Log in

Relevant bibliographies by topics / Yellow alkaline noodle (YAN) / Journal articles

Journal articles on the topic 'Yellow alkaline noodle (YAN)'

To see the other types of publications on this topic, follow the link: Yellow alkaline noodle (YAN).

Author: Grafiati

Published: 4 June 2021

Last updated: 21 February 2023

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles

Select a source type:

Consult the top 20 journal articles for your research on the topic 'Yellow alkaline noodle (YAN).'

Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.

You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.

Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.

1

Z., Nur Azura, Radhiah Shukri, Wan Zunairah Wan Ibadullah, Nurul Shazini R., Nur Hanani Z.A., and Ismail-Fitry M.R. "Physicochemical, cooking quality and sensory characterization of yellow alkaline noodle: impact of mango peel powder level." Food Research 4, no. 1 (June 11, 2019): 70–76. http://dx.doi.org/10.26656/fr.2017.4(1).170.

Full text

Abstract:

Mango peel comprises of 7-25% of mango fruit that contributes to the environmental pollution. Mango peel contains nutraceutical compounds that are useful as a functional ingredient to increase nutritional properties in Asian staple food, which in our case was yellow alkaline noodle. The objective of this research was to study the effect of mango peel powder at different levels (0%, 10%, 20%, and 30%) on the cooking, physicochemical and sensory properties of yellow alkaline noodles (YAN). Substitution of wheat flour with mango peel powder significantly increased 2 to 15 times fibre content in the YAN compared to control. Additionally, fat and carbohydrate were reduced by 8-45% and 6-25%, respectively. The lowest cooking quality was observed in YAN incorporated with 30% mango peel powder, which showed the highest cooking lost (20.45%) and the lowest cooking yield (163.7%). YAN with mango peel powder had decreased lightness (L*) and yellowness (b*). All of the texture profile was negatively affected by an increment of mango peel powder in YAN but showed no significant differences. Sensory attributes of YAN with the incorporation of mango peel powder up to 20% showed similar acceptance with the control. The YAN with 30% mango peel powder had significantly lower sensory acceptance of panelists than other YAN samples. The study suggests that mango peel powder substitution up to 20% is suitable to increase nutritional properties of YAN with minimal adverse effects on the cooking quality, textural properties and sensory attributes.

APA, Harvard, Vancouver, ISO, and other styles

2

Mares, D. J., and A. W. Campbell. "Mapping components of flour and noodle colour in Australian wheat." Australian Journal of Agricultural Research 52, no. 12 (2001): 1297. http://dx.doi.org/10.1071/ar01048.

Full text

Abstract:

Flour and noodle colour influence the value of wheat (Triticum aestivum L.) and are obvious targets for breeders seeking to improve quality, end-product range, and marketability of wheat. The objective of this investigation was to identify quantitative trait loci (QTLs) associated with flour and noodle colour traits and with individual components of colour. One hundred and sixty-three doubled haploid lines derived from Sunco Tasman, white-grained, prime hard, and hard wheats adapted to the north-eastern region of Australia were used for the bulk of this study and were supplemented by doubled haploid populations derived from CD87 Katepwa and Cranbrook Halberd for comparisons of flour colour. Samples of Sunco Tasman, together with parental lines, were grown at Narrabri, NSW, in 1998 and 1999 and at Roma, Qld, in 1998 and used for visible light reflectance measurements of flour brightness (CIE L*) and yellowness (CIE b*), and white salted noodle (WSN) and yellow alkaline noodle (YAN) brightness, yellowness, and colour stability. Xanthophyll content and polyphenol oxidase (PPO) activity were measured spectrophotometrically. No consistent QTLs were identified for flour L* or initial L* of WSN and YAN. Xanthophyll content was very strongly associated with QTLs located on chromosomes 3B and 7A and these QTLs also had a major influence on flour b*, WSN b*, and YAN b*. Noodle brightness at 2, 24, and 48 h and the magnitude of change in noodle L* and b* with time were affected by QTLs on 2D, contributed by Tasman, and, to a lesser degree, 2A. The QTL on 2D was clearly associated with control of grain PPO, an enzyme implicated in darkening of Asian style noodles. QTLs located on 2B, 4B, and 5B and associated with control of grain size or flour protein content also appeared to influence a number of colour traits.

