Journal articles on the topic 'Wind instruments Physiological aspects'
To see the other types of publications on this topic, follow the link: Wind instruments Physiological aspects.
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 50 journal articles for your research on the topic 'Wind instruments Physiological aspects.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
Uvarova, Olga V. "Setting up the performance technique of a novice wind instrument player: Acoustic and physiological aspects." Izvestia: Herzen University Journal of Humanities & Sciences, no. 201 (2021): 158–65. http://dx.doi.org/10.33910/1992-6464-2021-201-158-165.
Full text
2
Stepanova, Anna. "Features of the modern saxophone." Scientific bulletin of South Ukrainian National Pedagogical University named after K. D. Ushynsky 2020, no. 3 (132) (September 24, 2020): 66–70. http://dx.doi.org/10.24195/2617-6688-2020-3-8.
Full textAbstract:
The relevance of the topic is stipulated by the fact that saxophone performance is becoming widespread nowadays, it substantiates the needs to establish new performing schools and to initiate researches aimed at improving methods of playing the saxophone. The purpose of the article is to pay special attention to the social status of the saxophone, its role in the system of professional music education and the evolution of performing techniques of playing the saxophone. The research methods are as follows: theoretical analysis of scientific and methodological literature, comparative studies. Summary: The main scientific and methodological works devoted to the improvement of methods and techniques of playing the saxophone are considered. In the historical aspect, some theoretical works of domestic and foreign authors on the methods and techniques of playing the saxophone have been analysed: the American researcher Carr W.E.J., who identified the physiological features of playing wooden wind instruments (the flute, the oboe, the clarinet, the bassoon and the saxophone); the Russian Professor Ivanov V. D., who identified modification forms and types of saxophone music; the Ukrainian researchers Kyrylov S. V., who singled out the so-called "concert face of the saxophonist" and the associated set of his / her professional skills, Krupey M. V., who historically analysed saxophone performance and determined the stylistic basis for the formation of saxophonist’s performing skills, Professor V. Apatskyi, who came to the conclusion that the advantage of an "o-shaped" ear cushion is a peculiar position of the lower lip, which is necessary for flexible control of the cane. The article also considers scientific and methodological works of foreign authors, reflecting the problematic and related issues of saxophone performance, which allowed us to draw the following conclusions: academic and jazz saxophone performances develop in parallel and are interdependent; the recognition of the saxophone individuality contributes to the transformations within the professional system of education, the teaching of the saxophone having become narrowly professional in this connection; the development of saxophone performance has led to the creation of national schools, which stipulated a rise in the number of musicians of the new formation, both academic and jazz.
3
Uvarova, Olga V. "SCIENTIFIC AND PEDAGOGICAL DEVELOPMENTS IN THE FIELD OF SOUND FORMATION ON WIND INSTRUMENTS." EurasianUnionScientists 2, no. 2(71) (2020): 15–17. http://dx.doi.org/10.31618/esu.2413-9335.2020.2.71.584.
Full textAbstract:
The priority direction in modern conditions of musical and pedagogical activity is the training of highly qualified specialists. The main factor of successful methodological work in the field of wind instrument performance is the study of scientific achievements in physiology, pedagogy, and psychology. Currently, in the pedagogical practice of wind art, there are a number of issues that require a conceptual understanding of the physiological components of the voice and articulation apparatus, as well as the dependence of sound quality on these organs. The subject of the analysis is the correct functioning of the larynx as a resonator. The analysis of scientific and theoretical developments in the field of sound formation on wind instruments allowed us to explain a number of pedagogical approaches in the practice of musical and performing arts
4
Wen, Olivia Xin, and Carol Lynne Krumhansl. "Real-Time Responses to Stravinsky’s Symphonies of Wind Instruments." Music Perception 35, no. 1 (September 1, 2017): 60–76. http://dx.doi.org/10.1525/mp.2017.35.1.60.
Full textAbstract:
This experiment was designed to address factors that make repetition of musical themes within a piece recognizable, and to explore the relationship between internal repetition and musical interest. Thirty-seven participants of varied levels of music training listened to Stravinsky’s Symphoniesof Wind Instruments twice and responded to the music in real time. During the first listening, they continuously rated their level of interest and at the same time mentally identified the major themes. During the second listening, they indicated when they heard the major themes repeating. One theme was especially well recognized when repeated. It was relatively short, slow, began and ended with a predictable pattern, occurred relatively early in the piece, and was interspersed with other themes. Another theme stood out in the interest ratings, which was relatively long, fast, sometimes repeated immediately with a build-up of instrumentation and dynamics, and occurred later in the piece. In general, themes judged interesting were not those that were easily identified when repeated, suggesting these are independent aspects of this composition. No effect of music training was found. Extensive analyses of Stravinsky’s Symphonies consider how the themes are repeated and interwoven. The experimental results confirmed the musical attributes considered in these analyses.
5
Kotašová, Daniela. "Domestic Music Making and its Instruments: Zpráva z mezinárodní konference hudebních nástrojů v Edinburghu." Muzeum Muzejní a vlastivedná práce 60, no. 1 (2022): 64–68. http://dx.doi.org/10.37520/mmvp.2022.007.
Full textAbstract:
June 2022 saw the biennial conference on musical instruments organized by The Galpin Society in association with The University of Edinburgh. The papers presented a wide range of organological topics related to the fields of stringed instruments and especially wind instrument (woodwind and brass). During the conference, various options for the research methodology were presented: from the description of the construction and technical features of the instrument, decoration and design, through archival research, socio-economic aspects of production and trade, to the acoustic properties of the instruments. There was also the topic of the use of social media.
6
Maruri, M., J. A. Romo, and L. Gomez. "Aspects of quality control of wind profiler measurements in complex topography." Atmospheric Measurement Techniques 7, no. 1 (January 14, 2014): 135–48. http://dx.doi.org/10.5194/amt-7-135-2014.
Full textAbstract:
Abstract. It is well known in the scientific community that some remote sensing instruments assume that sample volumes present homogeneous conditions within a defined meteorological profile. At complex topographic sites and under extreme meteorological conditions, this assumption may be fallible depending on the site, and it is more likely to fail in the lower layers of the atmosphere. This piece of work tests the homogeneity of the wind field over a boundary layer wind profiler radar located in complex terrain on the coast under different meteorological conditions. The results reveal the qualitative importance of being aware of deviations in this homogeneity assumption and evaluate its effect on the final product. Patterns of behavior in data have been identified in order to simplify the analysis of the complex signal registered. The quality information obtained from the homogeneity study under different meteorological conditions provides useful indicators for the best alternatives the system can offer to build wind profiles. Finally, the results are also to be considered in order to integrate them in a quality algorithm implemented at the product level.
7
Bradley, Stuart. "Aspects of the Correlation between Sodar and Mast Instrument Winds." Journal of Atmospheric and Oceanic Technology 30, no. 10 (October 1, 2013): 2241–47. http://dx.doi.org/10.1175/jtech-d-12-00256.1.
Full textAbstract:
Abstract On a uniform terrain site, differences between a sodar and a mast-mounted cup anemometer will arise because of turbulent fluctuations and wind components being measured in different spaces, and because of the inherent difference between scalar and vector averaging. This paper develops theories for turbulence-related random fluctuations resulting from finite sampling rates and sampling from spatially distributed volumes. Coefficients of determination (R2) are predicted comparable to those obtained in practice. It is shown that more than two-thirds of the reduction in R2 arises from differences in the winds measured by mast instruments and by sodars, rather than by sodar errors: both instruments are measuring accurately, but just not in the same place or at the same time. The result is that sodars being used operationally should be able to measure winds to a root-mean-square accuracy of around 2%.
