Siga este enlace para ver otros tipos de publicaciones sobre el tema: Alfalfa Diseases and pests.
Artículos de revistas sobre el tema "Alfalfa Diseases and pests"
Crea una cita precisa en los estilos APA, MLA, Chicago, Harvard y otros
Consulte los 50 mejores artículos de revistas para su investigación sobre el tema "Alfalfa Diseases and pests".
Junto a cada fuente en la lista de referencias hay un botón "Agregar a la bibliografía". Pulsa este botón, y generaremos automáticamente la referencia bibliográfica para la obra elegida en el estilo de cita que necesites: APA, MLA, Harvard, Vancouver, Chicago, etc.
También puede descargar el texto completo de la publicación académica en formato pdf y leer en línea su resumen siempre que esté disponible en los metadatos.
Explore artículos de revistas sobre una amplia variedad de disciplinas y organice su bibliografía correctamente.
1
Yang, Bo, Yao Zhao y Zhenfei Guo. "Research Progress and Prospect of Alfalfa Resistance to Pathogens and Pests". Plants 11, n.º 15 (1 de agosto de 2022): 2008. http://dx.doi.org/10.3390/plants11152008.
Texto completoResumen
Alfalfa is one of the most important legume forages in the world and contributes greatly to the improvement of ecosystems, nutrition, and food security. Diseases caused by pathogens and pests severely restrict the production of alfalfa. Breeding resistant varieties is the most economical and effective strategy for the control of alfalfa diseases and pests, and the key to breeding resistant varieties is to identify important resistance genes. Plant innate immunity is the theoretical basis for identifying resistant genes and breeding resistant varieties. In recent years, the framework of plant immunity theory has been gradually formed and improved, and considerable progress has been made in the identification of alfalfa resistance genes and the revelation of the related mechanisms. In this review, we summarize the basic theory of plant immunity and identify alfalfa resistance genes to different pathogens and insects and resistance mechanisms. The current situation, problems, and future prospects of alfalfa resistance research are also discussed. Breeding resistant cultivars with effective resistance genes, together with other novel plant protection technologies, will greatly improve alfalfa production.
2
Li, Jin, Qiaoxia Shang, Yanqi Liu, Wenting Dai, Xin Li, Shuhua Wei, Guixin Hu, Mark Richard McNeill y Liping Ban. "Occurrence, Distribution, and Transmission of Alfalfa Viruses in China". Viruses 14, n.º 7 (12 de julio de 2022): 1519. http://dx.doi.org/10.3390/v14071519.
Texto completoResumen
Alfalfa (Medicago sativa L.) is one of the most important quality forages worldwide and is cultivated throughout China. Alfalfa is susceptible to a variety of viral diseases during its growth, which has caused huge amounts of commercial losses. However, the profile of the alfalfa virus in China remains ambiguous and the viruses transmitted by Odontothrips loti (Haliday), dominant insect pests in alfalfa, are also poorly understood. In the present study, virus diversity was investigated in the primary alfalfa-growing areas in China. A total of 18 alfalfa viruses were identified through RNA-sequencing (RNA-seq) and reverse transcription-polymerase chain reaction (RT-PCR). Two new plant viruses, Medicago sativa virus 1 (MsV1) and Medicago sativa luteovirus 1 (MsLV1), were detected for the first time. Another four viruses, including the Alfalfa ringspot-associated virus (ARaV), Alfalfa virus F (AVF), Alfalfa enamovirus 1 (AEV1), and Alfalfa deltaparitivirus (ADPV), were reported in China for the first time as well. Both Alfalfa mosaic virus (AMV) and Medicago sativa alphapartitivirus 2 (MsAPV2) are the dominant pathogens, with an infection incidence of 91.7–100%, and 74.4–97.2%, respectively. Additionally, O. loti with first- and second-instar nymphs were shown to acquire the AMV within 0.25 h of feeding on a virus-infected alfalfa. Transmission by thrips to healthy alfalfa plants was also demonstrated. Additionally, we clarified the dynamic changes in the AMV in pre-adult stages of O. loti, which indicated that the AMV is propagated in the nymph stage of O. loti. These findings provide valuable information for understanding the alfalfa virome, confirm the role thrips O. loti plays in alfalfa virus transmission, and improve our fundamental knowledge and management of diseases in China.
3
Solozhentseva, Lyudmila. "IDENTIFICATION AND CREATION OF PROMISING ALFALFA MATERIAL RESISTANT TO THE MOST HARMFUL FUNGAL DISEASES". Adaptive Fodder Production 2021, n.º 4 (7 de febrero de 2022): 57–66. http://dx.doi.org/10.33814/afp-2222-5366-2021-4-57-66.
Texto completoResumen
Alfalfa is a valuable high-protein fodder crop suitable for the preparation of various types of feed (green mass, hay, haylage, silage). Due to the increasing aridity of the climate, there is a need to expand its crops in the northern regions of the country. Currently, it is necessary to create alfalfa varieties with a good adaptation to modern environmental conditions, to improve the development of seed production of this crop. Often alfalfa plants are highly susceptible to disease damage, damage by pests. Fungal diseases (fusarium, brown spotting) during the epiphytotic period can also reduce the productivity of alfalfa herbage and its quality by 30% or more. Methods of selection, polycross, and hybridization were used to create a fusarium-resistant, brown-spotted alfalfa source material. Long-term work has made it possible to identify and create sources of alfalfa resistance to these diseases. In breeding nurseries, the most promising samples for further breeding were P 67 (2), LG 2, SU 9032, No. 27, No. 28, SU 85. In the competitive test and the control nursery, the best according to the results of the previous years (2014–2020 and earlier), samples of SGP 387, SGP 12, C 63-11 can be considered superior to the standard in productivity by an average of 15%, resistance to fusarium, brown spotting by 15–25%.
4
François, Sarah, Aymeric Antoine-Lorquin, Maximilien Kulikowski, Marie Frayssinet, Denis Filloux, Emmanuel Fernandez, Philippe Roumagnac, Rémy Froissart y Mylène Ogliastro. "Characterisation of the Viral Community Associated with the Alfalfa Weevil (Hypera postica) and Its Host Plant, Alfalfa (Medicago sativa)". Viruses 13, n.º 5 (28 de abril de 2021): 791. http://dx.doi.org/10.3390/v13050791.
Texto completoResumen
Advances in viral metagenomics have paved the way of virus discovery by making the exploration of viruses in any ecosystem possible. Applied to agroecosystems, such an approach opens new possibilities to explore how viruses circulate between insects and plants, which may help to optimise their management. It could also lead to identifying novel entomopathogenic viral resources potentially suitable for biocontrol strategies. We sampled the larvae of a natural population of alfalfa weevils (Hypera postica), a major herbivorous pest feeding on legumes, and its host plant alfalfa (Medicago sativa). Insect and plant samples were collected from a crop field and an adjacent meadow. We characterised the diversity and abundance of viruses associated with weevils and alfalfa, and described nine putative new virus species, including four associated with alfalfa and five with weevils. In addition, we found that trophic accumulation may result in a higher diversity of plant viruses in phytophagous pests compared to host plants.
5
LENSSEN, A. W., E. L. SORENSEN, G. L. POSLER y L. H. HARBERS. "TOTAL CELL WALL AND FIBER CONCENTRATIONS OF PERENNIAL GLANDULAR-HAIRED AND EGLANDULAR Medicago POPULATIONS". Canadian Journal of Plant Science 68, n.º 2 (1 de abril de 1988): 439–47. http://dx.doi.org/10.4141/cjps88-055.
Texto completoResumen
Host-plant resistance in alfalfa (Medicago sativa L.) is insufficient for control of the alfalfa weevil (Hypera postica) or the potato leafhopper (Empoasca fabae), two of the most important insect pests of alfalfa. Some wild Medicago species, which have erect glandular hairs, possess adequate host-plant resistance for control of both pests. We established a field trial (Wymore silty clay loam) in 1985 to determine the effects of erect glandular hairs on forage quality of several perennial Medicago species. Glandular and eglandular (without erect glandular hairs) plant populations were selected from the diploids, M. prostrata Jacq. and M. glandulosa David, and the tetraploids, M. glutinosa Bieb., M. sativa × M. glutinosa, and M. sativa × M. prostrata. Eglandular M. sativa ’Riley’ and M. sativa subsp. caerulea (Less, ex Ledeb.) Schmalh. were included as controls. Foliar diseases and insects were controlled. Leaves and stems were separated for three harvests in 1985 and one in 1986. The presence of erect glandular hairs did not significantly affect concentrations of neutral or acid detergent fibers, hemicellulose, lignin, or cellulose of leaves or stems within the species or hybrids tested. Neutral and acid detergent fibers and cellulose concentrations were generally lower in stems and higher in leaves of diploids than in corresponding parts of the tetraploid alfalfa cultivar Riley.Key words: Alfalfa, Medicago sp., glandular hairs, forage quality
6
Каримов, Ханиф, Khanif Karimov, Марат Валиуллин, Marat Valiullin, Рагат Миникаев y Ragat Minikaev. "TECHNOLOGICAL RECEIPTS FOR PRODUCING SUSTAINABLE YIELDS OF ALFALFA OF SARGA VARIETY". Vestnik of Kazan State Agrarian University 12, n.º 4 (15 de marzo de 2018): 13–14. http://dx.doi.org/10.12737/article_5a82a3b81c0f88.04670041.