APA, Harvard, Vancouver, ISO, and other styles

3

Asenstorfer, Robert E., Marie J. Appelbee, Christine A. Kusznir, and Daryl J. Mares. "Toward an Understanding of Mechanisms Involved in Non-Polyphenol Oxidase (Non-PPO) Darkening in Yellow Alkaline Noodles (YAN)." Journal of Agricultural and Food Chemistry 62, no. 20 (May 9, 2014): 4725–30. http://dx.doi.org/10.1021/jf500206e.

Full text

APA, Harvard, Vancouver, ISO, and other styles

4

Hung, Pham Van, and David W. Hatcher. "Ultra-performance liquid chromatography (UPLC) quantification of carotenoids in durum wheat: Influence of genotype and environment in relation to the colour of yellow alkaline noodles (YAN)." Food Chemistry 125, no. 4 (April 2011): 1510–16. http://dx.doi.org/10.1016/j.foodchem.2010.10.078.

Full text

APA, Harvard, Vancouver, ISO, and other styles

5

Hatcher, D. W., M. J. Anderson, R. M. Clear, D. G. Gaba, and J. E. Dexter. "Fusarium head blight: Effect on white salted and yellow alkaline noodle properties." Canadian Journal of Plant Science 83, no. 1 (January 1, 2003): 11–21. http://dx.doi.org/10.4141/p01-194.

Full text

Abstract:

Composite samples of Canada Western Red Winter wheat (CWRW) with varying levels of Fusarium head blight damage (0.5–9.6%) were prepared from the 1998 Western Canadian harvest survey and milled to yield both patent (60% extraction) and straight grade (~76%) flours. The mycotoxin deoxynivalenol (DON) levels in the flours ranged from 0.21 to 2.6 ppm with no significant influence due to flour extraction. No differences were attributable to Fusarium damage (FD) in the amount of work required to sheet either yellow alkaline (YA) or white salted (WS) noodles. The color of the raw (YA) noodles was adversely affected by FD as a significant loss in noodle brightness (L*) and an increase in redness (a*) were observed for noodles prepared from both patent and straight grade flour. Straight grade YA noodles, prepared from wheat with FD levels above acceptable limits for milling grades, displayed a significant loss in yellowness (b*) after aging for 24 h. Differences in noodle brightness of raw WS noodles were observed between the control and 9.6% FD samples for both patent and straight grade noodles at 24 h. Analysis of YA and WS noodles indicated a significant linear relationship between the number of specks and the quantity of FD in the wheat. YA and WS noodles displayed significant loss in cooked noodle texture with increasing FD levels. Maximum cutting stress and recovery declined with increasing FD for both noodle types whether made from patent or straight grade flour. Maximum wheat FD tolerances below 2% are required in order to ensure optimum noodle quality. Key words: Fusarium damage, noodles, color, texture and image analysis

APA, Harvard, Vancouver, ISO, and other styles

6

Konik, Christine M., Lene M. Mikkelsen, Ray Moss, and Peter J. Gore. "Relationships between Physical Starch Properties and Yellow Alkaline Noodle Quality." Starch - Stärke 46, no. 8 (1994): 292–99. http://dx.doi.org/10.1002/star.19940460804.

Full text

APA, Harvard, Vancouver, ISO, and other styles

7

Rebellato, Ana Paula, Priscila Ferreira Tavares, Guilherme Neves Trindade, Juliana A. Lima Pallone, Pedro H. Campelo, and Maria Teresa Pedrosa Silva Clerici. "Alkaline instant noodles: use of alkaline salts to reduce sodium and assessment of calcium bioaccessibility." Research, Society and Development 10, no. 2 (February 27, 2021): e51210212778. http://dx.doi.org/10.33448/rsd-v10i2.12778.

Full text

Abstract:

Instant noodles originated in eastern nations and have been accepted due to its practicality and low cost. However, its high sodium content can lead to health problems. The present study aimed to reduce sodium and increase calcium levels in noodles. A control (N1: K2CO3+ Na2CO3) and three treatments with the addition of calcium carbonate in combination with alkaline salts such as potassium and sodium carbonates (N2: K2CO3+ CaCO3; N3: Na2CO3+ CaCO3; and N4: CaCO3) were studied. Two hydration methods were investigated, and the technological characterization and the calcium bioaccessibility of the different noodle formulations were determined. N4 did not fit into the alkaline noodle category due to its neutral pH. N2 and N4 showed a sodium reduction of around 28% and a significant increase in calcium content, with higher bioaccessible calcium. Significant changes were observed for the noodles made with the addition of different alkaline salts, with a light-yellow color and better texture than the control, which can be a positive aspect, once products with reduced nutrients usually present differentiated coloring. Therefore, the use of calcium carbonate may be a promising alternative to increase Ca intake and to reduce the sodium content of instant noodles.