8
Schriks, M. C. M., and W. E. Van Amerongen. "Atraumatic perspectives of ART: psychological and physiological aspects of treatment with and without rotary instruments." Community Dentistry and Oral Epidemiology 31, no. 1 (January 24, 2003): 15–20. http://dx.doi.org/10.1034/j.1600-0528.2003.00021.x.
Full text
9
Villante, U., M. Vellante, A. Piancatelli, A. Di Cienzo, T. L. Zhang, W. Magnes, V. Wesztergom, and A. Meloni. "Some aspects of man-made contamination on ULF measurements." Annales Geophysicae 22, no. 4 (April 2, 2004): 1335–45. http://dx.doi.org/10.5194/angeo-22-1335-2004.
Full textAbstract:
Abstract. An analysis of the man made contamination on ULF measurements in highly populated areas has been conducted at several suitably chosen sites in Western Europe. The experimental results show common characteristics at different stations with clear evidence for an additional working day contamination with respect to weekends. These effects more clearly emerge in the vertical component that is less influenced by natural signals. A similar analysis conducted at Terra Nova Bay does not reveal any clear evidence for man made disturbances on Antarctic measurements. Key words. (Magnetospheric physics, instruments and techniques; Solar wind-magnetosphere interaction) (Geomagnetism and paleomagnetism time variations, diurnal to secular)
10
Clemente, Miguel Pais, André Moreira, Catarina Morais, José Manuel Amarante, Afonso Pinhão Ferreira, and Joaquim Mendes. "Tooth Position in Wind Instrument Players: Dentofacial Cephalometric Analysis." International Journal of Environmental Research and Public Health 18, no. 8 (April 19, 2021): 4306. http://dx.doi.org/10.3390/ijerph18084306.
Full textAbstract:
Background: Specific dentofacial characteristics in wind instrumentalists should be taken in consideration when analyzing physiological and anatomical issues regarding the musician’s embouchure, posture, and biomechanics during musical performance. Objectives: To compare tooth cephalometric characteristics between wind instrument players and string players (overjet, overbite, lower facial height, facial convexity, lower incisor inclination, and interincisal angle). Methods: In total, 48 wind instrumentalists (67%) and 24 string instrumentalists (33%). These musicians performed lateral tele-radiography and the correspondent linear and angular measurements of the dentofacial cephalometric analysis. Statistical comparison of wind and string instrumentalists was made by using an independent t-test. Results: Small variations on the analyzed parameters were found between the wind and string instrument groups. Based on the cephalometric analysis the variable interincisal angle was statistically significant (p < 0.05), when comparing the wind and string instrument group. Conclusions: Knowledge of the overjet and overbite value permits a substantial analysis on the tooth position of wind instrument players, where both of these parameters are increased and greater than the norm value. The cephalometry was an added value on the interpretation of possible factors that lead to the position of the central incisors of wind instruments. Till some extent in this group of musicians the applied forces during the embouchure mechanism on the anterior teeth and the existing perioral forces promote an equilibrium on the vector of forces. This study findings demonstrate that when evaluating the two samples, wind and string instruments there are different dentofacial configurations, however the only statistically significant differences that were found are related to the interincisal angle (p < 0.05).
11
Maruri, M., J. A. Romo, and L. Gomez. "Quality aspects of the measurements of a wind profiler in a complex topography." Atmospheric Measurement Techniques Discussions 6, no. 3 (June 13, 2013): 5217–50. http://dx.doi.org/10.5194/amtd-6-5217-2013.
Full textAbstract:
Abstract. It is well known amongst the scientific community that some remote sensing instruments have assumed that sample volumes present homogeneous conditions within a defined meteorological profile. At complex topographic sites and under extreme meteorological conditions, this assumption may be fallible depending on the site, and it is more likely to fail in the lower layers of the atmosphere. This piece of work tests the homogeneity of the wind field over a boundary layer wind profiler radar located in a complex terrain on the coast, under different meteorological conditions. The results reveal the qualitative importance of being aware of the deviations of this homogeneity assumption and evaluate its effect on the final product. Patterns of behaviour in data have been identified in order to simplify the analysis of the complex signal registered. The quality information obtained from the homogeneity study under different meteorological conditions is useful to look for the best alternatives the system can offer to build wind profiles. Finally, the results are also to be considered in order to integrate them in a quality algorithm implemented at product level.
12
Simani, Silvio, Saverio Farsoni, and Paolo Castaldi. "Data-Driven and Model-Based Control Techniques for a Wind Turbine Benchmark Model." International Journal of Robotics and Automation Technology 9 (December 5, 2022): 78–95. http://dx.doi.org/10.31875/2409-9694.2022.09.08.
Full textAbstract:
Abstract: Wind turbine plants are complex dynamic and uncertain processes driven by stochastic inputs and disturbances, as well as different loads represented by gyroscopic, centrifugal, and gravitational forces. Moreover, as their aerodynamic models are nonlinear, both modelling and control become challenging problems. On one hand, high–fidelity simulators should contain different parameters and variables in order to accurately describe the main dynamic system behaviour. Therefore, the development of modelling and control for wind turbine systems should consider these complexity aspects. On the other hand, these control solutions have to include the main wind turbine dynamic characteristics without becoming too complicated. The main point of this paper is thus to provide two practical examples of development of robust control strategies when applied to a simulated wind turbine plant. Extended simulations with the wind turbine benchhmark model and the Monte–Carlo tool represent the instruments for assessing the robustness and reliability aspects of the developed control methodologies when the model–reality mismatch and measurement errors are also considered. Advantages and drawbacks of these regulation methods are also highlighted with respect to different control strategies via proper performance metrics.
13
Morley, Iain. "Evolution of the Physiological and Neurological Capacities for Music." Cambridge Archaeological Journal 12, no. 2 (October 2002): 195–216. http://dx.doi.org/10.1017/s0959774302000100.
Full textAbstract:
Neuropsychological and developmental studies suggest human musical ability has a deep evolutionary history; but we do not find evidence of the manufacture and use of instruments, with which musical behaviours have often been assumed to be equated, until 70,000 years after the advent of Homo sapiens. This anomaly is addressed by examining the evidence from the fossil record for the evolution of the physiology and neurology required for musical behaviours, with the aim of identifying the development of the physiological and neurological capacity to produce and process melody and/or rhythm. Aural and vocal sophistication appear to have developed in tandem, beginning with full bipedalism around 1.75 million years ago, until a vocal apparatus similar to the modern was present in Homo heidelbergensis 400,000–300,000 years ago. Prosodic and structural aspects of both speech and music production and processing are lateralized in the brain in similar ways suggesting evolutionarily-shared foundations for these mechanisms.
14
Davy, John Laurence, Kym Burgemeister, David Hillman, and Simon Carlile. "A Review of the Potential Impacts of Wind Turbine Noise in the Australian Context." Acoustics Australia 48, no. 2 (June 27, 2020): 181–97. http://dx.doi.org/10.1007/s40857-020-00192-4.
