en Cultura de la Legalidad, número 15 Madrid, Universidad Carlos III. Donner, F. (2007) “Fight for God- But Do So with Kindness: Reflections on War, Peace, and Communal Identity in Early Islam”. In War and Peace in the Ancient World, Oxford. Blackwell. Durham M. (2000) The Christian right, the far right and the Boundaries of American Conservatism. Manchester: Manchester University Press. Dworkin R, (2013) “Foreword”, in Extreme Speech and Democracy, Oxford, Oxford University Press. Essig, C. (2001). Terrorism: Criminal Act of Act of War? Implications for National Security in the 21st Century. Pennsylvania: US Army War College. Foucault, M. (2009) Historia de la sexualidad 1. La voluntad de saber, México, Siglo XXI. Friedman B, H., Harper J, Preble C. (2010) Terrorizing ourselves. Why U.S. Counterterrorism Policy is Failing and How to Fix It. Washington D.C. Instituto Cato. Gallego, C. (2012). El concepto de seguridad jurídica en el Estado social. Revistas jurídicas. Vol 2, Núm 9, Recuperado de http://juridicas.ucaldas.edu.co/downloads/Juridicas9(2)_6.pdf Griset, P. L., Mahan, S. (2003) Terrorism in perspective, United States of America. Sage Publications Inc. González Calleja, E. (2013). El Laboratorio del Miedo, Madrid, Crítica. Habermas J. (1998) Derechos humanos y soberanía popular. Las versiones liberal y republicana, en Rafael del Águila, Fernando Val, Madrid, Alianza Habermas J. (1994) La desobediencia civil, piedra de toque del Estado democrático de Derecho, en Ensayos políticos, Barcelona, Península. Heydar S. (2017) Islamic Peace Ethics. Legitimate and Illegitimate Violence in Contemporary Islamic Thought. United States of America, Baden-Baden: NomosAschendorff Verlag. Hoffman B., Howard R. (2011) Terrorism and counterterrorism: Understandin the new security environment readings and interpretations: 4a eth, United States of America, Mcgraw-Hill. Hoffman, B. (2006). Inside Terrorism. New York: Columbia University Press. Jackson, R, et al., (2011) Terrorism. A Critical Introduction, New York, Palgrave Macmillian Jassies N. (2009) Mrinus Van Der Lubbe y el incendio del Reichstag. Trad., García Velasco C., España, Editorial Alikornio. Jellinek G (1954) Teoría Geenral de los Estados. Trad. Fernando de los Ríos. Buenos Aires, ed. Albatroz. Jenkins, B.M. (1975), "International Terrorism: A New Mode of Conflict", in Garitón D, y Schaerf C. Internactional Terrorism and World Security, Londres, Cromm Helm. Johnston, T. D. (1981). Selective costs and benefits in the evolution of learning. En J. S. Rosenblatt, R .A. Hinde, C. Beer y M. C. Busnel (Eds.). Advances of the study of behavior. New York: Academic Press Kilpatrick J (2020) Quand un état d’urgence temporarire devient permanent, le cas de la France. París, Transnational Institute. Khadduri, M. (1955) War and Peace in the Law of Islam. Baltimore, The Johns Hopkins Press. Kyrou, A. (2012). L’imaginaire des Anonymous, des luddites à V pour Vendetta. París Folis esssays Lasoen, K. (2018). “War of Nerves: The Domestic Terror Threat and the Belgian Army”. In Studies in Conflict & Terrorism, vol. 42, no. 11. Le Goff J. (1984) La Civilisation d l’occident médiéval, París, Foils Essay. Lillich, B. R. (1985) Paris Minimum Standards of Human Rights Norms in a State of Emergency, The American Journal of International Law, Vol. 79, No. 4 Locke J. (1997), Segundo tratado sobre el gobierno civil, Madrid, Alianza. Loubet Del Bayle, J. L. (1992) La Police. Approche socio-politique. Paris, Montchrestien. Luhmann, N. (2005) El derecho de la sociedad, 2a ed., México, Herder, Universidad Iberoamericana. Majoran, A. (2015). The illusion of war: Is terrorism a criminal act or an act of war? International Politics Reviews, Vol.3 Issue 1 Martin J-C, (2006) Les règles internationales relatives à la lutte contre le terrorismo. París, edición Bruylant. Nateras González M, E. (2018) Colombia Las autodefensas en Michoacán, México: ¿rescate de la ciudadanía ante la violencia? Revista Opinión Jurídica, Universidad de Medellín, Vol. 17, Núm. 33 Placido A. P., y Perkins L K. (2010) Drug Trafficking violence in México implications for the United States. Washington D.C. U.S. Senate Caucus on International Narcotics Control Departmente of Justice Poczynok, I. (2019). Fuerzas armadas y contraterrorismo. Apuntes para renovar un “debate crónico” en la Argentina. Revista Relaciones Internacionales, Estrategia Y Seguridad, vol. 2, Núm. 14 Poland J. (2004) Understanding Terrorism: Groups, Strategies and responses. New York. Pretince Hall. Rawls J (1999) La justificación de la desobediencia civil, en Justicia como equidad. Materiales para una teoría de la justicia, Madrid, Tecnos. Reinares, F y García-Calvo, C. (2016) Estado Islámico en España. Madrid: Real Instituto Elcano. Rivas, P., y Rey, P. (2008) Las autodefensas y el paramilitarismo en Colombia (1964-2003), Bogotá, CON Fines. Rapoport, D. (2004). “The four waves of modern terrorism”. En Audrey, C. y James, L. Attacking Terrorism: Elements of a Grand Strategy. Washington D.C. George town University Press Rodley N. (1985) International Human Rights Law, dans Evans, M. D, International Law, Oxford, Oxford University Press. Reitberger M (2013) “License to kill: is legitimate authority a requirement for just war? in International Theory, Cambridge, Cambridge University Press, Vol. 5, Issue 1. Robespierre Maximilien (2005) Por la felicidad y por la libertad, discursos. España, El viejo topo. Rousseau J. J., (2013) Discurso sobre el origen y fundamento de la desigualdad entre los hombres, Madrid, Calpe. Tinnes J. (2020) Bibliography: Defining and Conceptualizing Terrorism Compiled PERSPECTIVES ON TERRORISM Volume 14, Issue 6, The Netherlands Universiteit Leiden. recuperado de https://www.universiteitleiden.nl/perspectives-on-terrorism/archives/2020#volume-xiv-issue-6 Toboso Buezo M. (2020) Colección Segmentos de Seguridad Terrorismo y antiterrorismo. España. Institut de Seguretat Pública de Catalunya.. Saint Thomas Aquinas (2003) On law, morality and Politics, translated by Regan Richard United States of America, Hackett publishing company. Sinai, J. (2008) “How to Define Terrorism”, Perspectives on Terrorism, Journal of the Terrorism Research Initiative and the Center for Terrorism and Security Studies, The Netherlands, Universiteit Leiden, Vol. 2, No.4, recuperado de http://www.terrorismanalysts.com/pt/index.php/pot/article/view/33/html Skinner, B. F. (1953) Science and human behavior. New York, The Macmillan Company. United States Department of State. (2004) Patterns of Global Terrorism 2003 Washington, DC: Office of the Secretary of State, Office of the Coordinator for Counterterrorism. Valadés D. (1974) La dictadura constitucional en América Latina, México, UNAM. Walther T C., Höhn A., (2020) El ejército alemán y sus graves problemas con la ultraderecha. DW noticiero recuperado de https://www.dw.com/es/el-ej%C3%A9rcito-alem%C3%A1n-y-sus-graves-problemas-con-la-ultraderecha/a-54044495 Wallace, D. (2008). Combatiendo el terrorismo bajo las leyes de la guerra. Military Review Hispan-American, Vol. 88, Issue 2 Weber M. (1986) El político y el científico. (trad) Francisco Rubio Llorente, Madrid, Alianza Editorial.

Los estilos APA, Harvard, Vancouver, ISO, etc.

30

Gilligan, John J. "Nuclear Weapons and the Bishops' Voice - Matthew F. Murphy: Betraying the Bishops: How the Pastoral Letter on War and Peace is Being Taught. (Washington, D. C: Ethics and Public Policy Center, 1988. Pp. ix, 119. $7.95, paper.)". Review of Politics 50, n.º 4 (1988): 773–77. http://dx.doi.org/10.1017/s0034670500042169.

Texto completo

Los estilos APA, Harvard, Vancouver, ISO, etc.

31

Mekuria, T. A., T. J. Smith, E. Beers, G. W. Watson y K. C. Eastwell. "First Report of Transmission of Little cherry virus 2 to Sweet Cherry by Pseudococcus maritimus (Ehrhorn) (Hemiptera: Pseudococcidae)". Plant Disease 97, n.º 6 (junio de 2013): 851. http://dx.doi.org/10.1094/pdis-12-12-1115-pdn.

Texto completo

Resumen

Little cherry virus 2 (LChV2; genus Ampelovirus, family Closteroviridae) is associated with Little Cherry Disease (LCD), one of the most economically destructive diseases of sweet cherry (Prunus avium (L.)) in North America (1). Since 2010, incidence of LCD associated with LChV2 confirmed by reverse transcription (RT)-PCR assays has increased in orchards of Washington State. LChV2 was known to be transmitted by the apple mealybug (Phenacoccus aceris (Signoret)) (3). However, the introduction of Allotropus utilis, a parasitoid platygastrid wasp (2) for biological control, contributed to keeping insect populations below the economic threshhold. In recent years, the population of grape mealybug (Pseudococcus maritimus (Ehrhorn)) increased in cherry orchards of Washington State (Beers, personal observation). Since grape mealybug is reported to transmit Grapevine leafroll associated virus 3 (Ampelovirus) in grapevine (4), this study investigated whether this insect would also transmit LChV2. A colony of grape mealybugs on Myrobalan plum (Prunus cerasifera Ehrh.) trees was identified visually and morphologically from slide mounts. In a growth chamber, first and second instar crawlers were fed on fresh cut shoots of sweet cherry infected with a North American strain (LC5) of LChV2. After an acquisition period of 7 days, 50 crawlers were transferred to each young potted sweet cherry trees, cv. Bing, confirmed free from LChV2 by RT-PCR. This process was repeated in two trials to yield a total of 21 potted trees exposed to grape mealybug. One additional tree was left uninfested as a negative control. After 1 week, the trees were treated with pesticide to eliminate the mealybugs. Two to four months after the inoculation period, leaves were collected from each of the recipient trees and tested by RT-PCR for the presence of LChV2. To reduce the possibility of virus contamination from residual mealybug debris on leaf surfaces, the trees were allowed to defoliate naturally. After a 3-month dormant period, the new foliage that emerged was then tested. Two sets of primers: LC26L (GCAGTACGTTCGATAAGAG) and LC26R (AACCACTTGATAGTGTCCT) (1); and LC2.13007F (GTTCGAAAGTGTTTCTTGA) and LC2.14545R (CATTATYTTACTAATGGTATGAC) (this study) were used to amplify a partial segment of the replicase gene (409 bp) and the complete (1,080 bp) coat protein gene of LChV2, respectively. Of 21 trees tested, 18 yielded positive results for LChV2. The reaction products from six randomly selected trees were cloned and the virus identity was verified by sequencing. The sequences of RT-PCR amplicons from both primer pairs showed ≥99% identity to LChV2, strain LC5 (GenBank Accession No. AF416335). The result confirmed that P. maritimus transmits LChV2, a significant finding for this cherry production region. Grape mealybug is of increasing concern in the tree fruit industry because it is difficult to control in established orchards. The presence of infested orchards that serve as reservoirs of both LCD and this insect vector present a challenge for management. To the best of our knowledge this is the first report to show transmission of LChV2 by grape mealybug. References: (1) K. C. Eastwell and M. G. Bernardy. Phytopathology 91:268, 2001. (2) C. F. W. Muesbeck. Can Entomol. 71:158, 1939. (3) J. R. D. Raine et al. Can. J. Plant Pathol. 8:6, 1986. (4) R. Sforza et al. Eur. J. Plant Pathol. 109:975, 2003.

Los estilos APA, Harvard, Vancouver, ISO, etc.