APA, Harvard, Vancouver, ISO, and other styles

8

Hatcher, D. W., N. M. Edwards, and J. E. Dexter. "Effects of Particle Size and Starch Damage of Flour and Alkaline Reagent on Yellow Alkaline Noodle Characteristics." Cereal Chemistry Journal 85, no. 3 (May 2008): 425–32. http://dx.doi.org/10.1094/cchem-85-3-0425.

Full text

APA, Harvard, Vancouver, ISO, and other styles

9

Knox, R. E., R. M. DePauw, J. M. Clarke, F. R. Clarke, T. N. McCaig, and M. R. Fernandez. "Snowhite476 hard white spring wheat." Canadian Journal of Plant Science 87, no. 3 (July 1, 2007): 521–26. http://dx.doi.org/10.4141/cjps06070.

Full text

Abstract:

Snowhite476 hard white spring wheat (Triticum aestivum L.) is the first Canadian wheat cultivar to deploy the gene Bt8, which confers resistance to prevalent races of common bunt [Tilletia laevis Kuhn in Rabenh. and T. caries (DC.) Tul. & C. Tul.]. The productivity traits of Snowhite476 were intermediate to the check cultivars. Snowhite476 had intermediate kernel hardness combined with yellow alkaline and white salted noodle colour and textural attributes comparable to AC Vista. Key words: Triticum aestivum L., cultivar description, grain yield, disease resistance, Bt8

APA, Harvard, Vancouver, ISO, and other styles

10

DePauw, R. M., R. E. Knox, J. M. Clarke, F. R. Clarke, M. R. Fernandez, D. Salmon, and T. N. McCaig. "Snowhite475 hard white spring wheat." Canadian Journal of Plant Science 87, no. 4 (October 1, 2007): 895–900. http://dx.doi.org/10.4141/cjps06066.

Full text

Abstract:

In 2001–2003, cooperative testing Snowhite475 hard white spring wheat (Triticum aestivum L.) yielded grain in the range of the checks and was 3.4 and 3.3 d earlier maturing than AC Vista and AC Crystal, respectively. Snowhite475 had heavier test weight than AC Vista and larger seed size than AC Crystal and AC2000. Snowhite475 had higher protein content than the checks except 5701PR. It yielded more flour and had higher Agtron flour colour values than AC Crystal and AC Vista. Snowhite475 had intermediate kernel hardness, combined with yellow alkaline and white salted noodle colour and textural attributes better than AC Crystal, AC2000 and Snowbird. Key words: Triticum aestivum L., cultivar description, grain yield, maturity, milling properties, noodles

APA, Harvard, Vancouver, ISO, and other styles

11

Diep, Sally, Daiva Daugelaite, Anatoliy Strybulevych, Martin Scanlon, John Page, and Dave Hatcher. "Use of ultrasound to discern differences in Asian noodles prepared across wheat classes and between varieties." Canadian Journal of Plant Science 94, no. 3 (March 2014): 525–34. http://dx.doi.org/10.4141/cjps2013-043.

Full text

Abstract:

Diep, S., Daugelaite, D., Strybulevych, A., Scanlon, M., Page, J. and Hatcher, D. 2014. Use of ultrasound to discern differences in Asian noodles prepared across wheat classes and between varieties. Can. J. Plant Sci. 94: 525–534. Nine wheat varieties, five Canada Western Red Spring (CWRS) and four Canada Prairie Spring Red (CPSR), grown at the same locations and composited by variety, were milled to yield 65% extraction flours, which were used to form yellow alkaline raw and cooked noodles. The CWRS flours were ∼2% higher in protein content than the CPSR varieties, with varieties within each class exhibiting a wide range in dough strength as determined by Farinograph dough development time and stability. The ultrasonic velocity and attenuation of the raw noodles were measured at 40 kHz in disk-shaped samples, enabling the longitudinal storage modulus, loss modulus and tan Δ to be determined. Significant differences (P=0.05) between classes and within a class were found to exist for all ultrasonic parameters. In general, the CPSR varieties generated the highest storage moduli values, the lowest loss moduli, and the lowest tan Δ values, indicating this class/varieties exhibited a more elastic (firmer) raw noodle than the CWRS varieties even at a 2% lower protein content. A significant correlation, r=0.72,0.70, P=0.03, was also found between raw noodle velocity and M”, respectively, with cooked noodle bite as determined by maximum cutting stress.