Full textAbstract:
Abstract This manuscript describes a range of technical deliberations undertaken by the authors during their work as members of the Australian Government’s Independent Scientific Committee on Wind Turbines. Central to these deliberations was the requirement upon the committee to improve understanding and monitoring of the potential impacts of sound from wind turbines (including low frequency and infrasound) on health and the environment. The paper examines existing wind turbine sound limits, possible perceptual and physiological effects of wind turbine noise, aspects of the effects of wind turbine sound on sleep health and quality of life, low-frequency noise limits, the concept of annoyance including alternative causes of it and the potential for it to be affected by low-frequency noise, the influence of amplitude modulation and tonality, sound measurement and analysis and management strategies. In so doing it provides an objective basis for harmonisation across Australia of provisions for siting and monitoring of wind turbines, which currently vary from state to state, contributing to contention and potential inequities between Australians, depending on their place of residence.
15
Wu, Chien-Huei. "Beyond Liberalization: Health-Related Aspects of EU External Economic Agreements." European Foreign Affairs Review 17, Issue 4 (November 1, 2012): 511–32. http://dx.doi.org/10.54648/eerr2012037.
Full textAbstract:
This article argues that there exists a discrepancy between the Union's external competence in the sphere of public health or health services and the Union's internal competence on health policies. While the TFEU brings trade in health services into the scope of the CCP and assigns it as an exclusive competence of the EU, the Union may still have to rely upon the Member States in implementing international obligations relating to trade in health services. This article also argues that health-related aspects of EU external economic agreements go beyond liberalization front. In addition to conventional equivalency test on SPS measures and mutual recognition agreements on TBT issues, they also cover public health issues relating to tobacco control, alcohol, illicit drugs, HIV-AIDS, and sometimes nuclear disaster and soft instruments governing regulatory dialogue and cooperation.
16
Swartz, S. M., and N. Konow. "Advances in the study of bat flight: the wing and the wind." Canadian Journal of Zoology 93, no. 12 (December 2015): 977–90. http://dx.doi.org/10.1139/cjz-2015-0117.
Full textAbstract:
Bats are diverse, speciose, and inhabit most of earth’s habitats, aided by powered flapping flight. The many traits that enable flight in these mammals have long attracted popular and research interest, but recent technological and conceptual advances have provided investigators with new kinds of information concerning diverse aspects of flight biology. As a consequence of these new data, our understanding of how bats fly has begun to undergo fundamental changes. Physical and neural science approaches are now beginning to inform understanding of structural architecture of wings. High-speed videography is dramatically expanding documentation of how bats fly. Experimental fluid dynamics and innovative physiological techniques profoundly influence how we interpret the ways bats produce aerodynamic forces as they execute distinctive flight behaviors and the mechanisms that underlie flight energetics. Here, we review how recent bat flight research has provided significant new insights into several important aspects of bat flight structure and function. We suggest that information coming from novel approaches offer opportunities to interconnect studies of wing structure, aerodynamics, and physiology more effectively, and to connect flight biology to newly emerging studies of bat evolution and ecology.
17
Cha, Junseo, Seong Hee Choi, and Chul-Hee Choi. "Can a natural singing voice be enhanced through digital processing? Implications of voice training and vocology in singers." Revista de Investigación e Innovación en Ciencias de la Salud 3, no. 2 (December 18, 2021): 72–86. http://dx.doi.org/10.46634/riics.119.
Full textAbstract:
Introduction. The traditional way of facilitating a good singing voice has been achieved through rigorous voice training. In modern days, however, there are some aspects of the singing voice that can be enhanced through digital processing. Although in the past, the frequency or intensity manipulations had to be achieved through the various singing techniques of the singer, technology today allows the singing voice to be enhanced from the instruments within recording studios. In essence, the traditional voice pedagogy and the evolution of digital audio processing both strive to achieve a better quality of the singing voice, but with different methods. Nevertheless, the major aspects of how the singing voice can be manipulated are not communicated among the professionals in each field. Objective. This paper offers insights as to how the quality of the singing voice can be changed physiologically through the traditional ways of voice training, and also digitally through various instruments that are now available in recording studios. Reflection. The ways in which singers train their voice must be mediated with the audio technology that is available today. Although there are aspects in which digital technology can aid the singer’s voice, there remain areas in which the singers must train their singing system at a physiological level to produce a better singing voice.
18
Niedziela, Julia. "Lokalizacja instalacji odnawialnych źródeł energii – aspekty prawne." Studia Iuridica, no. 86 (June 14, 2021): 196–211. http://dx.doi.org/10.31338/2544-3135.si.2020-86.13.
Full textAbstract:
The article analyses in detail legal regulations governing the location of wind and photovoltaic farms. It also describes the basic planning instruments adopted in Poland. The analysis includes the principles adopted in the so-called “Distance Law”, i.e. the principle of investment location based on the local spatial development plan, and the principle of minimum distance of a wind tourbine from residential buildings. Next, the decisions permitting the location of PV farm were described - the decision on development conditions and the decision on the location of a public purpose investment. The article identifies legal and factual problems related to the adoption of legal regulations and offers potential solutions.
19
BIJU, P. S., ANJIT ANJAN, R. D. VASHISTHA, and K. SANTHOSH. "An indigenous state-of-the-art Digital Automatic Recording System (DARS) for surface meteorological observatories." MAUSAM 63, no. 4 (December 17, 2021): 607–14. http://dx.doi.org/10.54302/mausam.v63i4.411.
Full textAbstract:
The existing self recording instruments of India Meteorological Department (IMD) urgently require modernization by considering the demand for its real time interface with the modern now-casting tools like Doppler Weather Radar (DWR), real time weather models etc. Hence IMD has designed and developed a state-of-the-art Digital Automatic Recording System (DARS) for the automatic measurement, storage, display and communication of meteorological parameters like Atmospheric pressure, Wind speed, Wind direction, Air temperature, Relative humidity and Rainfall. The system has its origin from the existing IMD make High Wind Speed Recording (HWSR) System installed at more than 15 coastal observatories in the eastern coast of India, by suitable integration with different types of electronic meteorological sensors available in the global market. Authors have participated at various stages of design, development, installation, and data validation of the system. This paper highlights the design aspects of indigenous system and its data quality with respect to imported AWS and ground truth observations and the proposal for its installation at selected villages in a district to study the spatial variation of Wind and Rainfall during Monsoon period.
20
Aberson, Sim D., Michael T. Montgomery, Michael Bell, and Michael Black. "Hurricane Isabel (2003): New Insights Into the Physics of Intense Storms. Part II: Extreme Localized Wind." Bulletin of the American Meteorological Society 87, no. 10 (October 1, 2006): 1349–54. http://dx.doi.org/10.1175/bams-87-10-1349.
Full textAbstract:
An unprecedented dataset of category-5 Hurricane Isabel was collected on 12–14 September 2003. This two-part series focuses on novel dynamical and thermodynamical aspects of Isabel's innercore structure on 13 September. In Part I, using a composite of dropwindsonde and in situ aircraft data, the authors suggested that the axisymmetric structure of Isabel showed that the storm was superintense. Mesocyclones seen clearly in satellite imagery within the eye of Hurricane Isabel are hypothesized to mix high-entropy air at low levels in the eye into the eyewall, stimulating explosive convective development and a concomitant local horizontal wind acceleration. Part II focuses on a unique set of observations into an extraordinary small- (miso) scale cyclonic feature inside of the inner edge of the eyewall of Hurricane Isabel. A dropwindsonde released into this feature measured the strongest known horizontal wind in a tropical cyclone. This particular observation is discussed in the context of concurrent observations from airborne Doppler radar and other airborne instruments. These observations show wind even stronger than the system-scale superintense wind suggested in Part I. Speculation on the frequency of occurrence of these “little whirls” and their potentially catastrophic impacts are presented.