Texto completoResumen
The introduction of advanced technologies for alfalfa seeds cultivation of Sarga variety ensures a stable yield of seeds within 360-380 kilogramm per hectare. The main elements of this technology are the use of grass for seeds for only one year, careful preparation of the soil before sowing, respect for the depth of seeding, proper organization of bee pollination, protection of crops from diseases and pests, and the organization of seed processing.
7
Živić, Jelica, Milić Vojinović, Ivica Stančić y Desimir Knežević. "WEED FLORA IN ALFAFLA CROPS". International Conference on Technics, Technologies and Education, ICTTE 2019 (2019): 452–56. http://dx.doi.org/10.15547/ictte.2019.07.014.
Texto completoResumen
Alfalfa is a perennial crop that is grown several years on the same surface and because of this there are specificities in the composition and structure of the weed community. This leads to difficulties in suppresses and reduction of pests, diseases and weeds at the yield of alfalfa. The basic harmful effect of weeds is reflected through the competitiveness of water, nutrients and light. Weeds generally have low nutritional value, unpleasant smell and taste, and also affect the quality of alfalfa seeds. The most common types of economy effective perennial weed are Cirsium arvense (L), Sorghum halapense (L.), Convolvulus arvensis (L.) and Cuscuta genus. All agro-technical measures, which enable good soil, quality sowing, as well as plant protection later, are the basic measures for the protection of alfalfa from long-lasting weed species. This paper is based on analysis of weeds flora in alfalfa crops in the Nis district. The presence of the fifteen most important types of weed plants was found in all nine analyzed areas of alfalfa crops. Among the weeds, most common are Agropyrum repens(L.), Amaranthus retroflexus(L.), Chenopodium hybridum(L.), Cuscuta sp.(L.), Sorghum halapense(L.).
8
Boltayev, Botir y Sanjar Boltayev. "Management methods of harmful pests in the cotton-wheat crop rotation system". E3S Web of Conferences 244 (2021): 02049. http://dx.doi.org/10.1051/e3sconf/202124402049.
Texto completoResumen
This article analyzed the ecological succession between pests of crops as a result of the transition from the traditional cotton-alfalfa crop rotation system to the cotton-grain crop rotation system. It was found that the species composition, development and propagation characteristics of harmful organisms in the weeds around the field, as well as in the intermediate crops, can be reduced by up to 60-70%, and protected entomophagous organisms from the destructive effects of pesticides through lateral tillage of the 30-meter edge of the cotton crop. Furthermore, it was possible to apply biological methods to the remaining 70-80% of the field. It was necessary to properly organize the system of crop rotation “Cotton-grain” towards naturally controlling (reduce or eliminate) the number of harmful organisms (pests, diseases and weeds) in the agrophytocenosis. It was observed that diseases (especially rust), weeds (especially wild oats, raygras), pests (weeds, wheat thrips, slime,) were 2-3 times less in the grain planted after cotton, the number of spiders in the cotton field planted after grain were 3-4 times less, and diseases were decreased by 25-30%.
9
McNeill, Mark R., Xiongbing Tu, Colin M. Ferguson, Liping Ban, Scott Hardwick, Zhang Rong, Barbara I. P. Barratt y Zhang Zehua. "Diversity and impacts of key grassland and forage arthropod pests in China and New Zealand: An overview of IPM and biosecurity opportunities". NeoBiota 65 (1 de junio de 2021): 137–68. http://dx.doi.org/10.3897/neobiota.65.61991.
Texto completoResumen
For both New Zealand and China, agriculture is integral to the economy, supporting primary production in both intensive and extensive farming systems. Grasslands have important ecosystem and biodiversity functions, as well providing valuable grazing for livestock. However, production and persistence of grassland and forage species (e.g. alfalfa) is not only compromised by overgrazing, climate change and habitat fragmentation, but from a range of pests and diseases, which impose considerable costs on growers in lost production and income. Some of these pest species are native, but increasingly, international trade is seeing the rapid spread of exotic and invasive species. New Zealand and China are major trading partners with significant tourist flow between the two countries. This overview examines the importance of grasslands and alfalfa in both countries, the current knowledge on the associated insect pest complex and biocontrol options. Identifying similarities and contrasts in biology and impacts along with some prediction on the impact of invasive insect species, especially under climate change, are possible. However, it is suggested that coordinated longitudinal ecological research, carried out in both countries using sentinel grass and forage species, is critical to addressing gaps in our knowledge of biology and impact of potential pests, along with identifying opportunities for control, particularly using plant resistance or biological control.
10
Truzina, Lyudmila y Larissa Korovina. "TO THE ANNIVERSARY OF THE FEDERAL WILLIAMS RESEARCH CENTER OF FORAGE PRODUCTION AND AGROECOLOGY: ABOUT THE PLANT PROTECTION DEPARTMENT". Adaptive Fodder Production 2022, n.º 1 (5 de mayo de 2022): 59–70. http://dx.doi.org/10.33814/afp-2222-5366-2022-1-59-70.
Texto completoResumen
The main directions of research on chemical means of protecting fodder crops from diseases, pests and weeds in the field fodder production of the All-Russian Fodder Research Institute are given. Studies on toxicological assessment of feed and soil are given. Plant Protection Department included three laboratories: the Herbicide Laboratory, the Plant Protection Laboratory and the Feed Toxicological Evaluation Laboratory. The Laboratory of Herbicides was established in 1967 to conduct research on the chemical method of controlling weeds on fodder crops, hayfields and pastures. Research on the study of pests of fodder crops was started in 1939 in the newly created laboratory for the protection of fodder crops from pests and diseases. The Feed Toxicology Assessment Laboratory was established in 1980 to assess pesticide residues in crop and soil. As a result of the studies, a system of measures for clover from pests has been developed; alfalfa diseases and pests and measures to combat them in the Non-Chernozem zone were studied. Pests and pathogens of corn, root crops, peas, lupine and other fodder crops were identified; their biology, ecology and harmfulness have been studied. A set of protective measures has been developed to combat the main pests and diseases of fodder crops, including soil cultivation techniques, early sowing dates, the use of resistant varieties, micro- and macrofertilizers, pre-sowing treatment of seeds with combined preparations, etc. Plant Protection Department carried out work with herbicides. As a result of research begun in 1950, a method was developed to clean the meadows from weedy herbaceous vegetation with the help of preparations 2,4-D and 2M-4X. A chemical method for the destruction of woody and shrubby vegetation with the help of the same preparations in the Non-Chernozem zone of the European part of the USSR has been developed. Methods of using herbicides on crops of almost all fodder crops have been developed: perennial and annual legumes and cereal grasses for green mass and seeds, corn, fodder beets, rapeseed, etc. The theoretical issues of the mutual influence of fodder crops and weeds are studied, the substantiation of the effectiveness of the use of herbicides on different types of soils is given.
11
Godfrey, L. D., K. V. Yeargan y R. B. Muntifering. "Digestibility, Protein Content, and Nutrient Yields of Alfalfa Stressed by Selected Early Season Insect Pests and Diseases". Journal of Economic Entomology 80, n.º 1 (1 de febrero de 1987): 257–62. http://dx.doi.org/10.1093/jee/80.1.257.
Texto completo
12
Bhattarai, S., B. Coulman y B. Biligetu. "Sainfoin (Onobrychis viciifolia Scop.): renewed interest as a forage legume for western Canada". Canadian Journal of Plant Science 96, n.º 5 (1 de octubre de 2016): 748–56. http://dx.doi.org/10.1139/cjps-2015-0378.
Texto completoResumen
Sainfoin (Onobrychis viciifolia Scop.) is a perennial forage legume that has received renewed interest in western Canada because of its desirable forage characteristics. The objective of this review is to summarize previous studies on the agronomy, forage yield, nutritive value, seed characteristics, and diseases and pests of sainfoin. In addition, the review also focuses on the genetic diversity and registered cultivars of sainfoin and their potential use in temperate grasslands. Past studies have reported that sainfoin has a high nutritive value, and high voluntary intake and palatability to grazing animals. In western Canada, dry matter (DM) yield of sainfoin is 80%–95% that of alfalfa (Medicago sativa L.). Unlike other legumes such as alfalfa, sainfoin does not cause bloat in grazing animals due to the presence of condensed tannins. Sainfoin is suitable for monoculture or binary mixtures with either grasses or alfalfa. Genetic diversity studies revealed that sainfoin germplasm generally has high variation within populations. Genetic variation among plants provides an opportunity to develop improved cultivars with desirable characteristics. However, compared with the other forage legumes, sainfoin is still an underdeveloped forage crop with few cultivars being available in western Canada. New sainfoin cultivars with high DM yield and persistence under regional growing conditions are required.
13
Krut’, M. V. "An overview of innovative developments from the scientific provision of plant selection to resistance to diseases and pests". Scientific Journal Grain Crops 5, n.º 1 (2021): 23–29. http://dx.doi.org/10.31867/2523-4544/0154.