APA, Harvard, Vancouver, ISO, and other styles

12

Fujita, Masaya, Masako Seki, Hitoshi Matsunaka, Chikako Kiribuchi-Otobe, Ado Hiwatashi, Jun'ichi Kitano, Yukihide Kanda, Keiichi Miyamoto, and Yutaka Okumoto. "Relationship between Yellow Alkaline Noodle Quality and Flour Properties in Hard Wheat Varieties in the Central Region of Japan." Japanese Journal of Crop Science 77, no. 4 (2008): 449–56. http://dx.doi.org/10.1626/jcs.77.449.

Full text

APA, Harvard, Vancouver, ISO, and other styles

13

Taira, Masato, Naoto Nihei, Akari Endo, Yoshinori Taniguchi, Hidekazu Maejima, Kazuhiro Nakamura, and Hiroyuki Ito. "Effect of Nitrogen Topdressing at the Heading Stage on Yellow Alkaline Noodle Quality of a Hard Wheat Cultivar ‘Yukichikara’." Japanese Journal of Crop Science 81, no. 2 (2012): 173–82. http://dx.doi.org/10.1626/jcs.81.173.

Full text

APA, Harvard, Vancouver, ISO, and other styles

14

Soraya, Anissa, Shyan Yea Chay, Radhiah Shukri, Farinazleen Mohamad Ghazali, Kharidah Muhammad, Mohd Adzahan Noranizan, and Roselina Karim. "Reduction of microbial load in yellow alkaline noodle using optimized microwave and pulsed-UV treatment to improve storage stability." Journal of Food Science and Technology 56, no. 4 (February 13, 2019): 1801–10. http://dx.doi.org/10.1007/s13197-019-03624-w.

Full text

APA, Harvard, Vancouver, ISO, and other styles

15

Mojarrad, Lida Shahsavani, and Ali Rafe. "Effect of high-amylose corn starch addition on canning of yellow alkaline noodle composed of wheat flour and microbial transglutaminase: Optimization by RSM." Food Science & Nutrition 6, no. 5 (May 3, 2018): 1204–13. http://dx.doi.org/10.1002/fsn3.667.

Full text

APA, Harvard, Vancouver, ISO, and other styles

16

Ávila, C. M., M. C. Palomino, D. Hornero-Méndez, and S. G. Atienza. "Identification of candidate genes for lutein esterification in common wheat (Triticum aestivum) using physical mapping and genomics tools." Crop and Pasture Science 70, no. 7 (2019): 567. http://dx.doi.org/10.1071/cp18531.

Full text

Abstract:

A high carotenoid content is important for the production of pasta from durum wheat (Triticum durum Desf.) and yellow alkaline noodle from common wheat (T. aestivum L.). Carotenoid esters are more stable than free carotenoid during storage and processing, and thus they allow a higher retention through the food chain. Chromosome 7D carries gene(s) for lutein esterification. The aim of this study was the physical mapping of the gene(s) for lutein esterification on chromosome 7D and the identification of candidate genes for this trait. We developed crosses between a set of deletion lines for chromosome 7D in Chinese Spring (CS) background and the CS–Hordeum chilense substitution line CS(7D)7Hch. The F2 progeny derived from the deletion line 7DS4 produced a lower amount of lutein esters, which indicates that the main gene for lutein esterification is in the region of chromosome 7D lacking in 7DS4. Other gene(s) are contributing to lutein esterification because small amounts of lutein esters are produced in 7DS4. Genotyping by DArTSeq revealed that 7DS4 lacks a 127.7 Mb region of 7DS. A set of 10 candidate genes for lutein esterification was identified by using the wheat reference genome sequence along with the Wheat Expression Browser. This region contains the Lute locus previously identified in a different genetic background. Four genes with acyltransferase or GDSL esterase/lipase activity were identified in the vicinity of Lute. Our results indicate that the gene TraesCS7D01G094000 is a likely candidate for Lute but the gene TraesCS7D01G093200 cannot be ruled out. The candidate genes reported in this work are worthy for further investigation.