32

Rahman, Shahana Akhter, Kamrul Laila, Mujammel Haque, Mohammed Mahbubul Islam, Manik Kumar Talukder y Mohammad Imnul Islam. "COVID-19 Related Multi System Inflammatory Syndrome in Children: Scenario from a Tertiary Care Hospital in Bangladesh". Bangladesh Medical Research Council Bulletin 49, n.º 1 (1 de abril de 2023): 22–31. http://dx.doi.org/10.3329/bmrcb.v49i1.62417.

Texto completo

Resumen

Background: An association of multisystem inflammatory syndrome in children (MIS-C) with SARS-CoV-2 infection is now a well-established serious phenomenon and been increasingly reported from different countries. Objectives: The present study documents the presentation, management and immediate outcome of MIS-C patients from Bangabandhu Sheikh Mujib Medical University (BSMMU), Bangladesh. Study design: This was a retrospective study. Methods: This retrospective study was conducted in the department of pediatrics, BSMMU, Dhaka, Bangladesh. It included all the eligible MIS-C patients diagnosed during the study period (August 2020 to February 2022). Sixty cases fulfilled the diagnostic criteria and they had been included in the study. Data were collected using a predesigned and pre-tested questionnare from hospital records and also by interviewing the patients/parents over telephone when required. Results: Mean age of the children was 6.8year with F: M ratio of 1.2:1. All the sixty cases presented with fever associated with gastro-intestinal complications in 68% followed by other symptoms. Fifty two cases (87%) had known contacts. Laboratory evidence ofSARS-CoV-2 infection was present in 55% cases having positive serology or RT-PCR. Twelve patients (20%) had pre-existing co- morbidities. Majority of patients (48%) presented with Kawasaki Disease (KD) like illness. Mean neutrophil count, ESR, CRP, ferritin, LDH and D-dimer were higher and mean platelet and lymphocyte count were lower in this series. Interleukin-6 (IL-6) level was raised in all theseventeen (28%) patients, who were tested. Sixteen patients (27%) had chest X-ray abnormalities and ten of them had HRCT involvement. Fifteen (25%) patients had abnormalities in abdominal ultrasonogram. Coronary artery dilatation and ventricular dysfunction was present in seventeen (28%) and thirteen (22%) of MIS-C cases. IVIG and intravenous steroid was used in forty one (68%) and thirty nine (65%) children. Aspirin was given to twenty eight (47%) cases. Inotropic support was needed in 17% cases. Antibiotics were prescribed to all the patients. Fifty seven percent and 37% children were discharged without and with complications respectively. Mechanical ventilation was required in 6.6 % children who had pre-existing co-morbidities and all of them expired. Conclusion: Forty eight percent of MIS-C cases presented with KD like illness. Mortality was 6.6% and all the cases had preexisting comorbidities. MIS-C is a pediatric emergency and is of a great concern especially in children with pre-existing co-morbidities. Early diagnosis and referral to tertiary center for optimum management is essential. Bangladesh Medical Res Counc Bull 2023; 49(1): 22-31

Los estilos APA, Harvard, Vancouver, ISO, etc.

33

Grafton-Cardwell, E. E. y C. A. Reagan. "California Red Scale Pesticide Efficacy Trials, 1994". Arthropod Management Tests 21, n.º 1 (1 de enero de 1996): 75–76. http://dx.doi.org/10.1093/amt/21.1.75.

Texto completo

Resumen

Abstract Efficacy of two insect growth regulators (IGR) for the control of California red scale (CRS) were compared to an organophosphate insecticide. Additionally, the effects of the treatments on parasitism by Aphytis melinus and Comperiella bifasciata were evaluated. Insecticides were applied to CRS infested 11 yr old ‘Washington navel’ orange trees at the Lindcove Research and Extension Center, Exeter, California. Seven treatments included a water control, Supracide 2E applied once, CGA 59205 (an IGR) applied once at 20.0 gm(ai), and applied twice at 30.0 gm(ai), S-71639 (an IGR) applied twice both alone and in combination with 0.5% Volck Supreme Spray oil, and 0.5% Volck Supreme Spray oil applied twice. Treatments were assigned based on laboratory evaluation of population densities of live 1st and second instar males and females as well as third instar and gravid females on five randomly selected twig samples (2nd year growth) per tree. Treatments were applied to single trees and replicated 10 times. All treatment applications were timed for emergence of 1st generation CRS crawlers; four of the treatments were reapplied when the 2nd generation of crawlers emerged. Insecticides were applied on 12-13 May and 19 Jul with a Bean hand-sprayer at 450 psi and approximately 1000 gpa (11-12 gal/tree). After treatment, twig samples were evaluated in the same manner as the pretreatment samples. Additionally, we evaluated scale densities on five randomly selected fruit per tree. Sample collections were completed at approximately 30 d intervals after the first treatment. Pretreatment sampling was conducted on 13 Apr. Post treatment counts were conducted on twigs on 13 Jun and 12 Jul and both twigs and fruit on 17 Aug, and 27 Sep. We evaluated the percentage of fruit infested with >10 CRS per fruit in each of the treatments at harvest on 6-7 Dec. Concurrently we determined the percentage of parasitism by A. melinus and C. bifasciata of scale on fruit by evaluating live CRS for the presence of the parasitoids or evidence of host feeding by A. melinus.

Los estilos APA, Harvard, Vancouver, ISO, etc.

34

Tarnowski, T. L. B. y R. C. Ploetz. "First Report of Colletotrichum capsici Causing Postharvest Anthracnose on Papaya in South Florida". Plant Disease 94, n.º 8 (agosto de 2010): 1065. http://dx.doi.org/10.1094/pdis-94-8-1065b.

Texto completo

Resumen

Postharvest anthracnose of papaya, Carica papaya, is an important disease in most production areas worldwide (2). Colletotrichum gloeosporioides causes two types of anthracnose symptoms on papaya: (i) circular, sunken lesions with pink sporulation; and (ii) sharply defined, reddish brown and sunken lesions, described as ‘chocolate spot’ (2). Colletorichum spp. were isolated from lesions of the first type on papaya fruit from the University of Florida Tropical Research and Education Center, Homestead in December 2007 and from fruit imported from Belize in March 2008 (4). Single-spore isolates were identified using colony morphology and internal transcribed spacer (ITS) and mating type (MAT1-2) sequences. Two taxa were identified in both locations: (i) C. gloeosporioides (MAT1-2; GenBank Nos. GQ925065 and GQ925066) with white-to-gray, fluffy colonies with orange sporulation and straight and cylindrical conidia; and (ii) C. capsici (ITS; GenBank Nos. GU045511 to GU045514) with sparse, fluffy, white colonies with setose acervuli and falcate conidia. In addition, in Florida, a Glomerella sp. (ITS; GenBank Nos. GU045518 and GU045520 to GU045522) was recovered with darkly pigmented colonies that produced fertile perithecia after 7 to 10 days on potato dextrose agar (PDA). In each of three experiments, mature fruit (cv. Caribbean Red) were wounded with a sterile needle and inoculated with a 15-μl drop of 0.3% water agar that contained 105 conidia ml–1 of representative isolates of each taxon. The diameters of developing lesions were measured after 7 days of incubation in the dark at 25°C, and the presence of inoculated isolates was confirmed by their recovery from lesion margins on PDA. In all experiments, C. capsici and C. gloeosporioides produced lesions that were significantly larger than those that were caused by the water control and Glomerella sp. (respectively, approximately 12, 17, 0, and <1 mm in diameter). C. gloeosporioides produced sunken lesions with dark gray centers and pink/gray sporulation, which match those previously described for anthracnose on papaya (2). In contrast, C. capsici produced dark lesions due to copious setae of this pathogen; they resembled C. capsici-induced lesions on papaya that were reported previously from the Yucatan Peninsula (3). C. capsici has also been reported to cause papaya anthracnose in Asia (4), but to our knowledge, this is the first time it has been reported to cause this disease in Florida. Since it was also recovered from fruit that were imported from Belize, it probably causes anthracnose of papaya in that country as well. Another falcate-spored species, C. falcatum, was recovered from rotted papaya fruit in Texas (1). The Glomerella sp. was recovered previously from other hosts as an endophyte and causes anthracnose lesions on passionfruit (4). However, its role as a pathogen on papaya is uncertain since it was not pathogenic in the current work; the isolates that were recovered from papaya lesions may have colonized lesions that were caused by C. capsici and C. gloeosporioides. References: (1) Anonymous. Index of Plant Diseases in the United States. U.S. Dept. of Agric. Handb. No. 165. Washington, D.C., 1960. (2) D. M. Persley and R. C. Ploetz. Page 373 in: Diseases of Tropical Fruit Crops. R. C. Ploetz, ed. CABI Publishing. Wallingford, UK, 2003. (3) R. Tapia-Tussell et al. Mol Biotechnol 40:293, 2008. (4) T. L. Tarnowski. Ph.D. diss. University Florida, Gainesville, 2009.

Los estilos APA, Harvard, Vancouver, ISO, etc.

35

Ferreira, Sebastián Vargas, Eduardo Aguayo Ruíz Díaz y Leticia González Kunert. "Corruption: Review, social dimension of corruption and legal efforts in Paraguay". Internacional Multidisciplinary Journal of the Brazil 3, n.º 1 (8 de mayo de 2020): 2–15. http://dx.doi.org/10.46343/imjbr.v3i1.16.