Texto completoResumen
The Institute of Plant Protection of NAAS developed methods of plant selection for resistance to major pathogens and assessment methodology the resistance of winter wheat, potatoes, clover and alfalfa to pests to create complex resistant varieties. Donors of potato resistance to cancer, Alternaria, Phomosis and cyst-forming nematodes were identified. Methods for determining the resistance of cereals to high and low temperatures were developed. A collection of the Aegilops biuncialis L. wild wheat samples as sources of new resistance genes to plant diseases and pests was compiled. The soft winter wheat resistance genes to diseases by DNA markers were identified at the Institute of Plant Production named after V. Ya. Yuriev. The V. M. Remeslo Myronivka Institute of Wheat formed a set of winter wheat cultivars with group and complex resistance to diseases and pests. The Institute of Oilseed Crops of NAAS established physiological and biochemical mechanisms of resistance of sunflower, soybean, crown flax to pathogens. Collections of sunflower lines based on complex resistance to sunflower broomrape, dry rot, downy mildew and soybean lines based on complex resistance to white rot and Anthracnose were also created. In the National Scientific Center "Institute of Agriculture of NAAS", the fodder lupine resistance to the most important pathogens was investi-gated. The Institute of Agriculture in the Carpathian Region of NAAS revealed the spring barley, oat, rape, fiber flax varieties and selection numbers resistant to basic diseases; and the Institute of Rice of NAAS – rice cultivars resistant to diseases and pest pathogens. The resistance to main phytophagous insects of the modern genotypes of hemp, fiber flax and crown flax was assessed by the Institute of Agriculture of the North-East of NAAS. The assessment method of breeding value for the initial material of the main vegetables on the basis of disease resistance was developed by the Institute of Vegetables and Melons Growing of NAAS. Scientists of the Institute of Agroecology and Environmental Management of NAAS and V. M. RemesloMyronivka Institute of Wheat of NAAS revealed the cucumber and barley resistance to viral diseases. Key words: crops, pests, pathogens, resistance, resistance gene, resistance source.
14
Nichols, P. G. H., R. A. C. Jones, T. J. Ridsdill-Smith y M. J. Barbetti. "Genetic improvement of subterranean clover (Trifolium subterraneum L.). 2. Breeding for disease and pest resistance". Crop and Pasture Science 65, n.º 11 (2014): 1207. http://dx.doi.org/10.1071/cp14031.
Texto completoResumen
Subterranean clover (Trifolium subterraneum L.) is the most widely sown pasture legume in southern Australia and resistance to important diseases and pests has been a major plant-breeding objective. Kabatiella caulivora, the cause of clover scorch, is the most important foliar fungal pathogen, and several cultivars have been developed with resistance to both known races. Screening of advanced breeding lines has been conducted to prevent release of cultivars with high susceptibility to other important fungal foliar disease pathogens, including rust (Uromyces trifolii-repentis), powdery mildew (Oidium sp.), cercospora (Cercospora zebrina) and common leaf spot (Pseudopeziza trifolii). Several oomycete and fungal species cause root rots of subterranean clover, including Phytophthora clandestina, Pythium irregulare, Aphanomyces trifolii, Fusarium avenaceum and Rhizoctonia solani. Most breeding efforts have been devoted to resistance to P. clandestina, but the existence of different races has confounded selection. The most economically important virus diseases in subterranean clover pastures are Subterranean clover mottle virus and Bean yellow mosaic virus, while Subterranean clover stunt virus, Subterranean clover red leaf virus (local synonym for Soybean dwarf virus), Cucumber mosaic virus, Alfalfa mosaic virus, Clover yellow vein virus, Beet western yellows virus and Bean leaf roll virus also cause losses. Genotypic differences for resistance have been found to several of these fungal, oomycete and viral pathogens, highlighting the potential to develop cultivars with improved resistance. The most important pests of subterranean clover are redlegged earth mite (RLEM) (Halotydeus destructor), blue oat mite (Penthaleus major), blue-green aphid (Acyrthosiphon kondoi) and lucerne flea (Sminthurus viridis). New cultivars have been bred with increased RLEM cotyledon resistance, but limited selection has been conducted for resistance to other pests. Screening for disease and pest resistance has largely ceased, but recent molecular biology advances in subterranean clover provide a new platform for development of future cultivars with multiple resistances to important diseases and pests. However, this can only be realised if skills in pasture plant pathology, entomology, pre-breeding and plant breeding are maintained and adequately resourced. In particular, supporting phenotypic disease and pest resistance studies and understanding their significance is critical to enable molecular technology investments achieve practical outcomes and deliver subterranean clover cultivars with sufficient pathogen and pest resistance to ensure productive pastures across southern Australia.
15
Buhaiov, Vasyl, Vitalii Horenskyi y Ivanna Smulska. "RODENA – NEW ALFALFA SOWN SYNTHETIC (MEDICAGO SATIVA L.) INTENSIVE TYPE". Agriculture and Forestry, n.º 3 (28 de septiembre de 2021): 85–95. http://dx.doi.org/10.37128/2707-5826-2021-3-7.
Texto completoResumen
Further development of the livestock industry in our country depends primarily on the production of feed, their quantity and quality. The most effective way of solving this problem is to create and implement in the production of new varieties and hybrids of forage crops, which have higher yields of green mass, hay and seeds, better foliage and feed quality, intensity of regrowth in spring and after mowing, growing season, durability, stability to diseases and pests, winter hardiness and drought resistance and other features that determine their economic value. Another problem is the elimination of protein deficiency in the diets of farm animals by expanding the sown area under high-protein crops. The synthetic synthetics of alfalfa sowing Rodena was created on the basis of the hybrid population of Vinnichanka (Ukraine) x Vella (Denmark) at the Institute of Feed and Agriculture Podolia during 2003-2016. Posted in the state register of plants suitable for distribution in Ukraine, 09.11.2020 (Certificate of state registration of plant varieties of Rodena No. 200895 dated November 9, 2020, certificate of authorship on the variety of Rodena plants No. 16196001, Patent No. 210082 on January 19, 2021 ). When evaluating the feed and seed productivity of a variety on experienced fields of the Institute of Feeds, the advantage of Rodena varieties over the Syniuha Standard was established. Testing the suitability of a variety to distribute 8 points of research by the Ukrainian Institute of Examination of Plant Varieties confirmed higher rates of feed and seed productivity of the specified grade compared to the conditional standard. Creating a Synthetic Synthetic based on the use of clone genotypes, which, having a complex of economic and valuable signs, is highlighted by a high overall combinational ability, confirms the efficiency of this research direction. Rodena grade is recommended to use in clean and mixed crops with other perennial herbs for the production of high-quality feed in the soil and climatic zone of the Steppe of Ukraine.
16
Russin, J. S., L. D. Newsom, D. J. Boethel y A. N. Sparks. "Multiple pest complexes on soybean: influences of threecornered alfalfa hopper injury on pod and stem blight and stem anthracnose diseases and seed vigour". Crop Protection 6, n.º 5 (octubre de 1987): 320–25. http://dx.doi.org/10.1016/0261-2194(87)90061-5.
Texto completo
17
Chapin, J. W., J. S. Thomas y P. H. Joost. "Tillage and Chlorpyrifos Treatment Effects on Peanut Arthropods—An Incidence of Severe Burrower Bug Injury". Peanut Science 28, n.º 2 (1 de enero de 2001): 64–73. http://dx.doi.org/10.3146/i0095-3679-28-2-5.
Texto completoResumen
Abstract A 2-yr study was conducted on the effects of tillage and soil insecticide (chlorpyrifos) treatment on peanut arthropod pests. A 3 by 2 split-plot experiment with five replications was subjected to factorial ANOVA. Main plot treatments consisted of three tillage systems: conventional moldboard plow, strip tillage into a killed wheat cover crop, and strip tillage into corn stubble residue. Subplot insecticide treatments were granular chlorpyrifos applied at early pegging (growth stage R2) and untreated. Populations of corn earworn, Helicoverpa zea (Boddie), and velevetbean caterpillar, Anticarsia gemmatalis Hübner, were lower in strip tillage systems. Chlorpyrifos applications caused corn earworm outbreaks in all tillage systems, but these applications were more disruptive in strip tillage. Chlorpyrifos treatment also increased populations of fall armyworm, Spodoptera frugiperda (J.E. Smith), but had no measurable effect on velvetbean caterpillar populations. Pod damage from lesser cornstalk borer, Elasmopalpus lignosellus (Zeller), and wire-worms, Conoderus spp., was lower in strip tillage systems, and chlorpyrifos suppressed pod damage in all systems. Threecornered alfalfa hopper, Spissistilus festinus (Say), damage to peanut was greater in the wheat residue strip tillage system. Chlorpyrifos treatment reduced threecornered alfalfa hopper damage in all systems. Spider mite injury was not affected by tillage, but chlorpyrifos treatments resulted in mite outbreaks in all tillage systems. Burrower bug, Pangaeus bilineatus Say, injury to peanut kernels was greater in the strip tillage systems in 1999; and burrower bug injury was suppressed in the strip tillage systems by chlorpyrifos treatment. There was a significant interaction effect for burrower bug injury between tillage and insecticide treatment. Incidence of tomato spotted wilt virus also was reduced by strip tillage. Use of an effective fungicide program and a 3-yr crop rotation out of peanut production probably obscured any potential tillage effects on fungal diseases (southern stem rot, Rhizoctonia limb rot, and leaf spot). However, chlorpyrifos treatment increased Rhizoctonia limb rot incidence. Weed populations were generally greater in strip tillage systems, but postemergence herbicides effectively eliminated any potential confounding effect on yield and grade. Yield was not affected by tillage in either year, and chlorpyrifos had no effect on yield in 1998. In 1999, however, chlorpyrifos increased yield in both strip tillage systems. Neither tillage nor insecticide treatment affected grade (percentage total mature kernels) in 1998, but in 1999 grade was highest in conventional tillage and grade was improved by chlorpyrifos treatment in strip tillage systems. Crop value losses of $249 and $388/ha were attributed to burrower bug injury in untreated corn and wheat residue strip tillage systems, respectively. This injury may have been an anomaly of drought conditions but, given the potential economic impact, burrower bug merits further study in conservation tillage peanut production.