APA, Harvard, Vancouver, ISO, and other styles

17

Mondal, K. K., C. Mani, J. Singh, J. G. Kim, and M. B. Mudgett. "A New Leaf Blight of Rice Caused by Pantoea ananatis in India." Plant Disease 95, no. 12 (December 2011): 1582. http://dx.doi.org/10.1094/pdis-06-11-0533.

Full text

Abstract:

In September 2008, a new blight disease appeared on basmati rice (Oryza sativa L.) in fields in the northern states of India, including Uttar Pradesh, Haryana, and Punjab. First symptoms were water-soaked lesions at the tip of rice leaves. Lesions eventually spread down the leaf blades. Infected leaves turned light brown, exhibiting a blighted appearance. The disease was severe during the post-flowering stage. From 2008 to 2011, yellow-pigmented bacteria were consistently recovered on nutrient agar (beef extract 5 g, peptone 10 g, NaCl 5 g, and agar 20 g) from symptomatic rice leaves. The disease was thought to be caused by Xanthomonas oryzae pv. oryzae, the rice bacterial blight pathogen. However, physiological and molecular analysis of two strains (ITCC B0050 and ITCC B0055) isolated in 2008 revealed that the causal agent was the bacterium Pantoea ananatis. Colonies, raised and translucent with smooth margins, grew well within 24 h at 37°C. The bacteria are gram-negative facultative anaerobes with small rods arranged singly or in a chain of two to five cells. The bacteria are positive for catalase and indole production while negative for oxidase and alkaline reaction in malonate broth. Electron microscopy shows that the bacterial cells were 1.1 to 2.3 × 0.4 to 0.7 μm and have three to six peritrichous flagella. 16S rRNA gene sequence (1,535 nt generated by PCR with primers 5′AGAGTTTGATCATGGCTCAG3′ and 5′AAGGAGGTGATCCAACCGCA3′) of ITCC B0050 and ITCC B0055 (GenBank Nos. JF756690 and JF756691, respectively) share 99%-nt identity with P. ananatis (GenBank No. DQ512490.1). Biolog microbial identification analysis (version 4.2) of both strains showed similarity indices of 0.842 with P. ananatis (Biolog Inc., Hayward, CA). Pathogenicity was confirmed by employing the leaf tip clipping method to inoculate susceptible basmati rice (cv. Pusa basmati 1). Leaves were inoculated in triplicate with sterile water or a 1 × 108 CFU ml–1 suspension of each isolate in water. The artificially inoculated rice leaves produced water-soaked lesions similar to that observed during natural rice infection in the field. At 10 to 15 days postinoculation, the lesions on the inoculated leaves dried and turned from straw color to light brown. Yellow-pigmented bacteria were reisolated from the infected rice leaves and their identity was confirmed to be identical to the original strain by 16S rRNA sequence analysis and Biolog analysis. Both pathogen isolates elicited hypersensitive reaction in tobacco (Nicotiana tabacum cv. Xanthi) leaves 24 to 48 h postinoculation (1 × 108 CFU ml–1). These studies indicate that the causal agent of the newly emerged rice leaf blight disease in northern India is P. ananatis. Pantoea spp. are opportunistic pathogens documented to cause different diseases in economically important crop plants including grain discoloration of rice in China (1), leaf blight and bulb decay of onion in the United States (2), and leaf blight of rice in Korea (3). To our knowledge, this is the first report of rice leaf blight caused by P. ananatis in India. The significance of this pathogen to basmati rice production in India was not known until this report. The predominance of the disease in the major basmati-growing belts of northern India would certainly have great impact in reducing the yield potential of basmati rice. References: (1) H. Yan et al. Plant Dis. 94:482, 2010. (2) H. F. Schwartz and K. Otto. Plant Dis. 84:808, 2000. (3) H. B. Lee et al. Plant Dis. 94:1,372, 2010.

APA, Harvard, Vancouver, ISO, and other styles

18

Xu, Min, Gary G. Hou, Junzhou Ding, and Xianfeng Du. "Comparative study on textural and rheological properties between dry white salted noodle and yellow alkaline noodle as influenced by different tea extracts." Journal of Food Processing and Preservation 44, no. 12 (November 10, 2020). http://dx.doi.org/10.1111/jfpp.14981.