Texto completo

Resumen

The present work is a revision of corruption and the social effects it has on culture, poverty, gender and social organizations, interpreting these instances as integrative for the understanding of corruption as a phenomenon. Furthermore, the present work analyses the legal context of corruption in Paraguay. To address this, a literature review of current and topical research was carry it out, contextualizing the problem from a regional South American perspective and relating it to the efforts of the Paraguayan state with a focus on social corruption as described by various experts on the matter. In terms of the latter, the revision of the legal context of corruption in Paraguay creates an overview of the phenomenon, thus not only identifying the principal institutions, but also exposing their institutional evolution and the changes they represent in reality. Bibliografy Acemoglu, D.y Verdier, T. (2000), “The Choice between Market Failures and Corruption”. The American Economic Review, 194-211. Andvig, J. y Odd-Helge, F. (2000) “Research on Corruption: A Policy Oriented Survey”. Michelson institute y Norweigan Institute of international Affairs. Banco Mundial. (2000). Anticorruption in Transition: A Contribution to the Policy Debate. Washington, D.C: The World Bank. Biderbost, P. (2016). Guía para la Construcción de mapas de riesgos de Corrupción. Asunción: Secretaría Nacional Anticorrupción. Borda, D. & Caballero, M. (2017). Una reforma tributaria para mejorar la equidad y la recaudación. Revista Estudios Paraguayos. 107-132. Brunetti, A. & Weder, B. (1998). Explaining Corruption. University of Saarland and University of Basel. Carpenter, D. y Moss, D. (2014). Introduction. En: Carpenter, D. y Moss, D. (2014). Preventing Regulatory Capture: Special Interest Influence and How to Limit It. Nueva York, Estados Unidos: Cambridge University Press Comité Interinstitucional Técnico de Apoyo a la Implementación de la Convención Interamericana Contra la Corrupción – CITAIC. (2007). Informe de la república del Paraguay sobre las disposiciones seleccionadas para la segunda ronda de evaluación de la Convención Interamericana Contra la Corrupción para la XI Reunión del Comité de Expertos del MESISIC del 25 al 30 de junio de 2007, en Washington, D.C. Disponible en: http://www.oas.org/juridico/spanish/mec_avance_pryXI.pdf Consejo Impulsor del Sistema Nacional de Integridad – CISNI. (2003). Informe de Paraguay de la primera ronda de evaluación. Obtenido de: http://www.pj.gov.py/images/contenido/daii/cisni/unidad2/pdf/convencion.pdf De Quiróz, L. B. (1998). Dialnet. Obtenido de https://dialnet.unirioja.es/descarga/articulo/5110352.pdf Dimant, E. & Tosato, G. (2018). Causes and effects of corruption: what has past decade’s empirical research taught us? A survey. Journal of Economic Surveys. Vol. 32, No. 2, pp. 335–356. Etkin, J. (1993). La Doble Moral de las Organizaciones: Los Sistemas Perversos y la Corrupción Institucionalizada. Madrid, Editorial Mac Graw Hill. Fishman, R. y Gatti, R. (2000) “Decentralization and Corruption: Evidence Across Countries”. World Bank Policy Research Working Paper 2290. Friedrich, C. J. (1990), “Corruption Concepts in Historical Perspective.” in Political Corruption: A Handbook, Heidenheimer, A.J.; Johnston, M.; and LeVine, V.T. (eds.). New Brunswick. Transaction Publishers. Fukuyama, F. (1995). Trust: The Social Virtues and the Creation of Prosperity. New York, Free Press. Gould, D. y Amaro-Reyes, J. (1983) “The Effect of Corruption in Administrative Gray, C. y Kaufman, D. (1998) "Corruption and Development". Finance and Develpment, N° 35. Habermas, J. (1998). ¿Aprendemos de las Catástrofes? Diagnóstico y Retrospectiva de Nuestro Breve Siglo XX. Revista Nexos y copiado de El Mercurio. Hellman, J. & Kaufmann, D. (2001). La captura del Estado en las economías en transición. Finanzas & Desarrollo, septiembre, pp.31 – 35. Hellman, J. y Kaufmann, D. (2001). La captura del Estado en las economías en transición. Finanzas & Desarrollo, septiembre, pp.31 – 35. Hellman, J. y Schankerman, M. (2000). Intervention, Corruption and Capture: The Nexus between Enterprises and the State. European Bank for Reconstruction and Development Working Paper, No. 58. Hodgson, G. y Jiang, X. (2008). La economía de la corrupción y la corrupción de la economía: una perspectiva institucionalista. Revista de Economía Institucional, vol. 10, núm. 18, pp. 55-80. Kaufmann, D. (1997) "Corruption: The Facts". World Bank Policy Working Paper. Latinobarómetro. (2018). Latinobarómetro. Obtenido de http://www.latinobarometro.org/lat.jsp Llorente y Cuenca. (Setiembre de 2016). Desarrollando Ideas D+I. Obtenido de https://www.desarrollando-ideas.com/wp-content/uploads/sites/5/2016/09/160912_DI_informe_Corrupcion_LatAm_ESP.pdf Malem Seña, J. (2000) Globalización, Comercio Internacional y Corrupción, Barcelona, Editorial Gedisa. Malem Seña, J. (2000), Globalización, Comercio Internacional y Corrupción. Barcelona, Editorial Gedisa. Mauro, P. (1995) “Corruption and Growth”. Quarterly Journal of Economics. CX, 681 Méndez Giraldo, G.; López Santana, E. (Abril de 2016). Problema Social de la Corrupción. Perspectivas desde la dinámica de sistemas. Obtenido de Editorial Udistrital: http://editorial.udistrital.edu.co/contenido/c-870.pdf Performance: Ilustrations from Developing Countries”. World Bank Working Paper N° Proud´homme, R. (1995). "The Dangers of Decentralization". The World Bank Research Observer, Vol. 10, N° 2. Reos, O. (2002). “Efectos Económicos de la Corrupción”. Documento de la División de Programas de Estado y Sociedad Civil1. Banco Interamericano de Desarrollo. Rose-Ackerman, S. (2001). Corrupción y los Gobiernos. Barcelona, Editorial Siglo XX. SENAC. (2018). Sistema de seguimiento de procesos. Asunción: SENAC. Serafini, V. (2017). Elites y captura del Estado. Paraguay: un estudio exploratorio. Asunción. Decidamos. Shleifer, A. & Vishny, R. (1993). “Corruption”. Quarterly Journal of Economics, Vol. 103, N° 3. Soto, R. (2003). Flacso Andes. Obtenido de Biblioteca Digital de Vanguardia para Investigación en Ciencias Sociales Región Andina y América Latina: www.flacsoandes.edu.ec/web/imagesFTP/1275931953.raimundo_soto.pdf Suárez, F. & Gorrochategui, N. (1998). Corrupción Organizacional: Aspectos vinculados a la Estructura de Oportunidades en Diversos Tipos de Organizaciones y Casos de Corrupción Institucionalizados. Instituto de Investigaciones Administrativas de la Facultad de Ciencias Económicas de la Universidad de Buenos Aires. Swamy, A. (1999) “Gender and Corruption”. Draft Paper, IRIS Center, University of Maryland. Swamy, A. (1999). Gender and Corruption. Draft Paper, Iris Center, University of Maryland. Sztompka, P. (1997). “Trust, distrust and the paradox of democracy”. Centro Científico de Berlín para la Investigación Social. Disponible en http://skylla.wz-berlin.de/pdf/1997/p97-003.pdf Tanzi, V. (2000) Policies, Institutions and the Dark Side of Economics. Chetenham. Edward Elgar. Tanzi, V. y Davoodi, H. (1998) “Corruption, Public Investment and Growth”. International Monetary Found Working Paper, 97-139. Transparencia Internacional. (2017). Transparency International. Obtenido de https://www.transparency.org/news/feature/corruption_perceptions_index_2017 Transparency International (2017). Corruption Perceptions Index. Berlin, August. Trujillo Arjona, A. (2002) “La Corrupción Política: Una Revisión de la Literatura”. Universidad Carlos III de Madrid. Documento de Trabajo 02-14. Trujillo Arjona, A. (2002). La Corrupción Política: Una Revisión de la Literatura. Universidad Carlos III de Madrid, Documento de Trabajo 02-14. Varese, F. (2001). “Pervasive Corruption”, Working Paper, disponible en www.colbud.hu/honesty-trust/varese/pub01.htm Weyland, K. (1998) “The Politics of Corruption in Latin America”. Journal of Democracy 9, 108-21. Zavala, R. (2013). Universidad Autónoma Nuevo León. Obtenido de Repositorio Académico Digital: http://eprints.uanl.mx/3759/1/Apuntes_sobre_la_historia_de_la_corrupcion.pdf

Los estilos APA, Harvard, Vancouver, ISO, etc.

36

WASHINGTON, ELLIS. "EXCLUDING THE EXCLUSIONARY RULE: NATURAL LAW VS. JUDICIAL PERSONAL POLICY PREFERENCES*". Deakin Law Review 10, n.º 2 (1 de julio de 2005): 772. http://dx.doi.org/10.21153/dlr2005vol10no2art304.

Texto completo

Resumen

<div class="page" title="Page 1"><div class="layoutArea"><div class="column">* A previous versions of this article was published in C. James Newlan’s journal, THE SOCIAL CRITIC, as Ellis Washington, Excluding the Exclusionary Rule, 3 THE SOC. CRITIC (1998), and in ELLIS WASHINGTON, THE INSEPARABILITY OF LAW AND MORALITY: THE CONSTITUTION, NATURAL LAW AND THE RULE OF LAW 16-28 (2002) [hereinafter WASHINGTON, INSEPARABILITY OF LAW AND MORALITY]. For a comprehensive legal and historical analysis regarding the integration of the rule of law, jurispru- dence, and society in modern times, see generally Ellis Washington, Reply to Judge Richard A. Posner on the Inseparability of Law and Morality, 3 RUTGERS J. L. & RELIG. 1 (2001-2002); The Nuremberg Trials: The Death of the Rule of Law (In International Law), 49 LOY. L. REV. 471-518 (2003). ** Ellis Washington, DePauw University; B.A. 1983, University of Michigan; M.M. 1986, John Marshall Law School; J.D. 1994. The author an editor at the UNIVERSITY OF MICHIGAN LAW REVIEW and a law clerk for the Rutherford Institute. He was a faculty member at Davenport University and member of the Board of Visitors at Ave Maria School of Law. Currently, Mr. Washington is a freelance writer and lecturer at high schools, universities, and law schools throughout America specializing in the history of law, legal and political philosophy, jurisprudence, constitutional law, critical race theory, and legal feminist theory. He also teaches composition at Lansing Community College. In addition to numerous articles, he has published three books: THE DEVIL IS IN THE DETAILS: ESSAYS ON LAW, RACE, POLITICS AND RELIGION (1999); BEYOND THE VEIL: ESSAYS IN THE DIALECTICAL STYLE OF SOCRATES (2000, 2004); THE INSEPRABILITY OF LAW AND MORALITY: THE CONSTITUTION, NATURAL LAW AND THE RULE OF LAW (2002). His article, The Nuremberg Trials: The Death of the Rule of Law (In International Law), 49 LOY. L. REV. 471-518 (2003), has received both national and international recognition and has been accepted into many prestigious archives and collections including–Chambers Library of the Supreme Court of the United States, State Museum of Auschwitz-Birkenau, The Simon Wiesenthal Center, The U.S. Holocaust Memorial Museum, The Elie Wiesel Foundation for Humanity. *Exceeding gratitude to my friend, attorney Che Ali Karega (a.k.a. “Machiavelli”) for his antagonism, advice, ideas, source materials, and inspiration. To Arthur LaBrew, musicologist and historian, founder Michigan Music Research Center (Detroit), for his prescient comments and attention to detail on earlier drafts of the Article. To C. James Newlan, publisher of the Journal, THE SOCIAL CRITIC, for being my friend, my first publisher, an intellectual, a visionary, and the first person to believe that I had ideas worthy to be published and read. </div></div></div>

Los estilos APA, Harvard, Vancouver, ISO, etc.

37

Rush, M. C., A. K. M. Shahjahan, J. P. Jones y D. E. Groth. "Outbreak of False Smut of Rice in Louisiana". Plant Disease 84, n.º 1 (enero de 2000): 100. http://dx.doi.org/10.1094/pdis.2000.84.1.100d.

Texto completo

Resumen

False smut, caused by Ustilaginoidea virens (Cooke) Takah., has been occurring in Louisiana rice since at least 1906 (4). A color plate (no. 69) of the disease was published in the Compendium of Rice Diseases published by the American Phytopathological Society (3). The slide for this plate was taken by M. C. Rush in 1976 of rice grown at the Rice Research Station at Crowley, LA. Since that time, the disease has been sporadic and light in Louisiana. In 1997, however, incidence was high. False smut was present on many germ plasms at the Rice Research Station in Crowley and was observed on commercial cultivars in several growers' fields in southwestern Louisiana. Incidence ranged from 1 to 15% of tillers infected with at least two to three spore balls per infected panicle. The disease occurred on both long- and medium-grain cultivars. False smut of rice occurs in the field at the hard dough to mature stages of the crop. A few spikelets in a panicle transform into globose, yellowish green, velvety spore balls that are 2 to 5 cm in diameter and covered by a thin orange membrane. The membrane bursts open and releases powdery dark green spores. The chlamydospores formed in the spore balls are spherical to elliptical, warty, olivaceous, and 3 to 5 × 4 to 6 μm in dimension. Some of the spore balls develop one or more sclerotia, which are the overwintering structure, in the center. False smut has been considered a minor disease of rice that occurs sporadically in Louisiana. The recent discovery of ustilotoxin, a phytotoxin and mycotoxin, produced by this pathogen on diseased tissues suggests that the fungus may be of concern as a contaminant on rice products consumed by livestock and humans (1,2). This increases the need to monitor the incidence of this disease. References: (1) Koiso et al. Ustiloxin: A phytotoxin and a mycotoxin from false smut balls on rice panicles. Tetrahedron Lett. 33:4157, 1992. (2) Koiso et al. Ustiloxins, antimitotic cyclic peptides from false smut balls on rice panicles caused by Ustilaginoidea virens. J. Antibiot. 47:765, 1994. (3) F. N. Lee and P. S. Gunnel. 1992. Compendium of Rice Diseases. The American Phytopathological Society, St. Paul, MN. p. 28. (4) W. A. Orton. 1907. Plant diseases of 1906. Yearbook U.S. Department of Agriculture. U.S. Government Printing Office, Washington, DC, pp. 499–508.

Los estilos APA, Harvard, Vancouver, ISO, etc.

38

Shoucri, Sherif, Angela Gomez-Simmonds, Amir Lankarani, Qiuhu Shi, Franklin D. Lowy y Anne-Catrin Uhlemann. "206. Clinical and Molecular Characteristics of Community-associated Staphylococcus aureus Bacteremia in Injection and Non-injection Drug Users at a New York City Medical Center". Open Forum Infectious Diseases 8, Supplement_1 (1 de noviembre de 2021): S211. http://dx.doi.org/10.1093/ofid/ofab466.408.