21
Andreas, Edgar L., and Larry Mahrt. "On the Prospects for Observing Spray-Mediated Air–Sea Transfer in Wind–Water Tunnels." Journal of the Atmospheric Sciences 73, no. 1 (December 21, 2015): 185–98. http://dx.doi.org/10.1175/jas-d-15-0083.1.
Full textAbstract:
Abstract Nature is wild, unconstrained, and often dangerous. In particular, studying air–sea interaction in winds typical of tropical cyclones can place researchers, their instruments, and even their research platforms in jeopardy. As an alternative, laboratory wind–water tunnels can probe 10-m equivalent winds of hurricane strength under conditions that are well constrained and place no personnel or equipment at risk. Wind–water tunnels, however, cannot simulate all aspects of air–sea interaction in high winds. The authors use here the comprehensive data from the Air–Sea Interaction Salt Water Tank (ASIST) wind–water tunnel at the University of Miami that Jeong, Haus, and Donelan published in this journal to demonstrate how spray-mediated processes are different over the open ocean and in wind tunnels. A key result is that, at all high-wind speeds, the ASIST tunnel was able to quantify the so-called interfacial air–sea enthalpy flux—the flux controlled by molecular processes right at the air–water interface. This flux cannot be measured in high winds over the open ocean because the ubiquitous spray-mediated enthalpy transfer confounds the measurements. The resulting parameterization for this interfacial flux has implications for modeling air–sea heat fluxes from moderate winds to winds of hurricane strength.
22
Li, Zhen, Ad Stoffelen, and Anton Verhoef. "A generalized simulation capability for rotating- beam scatterometers." Atmospheric Measurement Techniques 12, no. 7 (July 4, 2019): 3573–94. http://dx.doi.org/10.5194/amt-12-3573-2019.
Full textAbstract:
Abstract. Rotating-beam wind scatterometers exist in two types: rotating fan-beam and rotating pencil-beam. In our study, a generic simulation frame is established and verified to assess the wind retrieval skill of the three different scatterometers: SCAT on CFOSAT (China France Oceanography SATellite), WindRad (Chinese Wind Radar) on FY-3E, and SeaWinds on QuikSCAT. Besides the comparison of the so-called first rank solution retrieval skill of the input wind field, other figures of merit (FoMs) are applied to statistically characterize the associated wind retrieval performance from three aspects: wind vector root mean square error, ambiguity susceptibility, and wind biases. The evaluation shows that, overall, the wind retrieval quality of the three instruments can be ranked from high to low as WindRad, SCAT, and SeaWinds, where the wind retrieval quality strongly depends on the wind vector cell (WVC) location across the swath. Usually, the higher the number of views, the better the wind retrieval, but the effect of increasing the number of views reaches saturation, considering the fact that the wind retrieval quality at the nadir and sweet swath parts stays relatively similar for SCAT and WindRad. On the other hand, the wind retrieval performance in the outer swath of WindRad is improved substantially as compared to SCAT due to the increased number of views. The results may be generally explained by the different incidence angle ranges of SCAT and WindRad, mainly affecting azimuth diversity around nadir and number of views in the outer swath. This simulation frame can be used for optimizing the Bayesian wind retrieval algorithm, in particular to avoid biases around nadir but also to investigate resolution and accuracy through incorporating and analyzing the spatial response functions of the simulated Level-1B data for each WVC.
23
Nachon, Juan Ignacio, María Soledad Segretin, and Sebastián Javier Lipina. "Conceptual and methodological approaches to the study of Self-Regulation: An inquiry within Developmental Science." Revista Argentina de Ciencias del Comportamiento 12, no. 3 (December 23, 2020): 13–31. http://dx.doi.org/10.32348/1852.4206.v12.n3.25739.
Full textAbstract:
The present work intends to thoroughly identify theoretical and practical applications of self-regulation (SR) in contemporary developmental research, by reviewing conceptual and operational definitions of SR, in addition to the methods and instruments used to assess it in empirical studies. 468 scientific articles with cumulative evidence from the last two decades of research were included (142 reviews and 326 original research articles). Using a mixed-methods approach based on grounded theory methodology, the main theoretical and methodological aspects involved in the definition and operationalization of SR were reviewed. Results point towards a growing consensus in the conceptual definition of SR, which emphasizes the interrelation of emotional and cognitive control, goal-oriented activity, physiological and interpersonal processes. Empirical research often considers to diverse biologic, behavioral and social features in the operationalization of the concept, making use of report scales, performance tasks and, to a lesser extent, physiological and observational measurements.
24
Tsiuliupa, S. D. "Doctoral dissertations of wind instruments musicians in Ukraine (the end of XX – early XXI century)." Problems of Interaction Between Arts, Pedagogy and the Theory and Practice of Education 54, no. 54 (December 10, 2019): 24–39. http://dx.doi.org/10.34064/khnum1-54.02.
Full textAbstract:
This paper is the first attempt to lay out the major scientific achievements of teachers of faculties of wind and percussion instruments of Ukrainian universities with 3-4 accreditation levels, for the period from second half of XX – to beg. of XXI century. This article systematizes and precisely analyzes the content of obtained PhD dissertations on musical art, theory and methodic of professional education, musical art, theory, the methodic and organization of cultural and educational activities. In the period of Ukraine’s integration into the European entities, scientific work becomes the leitmotif of the activity of a teacher of a higher art educational institution. The works of the leading scientists of Ukraine became the fundamental scientific researches of the evolution of spiritual musical performance. V. Apatsky in the doctoral dissertation “Theoretical foundations of playing the wind instruments (on the example of bassoon)” examines the acoustic nature of the instrument and the specificity of sound formation on it, the structure and functioning of the executive apparatus and methods of its formation, the basic means of expressiveness of the bassoonist and methods of development of performing skill. I. Yakustidi in the dissertation “The value of horn tone in the learning process” and by the method of numerical laboratory measurements explored the work of the sound-forming apparatus of the horn performer. Along with the experimental experiments, the dissertation covers the issues of performance history, theory and practice, methods of teaching horn performance. P. Krul in his study “Genesis of Wind and Percussion Instrumental Performance of Ukraine” traces the genesis of wind and percussion music in Ukraine. V. Posvaluk in the dissertation “Ways of Formation and Problems of Development of the Ukrainian Trumpet Performance School: Historical, Professional-Performing, Theoretical and Methodological Aspects” for the first time reveals the peculiarity of the historical way of formation and development of the national trumpet performance school and its regional peculiarities. V. Bohdanov dedicates his dissertation “Ways of Development of the Wind Musical Art in Ukraine (from the Origins to the Beginning of the XX Century) to the Study of the Wind Musical Art of Ukraine. Based on the systematization of actual data, the main directions of its evolution are highlighted. V. Kachmarchyk. The priority areas of the dissertation research “German flute art of the 18th – 19th centuries” were the creation of the historical periodization of the German flute art of the 18th – 19th centuries, and defining the role of J. J. Kwanz, J. G. Tromlits, A. B. Furstenau and T. Bohm in the formation of the German flute school. Y. Sverlyuk in his work “Theoretical and methodological bases of vocational training of conductor of an orchestra collective in higher art establishments” he explored methodological, theoretical and methodical bases of vocational training of conductor taking into account the specifics of future professional activity. A. Karpyak. In his Doctoral dissertation “Flutist’s Artistic Thesaurus as the Basis of Performing Skills” and for the first time in Ukrainian musicology, he provided a reasoned critical analysis of the key issues and problems in the development of contemporary flute art.