18
Перцева y Elena Pertseva. "ALFALFA PESTS IN SAMARA REGION FOREST-STEPPE". Bulletin Samara State Agricultural Academy 1, n.º 4 (27 de octubre de 2016): 28–32. http://dx.doi.org/10.12737/21800.
Texto completoResumen
The purpose of research is alfalfa yields increasing by crops of different ages in the conditions of forest-steppe of the Samara region. Field studies were carried out in breeding crop rotation of department introduction, selection of feed and oilseeds Volga research station named after P.N. Konstantinov in 2014. Entomofauna alfalfa crops of different varieties and ages were studied mowing butterfly net. More numerous entomofauna was recorded in crops of alfalfa 2011 compared with age-related crops in 2008. Specialized herbivores studied culture were found in the growing season 2014 agrocenoses alfalfa crops – alfalfa tolstonozhka (Bruchophagus roddi Guss), alfalfa semyaed (Tychius flavus), alfalfa weevils (Sitona humeralis Steph.), Alfalfa bug (Adelphocoris lineolatus Goeze), leaf alfalfa weevil larvae (Phytonomus variabilis Hbst.) and larvae of alfalfa bollworm (Heliothis viriplaca Hfn.). Forms relating to herbivores Polyphagous and Oligophagous cereals were also recorded. In addition agrocenoses met: Entomophages predator’s cocktsinellidy (Coccinellidae), different types of spiders (Arachnida) and representatives of the family of grasshoppers (Tettigonioidea). Large foliage of alfalfa plants was recorded under option Population 4. Several smaller foliage of plants observed in crops of alfalfa 2011 compared with planting in 2008. On the 3-year agrocenoses best foliage appeared on variety Guzel which had the lowest figures in the age crops. Alfalfa seed yields mainly depend on the age of the studied agrocenosis culture. Alfalfa crop given harvest seeds in 3.6-4.7 times more than the age-crops in 2008. The highest seed yield was obtained from the varieties of Emerald in 2008 and in 2011.
19
Chen, W., F. M. Dugan y R. McGee. "First Report of Dodder (Cuscuta pentagona) on Chickpea (Cicer arietinum) in the United States". Plant Disease 98, n.º 1 (enero de 2014): 165. http://dx.doi.org/10.1094/pdis-03-13-0334-pdn.
Texto completoResumen
Chickpea (Cicer arietinum L.) is an important rotational and an emerging specialty crop in the Pacific Northwest of the United States, in California, and in the Northern Great Plains of the United States and Canada. Dodders (Cuscuta spp.) are widespread parasitic weeds on many crops worldwide. Several Cuscuta species (primarily C. campestris Yuncker) have been reported to parasitize chickpea, and dodder is important on chickpea in the Indian subcontinent, the Middle East, and recently in Australia (4), but has previously not been reported from North America. On 28 July 2012, a chickpea field near Walla Walla, WA, was found parasitized by dodder. The chickpea was at late flowering and early pod filling stages and there were no other visible green weedy plants as observed from the canopy. There were about 15 dodder colonies varying in size from 2 to 15 meters in diameter in the field of about 500 acres. Chickpea plants in the center of the dodder colonies were wilting or dead. The colonies consisted of orange leafless twining stems wrapped around chickpea stems and spreading between chickpea plants. Haustoria of the dodder penetrating chickpea stems were clearly visible to the naked eye. Flowers, formed abundantly in dense clusters, were white and five-angled, with capitate stigmas, and lobes on developing calyxes were clearly overlapping. The dodder keyed to C. pentagona Engelm. in Hitchcock and Cronquest (3) and in Costea (1; and www.wlu.ca/page.php?grp_id=2147&p=8968 ). Specimens of dodder plants wrapping around chickpea stems with visible penetrating haustoria were collected on 28 July 2013 and vouchers (WS386115, WS386116, and WS386117) were deposited at the Washington State University Ownbey Herbarium. All dodder colonies in the field were eradicated before seed formation to prevent establishment of dodder. Total genomic DNA was isolated from dodder stems, and PCR primers ITS1 (5′TCCGTAGGTGAACCTGCGG) and ITS4 (5′TCCTCCGCTTATTGATATGC) were used to amplify the internal transcribed spacer (ITS) region of the nuclear rDNA. The ITS region was sequenced. BLAST search of the NCBI nucleotide database using the ITS sequence as query found that the most similar sequence was from C. pentagona (GenBank Accession No. DQ211589.1), and our ITS sequence was deposited in GenBank (KC832885). Dodder (C. approximata Bab.) has been historically a regional problem on alfalfa (Washington State Noxious Weed Control Board 2011). Another species stated to be “mainly” associated with legumes is C. epithymum Murr., and C. pentagona is “especially” associated with legumes (3). The latter species has sometimes been considered a variety (var. calycina) of C. campestris Yuncker (1,3). Although chickpea has been cultivated in the Walla Walla region for over 20 years, to our knowledge, this is the first time dodder has been observed on chickpea in North America. The likely source is from nearby alfalfa or other crop fields, with transmission by farm machinery or wild animals. Some chickpea germplasm exhibits partial resistance to C. campestris (2). References: (1) M. Costea et al. SIDA 22:151, 2006. (2) Y. Goldwasser et al. Weed Res. 52:122, 2012. (3) C. L. Hitchcock and A. Cronquist. Flora of the Pacific Northwest: An Illustrated Manual. University of Washington Press, Seattle, 1973. (4) D. Rubiales et al. Dodder. Page 98 in: Compendium of Chickpea and Lentil Diseases and Pests. W. Chen et al., eds. APS Press, St. Paul, Minnesota, 2011.
20
Zakarya, Yasser M., Mohamed M. Metwaly, Mohamed A. E. AbdelRahman, Mohamed R. Metwalli y Georgios Koubouris. "Optimized Land Use through Integrated Land Suitability and GIS Approach in West El-Minia Governorate, Upper Egypt". Sustainability 13, n.º 21 (5 de noviembre de 2021): 12236. http://dx.doi.org/10.3390/su132112236.
Texto completoResumen
Land evaluation is imperative for its efficient use in agriculture. Therefore, this study aimed at assessing the suitability of a region in West El-Minia for cultivating some of the major crops using the geographical information system (GIS). The results focus on allocating space for cultivating sugar beet and utilizing the free period of sugar beet in other crops. This exploitation helps to maintain the quality of the land and increase its fertility by using crop rotation with integrated agricultural management. A machine learning technique was implemented using the random forest algorithm (RF) to predict soil suitability classes for sugar beet using geomorphology, terrain attribute and remote sensing data. Fifteen major crops were evaluated using a suitability multicriteria approach in GIS environment for crop rotation decisions. Soil parameters were determined (soil depth, pH, texture, CaCO3, drainage, ECe, and slope) to characterize the land units for soil suitability. Soils of the area were found to be Entisols; Typic Torrifluvents, Typic Torripsamments and Typic Torriorthents and Aridsols; Typic Haplocacids, Calcic Haplosalids and Sodic Haplocalcids. Overall, the studied area was classified into four suitability classes: high “S1”, moderate “S2”, marginal “S3”, and not suitable “N”. The area of each suitability class changed depending on the crop tested. The highest two crops that occupied S1 class were barley with 471.5 ha (representing 6.8% of the total study area) and alfalfa with 157.4 ha (2.3%). In addition, barley, sugar beet, and sorghum occupied the highest areas in S2 class with 6415.3 ha (92.5%), 6111.3 ha (88.11%) and 6111.3 ha (88.1%), respectively. Regarding the S3 class, three different crops (sesame, green pepper, and maize) were the most highly represented by 6151.8 ha (88.7%), 6126.3 ha (88.3%), and 6116.7 ha (88.2%), respectively. In the end, potato and beans occupied the highest areas in N class with 6916.9 ha (99.7%) and 6853.5 ha (98.8%), respectively. The results revealed that the integration of GIS and soil suitability system consists of an appropriate approach for the evaluation of suitable crop rotations for optimized land use planning and to prevent soil degradation. The study recommends using crop rotation, as it contributes to soil sustainability and the control of plant pests and diseases, where the succession of agricultural crops on a scientific basis aims at maintaining the balance of nutrients and fertilizers in the soil.