Texto completo

Resumen

Abstract Background The opioid epidemic has resulted in a dramatic resurgence of bacterial infections, most notably those due to Staphylococcus aureus (SA). We compared the demographic, clinical, and molecular factors of injection drug users (IDUs) and non-IDUs with SA bacteremia. Methods Patients with SA bacteremia were identified through a query of the electronic medical record EMR from January 2018 to December 2019 at a New York City medical center. All cases of community-associated (CA) SA bacteremia among adults with a history of active injection drug use were evaluated. Patients with positive SA blood cultures ≤ 72 hours of admission were considered CA. IDUs were identified with keyword searches and were deemed active if they had a history of use in the 12 months prior to admission. A randomly selected group of non-IDUs with CA SA bacteremia was used for comparison at a 4:1 ratio. Available SA isolates underwent Illumina whole genome sequencing (WGS). Using SRST2 multilocus sequence types (MLST), antimicrobial resistance genes and putative virulence factors were extracted. Results From January 2018 to December 2019, 669 patients with SA bacteremia were identified. 29 patients were active IDUs. Compared to 112 randomly selected non-IDUs, IDUs were significantly younger and more likely to be unstably housed (Table 1). Rates of MRSA were similar in IDUs (31%) and non-IDUs (32.1%). Endocarditis (44.8% vs 11.6%) and abscesses (27.6% vs 8.9%) were diagnosed more frequently in IDUs than non-IDUs. A positive hepatitis C antibody was strongly associated with SA bacteremia in IDUs (62.1% vs 6.3%, p< 0.001). WGS demonstrated comparable proportions of sequence types across IDUs and non-IDUs. ST8 accounted for the majority of infections in both groups (Table 2). MRSA bacteremia due to ST8 occurred in a higher proportion of IDUs (7/29, 24.1%) than non-IDUs (14/112, 12.5%). Conclusion IDUs with CA SA bacteremia have unique demographic and clinical features that differentiate them from non-IDUs. Endocarditis rates in IDUs are of particular concern. Use of these risk factors could allow hospitals to rapidly identify IDUs and offer them necessary medical and social services. WGS revealed a majority of MRSA bacteremia was due to one sequence type in IDUs (ST8). Further analysis of virulence genes in this cohort are ongoing. Disclosures Franklin D. Lowy, MD, GlaxoSmithKline (Advisor or Review Panel member)UpToDate (Other Financial or Material Support, Topic Writer and Editor) Anne-Catrin Uhlemann, MD, PhD, Merck (Grant/Research Support)

Los estilos APA, Harvard, Vancouver, ISO, etc.

39

Imelda y Halimatusa’diah. "MINORITY LANGUAGE REVITALIZATION: BETAWINESE AND LAMPUNGNESE CASE STUDY". Linguistik, Terjemahan, Sastra (LINGTERSA) 2, n.º 1 (5 de mayo de 2021): 16–21. http://dx.doi.org/10.32734/lingtersa.v2i1.6120.

Texto completo

Resumen

Awareness about the decline of various ethnic cultures in Indonesia has been the government concern since the New Order era (1966-1998). Towards the issues, the Indonesian government has done more concrete actions, i.e., cultural revitalization, including local languages, which began in the second year of the First Five Development Year (Repelita), the 1970s [1]. The same source further explained that there were five main activities to carry on, including (a) language standardization, (b) language socialization, (c) translation, (d) language and literary research, and (e) development of language agents and information networks [1]. Interestingly, (a) the condition of the local language in Indonesia, (b) the shifting factor of the language, and (c) the language revitalizations that have been done are various. The paper will discuss two cases of minority languages revitalization in Indonesia, namely Betawi and Lampung. Both languages are interesting to review and compare since they have the same characteristics: they are the language of minority ethnic groups whose environment is the center of migration of various ethnicities since the Dutch colonial. The massive development of Jakarta has displaced Betawi people to the suburbs, such as Depok, Bekasi and Tangerang (Shahab, 2004: 20). As a consequence, the existence and the role of the Betawi language, which is considered a dialect of Jakarta, is now being eroded (Chaer, 2017: 160). Meanwhile, the Lampungnese region has been the first transmigrant location in the colonial era from Java island, 1905. Currently, Lampungnese is around 11.92 percent [2] of the entire population in the Province and the younger speakers have shifted to Indonesian/Malay. This desk study examines various literature, previous research, and policy papers to present findings regarding the latest report on language revitalization carried out. One of the efforts to revitalize the Betawi language that has been carried out is building Betawi cultural villages in Condet and Setu Babakan [3]. However, the high number of mixed marriages and the dominance of Indonesian made it challenging to transmit local language between generations since younger generations speak Indonesian more often. On the other hand, the Lampung provincial government has made efforts to teach the Lampung language from elementary school to university to produce Lampung language teachers. Unfortunately, the efforts that have been done have not shown better results since younger Lampungneses are more fluent in Indonesian better than Lampungnese.

Los estilos APA, Harvard, Vancouver, ISO, etc.

40

Ghauch, Ziad Georges. "Efficient polynomial chaos approximations: Active, local and basis-adapted". ANZIAM Journal 62 (8 de junio de 2021): C16—C29. http://dx.doi.org/10.21914/anziamj.v62.15833.

Texto completo

Resumen

Metamodels provide an efficient means for the approximation of response surfaces of systems, particularly for resource-intensive experiment designs. It is oftentimes the case that interest is focused on a specific region of the parameter space. We propose an efficient recipe for the local approximation of response surfaces using Polynomial Chaos techniques. For systems embedded in high-dimensional settings, a basis-adapted spectral representation is exploited locally for dimension reduction. The proposed approach comprises an initial heuristic global solution for parameter space exploration using an approximate global Polynomial Chaos metamodel, followed by a local design being refined through an active learning scheme. The problem of turbulent flow around a symmetric airfoil is considered. Statistical estimators based on the local, active, basis-adapted approach show less bias and faster convergence as compared to the estimators from a global solution. References B. J. Bichon, M. S. Eldred, L. P. Swiler, S. Mahadevan, and J. M. McFarland. Efficient global reliability analysis for nonlinear implicit performance functions. AIAA J. 46(10):2459–2468, 2008. doi: 10.2514/1.34321. G. E. P. Box and N. R. Draper. Empirical Model-Building and Response Surfaces. Wiley, 1987. V. Dubourg, B. Sudret, and F. Deheeger. Metamodel-based importance sampling for structural reliability analysis. Prob. Eng. Mech. 33:47–57, 2013. doi: 10.1016/j.probengmech.2013.02.002. R. G. Ghanem and P. D. Spanos. Stochastic finite element: A spectral approach. Dover, 1991. doi: 10.1007/978-1-4612-3094-6. Z. G. Ghauch. Leveraging adapted polynomial chaos metamodels for real-time Bayesian updating. J. Verif. Valid. Uncert. 4(4):041003, 2020. doi: 10.1115/1.4045693. Z. G. Ghauch, V. Aitharaju, W. R. Rodgers, P. Pasupuleti, A. Dereims, and R. G. Ghanem. Integrated stochastic analysis of fiber composites manufacturing using adapted polynomial chaos expansions. Compos. Part A: Appl. Sci. 118:179–193, 2019. doi: 10.1016/j.compositesa.2018.12.029. M. E. Johnson, L. M. Moore, and D. Ylvisaker. Minimax and maximin distance designs. J. Stat. Plan. Infer. 26(2):131–148, 1990. doi: 10.1016/0378-3758(90)90122-B. A. Notin, N. Gayton, J. L. Dulong, M. Lemaire, P. Villon, and H. Jaffal. RPCM: A strategy to perform reliability analysis using polynomial chaos and resampling. Euro. J. Comput. Mech. 19(8):795–830, 2010. doi: 10.3166/ejcm.19.795-830. OpenCFD. OpenFOAM User’s Guide. 2019. https://www.openfoam.com/documentation/user-guide. V. Picheny, D. Ginsbourger, O. Roustant, R. T Haftka, and N.-H. Kim. Adaptive designs of experiments for accurate approximation of target regions. J. Mech. Design. 132(7):071008, 2010. doi: 10.1115/1.4001873. C. Thimmisetty, P. Tsilifis, and R. Ghanem. Homogeneous chaos basis adaptation for design optimization under uncertainty: Application to the oil well placement problem. AI EDAM 31(3):265–276, 2017. doi: 10.1017/S0890060417000166. R. Tipireddy and R. Ghanem. Basis adaptation in homogeneous chaos spaces. J. Comput. Phys. 259:304–317, 2014. doi: 10.1016/j.jcp.2013.12.009. P. Tsilifis and R. G. Ghanem. Reduced Wiener chaos representation of random fields via basis adaptation and projection. J. Comput. Phys. 341:102–120, 2017. doi: 10.1016/j.jcp.2017.04.009. Turbulence Modeling Resource. NASA Langley Research Center. Washington, DC, 2018. http://turbmodels.larc.nasa.gov/.

Los estilos APA, Harvard, Vancouver, ISO, etc.

41

Gesundheit, Benjamin, Reuven Or, Einat Budowski, Michael Y. Shapira, Igor B. Resnick, Simcha Samuel, Liliane Dray, Orit Kaplan y Dana Wolf. "The Rate of Cytomegalovirus Infection and Disease in Correlation with the Type of Hematopoietic Stem Cell Transplantation in the Era of Preemptive Antiviral Therapy". Blood 112, n.º 11 (16 de noviembre de 2008): 4347. http://dx.doi.org/10.1182/blood.v112.11.4347.4347.

Texto completo

Resumen

Abstract Background: Despite diagnostic and therapeutic advances, cytomegalovirus (CMV) has remained a significant complication after hematopoietic stem cell transplantation (HSCT). The widespread use of preemptive antiviral therapy has reduced the occurrence of early CMV disease and changed its epidemiology. In order to define the current trends and to establish future guidelines, we retrospectively analyzed the rate of CMV infection and disease in the following types of HSCT: autologous HSCT, fully matched-, mismatched- and haploidentical-allogeneic HSCT. Patients & Methods: Patients receiving HSCT in the Hadassah Hebrew University Medical Center over a 5-year period (April 2003-March 2008) were retrospectively reviewed for the occurrence of CMV infection and disease in relation to the 4 types of HSCT. Infection was defined by the presence of positive CMV antigenemia and/or real time PCR assays, and patients received preemptive antiviral treatment upon detection of CMV infection. Results: Of 634 patients who received HSCT in our center during the study period, 276 (43.5%) developed CMV infection and 16 (2.5%) had evidence for CMV disease, with the vast majority of disease occurring among haploidentical HSCT recipients. The occurrence of CMV infection and disease by transplant type is presented in the table: Type of HSCT Total Patients (tested patients) Number of patients with CMV infection (% of tested patients) CMV disease (% of tested patients; % of patients with CMV infection) (A.) autologous HSCT 240 (214) 55 (25.7%) 1 (0.5%; 1.8%) (B.) fully matched 289 (254) 145 (57.1%) 1 (0.4%; 0.7%) (C.) mismatched- 44 (38) 20 (52.6%)%) 0 (D.) haploidentical-allogeneic HSCT 113 (102) 56 (54.9%) 14 (13.7%; 25.0%) No statistically significant differences were found between the CMV-donor and recipient serostatus in the 3 categories of allogeneic HSCT. The rate of CMV infection was significantly higher in allogeneic compared to autologous HSCT (p < 0.001), with no significant differences between the 3 types of allogeneic HSCT. However, the rate of disease was significantly higher in haploidentical HSCT (p < 0.001). Fifteen of the 16 patients with CMV disease had a fatal outcome. We are presently analyzing the viral load kinetics and the associated risk factors in the different HSCT categories, Conclusions: Preemptive antiviral approach proved to be effective in the prevention of CMV disease in autologous and fully matched as well as mismatched allogeneic HSCT recipients. The increased rate of CMV disease and associated mortality in recipients of haploidentical HSCT despite preemptive antiviral therapy reflects their delayed immune reconstitution, and raises concern regarding the effectiveness of the current preemptive antiviral approach. Based on our findings, close monitoring and prophylactic antiviral treatment should be employed in this high-risk subgroup of HSCT recipients.

Los estilos APA, Harvard, Vancouver, ISO, etc.

42

Yoshida, Minoru, Kazuo Tamura, Masahiro Imamura, Yoshiro Niitsu, Takeshi Sasaki, Akio Urabe, Kazuma Ohyashiki et al. "Efficacy and Safety of Micafungin as An Empirical Antifungal Therapy for Suspected Fungal Infection in Patients with Hematological Disorders." Blood 112, n.º 11 (16 de noviembre de 2008): 1939. http://dx.doi.org/10.1182/blood.v112.11.1939.1939.