25
Ciekurs, Kalvis, Viesturs Krauksts, Daina Krauksta, Juris Grants, and Baiba Smila. "OLYMPIC TEAM ROWER STROKE TECHNICAL ANALYSIS." SOCIETY. INTEGRATION. EDUCATION. Proceedings of the International Scientific Conference 4 (May 21, 2019): 71. http://dx.doi.org/10.17770/sie2019vol4.3940.
Full textAbstract:
It is much spoken about and researched how to increase the speed of moving in rowing. Many scientists have researched the technical aspects in rowing. Most part of researches is based on oxygen maximal consumption and other physiological changes during a load. Although there are various researches, stating the technical nuances of leg and arm work, comparatively little attention is paid to the role of the arm work. The cycle length in different distances and having different water flow – before the wind, against the wind and with the side wind is stated. The aim was to research one stroke technical nuances in rowing looking for stroke rate from 24 till 34. A pilot study was carried out. One Lithuanian Olympic team rower was participated this pilot study and he was tested in different stroke rate. The following methods were used in study: test exercise, video analysis with KinezioVideoAnalyzer 3.0. and mathematical statistics. The results: having stated the result average of stroke rate was 28,6 and speed of stroke was 0,82 sec. Conclusions: the obtained data from rower show small differences changing stroke rate.
26
von Steinbuechel, Nicole, Amra Covic, Suzanne Polinder, Thomas Kohlmann, Ugne Cepulyte, Herbert Poinstingl, Joy Backhaus, et al. "Assessment of Health-Related Quality of Life after TBI: Comparison of a Disease-Specific (QOLIBRI) with a Generic (SF-36) Instrument." Behavioural Neurology 2016 (2016): 1–14. http://dx.doi.org/10.1155/2016/7928014.
Full textAbstract:
Psychosocial, emotional, and physical problems can emerge after traumatic brain injury (TBI), potentially impacting health-related quality of life (HRQoL). Until now, however, neither the discriminatory power of disease-specific (QOLIBRI) and generic (SF-36) HRQoL nor their correlates have been compared in detail. These aspects as well as some psychometric item characteristics were studied in a sample of 795 TBI survivors. The ShannonH'index absolute informativity, as an indicator of an instrument’s power to differentiate between individuals within a specific group or health state, was investigated. Psychometric performance of the two instruments was predominantly good, generally higher, and more homogenous for the QOLIBRI than for the SF-36 subscales. Notably, the SF-36 “Role Physical,” “Role Emotional,” and “Social Functioning” subscales showed less satisfactory discriminatory power than all other dimensions or the sum scores of both instruments. The absolute informativity of disease-specific as well as generic HRQoL instruments concerning the different groups defined by different correlates differed significantly. When the focus is on how a certain subscale or sum score differentiates between individuals in one specific dimension/health state, the QOLIBRI can be recommended as the preferable instrument.
27
Abir, Ahmed Raihan, and Shamima Parvin Lasker. "Ethical aspects of Dhaka University Tele-medicine System." Bangladesh Journal of Bioethics 6, no. 3 (May 6, 2016): 30–36. http://dx.doi.org/10.3329/bioethics.v6i3.27617.
Full textAbstract:
To provide basic health care services in rural areas is one of the major challenges for developing countries like Bangladesh because of lack of infrastructures and unavailability of qualified medical doctors in the villages. Telemedicine viewed as a new way of offering health care services that has the potential to overcome this problem. Author is a member of extended group at Dhaka University (DU) which has been developing telemedicine equipment and data acquisition software to promote telemedicine practice in Bangladesh. PC based ECG equipment, Digital stethoscope, Digital microscope, Digital X-ray view box and some other essential medical equipment was developed for telemedicine services. The data acquisition software establishes an easy and appropriate patients to doctor interaction through a trained operator in a remote center that involve management and arrangement of consultation of a chosen and agreeing doctor by a patient. Upon establishing audio-visual connection between patient and doctor relevant physiological data from different diagnostic instruments will be uploaded securely in a dedicated web server which can be viewed real time using unique patient/doctor ID and password. Recently the Telemedicine group of DU and a local NGO named SAMAMA with support from Service innovation fund (SIF) of Prime Minister Office (PMO) of Bangladesh took the initiative to establish eight rural telemedicine centers and one expert center for the field trial of telemedicine in Bangladesh. The aim of this paper is to examine the ethical challenges of such health care system and our effort to overcome those problem before starting the field trial.
28
Zhang, Ning, Yizhong Qu, Zhizhong Song, Yahui Chen, and Jiang Jiang. "Responses and sensitivities of maize phenology to climate change from 1971 to 2020 in Henan Province, China." PLOS ONE 17, no. 1 (January 25, 2022): e0262289. http://dx.doi.org/10.1371/journal.pone.0262289.
Full textAbstract:
Climate change affects many aspects of the physiological and biochemical processes of growing maize and ultimately its yield. A comprehensive climate suitability model is proposed that quantifies the effects of temperature, precipitation, solar radiation, and wind in different phenological stages of maize. It is calibrated using weather and yield data from China’s Henan Province. The comprehensive suitability model showed the capability of correctly hindcasting observed temporal and spatial changes in maize phenology in response to climatic factors. The predicted yield based on the suitability model can well match the recorded field yield very well from 1971–2020. The results of correlation showed that the yields are more closely related to multi-weather factors, temperature and precipitation than to solar radiation and wind. The sensitivity analysis illustrates that temperature and precipitation are the dominant weather factors affecting yield changes based on a direct differentiation method. The comprehensive suitability model can provide a scientific support and analysis tool for predicting grain production considering climate changes.
29
Chen, Su, Peng Chen, Lei Ding, and Delu Pan. "Assessments of the Above-Ocean Atmospheric CO2 Detection Capability of the GAS Instrument Onboard the Next-Generation FengYun-3H Satellite." Remote Sensing 14, no. 23 (November 28, 2022): 6032. http://dx.doi.org/10.3390/rs14236032.
Full textAbstract:
The next-generation FengYun-3H satellite carrying a greenhouse gas absorption spectrometer (GAS) is planned for launch by 2024 with a strengthened ability to help researchers understand the global carbon cycle. However, assessments of the atmospheric CO2-detection capabilities of GAS are still incomplete, mainly in the following aspects: previous studies on the spectral range of GAS instruments often used the weak absorption band of CO2 molecules (1.61 μm); research on the measurement accuracies of different atmospheric environments above oceans is lacking; and most studies considered land surfaces as the bottom boundaries. Here, we simulated high spectral CO2 absorption spectra in both the strong and weak bands (2.06 and 1.61 μm) while considering the effects of different instrumental (spectral resolution and sampling rate) and environmental (wind speed, visibility, and rough sea surface) parameters. This is the first atmospheric CO2 absorption spectrum study to consider rough-sea-surface effects. The preliminary results show that the root mean squared error (RMSE) and mean absolute difference (MAD) values of the atmospheric CO2 transmittance spectra of GAS are 0.031 and 0.011, respectively, in the 1.61 μm band and 0.05 and 0.033 in the 2.06 μm band, revealing that GAS is competitive among similar CO2 instruments. This study provides a design reference for next-generation GAS instruments and contributes to spectral data CO2 processing in the above-sea atmosphere.