21
Jovicic, Ivana, Andja Radonjic y Olivera Petrovic-Obradovic. "Aphids (Hemiptera: Aphididae) on alfalfa in Serbia: Seasonal dynamics and pest status". Pesticidi i fitomedicina 37, n.º 3 (2022): 77–83. http://dx.doi.org/10.2298/pif2203077j.
Texto completoResumen
Alfalfa (Medicago sativa) is the most important forage legume and one of the most widely grown crops in Serbia. Aphids (Hemiptera: Aphididae) are one of the most significant groups of pests of that crop. Three aphid species, Acyrthosiphon pisum, Aphis craccivora and Therioaphis trifolii, are considered as important pests of alfalfa in Serbia. The most abundant of them, T. trifolii, is more adapted to warmer temperatures and it is the predominant aphid species during summer months, while A. pisum is prevalent during the spring period. In warmer climates, an increasing abundance of T. trifolii and decreasing populations of A. pisum have been observed in alfalfa in Serbia. On the other hand, A. craccivora is a minor pest of alfalfa, which rarely occurs in high numbers. The present paper synthesizes the existing knowledge about these three aphid pests of alfalfa, including their morphology, biology, seasonal dynamics, pest status and effects of temperature on their development.
22
Arnett, W. Harold. "Control of Insect Pests of Forage Alfalfa, 1985." Insecticide and Acaricide Tests 11, n.º 1 (1 de enero de 1986): 203. http://dx.doi.org/10.1093/iat/11.1.203.
Texto completoResumen
Abstract A 10-yr-old stand of alfalfa located at the Main Station Field Laboratory, Reno, NV was used for this study. Treatments were applied when alfalfa was 14-16 inches tall with 30-40% of terminals showing alfalfa weevil damage. Plots were 25 × 50 ft with treatments replicated 4 times in a randomized complete block design. Sprays were applied with a CO2 activated bicycle plot sprayer calibrated to deliver 18.5 gpa at 35 psi. Treatments were on May 24 and posttreatment samples were taken on May 27, 31 and jun 7, 14 and consisted of 10 sweeps of a standard net taken at random from each replicate. Conditions at treatment were calm, sunny and 78°F. No measurable precipitation occurred during study period.
23
Tanigoshi, Lynell K. y Jon Babcock. "Prebloom Control of Insect Pests of Alfalfa, 1987". Insecticide and Acaricide Tests 13, n.º 1 (1 de enero de 1988): 187. http://dx.doi.org/10.1093/iat/13.1.187.
Texto completoResumen
Abstract This test was undertaken in a commercial stand of ‘Vernima’ seed alfalfa that has been in production for 3 yr near Gardena, Walla Walla County, Wash. Spray treatments were applied with a C02-powered backpack sprayer calibrated to deliver 27 gal/acre at 30 psi from a 4-ft boom with 4 8003 flat-fan nozzles on 19-inch spacings. Treatment date was 16 Apr and subsequent samples were collected on 23 Apr and 6 May. Each sample was made up of 5 180-degree sweeps from a 15-inch-diam sweep net.
24
Johnson, Gregory, Kurt Kammerzell y Susan Hudson. "Control of Sugarbeet Insect Pests, 1988". Insecticide and Acaricide Tests 14, n.º 1 (1 de enero de 1989): 282–83. http://dx.doi.org/10.1093/iat/14.1.282a.
Texto completoResumen
Abstract Granular insecticide treatments were applied at planting time to 2 separate flood-irrigated fields located in the Yellowstone Valley of eastern Montana. Field 1, previously in alfalfa, was planted to ‘Beta 3265’ on 24 May using an IH185 8-row planter. Granular insecticides were banded on top of the ridge through a ground-driven Gandy applicator and lightly incorporated with a drag chain. Each treatment and untreated control were replicated 10 times in a randomized complete block design. Individual replicates were 2 rows (22-inch spacing) by 2,500 ft. Field 2 was planted in ‘Beta 6566’ on 1 Apr using an Arts-Way Heath Airseeder. This field was a 3-yr stand of alfalfa. Insecticides were banded on top of the row through an electric-drive Gandy applicator and roto-incorporated 2-3 inches deep.
25
Doss, Michael y Richard Berberet. "Control of Insect Pests of Alfalfa in Oklahoma, 1986". Insecticide and Acaricide Tests 12, n.º 1 (1 de enero de 1987): 164–65. http://dx.doi.org/10.1093/iat/12.1.164a.
Texto completoResumen
Abstract Chemical treatments were applied on 2 Mar in a dryland field of “Arc” alfalfa on the South Central Research Station at Chickasha, OK. Controls for the alfalfa weevil, blue alfalfa aphid and pea aphid were evaluated. Chemicals were applied using a tractor drawn boom sprayer equipped with flooding nozzles and calibrated to deliver 20 gpa at 20 psi. Temperature at the time of application ranged from 60-70°F and winds were less than 5 mph. Plots were 4 x 7 m and arranged in a randomized complete block design with 4 replications. Population densities of weevil larvae were determined from 25 stem samples taken/plot on each posttreatment sampling date. Larvae were extracted from foliage with Berlese funnels and counts were calculated as larvae/stem. Pretreatment counts indicated an infestation level of 3.3 larvae/stem. Aphids were sampled by clipping 10 stems/plot on each date and washing aphids into a container of alcohol for counting. Initial aphid populations were less than i/stem.
26
Kurniati, Ridha, Nurdin Saidi y Rosnani Nasution. "ANTIFEEDANT ACTIVITY FROM NEEM LEAF EXTRACT (Azadirachta indica A Juss)". Jurnal Natural 18, n.º 1 (24 de enero de 2018): 7–10. http://dx.doi.org/10.24815/jn.v18i1.8781.
Texto completoResumen
Antifeedant activity of neem leaf (A. indica A. Juss) has been identified by against Tenebrio molitor bio-indicator. The highest activity was obtained on ethyl acetate extract at 0.5% concentration having Antifeedant Index (AI) of 51.53% and most active at 10% concentration of 82.05%. The method used to test the antifeedant activity is the no choice leaf disk method. Secondary metabolites contained in neem leaf extract (A. indica A. juss) include terpenoids, steroids, flavonoids, saponins and phenolics. Keywords: Neem leaf (Azadirachta Indica A.Juss), No choice leaf disk method, Antifeedant ActivityREFFERENCES Benge, M.D. 1986. Neem the Cornucopia Tree. S and T/FENR Agroforestation Technical Series No. 5. Agency for International Development Washington, D.C.190p.Schumutterer., H. 2002. Properties and Potensial of Natural pPsticides from Neem Tree, Azadirachta indica Ann. Rev. Entomol. 35; 271-291Alzohairy, M.A. 2016. Review Article Therapeutics Role of Azadirachta indica (Neem) and Their Active Constituents in Diseases Prevention and Treatment, Article ID 7382506, 11p.4. Patel, S.M., Venkata., K.C.N., Bhattacharyya, P., Sethi, G., Bishayee, A. 2016. Potential of Neem (Azadirachta indica) For Prevention and treatment of Oncologic Diseases Seminar In Cancer BiologyDiabate, D., Gnago, J.A., Tano, Y., 2014. Toxicity, Antifeedant and Repellent, effect of Azadirachta indica A. Juss and Jatropa carcus L. aqueous extracts agaianst Plutella xylostella (Lepidoptera: Plutellidae) J. Basic. Appl. Sci. Res. 4 (11) : 51 – 60Jeyasankar, A., and Gokilamani, D., 2016. Biology and eco-friendly control of Amaranth pests, Hymenia recurvalis Fabricus and Psara basalis (Lepidoptera : Crambidae) Inter. J. Acad. Stud. 2 (4): 218 – 230.Pavunraj, M., Muthu, C., Ignacimuthu,S., Janarthanan, S., Duraipandiyan, V., Raja, N. and Vimalraj, S. 2011. Antifeedant Activity of a Novel 6-(4,7-hydroxyl-heptyl)Quinone From The Leaves of The Milkweed Pergularia daemia on The Cotton Bollworm Helicoverpa armegera (Hub.) and The Tobacco Armworm Spodoptera litura (Fab.) Phytoparasitica 39 : 145 – 150.Munoz, E., Lamilla, C., Marin, J.C., Alarcon, J., Cespedes, C.L.m 2012. Antifeedant, Insect Growth and Insecticidal Effec of Calceolaria talcana (Calceolariaceae) on Dropsopphila melanogaster and Spodoptera frugiperda Industrial Crops and Product, 42, 137 – 144.Saxena, M., Saxena, J., Nema, R., Singh, D and Gupta, A. 2013. Phytochemistry of Medicinal Plants Journal pharmacognosy and Phytochemistry, 1;6.Liu, L., Zhao, Y.L., Cheng, G.G., Chen, Y.Y., Qin, angX.J., C.C.W., Yang, X.W., Liu, Y.P., Luo, X.D, 2014. Antifeedant activity and effect of fruits and seed extract of Cabralea canjerana canjerana (Vell.) Mart. (Meliaceae) on the immature stages of the fall armworm Spodoptera frugiperda (JE Smith) (Lepidoptera: Noctuidae Crops and Product. 65 ; 156 – 158.Schoonhven, LM. 1982. Biologycal Aspect of Antifeedant . Ent, Exp and Appl .31: 57 - 69Gahukar, R.T. 2014. Factor Affecting Content and Bioefficacy of Neem (Azadirachta indica A. Juss) Phytochemicals used in Agriculture pest control A Review. Crop Protection. 62: 93 – 99.Pattanaik, S.J., Ranghupati, N.D.,Chary, P.2006.Ecomorphometric Marker Reflect Variation in Azadirachtin Contents of Azadirachta indica A. Juss. (Meliaceae) in Select Regions of Andhra Pradesh India. Curr. Sci, 91:628 – 636.Adel, M.M., Sehnal, H., Jurzysta, M. 2000. Effects of Alfalfa safonin on the Moth Spodoptera litura Journal of Chemical Ecology, 26 : 7-14Shuklar, Y.N., Rani, A. Tripathi,A.K., Sharma, S. 1996. Antifeedant, Activity of Ursolic Acid Isolation from Duboisia myoporoides Phytotheraphy, 10 : 359 – 360Walter, J.F. 1999. Commercial With Neem Product, P. 155-170. In Franklin R, Hall and Julius J. Menn. Biopesticides Use and Delivery. Humana Press. Totowo, New Jersey.