Full text

APA, Harvard, Vancouver, ISO, and other styles

19

Xu, Min, Jingjing Du, Gary G. Hou, and Xianfeng Du. "Effect of Tea Extract on Starch Gelatinization, Gluten Aggregation and Quality Characteristics of Dry Yellow Alkaline Noodle." International Journal of Food Science & Technology, December 30, 2022. http://dx.doi.org/10.1111/ijfs.16277.

Full text

APA, Harvard, Vancouver, ISO, and other styles

20

Yu, Lin, Changdeng Yang, Zhijuan Ji, Yuxiang Zeng, Yan Liang, and Yuxuan Hou. "First Report of New Bacterial Leaf Blight of Rice Caused by Pantoea ananatis in Southeast China." Plant Disease, July 28, 2021. http://dx.doi.org/10.1094/pdis-05-21-0988-pdn.

Full text

Abstract:

In autumn 2020, leaf blight was observed on rice (Oryza sativa L., variety Zhongzao39, Yongyou9, Yongyou12, Yongyou15, Yongyou18, Yongyou1540, Zhongzheyou8, Jiafengyou2, Xiangliangyou900 and Jiyou351) in the fields of 17 towns in Zhejiang and Jiangxi Provinces, China. The disease incidence was 45%-60%. Initially, water-soaked, linear, light brown lesions emerged in the upper blades of the leaves, and then spread down to leaf margins, which ultimately caused leaf curling and blight during the booting-harvest stage (Fig. S1). The disease symptoms were assumed to be caused by Xanthomonas oryzae pv. oryzae (Xoo), the pathogen of rice bacterial blight. 63 isolates were obtained from the collected diseased leaves as previously described (Hou et al. 2020). All isolates showed circular, smooth-margined, yellow colonies when cultured on peptone sugar agar (PSA) medium for 24h at 28℃. The cells were all gram-negative and rod-shaped with three to six peritrichous flagella; positive for catalase, indole, glucose fermentation and citrate utilization, while negative for oxidase, alkaline, phenylalanine deaminase, urease, and nitrate reductase reactions. 16S rRNA gene sequence analysis from the 6 isolates (FY43, JH31, JH99, TZ20, TZ39 and TZ68) revealed that the amplified fragments shared 98% similarity with Pantoea ananatis type strain LMG 2665T (GenBank JFZU01) (Table S3). To further verify P. ananatis identity of these isolates, fragments of three housekeeping genes including gyrB, leuS and rpoB from the 6 isolates were amplified and sequenced, which showed highest homology to LMG 2665T with a sequence similarity of 95%-100% (Table S3). Primers (Brady et al. 2008) and GenBank accession numbers of gene sequences from the 6 isolates are listed in Table S1 and Table S2. Phylogenetic analysis of gyrB, leuS and rpoB concatenated sequences indicated that the 6 isolates were clustered in a stable branch with P. ananatis (Fig. S2). Based on the above morphological, physiological, biochemical and molecular data, the isolates are identified as P. ananatis. For pathogenicity tests, bacterial suspension at 108 CFU/mL was inoculated into flag leaves of rice (cv. Zhongzao39) at the late booting stage using clipping method. Water was used as a negative control. The clipped leaves displayed water-soaked lesions at 3 to 5 days after inoculation (DAI); then the lesion spread downward and turned light brown. At about 14 DAI, blight was shown with similar symptoms to those samples collected from the rice field of Zhejiang and Jiangxi provinces (Fig. S1). In contrast, the control plants remained healthy and symptomless. The same P. ananatis was re-isolated in the inoculated rice plants, fulfilling Koch’s postulates. In the past decade, P. ananatis has been reported to cause grain discoloration in Hangzhou, China (Yan et al. 2010) and induce leaf blight as a companion of Enterobacter asburiae in Sichuan province, China (Xue et al. 2020). Nevertheless, to the best of our knowledge, this is the first report of P. ananatis as the causative agent of rice leaf blight in southeast China. This study raises the alarm that the emerging rice bacterial leaf blight in southeast China might be caused by a new pathogen P. ananatis, instead of Xoo as traditionally assumed. Further, the differences of occurrence, spread and control between two rice bacterial leaf blight diseases caused by P. ananatis and Xoo, respectively need to be determined in the future.

APA, Harvard, Vancouver, ISO, and other styles

We offer discounts on all premium plans for authors whose works are included in thematic literature selections. Contact us to get a unique promo code!