30
Gao, Wei, Ruoxiang Tu, Hao Li, Yongli Fang, and Qingmin Que. "In the Subtropical Monsoon Climate High-Density City, What Features of the Neighborhood Environment Matter Most for Public Health?" International Journal of Environmental Research and Public Health 17, no. 24 (December 21, 2020): 9566. http://dx.doi.org/10.3390/ijerph17249566.
Full textAbstract:
Urbanization and climate change have been rapidly occurring globally. Evidence-based healthy city development is required to improve living quality and mitigate the adverse impact of the outdoor neighborhood environment on public health. Taking Guangzhou as an example to explore the association of neighborhood environment and public health and preferably to offer some implications for better future city development, we measured ten environmental factors (temperature (T), wind-chill index (WCI), thermal stress index (HSI), relative humidity (RH), average wind speed (AWS), negative oxygen ions (NOI), PM2.5, luminous flux (LF), and illuminance (I)) in four seasons in four typical neighborhoods, and the SF-36 health scale was employed to assess the physical and mental health of neighborhood residents in nine subscales (health transition(HT), physiological functions (PF), general health status (GH), physical pain (BP), physiological functions (RP), energy vitality (VT), mental health (MH), social function (SF), and emotional functions (RE)). The linear mixed model was used in an analysis of variance. We ranked the different environmental factors in relation to aspects of health and weighted them accordingly. Generally, the thermal environment had the greatest impact on both physical and mental health and the atmospheric environment and wind environment had the least impact on physical health and mental health, respectively. In addition, the physical health of the resident was more greatly affected by the environment than mental health. According to the results, we make a number of strategic suggestions for the renewal of the outdoor neighborhood environment in subtropical monsoon climate high-density cities and provide a theoretical basis for improving public health through landscape architecture at the neighborhood scale.
31
Truong, Takara E., Nathaniel G. Luttmer, Ebsa R. Eshete, Alia B. M. Zaki, Derek D. Greer, Tren J. Hirschi, Benjamin R. Stewart, Cherry A. Gregory, and Mark A. Minor. "Evaluating the Effect of Multi-Sensory Stimulation on Startle Response Using the Virtual Reality Locomotion Interface MS.TPAWT." Virtual Worlds 1, no. 1 (September 9, 2022): 62–81. http://dx.doi.org/10.3390/virtualworlds1010005.
Full textAbstract:
The purpose of the study was to understand how various aspects of virtual reality and extended reality, specifically, environmental displays (e.g., wind, heat, smell, and moisture), audio, and graphics, can be exploited to cause a good startle, or to prevent them. The TreadPort Active Wind Tunnel (TPAWT) was modified to include several haptic environmental displays: heat, wind, olfactory, and mist, resulting in the Multi-Sensory TreadPort Active Wind Tunnel (MS.TPAWT). In total, 120 participants played a VR game that contained three startling situations. Audio and environmental effects were varied in a two-way analysis of variance (ANOVA) study. Muscle activity levels of their orbicularis oculi, sternocleidomastoid, and trapezius were measured using electromyography (EMG). Participants then answered surveys on their perceived levels of startle for each situation. We show that adjusting audio and environmental levels can alter participants physiological and psychological response to the virtual world. Notably, audio is key for eliciting stronger responses and perceptions of the startling experiences, but environmental displays can be used to either amplify those responses or to diminish them. The results also highlight that traditional eye muscle response measurements of startles may not be valid for measuring startle responses to strong environmental displays, suggesting that alternate muscle groups should be used. The study’s implications, in practice, will allow designers to control the participants response by adjusting these settings.
32
Wooliscroft, L. J. C., T. Dudok de Wit, V. V. Krasnosel'skikh, and M. A. Balikhin. "On aspects of the measurement of non-linear turbulence processes using the cluster wave experiments." Nonlinear Processes in Geophysics 3, no. 1 (March 31, 1996): 58–65. http://dx.doi.org/10.5194/npg-3-58-1996.
Full textAbstract:
Abstract. The ESA/NASA Cluster mission has four identical satellites and is due for launch at the end of 1995. It will provide a unique opportunity to study medium scale processes in the region from inside the magnetopause to the solar wind. The polar orbit will allow measurements in the cusp and along auroral field lines, both regions where turbulence is to be expected. Five of the eleven instruments on each payload form the Wave Experiment Consortium (WEC); EFW, STAFF, VMISPER, WBD and DWP. The WEC is capable of a wide variety of wave and turbulence measurements. This paper outlines these capabilities and describes the form of the data which will be collected. The paper gives a discussion of how the WEC data may be analysed so as to give an insight into the non-linear processes which occur in these regions of the space plasmas. There are many ways in which a plasma may be considered to behave in a non-linear manner. We concentrate on how the spatio-temporal turbulence in the plasma may be investigated so as to yield the energy spectrum with respect to both the frequency and wave number.
33
Ni, Kai, Yihua Hu, Xianming Ye, Hamzah S. AlZubi, Phil Goddard, and Mohammed Alkahtani. "Carbon Footprint Modeling of a Clinical Lab." Energies 11, no. 11 (November 9, 2018): 3105. http://dx.doi.org/10.3390/en11113105.
Full textAbstract:
Modeling of a clinical lab carbon footprint is performed in this study from the aspects of electricity, water, gas consumption and waste production from lab instruments. These environmental impact indicators can be expressed in the form of the CO2 equivalent. For each type of clinical test, the corresponding consumption of energy resources and the production of plastics and papers are taken into consideration. In addition, the basic lab infrastructures such as heating, ventilation, air-conditioning (HVAC) systems, lights, and computers also contribute to the environmental impact. Human comfort is to be taken into account when optimizing the operation of lab instruments, and is related to the operation of HVAC and lighting systems. The detailed modeling takes into consideration the types of clinical tests, operating times, and instrument specifications. Two ways of disposing waste are classified. Moreover, the indoor environment is modeled. A case study of the Biochrom 30+ amino acid analyzer physiological system in Alder Hey Children’s Hospital is carried out, and the methods of mitigating the overall environmental impacts are discussed. Furthermore, the influence of climate on the results is investigated by using the climate data in Liverpool and Athens in October.
34
Zarza-Alzugaray, Francisco Javier. "Relación Entre La Sensibilidad Al Premio Y Al Castigo Y Los Niveles Motivacionales. Estudiantes Superiores De Música, Instrumentistas De Viento Metal." European Scientific Journal, ESJ 14, no. 11 (April 30, 2018): 23. http://dx.doi.org/10.19044/esj.2018.v14n11p23.
Full textAbstract:
The sensitivity to reward and punishment, within the theory of anxiety of Gray (1986) is considered as one of the ways to explain different motivational aspects and activators or inhibitors of behavior. In this sense, in this article we present how from the two activation or inhibition of behavior ways we can see how the motivation of a sample of students of higher level wind instruments is modulated and explained. Thus, the specific demands of task related together with the sensitivity to punishment are the factors that have the greatest explanatory and associative power, while factors such as sensitivity to punishment or perfectionism need further study to clarify their role in the explanation of the general motivation and of the presence of behavior activation. Finally, a better knowledge of these constructs will allow the educational community to improve the teaching practice.
35
Hanišáková, Nikola, Monika Vítězová, and Simon K. M. R. Rittmann. "The Historical Development of Cultivation Techniques for Methanogens and Other Strict Anaerobes and Their Application in Modern Microbiology." Microorganisms 10, no. 2 (February 10, 2022): 412. http://dx.doi.org/10.3390/microorganisms10020412.