27
SMALL, ERNEST. "INSECT PESTS AND THE EVOLUTION OF DEFENSIVE GLANDULAR TRICHOMES IN ALFALFA". Canadian Journal of Plant Science 65, n.º 3 (1 de julio de 1985): 589–96. http://dx.doi.org/10.4141/cjps85-081.
Texto completoResumen
Glandular trichomes can defend (Medicago species from herbivores in a variety of insect orders. Wild alfalfas with high concentrations of glandular trichomes occur in a restricted portion of the geographical range of the species (Medicago saliva L. sensu lato), especially in the Caucasus, Ukraine, and adjacent areas of the USSR. These observations suggest that this adaptation was developed to defend the alfalfa against insect pests with similar geographical distribution. That M. sativa plants with pods covered with glandular hairs tend to have larger, if fewer, seeds than plants with pods lacking the hairs also suggests an adaptation against herbivores. Because the glandular trichomes occur primarily on the ovaries and pods, the pests likely feed on seeds. After considering the biology and geography of the major Soviet insect pests of cultivated alfalfa, it was concluded that the most likely insects responsible for the localized evolution of pod glandularity are species of Tychius (Coleoptera: Curculionidae).Key words: Alfalfa, Medicago sativa L., seed chalcid, Brachophagus, Tychius, glandular trichomes, pest resistance (immunity)
28
Tanigoshi, Lynell K. y Jon Babcock. "Prebloom Control of Insect Pests of Alfalfa Seed, 1987". Insecticide and Acaricide Tests 13, n.º 1 (1 de enero de 1988): 189. http://dx.doi.org/10.1093/iat/13.1.189.
Texto completoResumen
Abstract Experimental trials were conducted in plots measuring 0.01 acre on a 3-yr-old ‘Hiphy’ alfalfa seed stand near Touchet, Walla Walla County, Wash. Plots were arranged in a completely randomized design with 4 replications. Insecticide treatments were applied with a C02-powered backpack sprayer with a 4-ft spray boom calibrated to deliver 27 gal/acre at 30 psi. Four 8003 flatfan nozzles at 19-inch spacings were used on the boom. Treatments were applied on 23 Apr, and population estimates were determined 7 and 14 days posttreatment with a standard 15-inch-diam sweep net.
29
Tanigoshi, Lynell K. y Jon Babcock. "Prebloom Control of Insect Pests of Alfalfa Seed, 1987". Insecticide and Acaricide Tests 13, n.º 1 (1 de enero de 1988): 186. http://dx.doi.org/10.1093/iat/13.1.186.
Texto completoResumen
Abstract Chemical treatments were applied on 14 May on a 3-yr-old stand of ‘Shenandoah’ seed alfalfa in Touchet, Walla Walla County, Wash. Spray treatments were applied using a C02-powered backpack sprayer calibrated to deliver 27 gal/acre at 30 psi. Four 8003 flat-fan nozzles were arranged at 19-inch spacings on a 4-ft boom. A completely randomized design was used with 0.01 acre plots replicated 4 times. Insect populations were sampled at 7, 14, 21, and 28 days posttreatment with 5 180-degree sweeps made with a standard 15-inchdiam sweep net. Adults of the alfalfa weevil were not reported because there were fewer than 1 adult/sweep in the posttreatment counts; populations remained at low densities throughout the sampling period.
30
GOTO, Chie y Hitoshi TSUTSUI. "Epizootic of Entomophaga aulicae in lepidopterous pests of alfalfa." Japanese journal of applied entomology and zoology 33, n.º 1 (1989): 35–38. http://dx.doi.org/10.1303/jjaez.33.35.
Texto completo
31
Skelton, Laura E. y Gary W. Barrett. "A comparison of conventional and alternative agroecosystems using alfalfa (Medicago sativa) and winter wheat (Triticum aestivum)". Renewable Agriculture and Food Systems 20, n.º 1 (marzo de 2005): 38–47. http://dx.doi.org/10.1079/raf200478.
Texto completoResumen
AbstractNatural systems agriculture is based on an understanding that natural systems are self-sustaining due to regulatory mechanisms and processes that help to ensure the long-term maintenance of the ecosystem. An agroecosystem modeled after nature should encompass greater stability and biodiversity at all levels of organization than an agroecosystem based on conventional agricultural practices. The main objective of this study was to determine whether agroecosystems modeled after nature exhibit advantages over conventional agroecosystems. Five treatments were examined: winter wheat (Triticum aestivum L.) monoculture, alfalfa (Medicago sativa L.) monoculture, strip-cropped alfalfa and wheat, and two alfalfa–wheat intercrops (one no-till and one conservation-till). Indicators of ecosystem function studied included primary productivity, soil fertility, plant nitrogen (N) concentration, and abundances of arthropod pests and predators. No fertilizers or pesticides were used prior to or during this investigation. Monoculture, strip-crop and conservation-till treatments produced significantly higher yields than no-till intercropped alfalfa and wheat. Although yields from the no-till intercrop were low, wheat protein values were comparable to other treatments. Soil N concentrations tended to be high in treatments containing alfalfa. Insect pests preferred alfalfa and were, therefore, often more abundant in treatments containing high percentages of alfalfa, as were predators such as spiders. Researching alternatives to monoculture agroecosystems, such as the intercrop systems in this study, may provide us insight into a true natural systems agriculture.
32
Evans, Edward. "Dispersal in Host–Parasitoid Interactions: Crop Colonization by Pests and Specialist Enemies". Insects 9, n.º 4 (5 de octubre de 2018): 134. http://dx.doi.org/10.3390/insects9040134.
Texto completoResumen
Interactions of insect pests and their natural enemies increasingly are being considered from a metapopulation perspective, with focus on movements of individuals among habitat patches (e.g., individual crop fields). Biological control may be undercut in short-lived crops as natural enemies lag behind the pests in colonizing newly created habitat. This hypothesis was tested by assessing parasitism of cereal leaf beetle (Oulema melanopus) and alfalfa weevil (Hypera postica) larvae at varying distances along transects into newly planted fields of small grains and alfalfa in northern Utah. The rate of parasitism of cereal leaf beetles and alfalfa weevils by their host-specific parasitoids (Tetrastichus julis (Eulophidae) and Bathyplectes curculionis (Ichneumonidae), respectively) was determined for earliest maturing first generation host larvae. Rates of parasitism did not vary significantly with increasing distance into a newly planted field (up to 250–700 m in individual experiments) from the nearest source field from which pest and parasitoid adults may have immigrated. These results indicate strong, rapid dispersal of the parasitoids in pursuing their prey into new habitat. Thus, across the fragmented agricultural landscape of northern Utah, neither the cereal leaf beetle nor the alfalfa weevil initially gained substantial spatial refuge from parasitism by more strongly dispersing than their natural enemies into newly created habitat. Additional studies, including those of colonization of newly planted crops by generalist pests and natural enemies, are called for in assessing these results with a broader perspective.
33
Wedberg, John L. "Control of an Alfalfa Insect Complex, 1985". Insecticide and Acaricide Tests 11, n.º 1 (1 de enero de 1986): 220. http://dx.doi.org/10.1093/iat/11.1.220.
Texto completoResumen
Abstract Insecticides were applied May 17 ’85 with a tractor-drawn sprayer equippe. with 8003 Tee Jet nozzles delivering 23 gal/acre at 30 psi of pressure. Plots were 17 ft wide by 50 ft long and replicated 4 times. Plots wert evaluated by taking 10 pendulum-style net sweeps on the dates indicated and counting all economic insect pests found.