Texto completo

Resumen

Abstract Background: Invasive fungal infections (IFIs) are of serious concern in the management of immunocompromised patients (pts) with hematological disorders. Empiric antifungal therapy is recommended for neutropenic pts with persistent fever, because treatment after confirmation of fungal infection often produces poor outcomes. Micafungin (MCFG), one of the echinocandin families, was launched first in Japan in 2002, and has now been approved in more than 11 countries and areas including the USA and the EU. Although the efficacy and safety of MCFG against both Candida and Aspergillus infections has been shown in many clinical trials, there are few clinical study reports on the empiric therapy of a suspected fungal infection. Here, we report the multi-center study results of MCFG for the empiric antifungal therapy, which were conducted from April 2005 to September 2006 in Japan. Objective: This prospective study was performed to clarify the efficacy and safety of MCFG for the empirical antifungal therapy on suspected fungal infection in pts with hematological disorders and neutropenia. Methods: Study design: A multiple-center, open, uncontrolled study. The investigator registered pts with neutropenia (< 1,000/μl) who met the following criteria to the Subject Registration Center. Suspected fungal infections were divided into two categories: possible fungal infection defined by positive clinical symptoms/findings and serological testing (beta-D-glucan or galactomannan) or diagnostic imaging (chest X-ray or CT scan), refractory fever defined by unexplained persistent fever (an axillary temperature higher than 37.5 °C) after the antibacterial treatment over 2 days and by positive clinical symptoms/findings. IFIs categorized as proven or probable were not included in this study. Efficacy evaluation was performed using an algorithm based on each of the evaluation of clinical symptoms/findings, imaging study findings, and serological tests. Results: 388 pts (M:234, F:154, mean age:57.8 years old) were registered. The mean dosage and duration of treatment with MCFG were 154.6±55.3 mg/day and 14.0±6.9 days, respectively. The main underlying hematological disorders were acute leukemia (61.3%), non-Hodgkin’s lymphoma (18.3%) and myelodysplastic syndrome (10.8%). The number of pts with hematopoietic stem cell transplantation (HSCT) was 76 (19.6%). The clinical response rate (CRR), excluding 4 non-evaluable pts was 63.3% (243/384): 60.1% (89/148) for pts with possible fungal infection and 65.3% (154/236) for pts with refractory fever, respectively. Even in persistent neutropenic pts whose neutrophil counts were < 500/μL throughout the treatment with MCFG, the CRR was high enough: 46.9% (61/130). No difference was observed in the CRR among the main underlying hematological disorders. The CRR in pts with HSCT and other conditions were 63.2% (48/76) and 63.3% (195/308), respectively. Drug-related adverse events (DAEs) were observed in 16.8% (65/388). Serious DAEs such as elevation of serum bilirubin and renal dysfunction was observed in 0.52% (2/388). Conclusion: MCFG was confirmed to have high clinical efficacy and be safe for the treatment of suspected fungal infection in pts with hematological disorders and neutropenia.

Los estilos APA, Harvard, Vancouver, ISO, etc.

43

Ssepuuya, Joel, Stephanie Zhang, Kelsey Meador, Lizeth Tamayo y Brandon Pierce. "Abstract C124: Identifying cancer disparities in the University of Chicago catchment area". Cancer Epidemiology, Biomarkers & Prevention 32, n.º 1_Supplement (1 de enero de 2023): C124. http://dx.doi.org/10.1158/1538-7755.disp22-c124.

Texto completo

Resumen

Abstract (a) Cancer statistics are vital for helping doctors and researchers track cancer cases and use the data to find trends in various populations and patterns of occurrences, and make important public health decisions on where to direct funding, screening programs, and other steps to take in high-rate areas. This data can also tell doctors and researchers how effective some treatments are, based on the rise or fall in incidence and mortality rates, and can also help them pinpoint areas that need more attention. (b) Disparities in cancer incidence and mortality have not been described for the University of Chicago Comprehensive Cancer Center’s (UCCCC) patient catchment area (CA), the region from which the center draws its patients. This research aimed to describe incidence and mortality rates (2013-2017) for leading cancers in the CA, which consists of Cook County, IL; DuPage County, IL; Lake County, IL; Will County, IL; and Lake County, IN. Age-adjusted rates (per 100,000) were calculated for leading cancers by sex for each county, the CA, U.S., and IL. Racial disparities were also examined by comparing Black rates to White rates. (c) Incidence rates were higher in the CA compared to the U.S for all cancers data was available for: all sites combined, breast, and prostate. For males, mortality rates of prostate, colorectal, pancreatic, and stomach cancers were higher in the CA compared to the U.S. For females, mortality rates of breast, colorectal, myeloma, uterine, stomach, and bladder cancers, as well as all sites combined were higher in the CA compared to the U.S. By county, males experienced incidence rates of 8% to nearly 2.5 times higher and mortality rates 3% to over 1.5 times higher compared to the U.S. for various cancers. By county, females experienced incidence rates 5% to over 4 times higher and mortality rates 4% to over 1.5 times higher compared to the U.S. for various cancers. Lake County, IN generally had the highest incidence and mortality rates. Racial disparities in incidence and mortality were present for most cancers in the CA overall and by county. For males, racial disparities in mortality for prostate, stomach, and larynx are of greatest concern. For females, racial disparities in mortality for myeloma, cervical, and uterine are of greatest concern. (d) This research highlights important health inequities and priorities for the UCCC to reduce these disparities in the areas of cancer risk, prevention, and treatment. Citation Format: Joel Ssepuuya, Stephanie Zhang, Kelsey Meador, Lizeth Tamayo, Brandon Pierce. Identifying cancer disparities in the University of Chicago catchment area [abstract]. In: Proceedings of the 15th AACR Conference on the Science of Cancer Health Disparities in Racial/Ethnic Minorities and the Medically Underserved; 2022 Sep 16-19; Philadelphia, PA. Philadelphia (PA): AACR; Cancer Epidemiol Biomarkers Prev 2022;31(1 Suppl):Abstract nr C124.

Los estilos APA, Harvard, Vancouver, ISO, etc.

44

Selvanesan, Benson, Sheelu Varghese, Justyna Andrys, Ricardo Arriaza, Rahul Prakash, Purushottam Tiwari, Cara Olsen et al. "Abstract P2-17-04: Pharmacological inhibition of LY6K induced cell cycle arrest and DNA damage by disrupting the LY6K-Histone-Aurora B signaling axis". Cancer Research 83, n.º 5_Supplement (1 de marzo de 2023): P2–17–04—P2–17–04. http://dx.doi.org/10.1158/1538-7445.sabcs22-p2-17-04.

Texto completo

Resumen

Abstract Pharmacological inhibition of LY6K induced cell cycle arrest and DNA damage by disrupting the LY6K-Histone-Aurora B signaling axis Benson C. Selvanesan1,2, Sheelu Varghese1,2, Justyna Andrys5, Ricardo H. Arriaza6, Rahul Prakash6, Purushottam B Tiwari7, Cara Olsen8, Daniel Hupalo2,4, Yuriy Gusev5, Megha N. Patel6, Sara Contente1, Miloslav Sanda9, Aykut Uren7, Matthew D. Wilkerson3,4, Clifton L. Dalgard3,4, Linda S. Shimizu6, Maksymilian Chruszcz6, Tomasz Borowski5, Geeta Upadhyay 1,3,7. Affiliations 1 Department of Pathology, 2 Henry M. Jackson Foundation, 3 Murtha Cancer Center, 4 Department of Anatomy, Physiology, and Genetics 8 Department of Preventive Medicine and Biostatistics Uniformed Services University of the Health Sciences, Bethesda, MD, USA. 5 Jerzy Haber Institute of Catalysis and Surface Chemistry Polish Academy of Sciences, Cracow, Poland. 6 Department of Chemistry and Biochemistry, University of South Carolina, Columbia, SC, USA. 7 Department of Oncology, Georgetown University Medical Center, Washington, DC, USA. 9 Max Planck Institute for Heart and Lung Research, Ludwigstrasse, 43, 61231 Bad Nauheim, Germany. Correspond Disclaimer The opinions expressed herein are those of the authors and are not necessarily representative of the official policies of the Uniformed Services University of the Health Sciences (USUHS), the Department of Defense (DOD), the United States Army/Navy/Air Force, the U.S. Government, or any other funding agencies Conflict of Interest None Acknowledgments NIH, NCI, R01 CA227694. NIH, NCI, R21CA256424. DOD, USUHS, VPR-NFP-74-9824. Biomedical Instrumentation Center, USUHS. The American Genome Center, USUHS. Antibody Characterization Program, Clinical Proteomics Tumor Analysis Consortium (CPTAC), National Cancer Institute, National Institute of Health. The Polish Grid Infrastructure, Cracow, Poland. NIH P30CA51008 and 1S10OD019982-01 to Biacore Molecular Interaction Shared Resource (BMISR), Georgetown University. ABSTRACT Increased expression of LY6K is significantly associated with poor survival outcomes in many solid cancers, including triple-negative and estrogen receptor-positive breast, ovarian, gastric, head and neck, neuroblastoma, bladder, and lung cancers. Inhibition of LY6K signaling is an ideal therapeutic approach for cancer, since the LY6K protein is not involved in vital organ function. Previously, we identified the small molecule NSC243928 as a binder of LY6K using surface plasmon resonance screening and showed that its activity was dependent on LY6K expression in triple-negative breast cancer cells. Here, we demonstrate the structural basis of the molecular interaction of NSC243928 with LY6K protein and the subsequent inhibition of LY6K function in mitosis and cell division via Aurora B-histone pathway. We observed that LY6K interacts with phosphorylated histones and Aurora B kinases during mitosis and that this interaction was disrupted in the presence of NSC243928. Disruption of LY6K function in mitosis/cytokinesis leads to DNA damage, senescence, and apoptosis of cancer cells. We observed that NSC243928 led to increased binding of LY6K to phosphorylated gammaH2X at S139, which was dependent on NSC243928 interaction with LY6K on phenylalanine 79. Furthermore, we observed increased levels of phosphorylated gammaH2X at S139 and increased caspase-3 activation in the tumor isografts of 4T1 and E0771 mammary tumors treated with NSC243928. These data reveal that LY6K is a novel cell cycle target for therapeutic development in triple-negative breast cancer and other solid cancers with high expression of LY6K, such as bladder cancer, head and neck, and lung cancer. Citation Format: Benson Selvanesan, Sheelu Varghese, Justyna Andrys, Ricardo Arriaza, Rahul Prakash, Purushottam Tiwari, Cara Olsen, Daniel Huplo, yuriy Gusev, Megha Patel, Sara Contente, Miloslav Sanda, Matthew Wilkerson, Clifton Dalgard, Linda S. Shimizu, Maksymilian Chruszcz, Tomasz Borowski, Geeta Upadhyay. Pharmacological inhibition of LY6K induced cell cycle arrest and DNA damage by disrupting the LY6K-Histone-Aurora B signaling axis [abstract]. In: Proceedings of the 2022 San Antonio Breast Cancer Symposium; 2022 Dec 6-10; San Antonio, TX. Philadelphia (PA): AACR; Cancer Res 2023;83(5 Suppl):Abstract nr P2-17-04.

Los estilos APA, Harvard, Vancouver, ISO, etc.

45

Banamtuan, Maglon F. y Harun Y. Natonis. "Early Childhood Mindset Stimulation for Understanding Pancasila Through Affective Education". JPUD - Jurnal Pendidikan Usia Dini 13, n.º 1 (30 de abril de 2019): 29–42. http://dx.doi.org/10.21009/10.21009/jpud.131.03.