Full textAbstract:
The cultivation and investigation of strictly anaerobic microorganisms belong to the fields of anaerobic microbial physiology, microbiology, and biotechnology. Anaerobic cultivation methods differ from classic microbiological techniques in several aspects. The requirement for special instruments, which are designed to prevent the contact of the specimen with air/molecular oxygen by different means of manipulation, makes this field more challenging for general research compared to working with aerobic microorganisms. Anaerobic microbiological methods are required for many purposes, such as for the isolation and characterization of new species and their physiological examination, as well as for anaerobic biotechnological applications or medical indications. This review presents the historical development of methods for the cultivation of strictly anaerobic microorganisms focusing on methanogenic archaea, anaerobic cultivation methods that are still widely used today, novel methods for anaerobic cultivation, and almost forgotten, but still relevant, techniques.
36
Tararak, Yu P. "The history of the origin and development of the trumpet: the organological aspect." Problems of Interaction Between Arts, Pedagogy and the Theory and Practice of Education 54, no. 54 (December 10, 2019): 123–37. http://dx.doi.org/10.34064/khnum1-54.08.
Full textAbstract:
Logical reason for research. Modern performance on wind instruments, in particular on the trumpet, is characterized by a powerful development. It is an object of listening interest and composing, and today it has a fairly large repertoire of both transpositions and original works in many instrumental compositions (from solo to various ensembles and orchestras) in different styles and genres. This situation in music practice requires theoretical understanding and generalization, however, we can state that at the moment, music science highlights the performance on the wind instruments without any system, mostly from the methodological viewpoint. Innovation. The article under consideration deals with the organological aspect of studying the specificity of the performance on the trumpet, which combines a number of historical and practical questions and allows them to be answered in connection with the requests of both music science and music practice (from the peculiarities of the sound production on various instruments of the trumpet family at different times (from the historical origins of trumpet performance to the present) to the technical and artistic tasks faced by the trumpet performer, as well as by the composers who create both transpositions of time-tested music for trumpet and original trumpet pieces that take into account technical, timbre, artistic and expressive capabilities of this instrument). Objectives. The purpose of research is to reveal connection between the historical-organological and practical specificity of the performance on the trumpet in the past and at present. Methods. The main methods of the research are historical and organological. Results and Discussion. Trumpet as a musical instrument is one of the oldest musical instruments in the world. Its earliest prototypes are revealed in archaeological studies of the historical past of humanity. The prototypes of embouchure instruments are horn, bone, and tusk pipes with conical bore, mostly curved, which are ancestors of the horn family; instruments with straight cylindrical pipes formed a family of trumpet. The art of playing wind instruments was a significant development in ancient Egypt, where the state placed musical art at the service of rulers and worship. Musicians in those days accompanied festive events and rituals; what is more, wind and percussion instruments became the basis for the creation of military orchestras. A straight metal trumpet appeared in Europe in the Middle Ages. In the countries of Central Asia, Iran, Tajikistan, Kazakhstan copper brass instruments were played. China’s music and performing culture employed bronze trumpets of various sizes. In the 14th-15th centuries the evolution of metal instruments underwent qualitative changes. Forms of curved trumpets were born. In addition to this, trumpets were split into low and high ones; later, middle-register instruments appeared. The so-called natural trumpets, used then, were very close in sound to the modern trumpet. In Europe there were masters who made metal instruments; eminent experts in this field, the Heinlein Schmidt family, the Nagel family, English masters Dudley, U. Bullem worked in Nuremberg from the 15th and up to the 19th century. The emergence of a slide trumpet, a trumpet with a sliding crook, is connected with the attempts to improve the instrument for the sound production of more chromatic sounds (we must distinguish the achievements of Anton Weidinger). An important step in the evolution of the chromatic trumpet was the use of horn invention (croooks). In the mid-nineteenth century, having improved the inventory system with a valve mechanism, the trumpet finally gained its place in the orchestra as a chromatic instrument. At the present time, a trumpet with a piston valve mechanism (in jazz, variety, modern music) has become very popular. At the turn of the 19th-20th centuries, trumpets of different structures, such as in C, in D, in Es, in F, were constructed; the designs of these trumpets are almost indistinguishable from the design of the modern trumpet. The piccolo trumpet was designed for a solo performance of ancient music (clarinet style); to amplify the low sounds, the alt trumpet in F and the bass trumpet became popular. Compared to fixed-mode instruments, the trumpet is a semifixed-pitch instrument. Therefore, a skilled performer is able to adjust the pitch within a certain area and correct defects in the setting of separate modeless sounds. The "planned" inaccuracy of the trumpet intonation is related to the use of a third valve. To correct the intonation associated with this, the trumpet has a device for extending an additional pipe of the third valve. There is no precise theoretical prediction of the given problem, so the correction of modeless sounds requires from the performer well-developed musical ear and knowledge of the specific features of their instrument. Conclusions. The summarized results of the presented article indicate that the organological aspect of the research in the field of performance on wind instruments, in particular, on the trumpet, is important and illustrative. It is an indispensable link that binds the theoretical and practical vectors of the study of trumpet art as a single set of knowledge; helps to identify the connection between the historical, organological and practical aspects of the performance on the trumpet, both past and present; promotes awareness of the specificity of playing a particular instrument, especially, understanding and assimilation of the design features of the trumpet in all its historical variants, and the corresponding principles of sound production with technical-acoustic and artistic effects; outlines the theoretical, scientific and methodological tasks for performers and composers whose work is related to the art of playing the trumpet. These are the directions in which further avenues for researching music related to the performance on the trumpet of different times, styles and genres can be seen.
37
Sills, Helen. "Time Remembered." KronoScope 5, no. 1 (2005): 59–72. http://dx.doi.org/10.1163/1568524054005168.
Full textAbstract:
AbstractThe human brain is capable of experiencing highly complex auditory imagery. Musicians find it valuable to mentally rehearse the auditory image of a piece of music, in the absence of the orchestra or instrument, to help perfect their actual physical performance of it. For this, the auditory image must first be founded on a perfect memory of all the work's musical aspects, and then 'lived- through  in a very finely-judged realisation of its movement in time, so that all its precision or expressive flexibility of tempo and qualities of meaning are fully released.<br /><br />Two neural processes shed light on the trained musician's ability to reproduce the duration of a mental rehearsal with great accuracy: the generation of firing patterns searching for pattern and symmetry, and the coherence behaviour of music processing units in the higher wave-bands. In the light of these two processes, I comment on the experience of mentally rehearsing 'Prélude á L'Aprés-midi d'un Faune', and 'Symphonies of Wind Instruments', and on the organising relationships which heighten the temporal aspects to produce a strong auditory form.
38
Ferrari, Marco, Makii Muthalib, and Valentina Quaresima. "The use of near-infrared spectroscopy in understanding skeletal muscle physiology: recent developments." Philosophical Transactions of the Royal Society A: Mathematical, Physical and Engineering Sciences 369, no. 1955 (November 28, 2011): 4577–90. http://dx.doi.org/10.1098/rsta.2011.0230.