34
Flint, Mary Louise y Philip A. Roberts. "Using crop diversity to manage pest problems: Some California examples". American Journal of Alternative Agriculture 3, n.º 4 (1988): 163–67. http://dx.doi.org/10.1017/s0889189300002447.
Texto completoResumen
AbstractModerate to large scale California growers (as well as small scale ones) manipulate cropping patterns in a number of ways to reduce pest problems. Crop rotation, which can be defined as diversifying crops over time, is used to manage selected pests, primarily weeds, pathogens, and nematodes. As a substitute for pesticides, crop rotation has been most rewarding in the control of nematodes; sugarbeet cyst and root knot nematode examples are detailed. Some pests that invade fields from nearby areas can be managed by modifying adjacent cropping patterns or practices; Pierce's disease of grapes, sugarbeet yellows and border harvesting of alfalfa are given as examples. Finally, multiple crops can be grown within a single field or orchard. Although this approach is not widely practiced by many California growers, two examples of systems where intercropping has been shown to limit pest numbers without the use of pesticides are described: intercropping of cotton with alfalfa and companion planting oats when seeding alfalfa. These examples show that using crop diversification to manage pests is feasible, but growers must be strongly motivated to make the necessary changes in cropping patterns. Most of the systems that have been widely adopted are those for which few other economically feasible methods were available.
35
Rethwisch, Michael D. "Control of Early-Season Pests, 1988". Insecticide and Acaricide Tests 14, n.º 1 (1 de enero de 1989): 178–79. http://dx.doi.org/10.1093/iat/14.1.178a.
Texto completoResumen
Abstract Seven treatments were applied 22 Feb to 30-ft plots arranged in a randomized complete block design and replicated 4 times in a 2-yr-old stand of alfalfa southeast of Yuma, Ariz. Spray treatments were applied with a CO2-powered backpack sprayer calibrated to deliver 6.7 gal/acre at 30 psi. Control plots received 6.7 gal water/acre at 30 psi, Plots were sampled at 1, 3, and 8 DAT with a standard 15-inch-diam sweep net. Ten 180° sweeps/plot were taken.
36
Raman, K. V. "SURVEY OF DISEASES AND PESTS IN AFRICA: PESTS". Acta Horticulturae, n.º 213 (septiembre de 1987): 145–50. http://dx.doi.org/10.17660/actahortic.1987.213.15.
Texto completo
37
Ghahramani, Mahsa, Roghaiyeh Karimzadeh, Shahzad Iranipour y Andrea Sciarretta. "Does Harvesting Affect the Spatio-Temporal Signature of Pests and Natural Enemies in Alfalfa Fields?" Agronomy 9, n.º 9 (11 de septiembre de 2019): 532. http://dx.doi.org/10.3390/agronomy9090532.
Texto completoResumen
Determining the spatio-temporal distribution and association of pests and natural enemies would be useful for implementing biological control of pests and could also be used in site-specific pest management. In this study, the spatio-temporal distribution and association of aphids, plant bugs, and natural enemies were assessed in alfalfa fields using geo-statistics and spatial analysis by distance indices (SADIE). Additionally, the effect of alfalfa hay-harvesting on the spatial and temporal distribution of these insects was investigated for the first time. Geostatistical analysis indicated that the degree of dependence (DD) was ≥75% for 11 out of 39, 9 out of 35, 3 out of 12, 10 out of 29, and 2 out of 20 datasets for pea aphid Acyrthosiphon pisum, spotted alfalfa aphid Therioaphis maculata, cowpea aphid Aphis craccivora, alfalfa plant bug Adelphocoris lineolatus, and tarnished plant bug Lygus rugulipennis, respectively. The results also indicated that DD was ≥75% in 7 out of 45, 18 out of 45, and 3 out of 20 datasets for Coccinella septempunctata, Hippodamia variegata, and Pterostichus melanarius, respectively. Harvesting decreased the aggregation of the ladybirds, which resulted in a decrease in the index of aggregation. The geo-statistics results were confirmed by SADIE in 75% of datasets. These results can be used in biological control and site-specific management of aphids and plant bugs in alfalfa fields.
38
Devyatkin, Alexander Mikhailovich, Alexander Ivanovich Belyi y Albina Andreevna Levychenkova. "Entomophages-predators of pests of alfalfa agrocenoses of Kuban Region". Proceedings of the Kuban State Agrarian University, n.º 88 (2021): 67–73. http://dx.doi.org/10.21515/1999-1703-88-67-73.
Texto completo
39
Sisterson, Mark S., Donal P. Dwyer y Sean Y. Uchima. "Alfalfa and Pastures: Sources of Pests or Generalist Natural Enemies?" Environmental Entomology 47, n.º 2 (27 de febrero de 2018): 271–81. http://dx.doi.org/10.1093/ee/nvy011.
Texto completo
40
Sorensen, E. L., D. L. Stuteville, E. K. Horber y D. Z. Skinner. "Registration of KS219 Alfalfa Germplasm with Resistance to Eight Pests". Crop Science 32, n.º 2 (marzo de 1992): 502–3. http://dx.doi.org/10.2135/cropsci1992.0011183x003200020055x.
Texto completo
41
Bisges, A. y R. Berberet. "Control of Insect Pests in the First Alfalfa Crop, 1993". Arthropod Management Tests 19, n.º 1 (1 de enero de 1994): 167. http://dx.doi.org/10.1093/amt/19.1.167.
Texto completo
42
Berberet, R., A. Zarrabi y A. Bisges. "Control of Insect Pests in The First Alfalfa Crop, 1995". Arthropod Management Tests 21, n.º 1 (1 de enero de 1996): 193. http://dx.doi.org/10.1093/amt/21.1.193.
Texto completoResumen
Abstract Seven chemical insecticide treatments were evaluated for control of AW larvae and aphids in the first crop of a second year stand of ‘Cimarron VR’ alfalfa on the Agronomy Experiment Station, Stillwater, OK. Pretreatment samples indicated a population of 3.1 AW larvae and 20.5 aphids per stem. Insecticides were applied on 1 Apr using flooding nozzles (Spraying Systems Co., TK SS-5) calibrated to deliver 20 gpa at 24 psi when traveling 3 mph. A RCB design was used with 5 X 10 m plots replicated 4 times. Sampling was conducted at 3, 6, 13, and 18 DAT by pulling 25 stems per plot and placing them in standard Berlese funnels to extract insects for counting. Subsamples of aphids were identified on each date to determine the proportions of species present. Dry matter yields were estimated from samples of forage taken from a 1 X 5 m area in each plot. Subsamples were dried for determination of moisture content and yields were calculated on a dry weight/acre basis.
43
Heitefuss, Rudolf. "Wheat Diseases and Pests". Journal of Phytopathology 159, n.º 4 (5 de octubre de 2010): 324. http://dx.doi.org/10.1111/j.1439-0434.2010.01750.x.
Texto completo
44
Tyshchenko, A. V., O. D. Tyshchenko, G. M. Kuts, O. O. Piliarska y N. M. Galchenko. "Anti-pest protection of two-year old alfalfa grown for seeds". Plant Breeding and Seed Production, n.º 119 (12 de julio de 2021): 170–80. http://dx.doi.org/10.30835/2413-7510.2021.237163.
Texto completoResumen
Purpose. To evaluate the effectiveness of different insecticides against pests on two-year old alfalfa grown for seeds.
Materials and methods. The study was conducted in the experimental field of the Institute of Irrigated Agriculture of NAAS in 2017–2019. The filed experiments were laid out in split plots. The main plots (factor A) were for water supply conditions (no irrigation vs. irrigation); sub-plots (factors B and C) were for application of insecticides. Seeds were sown in wide rows with interrows of 70 cm.
Results and discussion. When the two-year old alfalfa canopy (budding onset) was inspected before insecticide treatment, the average numbers of pests were as follows: alfalfa plant bug – 3.0 specimens/10 sweeps, alfalfa aphid – 20.0 specimens/10 sweeps, beet webworm – 3.0 specimens/10 sweeps, alfalfa weevil (imagoes/grubs) – 1.0/3.0 specimens/10 sweeps, and alfalfa seed weevil – 1.0 specimens/10 sweeps. Treatment 1 reduced the pest numbers in the canopy: alfalfa plant bug – by 70.0–93.3%, alfalfa aphid – by 93.0–97.5%, beet webworm – by 80.0–96.7, alfalfa weevil (imagoes/grubs) – by 60.0–90.0%/73.3–93.3%, and alfalfa seed weevil – by 76.0–94.0%, depending on the insecticide. Treatment 2 helped to reduce the pest numbers in the canopy. Insecticide containing active substances chlorpyrifos 500 g/L and cypermethrin 50 g/L applied at a dose of 1.00 L/ha was the most effective. The highest seed yield was achieved after treatment 1 with insecticide containing active ingredients chlorpyrifos 500 g/L and cypermethrin 50 g/L applied at a dose of 1.00 L/ha and treatment 2 with insecticide containing active ingredients chlorantraniliprole 200 g/L and lambda-cyhalothrin 50 g/L applied at a dose of 0.17 L/ha and 0.15 L/ha, respectively.