Texto completo

Resumen

This study aims to find out how to stimulate Early Childhood Mindset in Theodeosius kindergarten through affective education. This research is qualitative research. Data analysis is done by reducing data, presenting data, and drawing conclusions. The research findings showed that students were very enthusiastic about following the activities of the teacher with pleasure, happiness and did not feel burdened from the initial activities to the final activities of the students who followed them well. The efforts made by TK Theodosius educators are good, so that it can be said that the teacher's efforts to train children's independence are maximized. The students have begun to instill Pancasila values in their daily lives, namely Godhead, Humanity, the Value of Unity, People's Value, and Social Justice. Keywords: Affective Education, Early Childhood Mindset Stimulation, Understanding Pancasila. References Abramson, L., Daniel, E., & Knafo-noam, A. (2018). Journal of Experimental Child The role of personal values in children ’ s costly sharing and non-costly giving. Journal of Experimental Child Psychology, 165, 117–134. https://doi.org/10.1016/j.jecp.2017.03.007 Aydoğan, C., Farran, D. C., & Sağsöz, G. (2015). The relationship between kindergarten classroom environment and children’s engagement. European Early Childhood Education Research Journal, 23(5), 604–618. https://doi.org/10.1080/1350293X.2015.1104036 Bowo, T. A., & Budiati. (2017). Model Pembelajaran Bahasa Inggris Interaktif Menggunakan Flascard Berbasis Pancasila Sebagai Upaya Pembentukan Karakter Bangsa. Media Penelitian Pendidikan, 11(2), 59–74. Cartledge, G., & Milburn, J. F. (1980). Teaching social skills to children. Pergamon Press. Chou, S. Y., & Pearson, J. M. (2012). Organizational citizenship behaviour in IT professionals: An expectancy theory approach. Management Research Review, 35(12), 1170–1186. https://doi.org/10.1108/01409171211281282 Decety, J., Meidenbauer, K. L., & Cowell, J. M. (2018). The development of cognitive empathy and concern in preschool children: A behavioral neuroscience investigation. Developmental Science, 21(3), 1–12. https://doi.org/10.1111/desc.12570 Dodge, D. T. (2004). Early Childhood Curriculum Models Why What and How Programs Use them. Exchange Organizational Behavior Teaching Journal, (February), 71–75. Domitrovich, C. E., Durlak, J. A., Staley, K. C., & Weissberg, R. P. (2017). Social-Emotional competence: An essential factor for promoting positive adjustment and reducing risk in school children. Child Development, 88(2), 408–416. https://doi.org/10.1111/cdev.12739 Dunlap, G., Powell, D., & Org, W. C. (2009). Promoting Social Behavior of Young Children in Group Settings: A Summary of Research. Technical Assistance Center on Social Emotional Intervention for Young Children, (August). Retrieved from www.challengingbehavior.org Emilson, A., & Johansson, E. (2013). Values in Nordic Early Childhood Education: Democracy and the Child’s Perspective. Choice Reviews Online, 30(11), 30-6297-30–6297. https://doi.org/10.5860/choice.30-6297 Ertürk, A. (2007). Increasing organizational citizenship behaviors of Turkish academicians. Journal of Managerial Psychology, 22(3), 257–270. https://doi.org/10.1108/02683940710733089 Esnard, C., & Jouffre, S. (2008). Organizational citizenship behavior: Social valorization among pupils and the effect on teachers’ judgments. European Journal of Psychology of Education, 23(3), 255–274. https://doi.org/10.1007/BF03172999 Grajczonek, J., & Truasheim, M. (2017). Implementing Godly Play in educational settings: a cautionary tale. British Journal of Religious Education, 39(2), 172–186. https://doi.org/10.1080/01416200.2015.1110112 Hamid. (2015). Semiotika Kewarganegaraan. Bandung: Rizqi Press. Hildebrandt, C., & Zan, B. (2015). Pendekatan Konstruktivis pada Pendidikan Moral Anak Usia Dini. In Handbook Pendidikan Moral dan Karakter (pp. 511–536). Bandung: Nusa Media. Hurlock, E. B. (1999). Perkembangan Anak Jilid I. (Erlangga, Ed.). jakarta. Hurlock, E. B. (2010). Perkembangan Anak (6th ed.). Jakarta: Erlangga. Mahanani, P., Purnama Putra, A., & Kristianingsih, K. (2018). Analysis of the Influence of Understanding the Pancasila Values of Teachers on Learning in Elementary School, 244(Ecpe), 168–172. https://doi.org/10.2991/ecpe-18.2018.37 Mayfield, C. O., & Taber, T. D. (2010). A prosocial self-concept approach to understanding organizational citizenship behavior. Journal of Managerial Psychology, 25(7), 741–763. https://doi.org/10.1108/02683941011075283 Nicholson, J., Kuhl, K., Maniates, H., Lin, B., Bonetti, S., Nicholson, J., … Bonetti, S. (2018). A review of the literature on leadership in early childhood : examining epistemological foundations and considerations of social justice, 4430. https://doi.org/10.1080/03004430.2018.1455036 Organ, D. W. (1988). Organizational citizenship behavior: The good soldier syndrome. Lexington: Lexington Books. Podsakoff, P. M., MacKenzie, S. B., Moorman, R. H., & Fetter, R. (2015). Transformational Leader Behaviors and Their Effects on Trust , Satisfaction , and Organizational Citizenship Behaviors. JAI Press Inc., (August), 107–142. https://doi.org/10.1016/1048-9843(90)90009-7 Podsakoff, P. M., MacKenzie, S. B., Paine, J. B., & Bachrach, D. G. (2000). Organizational Citizenship Behaviors: A Critical Review of the Theoretical and Empirical Literature and Suggestions for Future Research. Journal of Management, 25(3), 513–563. https://doi.org/10.1016/0009-2614(78)85552-3 Robson, J. V. K. (2019). How do practitioners in early years provision promote Fundamental British Values ? How do practitioners in early years provision promote, 9760. https://doi.org/10.1080/09669760.2018.1507904 Ronald Silalahi, U. yuwono. (2016). Research in social sciences and technology. Research in Social Sciences and Technology, 2(3), 58–57. Retrieved from http://www.ressat.org/index.php/ressat/article/view/329 Samuelsson, I. P., & Hagglund, S. (2009). Early Childhood Education and Learning for Sustainable Development and Citizenship. International Journal, 41(2), 49–63. Sanjaya, W. (2013). Penelitian Pendidikan (Jenis, Metode, dan Prosedur),. Jakarta: Kencana Prenada Media Group. Stephens, M., & Ormandy, P. (2018). Extending conceptual understanding: How interprofessional education influences affective domain development. Journal of Interprofessional Care, 32(3), 348–357. https://doi.org/10.1080/13561820.2018.1425291 LK Stevenson, B. (2017). Children’s independence: a conceptual argument for connecting the conduct of everyday life and learning in Finland. Children’s Geographies, 15(4), 439–451. https://doi.org/10.1080/14733285.2016.1271942 UNESCO. (2014). Preparing learners for the challenges of the 21st century. France: UNESCO. Retrieved from http://www.unesco.org/new/en/global-citizenship-education UNESCO. (2015). Global citizenship education: topics and learning objectives.

Los estilos APA, Harvard, Vancouver, ISO, etc.

46

Andayani, Friska Tri y Endang Ekowarni. "Peran Relasi Orang Tua-Anak dan Tekanan Teman Sebaya terhadap Kecenderungan Perilaku Pengambilan Risiko". Gadjah Mada Journal of Psychology (GamaJoP) 2, n.º 2 (6 de febrero de 2018): 138. http://dx.doi.org/10.22146/gamajop.33097.

Texto completo

Resumen

Alsa, A. (2014). Pendekatan kualitatif dan kuantitatif serta kombinasinya dalam penelitian psikologi. Cetakan V. Yogyakarta: Pustaka Pelajar.Badan Koordinasi Keluraga Berencana Nasional (BKKBN). (2011). Kajian profil penduduk remaja (10-24 tahun): Ada apa dengan remaja. Policy Brief Puslitbang Kependudukan. Retrieved fromhttp://www.depkes.go.id/resources/download/pusdatin/infodatin/infodatin%20reproduksi%20remaja-ed.pdfBadan Pusat Statistik (BPS). (2012). Survei demografi dan kesehatan Indonesia 2012. Kesehatan Reproduksi remaja. Jakarta: Kementerian Kesehatan Jakarta. Retrieved from http://www.bkkbn.go.id/litbang/pusdu/Hasil%20Penelitian/SDKI%202012/Laporan%20Pendahuluan%20REMAJA%20SDKI%202012.pdfBadan Pusat Statistik Provinsi D.I. Yogyakarta. (2015). Statistik politik dan keamanan Provinsi Daerah Istimewa Yogyakarta. Yogyakarta: Badan Pusat Statistik.Baumrind, D., Larzele, R. E., & Owens, E. B. (2010). Effect of preschool parents’ power assertive patterns ang practise on adolescent development. Parenting Science and Practice, 10(3), 157-201.Bonino, Cattelino, & Clairano,. (2005). Adolescents and risk, behavior, functions, and protective factors. Italia: Springer.Burt, S.A., McGue, M., Lacono, W.G., & Krueger, R.F. (2006). Differential parent–childrelationships and adolescent externalizing symptoms: Cross-lagged analyses within a monozygotic twin differences design. Devevelopmental Psychology, 42, 1289–1298.Chein, J., Albert, D., O’Brien, L., Uckert, K., & Steiberg, L. (2011). Peer increase adolescent risk taking by enhancing activity in the brain’s reward circuitry. Journal Development Science, 14(2), F1-F10.Choo, H., & Shek, D. (2013). Quality of parent-child relationship, family conflic, peer pressure, and drinking behaviours of adolescents in an Asian context: the case of Singapore. Social Indication Rescue, 110, 1141-1157.Clasen, D. R., & Brown, B. B. (1987). Understanding peer pressure in the middle school. Journal of Adolescence, 19(1), 21-23.Crawford, L. A., & Novak, K. B. (2002). Parental and peer influences on adolescent drinking: The relative impact of attachment and opportunity. Journal of Child & Adolescent Substance Abuse, 12(1), 1-26.Crockett, L. J., Raffaelli, M., & Shen, Y. L. (2006). Linking self-regulation and risk proneness to risky sexual behavior: Pathways through peer pressure and early substance use. Journal of Research on Adolescence, 16(4), 503-525.Derek, K., & Smiler, A. P. (2013). Norms and peer pressure in adolescent boys and girls alcohol use, Substance Use Misuse, 48(5), 371-378.DiClemente, R. J., Santelli, J. S., & Crosby, R. A. (2009). Adolescent health. Understanding and preventing risk behaviour. San Franscisco: Jossey-Bass: A Wiley Imprint.Dixson, M., Bermes, E., & Fair, S. (2014). An Instrument to investigate expectations about and experiences of the parent-child relationship: The parent-child relationship schema scale. Social Science, 3, 84-114.Eaton, D. K., Kann, L. & Kinchen, S. (2006). Youth risk behavior surveillance. Division of Adolescent and School Health, National Center for Chronic Disease Prevention and Health Promotion,55(5),1-108.Faska. (2015, April 5). Pernikahan dini di Jogja meningkat tajam. Pojoksatu. Retrieved fromhttp://pojoksatu.id/news/berita-nasional/2015/04/05/pernikahan-dini-di-jogja-meningkat-tajam/Fisher, L., & Feldman, S. S. (1998). Familial antecedents of young adulth health risk behavior: A longitudinal study. Journal of Family, 12(1), 68-80.Gardner, M. & Steinberg, L. (2005). Peer influence on risk taking, risk preference, and risky decision making in adolescence and adulthood: An experimental study. Developmental Psychology, 41(4), 625–635.Garnefski, N., & Diekstra, R. F. W. (1996). Perceived social support from family, school, and peers: Relationship with emotional and behavioral problem among adolescents. Journal of the American Academy of Child and Adolescent Psychiatry, 35(12), 1657-1664.Gheorghiu, A., Delhomme, P., & Felonneau, M. L. (2015). Peer pressure and risk taking in young drivers’ speeding behavior. Transportation Research Part F, 35, 101–111.Ghozali, I. (2011). Aplikasi analisis multivariat dengan program IBM SPSS 19, Edisi kelima. Semarang: Universitas Diponegoro.Gullone, E. & Moore, S. (2000). Developing adolescents: A reference for professionals. Washington DC: American Psychological Association.Informasi Kementerian Pemuda dan Olahraga. (2009). Kementerian pemuda dan olahraga. Biro Perencanaan: Sekretariat Kementerian Pemuda dan Olahraga.Jahun, K. (2011). Patterns of parent-child relationship quality, parent depression and adolescent development outcomes (Disertasi tidak terpublikasi). University of Washington, School of Nursing. Jessor, R., & Jessor, T. (2009). Description versus explanation in cross-national research on adolescent. Journal of Adolescent Health, 43(6), 527-528.Jessor, R., Turbin, M.S., Costa, F.M., Dong, Q., Zhang, H., & Wang, C. (2003). Adolescent problem behavior in China and the United States: A cross-national study of psychosocial protective factors. Journal of Adolescence Research,13, 329–360.Johnson, & Matthew, D. (2013). Parent-child relationship quality directly and indirectly influences hooking up behaviour reported in young adulthood through alcohol us in adolescence. Arch Sex Behaviour, 42, 1463-1472.Karriker-Jaffe, K. J., Foshee, V. A., Ennett, S. T., & Suchindran, C., (2008). The development of aggression during adolescence: Sex differences intrajectories of physical and social aggression among youth in rural areas. Journal Abnormal.Child Psycholology, 36, 1227–1236.Kementerian Dalam Negeri (Kemendagri). (2014). Kode dan data wilayah administrasi pemerintahan. Jakarta: Ditjen Kependudukan dan Catatan Sipil Kemendagri Per Semester I.Klahr, A.M., McGue, M., Lacono, W.G., & Burt, S.A. (2011). The association between parent–child conflict and adolescent conduct problems over time: Results from a longitudinal adoption study. Journal Abnormal Psychology, 120, 46–56.Masten, A. S. (2001) Resiliensi process in development. American Psichological Association, 56(3), 227-228.Mathijssen, J. P. J., Janssen, M. M., Bon-Martens, M., Oers, H. A., Boer, A. D., & Garretsen, H. F. (2014). Alcohol segment-specific associations between the quality of the parent-child relationship and adolescent alcohol use. Journal of Public Health, 872, 1471-2458.Leather, N. C. (2009). Risk-taking behaviour in adolescence: A literature review. Journal of Child Health Care,13(3), 295–304. Oni, A. A. (2010). Peer group pressure as a determinant of adolescent social adjustment in Nigerian schools. Asian Pasific Journal of Educators and Education, 25, 189-202.Peacock, A., & Bruno, R. (2015). Young adults who mix alcohol with energy drink: Typology of risk taking behaviour. Addictive Behaviours, 45, 252-258.Qu, Y., Fuligni, A. J., Galvan, A., & Telzer, E. H. (2015). Buffering effect of positive parent–child relationships on adolescent risk taking: A longitudinal neuro imaging investigation. Developmental Cognitive Neuroscience, 15, 26–34.Ritcher. (2010). Risk behavior in adolescence, patterns, determinants, and consequences. Germany: Springer Fachmedien.Sales, J. M., & Irwin, C. E., Jr. (2009). Theories of adolescent risk-taking: A biopsychosocial model. In R. DiClemente & R. Crosby (Eds.), Adolescent health:Understanding and preventing risk behaviors andadverse health outcomes (pp. 31–50). San Francisco, CA: Jossey-Bass.Santrock, J. W. (2003). Adolescene: Perkembangan remaja. Jakarta: Erlangga.Savitri, A. R. (2015, Desember 11). Inilah organisasi paling nge-hits di Yogyakarta. Youth Forum. Retrieved from http://www.duniaremaja. jogjaprov.go.id/detilberita/14/1/Inilah-Organisasi-Paling-Nge-Hits-di-Yogyakarta,-YouthForum-DIYSkaar, N. R. (2009). Development of the adolescent exploratory and health risk behaviour rating scale(Unpublished dissertation). University of Minnesota, United Stated.Sofronoff, Dalgliesh, & Kosky. (2004). Out of options, a cognitive model of adolescent suicide and risk-taking. USA: Cambridge University Press.Stattin, H., & Kerr, M. (2000). Parental monitoring: A reinterpretation. Child Developmental, 71, 1072-1085.Survei Demografi dan Kesehatan Indonesia. (2013). Kesehatan reproduksi remaja. Badan Pusat Statistik. Jakarta: Indonesia.Tsai, K. M. (2013). Continuity and discontinuity in perceptions of family relationship from adolescence to young adulthood. Journal of Child Development, 84(2), 471-484.Turley, R. N. L., Desmond, M., & Bruch, S. K. (2010). Unanticipated educational consequences of a positive parent-child relationship. Journal of Marriage and Family, 72(5), 1377-1390.