Conclusions. The highest seed yield was achieved after treatment 1 with insecticide containing active ingredients chlorpyrifos 500 g/L and cypermethrin 50 g/L applied at a dose of 1.00 L/ha and treatment 2 with insecticide containing active ingredients chlorantraniliprole 200 g/L and lambda-cyhalothrin 50 g/L applied at a dose of 0.17 L/ha and 0.15 L/ha, respectively
45
Farnsworth, Norman R. "Alfalfa pills and autoimmune diseases". American Journal of Clinical Nutrition 62, n.º 5 (1 de noviembre de 1995): 1026–27. http://dx.doi.org/10.1093/ajcn/62.5.1026a.
Texto completo
46
I., Prihantoro,, Anandia, A., Aryanto, A. T., Setiana, M. A. y Karti, P. D. M. H. "THE ADAPTATION LEVEL OF ALFALFA (MEDICAGO SATIVA L.) THAT IRRADIATED WITH GAMMA RAYS ON A FIELD SCALE". Pastura 9, n.º 1 (24 de septiembre de 2019): 1. http://dx.doi.org/10.24843/pastura.2019.v09.i01.p01.
Texto completoResumen
Alfalfa (Medicago sativa L.) a high nutritious and palatability legume for ruminant. Constrain of alfalfa availability in Indonesia are due to the plant adaptability in tropical environment. Aim of the study was to measure the adaptation level of alfalfa that irradiated with gamma rays on a field scale. The study consisted of four types of plant sources, mutation plants with different gamma ray levels (0Gy, 200Gy, 300Gy and 400Gy). Plant tillers was analyzed with a complete randomized design with 3 replications, 20 plants per replication. Growth capability, leaf color, flowering time and pest attack level were analyzed descriptively. The results showed that alfalfa irradiated with 300 Gy significantly (p<0.05) produced highest tillers. Irradiated 300 Gy plant gave better result on growth capability, flowering capability, and number of not attack plant from pests. The higher level of gamma ray irradiation showed the changed in leaf color levels from dark green to light green.
Keywords: alfalfa (Medicago sativa L.), mutation, gamma ray irradiation, field scale
47
Li, Y. P., M. P. You, T. N. Khan, P. M. Finnegan y M. J. Barbetti. "First Report of Phoma herbarum on Field Pea (Pisum sativum) in Australia". Plant Disease 95, n.º 12 (diciembre de 2011): 1590. http://dx.doi.org/10.1094/pdis-07-11-0594.
Texto completoResumen
Black spot disease on field pea (Pisum sativum) in Australia is generally caused by one or more of the four fungi: Mycosphaerella pinodes (anamorph Ascochyta pinodes), Phoma medicaginis var. pinodella (synonym Phoma pinodella), Ascochyta pisi, and Phoma koolunga (1,2,4). However, in 2010 from a field pea blackspot disease screening nursery at Medina, Western Australia, approximately 25% of isolates were a Phoma sp. that was morphologically different to Phoma spp. previously reported on field pea in Western Australia, while the remaining 75% of isolates were either M. pinodes or P. medicaginis var. pinodella. Single-spore isolations of 23 isolates of this Phoma sp. were made onto potato dextrose agar. A PCR-based assay with the TW81 and AB28 primers was used to amplify from the 3′ end of 16S rDNA, across ITS1, 5.8S rDNA, and ITS2 to the 5′ end of the 28S rDNA. The DNA products were sequenced and BLAST analyses were used to compare sequences with those in GenBank. In each case, the sequence had ≥99% nucleotide identity with the corresponding sequence in GenBank for P. herbarum. Isolates also showed morphological similarities to P. herbarum as described in other reports (e.g., 3). The relevant information for a representative isolate has been lodged in GenBank (Accession No. JN247437). The same primers were used by Davidson et al. (2) to identify P. koolunga, but none of our 23 isolates were P. koolunga. A conidial suspension of 107 conidia ml–1 from a single-spore culture was spray inoculated onto foliage of 10-day-old Pisum sativum cv. Dundale plants maintained under >90% relative humidity conditions for 72 h postinoculation. Symptoms evident by 11 days postinoculation consisted of pale brown lesions that were mostly 1.5 to 2 mm long and 1 to 1.5 mm wide. Approximately 50% of lesions showed a distinct chlorotic halo extending 1 to 2 mm outside the boundary of the lesion. P. herbarum was readily reisolated from infected foliage. A culture of this representative isolate has been lodged in the Western Australian Culture Collection Herbarium maintained at the Department of Agriculture and Food Western Australia (Accession No. WAC13499). Outside of Australia, P. herbarum, while generally considered a soilborne opportunistic pathogen, has been reported on a wide range of species, including field pea (3). Molecular analysis of historical isolates collected from field pea in Western Australia, mostly in the late 1980s, did not show any incidence of P. herbarum, despite this fungus being reported on alfalfa (Medicago sativa) and soybean (Glycine max) in Western Australia in 1985 (Australian Plant Pest Database). In Western Australia, this fungus has also been recorded on a Protea sp. in 1991 and on Arabian pea (Bituminaria bituminosa) in 2010 (Australian Plant Pest Database). To our knowledge, this is the first report of P. herbarum as a pathogen on field pea in Australia. These previous reports of P. herbarum on other hosts in Western Australia and the wide host range of P. herbarum together suggest the potential for this fungus to be a pathogen on a wider range of genera/species than field pea. References: (1) T. W. Bretag and M. Ramsey. Page 24 in: Compendium of Pea Diseases and Pests. 2nd ed. The American Phytopathologic Society, St Paul, MN, 2001. (2) J. A. Davidson et al. Mycologica 101:120, 2009. (3) G. L. Kinsey. Phoma herbarum. No 1501. IMI Descriptions of Fungi and Bacteria, 2002. (4) T. L. Peever et al. Mycologia 99:59, 2007.
48
Mazahery-Laghab, H., B. Yazdi-Samadi, M. Bagheri y A. R. Bagheri. "Alfalfa (Medicago sativaL.) shoot saponins: identification and bio-activity by the assessment of aphid feeding". British Journal of Nutrition 105, n.º 1 (28 de septiembre de 2010): 62–70. http://dx.doi.org/10.1017/s0007114510003120.
Texto completoResumen
Biochemical components in alfalfa (Medicago sativaL.), such as saponins, can act as protecting factors against bio-stresses. Saponins are also antifeedants and show oral toxicity towards higher and lower animals. Changes in saponins, such as variation in the carbon skeleton, or hydrolysis of saponin glycosides and other conjugates, may change their biological effects. The aims of this research were to study saponin variation in different growth stages of alfalfa and to investigate the biological role of saponins in the spotted alfalfa aphid,Therioaphis maculata. Saponins from alfalfa shoots in different growth stages were extracted, chemically purified and analysed by TLC. Specific saponins such as soyasaponin1 from root and shoot and two bisdesmosides of medicagenic acid, one from shoot and another from root tissues, were identified using reference compounds allowing changes in saponin composition during plant development in different shoot tissues of alfalfa to be assessed. The response of the alfalfa aphid to feeding on alfalfa in different growth stages was studied. No significant difference in the survival of aphids, from neonate to adult, was observed, but due to the antibiotic effects of saponins, two differences were found in the onset of nymph production and cumulative nymph production. The results show that the saponin composition in alfalfa changes with plant development and this, in turn, can often negatively affect the development of specific insect pests such as the spotted alfalfa aphid, suggesting a possible biological role of alfalfa saponins.
49
Godfrey, L. D. y K. V. Yeargan. "Effects and Interactions of Early Season Pests on Alfalfa Yield in Kentucky". Journal of Economic Entomology 80, n.º 1 (1 de febrero de 1987): 248–56. http://dx.doi.org/10.1093/jee/80.1.248.
Texto completo
50
Doss, Michael y Richard Berberet. "Control of Early-Season Pests, 1988". Insecticide and Acaricide Tests 14, n.º 1 (1 de enero de 1989): 170. http://dx.doi.org/10.1093/iat/14.1.170.
Texto completoResumen
Abstract This test was conducted on a field of ‘Cimarron’ alfalfa at the Southcentral Research Station in Chickasha, Okla. Efficacy of several foliar insecticides was determined for AW larvae, PA, and BAA. Pretreatment counts made 21 Mar indicated an infestation level for AW in excess of the economic threshold (1.5 larvae/stem). PA numbered less than 1/stem, and there were approximately 20 BAA/stem. Insecticides were applied 21 Mar with a tractor-drawn boom sprayer equipped with flooding nozzles and calibrated to deliver 20 gal/acre at 20 psi. Plots were 4.0 by 7.0 m, arranged in a randomized complete block design with 4 replicates. AW population densities were estimated from 25 stem samples taken from each plot on each posttreatment sampling date. Larvae were extracted from foliage with Berlese funnels prior to counting. Efficacy data for control of each aphid species were determined by clipping 10 stems/plot and washing the aphids into jars of alcohol for counting and identification. Yield was determined by harvesting a 1.0- by 5.0-m area from each plot using a Carter harvester.