Los estilos APA, Harvard, Vancouver, ISO, etc.

47

Sani, Ahmed Sani. "Assessment of Knowledge and Awareness of Cervical Cancer Among Women of Reproductive Age in Kaga Local Government Area, Borno State, Nigeria". International Journal of Health Sciences 6, n.º 2 (13 de marzo de 2023): 1–8. http://dx.doi.org/10.47941/ijhs.1209.

Texto completo

Resumen

Purpose: Incidences of cervical cancer have assumed alarming proportions among women of reproductive age in developing countries. It is a grave concern because it is an easily detectable and preventable disease. More concerning also is the high mortality rate associated with this condition. This study sought to investigate the level of knowledge and awareness of cervical cancer among women of reproductive age in Kaga Local government area of Borno state, Nigeria. The study also investigated the knowledge of signs and symptoms, and knowledge of preventive methods. Methodology: It is a descriptive survey research type which investigated into the nature of trends and influences of variables upon one another as they interact. A well-structured questionnaire titled “Knowledge of Cervical Cancer Questionnaire” (KCCQ), consisting of 34 items was used as instrument for collecting data. It was adapted from the instruments of Abiodun, Fatungase, Olu-Abiodun, Idowu-Ajiboye, and Awosile (2013) and from the studies by Ziba, Baffoe, Dapare, Shittu, and Antuamwine (2015). The questionnaire consists of 5 sections, identified as A, B, C, D, and E. The items in Section B were used to elicit information on the knowledge and awareness about cervical cancer, screening, prevention, etc. The continuum used was a simple yes and no response. From an estimated population of 158,184, a sample of 400 respondents was chosen through a combination of purposive sampling and random sampling techniques. Four research questions and three hypotheses formulated and tested at 0.05 level of significance guided the study. Simple percentage and chi-square were used as tools for data analyses. Findings: Findings of the study revealed that the general level of awareness of cervical cancer is low among the study group. Also, the study revealed that the level of knowledge of preventive measures and of risk factors was low. Unique Contribution to Theory, Policy and Practice: It was recommended amongst others that, thorough health counseling and screening should be made compulsories for all women of reproductive age, and that, quality cancer screening center should be established in Kaga to foster early diagnosis and treatment to prevent complications that arises from cervical cancer.

Los estilos APA, Harvard, Vancouver, ISO, etc.

48

Castro-Corredor, D., L. Á. Calvo Pascual, E. C. Garrido Merchán, M. A. Ramírez Huaranga y M. Paulino Huertas. "AB0851 APPLICABILITY OF THE MASEI INDEX IN ENTHESIS AND ITS ASSOCIATION WITH OTHER INDICES / SEROLOGICAL MARKERS OF ACTIVITY IN PATIENTS WITH SPONDYLOARTHRITIS". Annals of the Rheumatic Diseases 81, Suppl 1 (23 de mayo de 2022): 1550.2–1551. http://dx.doi.org/10.1136/annrheumdis-2022-eular.3927.

Texto completo

Resumen

BackgroundSpondyloarthritis (SpA) are a group of chronic inflammatory diseases with affectation, mainly of the axial skeleton and, also, of peripheral joints. The enthesis is one of the target organs, since an inflammation of it, known as enthesitis, can be observed, which in many patients with spondyloarthritis could be unnoticed.ObjectivesFind the relation between the MASEI index (Madrid Sonographic Enthesitis Index) in entheses and other indices/serological activity markers (such as BASDAI, DAPSA or ASDAS and ESR, CRP) in spondyloarthritis patients.MethodsObservational, descriptive and cross-sectional study. Data were collected from patients with SpA who underwent musculoskeletal ultrasound using the Madrid Sonographic Enthesitis Index (MASEI) and who were treated in our clinics from May 2021 to September 2021 and under the approval of the CEICm of our center. The variables evaluated were described using measures of frequency and measures of central tendency/dispersion, as appropriate. First, we tested the normality of all the variables, using a Shapiro-Wilk test. We studied the correlation of parametric numerical variables (such as MASEI-Vitamin D, MASEI-ASDAS), using the Pearson coefficient. On the other hand, for non-parametric numerical variables (such as MASEI-BASDAI) we use Spearman’s coefficient. For parametric numeric and categorical variables (such as MASEI-VITAMINA D, ASDAS-VITAMINA D) we constrast the mean of differences using the T-Student test, while for non-parametric numerical and categorical variables, we contast the difference of means with the Mann-Whitney U test (MASEI-PCR, MASEI_VSG). Finally, to find out the correlation between categorical variables (such as VITAMIN D-PCR), we used a chi-square test. Finally, we have done a curve-fitting study with Matlab, obtaining the functions that better adjust the data avoiding overfitting. We have done this parametric optimization with the following pairings: MASEI-ASDAS, MASEI-BASDAI and MASEI DAPSA.ResultsWe analyze twenty four patients with SpA (with mean age 50.50 ± 10.63 years) 8 women and 16 men. They present: radiographic axial spondyloarthritis (5 patients), non-radiographic axial spondyloarthritis (4 patients), psoriatic arthritis (10 patients), spondyloarthritis associated with inflammatory bowel disease (2 patients), reactive arthritis (2 patients), and, finally, one patient has undifferentiated peripheral spondyloarthritis. The variables have the following average levels: ASDAS, 2.35 (±1.09); BASDAI (for those with axial involvement) 4.54 (±2.93); DAPSA (for psoriatic arthritis) 10.98 (± 6.85) and total MASEI 19.88 (± 14.77). We have found a correlation between the total MASEI and the following variables: ASDAS (Pearson coefficient=0.696), BASDAI (Spearman coefficient=0.823) and DAPSA (Pearson coefficient=0.823). The mean vitamin D levels were 25.98 (±12.05), and it has a negative correlation with the MASEI equal to -0.317. As far as curve fitting is concern, a couple of sinusoidal functions were obtained for the MASEI-ASDAS and MASEI DAPSA pairings (see Figure 1 and Figure 3) and a linear regression for MASEI-BASDAI (see Figure 2). These three curves have an R-squared fit of 0.77, 0.87 and 0.52, respectively.ConclusionPatients with spondyloarthritis who present greater activity of the disease measured by ASDAS, BASDAI/DAPSA and by the serological markers of inflammation CRP and ESR, present a higher total MASEI than patients who are controlled. In addition, it has been observed that patients with low levels of vitamin D have higher disease activity and a higher total MASEI.References[1]De Miguel E, Cobo T, Muñoz-Femández S, Naredo E, Usón J, Acebes JC, et al. Validity of enthesis ultrasound assessment in spondyloarthropathy. Ann Rheum Dis. 2009;68(2):169–74.Disclosure of InterestsDavid Castro-Corredor Speakers bureau: UCB, Lilly, Pfizer, Gebro Pharma, Nordic Pharma, Luis Ángel Calvo Pascual: None declared, Eduardo C. Garrido Merchán: None declared, Marco Aurelio Ramírez Huaranga Speakers bureau: Grunenthal, Gebro Pharma, Marcos Paulino Huertas Speakers bureau: Lilly, Pfizer

Los estilos APA, Harvard, Vancouver, ISO, etc.

49

Sandhu, Ravinder K., Jack M. Lionberger, Megan Othus, John M. Pagel, Kathleen ShannonDorcy, Paul C. Hendrie, Stephen H. Petersdorf, Pamela S. Becker, Frederick R. Appelbaum y Elihu H. Estey. "Survival After Failure of Initial Therapy for Newly-Diagnosed or Relapsed/Refractory AML At An Academic Center: Subsequent Clinical Trial Vs. Not". Blood 118, n.º 21 (18 de noviembre de 2011): 1497. http://dx.doi.org/10.1182/blood.v118.21.1497.1497.

Texto completo

Resumen

Abstract Abstract 1497 Background: Many adult patients do not enter complete remission (CR) after therapy for acute myeloid leukemia (AML) and the physician must often give advice regarding continued anti-AML therapy in a clinical trial. Even with novel therapeutics and approaches, numerous publications suggest a probability of CR <20% in these patients. Considering the time investment, the possibility of toxicity, and the impact on quality of life, the “non trial” (i.e. supportive or palliative care) approach becomes a potentially attractive alternative for some patients. These factors are especially critical when the patient lives a considerable distance from the treating center. To better inform this decision-making process, we compared survival in two groups of patients who had each received therapy at the Seattle Cancer Care Alliance (outpatient) or University of Washington (inpatient) (SCCA/UW) without obtaining a CR. One group included those who subsequently elected to enroll in a clinical trial and did not achieve a remission (Trial group), and the other group included patients who subsequently decided to receive no further specific anti-leukemic therapy at the SCCA/UW (the Non-trial group). Methods: Patients were identified by database query, and when necessary confirmed by direct review of paper and electronic medical records. Our data set included patients arriving to the SCCA/UW between January 2008 and March of 2011. Patients selected for this study were those whose most recent therapy was given at SCCA/UW and was unsuccessful (no CR). The date this outcome was determined is called the “resistance date” (RD). We dated survival from RD in the Non-trial group and from the date on which the salvage treatment was started in the patients receiving therapy. As best we can tell, none of the Non-Trial patients received subsequent salvage outside the SCCA/UW (i.e., after returning home). Multivariate analysis was used to assess the effect on survival time of (a) Trial participation (yes or no), (b) age, (c) performance status (PS 0–1 vs. 2–4) at resistance date, (d) cytogenetics (unfavorable vs. favorable/intermediate), and (e) status at initial SCCA/UW visit (newly-diagnosed vs. secondary vs. relapsed vs. refractory). Results: 134 patients had their initial SCCA/UW therapy without obtaining CR. Sixty-four of these subsequently received unsuccessful salvage therapy at the SCCA/UW (the Trial group) and 70 did not (Non-trial group). Distribution of age (median 59), cytogenetic risk (60% unfavorable), and PS of 2 or higher (35%) was similar in both groups. Independent predictors of shorter survival were: PS 2–4 (HR 1.70, p=0.02), “unfavorable” cytogenetics (HR 1.77, p = 0.01), relapsed at initial SCCA visit compared to newly-diagnosed (HR 1.93, p = 0.03), and presence in the non-trial group (HR 3.20, p <.001). The unadjusted survival comparison is shown below and indicates an approximate 10 month median survival benefit for patients receiving salvage at SCCA (HR 2.68, p<.001). Conclusions: There is a survival benefit associated with receiving salvage therapy (Trial group) for adult AML at the SCCA/UW (and presumably similar centers) despite failure to achieve CR with this salvage therapy. This degree of benefit in a new therapeutic trial would likely lead to FDA approval. The seeming advantage may reflect a non-quantifiable bias leading to selection of “better” patients for trials, a closer follow-up of patients placed on trials, or a true survival benefit despite lack of CR. The latter might reflect a regimen's ability to lower malignant proliferation and/or improve functional cell counts. Despite the confounding, and recognizing that a randomized trial to address this issue is unlikely, it seems reasonable for a patient to attempt to participate in clinical trials of new AML salvage therapies, recognizing however, that factors other than survival may affect a given patient's decision. Disclosures: No relevant conflicts of interest to declare.

Los estilos APA, Harvard, Vancouver, ISO, etc.

50

KITLV, Redactie. "Book Reviews". New West Indian Guide / Nieuwe West-Indische Gids 69, n.º 3-4 (1 de enero de 1995): 315–410. http://dx.doi.org/10.1163/13822373-90002642.

Texto completo

Resumen

-Dennis Walder, Robert D. Hamner, Derek Walcott. New York: Twayne Publishers, 1993. xvi + 199 pp.''Critical perspectives on Derek Walcott. Washington DC: Three continents, 1993. xvii + 482 pp.-Yannick Tarrieu, Lilyan Kesteloot, Black writers in French: A literary history of Negritude. Translated by Ellen Conroy Kennedy. Washington DC: Howard University Press, 1991. xxxiii + 411 pp.-Renée Larrier, Carole Boyce Davies ,Out of the Kumbla: Caribbean women and literature. Trenton NJ: Africa World Press, 1990. xxiii + 399 pp., Elaine Savory Fido (eds)-Renée Larrier, Evelyn O'Callaghan, Woman version: Theoretical approaches to West Indian fiction by women. London: Macmillan Caribbean, 1993. viii + 126 pp.-Lisa Douglass, Carolyn Cooper, Noises in the blood: Orality, gender and the 'vulgar' body of Jamaican popular culture. London: Macmillan Caribbean, 1993. ix + 214 pp.-Christine G.T. Ho, Kumar Mahabir, East Indian women of Trinidad & Tobago: An annotated bibliography with photographs and ephemera. San Juan, Trinidad: Chakra, 1992. vii + 346 pp.-Eva Abraham, Richenel Ansano ,Mundu Yama Sinta Mira: Womanhood in Curacao. Eithel Martis (eds.). Curacao: Fundashon Publikashon, 1992. xii + 240 pp., Joceline Clemencia, Jeanette Cook (eds)-Louis Allaire, Corrine L. Hofman, In search of the native population of pre-Colombian Saba (400-1450 A.D.): Pottery styles and their interpretations. Part one. Amsterdam: Natuurwetenschappelijke Studiekring voor het Caraïbisch Gebied, 1993. xiv + 269 pp.-Frank L. Mills, Bonham C. Richardson, The Caribbean in the wider world, 1492-1992: A regional geography. Cambridge: Cambridge University Press, 1992. xvi + 235 pp.-Frank L. Mills, Thomas D. Boswell ,The Caribbean Islands: Endless geographical diversity. New Brunswick NJ: Rutgers University Press, 1992. viii + 240 pp., Dennis Conway (eds)-Alex van Stipriaan, H.W. van den Doel ,Nederland en de Nieuwe Wereld. Utrecht: Aula, 1992. 348 pp., P.C. Emmer, H.PH. Vogel (eds)-Idsa E. Alegría Ortega, Francine Jácome, Diversidad cultural y tensión regional: América Latina y el Caribe. Caracas: Nueva Sociedad, 1993. 143 pp.-Barbara L. Solow, Ira Berlin ,Cultivation and culture: Labor and the shaping of slave life in the Americas. Charlottesville: University Press of Virginia, 1993. viii + 388 pp., Philip D. Morgan (eds)-Andrew J. O'Shaughnessy, Karen Ordahl Kupperman, Providence Island, 1630-1641: The other puritan colony. Cambridge: Cambridge University Press, 1993. xiii + 393 pp.-Armando Lampe, Johannes Meier, Die Anfänge der Kirche auf den Karibischen Inseln: Die Geschichte der Bistümer Santo Domingo, Concepción de la Vega, San Juan de Puerto Rico und Santiago de Cuba von ihrer Entstehung (1511/22) bis zur Mitte des 17. Jahrhunderts. Immensee: Neue Zeitschrift für Missionswissenschaft, 1991. xxxiii + 313 pp.-Edward L. Cox, Carl C. Campbell, Cedulants and capitulants; The politics of the coloured opposition in the slave society of Trinidad, 1783-1838. Port of Spain, Trinidad: Paria Publishing, 1992. xv + 429 pp.-Thomas J. Spinner, Jr., Basdeo Mangru, Indenture and abolition: Sacrifice and survival on the Guyanese sugar plantations. Toronto: TSAR, 1993. xiii + 146 pp.-Rosemarijn Hoefte, Lila Gobardhan-Rambocus ,Immigratie en ontwikkeling: Emancipatie van contractanten. Paramaribo: Anton de Kom Universiteit, 1993. 262 pp., Maurits S. Hassankhan (eds)-Juan A. Giusti-Cordero, Teresita Martínez-Vergne, Capitalism in colonial Puerto Rico: Central San Vicente in the late nineteenth century. Gainesville: University Press of Florida, 1992. 189 pp.-Jean Pierre Sainton, Henriette Levillain, La Guadeloupe 1875 -1914: Les soubresauts d'une société pluriethnique ou les ambiguïtés de l'assimilation. Paris: Autrement, 1994. 241 pp.-Michèle Baj Strobel, Solange Contour, Fort de France au début du siècle. Paris: L'Harmattan, 1994. 224 pp.-Betty Wood, Robert J. Stewart, Religion and society in post-emancipation Jamaica. Knoxville: University of Tennessee Press, 1992. xx + 254 pp.-O. Nigel Bolland, Michael Havinden ,Colonialism and development: Britain and its tropical colonies, 1850-1960. New York: Routledge, 1993. xv + 420 pp., David Meredith (eds)-Luis Martínez-Fernández, Luis Navarro García, La independencia de Cuba. Madrid: MAPFRE, 1992. 413 pp.-Pedro A. Pequeño, Guillermo J. Grenier ,Miami now! : Immigration, ethnicity, and social change. Gainesville: University Press of Florida, 1992. 219 pp., Alex Stepick III (eds)-George Irving, Alistair Hennessy ,The fractured blockade: West European-Cuban relations during the revolution. London: Macmillan Caribbean, 1993. xv + 358 pp., George Lambie (eds)-George Irving, Donna Rich Kaplowitz, Cuba's ties to a changing world. Boulder CO: Lynne Rienner, 1993, xii + 263 pp.-G.B. Hagelberg, Scott B. MacDonald ,The politics of the Caribbean basin sugar trade. New York: Praeger, 1991. vii + 164 pp., Georges A. Fauriol (eds)-Bonham C. Richardson, Trevor W. Purcell, Banana Fallout: Class, color, and culture among West Indians in Costa Rica. Los Angeles: UCLA Center for Afro-American studies, 1993. xxi + 198 pp.-Gertrude Fraser, George Gmelch, Double Passage: The lives of Caribbean migrants abroad and back home. Ann Arbor: University of Michigan Press, 1992. viii + 335 pp.-Gertrude Fraser, John Western, A passage to England: Barbadian Londoners speak of home. Minneapolis: University of Minnesota Press, 1992. xxii + 309 pp.-Trevor W. Purcell, Harry G. Lefever, Turtle Bogue: Afro-Caribbean life and culture in a Costa Rican Village. Cranbury NJ: Susquehanna University Press, 1992. 249 pp.-Elizabeth Fortenberry, Virginia Heyer Young, Becoming West Indian: Culture, self, and nation in St. Vincent. Washington DC: Smithsonian Institution Press, 1993. x + 229 pp.-Horace Campbell, Dudley J. Thompson ,From Kingston to Kenya: The making of a Pan-Africanist lawyer. Dover MA: The Majority Press, 1993. xii + 144 pp., Margaret Cezair Thompson (eds)-Kumar Mahabir, Samaroo Siewah, The lotus and the dagger: The Capildeo speeches (1957-1994). Port of Spain: Chakra Publishing House, 1994. 811 pp.-Donald R. Hill, Forty years of steel: An annotated discography of steel band and Pan recordings, 1951-1991. Jeffrey Thomas (comp.). Westport CT: Greenwood, 1992. xxxii + 307 pp.-Jill A. Leonard, André Lucrèce, Société et modernité: Essai d'interprétation de la société martiniquaise. Case Pilote, Martinique: Editions de l'Autre Mer, 1994. 188 pp.-Dirk H. van der Elst, Ben Scholtens ,Gaama Duumi, Buta Gaama: Overlijden en opvolging van Aboikoni, grootopperhoofd van de Saramaka bosnegers. Stanley Dieko. Paramaribo: Afdeling Cultuurstudies/Minov; Amsterdam: Koninklijk Instituut voor de Tropen, 1992. 204 pp., Gloria Wekker, Lady van Putten (eds)-Rosemarijn Hoefte, Chandra van Binnendijk ,Sranan: Cultuur in Suriname. Amsterdam: Koninklijk Instituut voor de Tropen/Rotterdam: Museum voor Volkenkunde, 1992. 159 pp., Paul Faber (eds)-Harold Munneke, A.J.A. Quintus Bosz, Grepen uit de Surinaamse rechtshistorie. Paramaribo: Vaco, 1993. 176 pp.-Harold Munneke, Irvin Kanhai ,Strijd om grond in Suriname: Verkenning van het probleem van de grondenrechten van Indianen en Bosnegers. Paramaribo, 1993, 200 pp., Joyce Nelson (eds)-Ronald Donk, J. Hartog, De geschiedenis van twee landen: De Nederlandse Antillen en Aruba. Zaltbommel: Europese Bibliotheek, 1993. 183 pp.-Aart G. Broek, J.J. Oversteegen, In het schuim van grauwe wolken: Het leven van Cola Debrot tot 1948. Amsterdam: Muelenhoff, 1994. 556 pp.''Gemunt op wederkeer: Het leven van Cola Debrot vanaf 1948. Amsterdam: Muelenhoff, 1994. 397 pp.

Los estilos APA, Harvard, Vancouver, ISO, etc.

Artículos de revistas sobre el tema "Center of Concern (Washington, D.C.)"

Crea una cita precisa en los estilos APA, MLA, Chicago, Harvard y otros