Full textAbstract:
This article provides a snapshot of muscle near-infrared spectroscopy (NIRS) at the end of 2010 summarizing the recent literature, offering the present status and perspectives of the NIRS instrumentation and methods, describing the main NIRS studies on skeletal muscle physiology, posing open questions and outlining future directions. So far, different NIRS techniques (e.g. continuous-wave (CW) and spatially, time- and frequency-resolved spectroscopy) have been used for measuring muscle oxygenation during exercise. In the last four years, approximately 160 muscle NIRS articles have been published on different physiological aspects (primarily muscle oxygenation and haemodynamics) of several upper- and lower-limb muscle groups investigated by using mainly two-channel CW and spatially resolved spectroscopy commercial instruments. Unfortunately, in only 15 of these studies were the advantages of using multi-channel instruments exploited. There are still several open questions in the application of NIRS in muscle studies: (i) whether NIRS can be used in subjects with a large fat layer; (ii) the contribution of myoglobin desaturation to the NIRS signal during exercise; (iii) the effect of scattering changes during exercise; and (iv) the effect of changes in skin perfusion, particularly during prolonged exercise. Recommendations for instrumentation advancements and future muscle NIRS studies are provided.
39
Listiana, Nova, Dadi Setiadi, and Kusmiyati Kusmiyati. "Analysis of student responses to online learning in biology subjects at Senior High School of Central Lombok." Jurnal Pijar Mipa 17, no. 4 (July 30, 2022): 469–74. http://dx.doi.org/10.29303/jpm.v17i4.3388.
Full textAbstract:
The current Covid-19 pandemic has a significant impact on all aspects of human life, one of which is in the field of education. This study aims to determine how the senior high school students of North Batukliang central Lombok Indonesia respond to online learning in biology subjects. This research is qualitative descriptive research. The sampling technique in this research is saturated sampling. Meanwhile, the instruments used in this study were interviews and questionnaires. The study showed a positive response: the understanding indicator obtained a student response of 61%, and the independence indicator was 67%, which was included in the strong category. In the facility indicator, the student response value is 79% which is in a very strong category. The learning process still needs to be optimized and needs to be evaluated for the sake of improving online learning in the next period.
40
Irons, Rachel D., April Harding Scurr, Alexandra P. Rose, Julie C. Hagelin, Tricia Blake, and Daniel F. Doak. "Wind and rain are the primary climate factors driving changing phenology of an aerial insectivore." Proceedings of the Royal Society B: Biological Sciences 284, no. 1853 (April 26, 2017): 20170412. http://dx.doi.org/10.1098/rspb.2017.0412.
Full textAbstract:
While the ecological effects of climate change have been widely observed, most efforts to document these impacts in terrestrial systems have concentrated on the impacts of temperature. We used tree swallow ( Tachycineta bicolor ) nest observations from two widely separated sites in central Alaska to examine the aspects of climate affecting breeding phenology at the northern extent of this species' range. We found that two measures of breeding phenology, annual lay and hatch dates, are more strongly predicted by windiness and precipitation than by temperature. At our longest-monitored site, breeding phenology has advanced at nearly twice the rate seen in more southern populations, and these changes correspond to long-term declines in windiness. Overall, adverse spring climate conditions known to negatively impact foraging success of swallows (wet, windy weather) appear to influence breeding phenology more than variation in temperature. Separate analyses show that short windy periods significantly delay initiation of individual clutches within years. While past reviews have emphasized that increasing variability in climate conditions may create physiological and ecological challenges for natural populations, we find that long-term reductions in inclement weather corresponded to earlier reproduction in one of our study populations. To better predict climate change impacts, ecologists need to more carefully test effects of multiple climate variables, including some, like windiness, that may be of paramount importance to some species, but have rarely been considered as strong drivers of ecological responses to climate alteration.
41
Leeson, K. E., and J. B. Kirkpatrick. "Ecological and physiological explanations for the restriction of a Tasmanian species of Ozothamnus to a single population." Australian Journal of Botany 52, no. 1 (2004): 39. http://dx.doi.org/10.1071/bt03076.
Full textAbstract:
Vascular plant species that occur in only one population are surprisingly frequent, and not only on oceanic islands. The potential causes of this extreme restriction include the anthropogenic, the historic, the biological and the ecological. Ozothamnus reflexifolius, a one-population composite shrub occurs in an environment unaffected by human activity and is unlikely to be a neoendemic. It does occupy an environment of extreme aridity in a centre of local endemism, indicating a relict status. The species composition of the vegetation containing O. reflexifolius is distinct from the species composition of the surrounding forest. O. reflexifolius is fecund and has seeds with adaptations for potential wind dispersal to other rock plates, which are not in short supply in the vicinity. However, germination trials indicated that O. reflexifolius seeds have a short period of viability. Annual growth rings in the stems of the species are directly correlated with the number of sympodial branchings and shrub height. The age structure of the population implies continuous regeneration. The varying aspects of the large rock plate on which the distribution of O. reflexifolius is centred would prevent loss of the whole population in any fire, a common event in the area, whereas other rock plates in surrounding areas do not have this protection. The species may colonise, and then be destroyed by fire on surrounding rock plates, while being secure in its central population.
42
Madhvapathy, Surabhi R., Hany M. Arafa, Manish Patel, Joshua Winograd, Jessy Kong, Jason Zhu, Shuai Xu, and John A. Rogers. "Advanced thermal sensing techniques for characterizing the physical properties of skin." Applied Physics Reviews 9, no. 4 (December 2022): 041307. http://dx.doi.org/10.1063/5.0095157.
Full textAbstract:
Measurements of the thermal properties of the skin can serve as the basis for a noninvasive, quantitative characterization of dermatological health and physiological status. Applications range from the detection of subtle spatiotemporal changes in skin temperature associated with thermoregulatory processes, to the evaluation of depth-dependent compositional properties and hydration levels, to the assessment of various features of microvascular/macrovascular blood flow. Examples of recent advances for performing such measurements include thin, skin-interfaced systems that enable continuous, real-time monitoring of the intrinsic thermal properties of the skin beyond its superficial layers, with a path to reliable, inexpensive instruments that offer potential for widespread use as diagnostic tools in clinical settings or in the home. This paper reviews the foundational aspects of the latest thermal sensing techniques with applicability to the skin, summarizes the various devices that exploit these concepts, and provides an overview of specific areas of application in the context of skin health. A concluding section presents an outlook on the challenges and prospects for research in this field.
43
Ziyun, Li, Saipolbarin Ramli, Suo Yan Mei, Mohammad Taufiq Abdul Ghani, and Nazri Atoh. "READING SKILLS LEARNING PROBLEMS AMONG STUDENTS OF ARABIC COLLEGE TONGXIN NINGXIA CHINA." International Journal of Humanities, Philosophy and Language 3, no. 11 (September 10, 2020): 01–09. http://dx.doi.org/10.35631/ijhpl.311001.
Full textAbstract:
Reading skill proficiency is a pre-requisite for language teaching and learning (T&L) activities that students need to master. This is because by mastering the reading skill, one can understand the content of the reading text and enrich their vocabulary. However, the data showed that the students at Tongxin Arabic College of Ningxia in China were still facing the challenge to master the reading skill. This situation indirectly poses a barrier to achieving the objectives of T&L activities. Therefore, this study was conducted to obtain data related to the problems faced by students in mastering the reading skill in Arabic language T&L activities at Tongxin Arabic College. The instruments used in this study were questionnaires, observations, and interviews. The simple random sampling method used in this study involved 56 female students, 44 male students, 3 male teachers, and 9 female teachers. The data obtained were analysed using SPSS software. It was found from the findings of the study that there were five factors that had influenced the reading skill proficiency among students, namely physiological factors, self-motivation, effort, implementation strategies, and lack of vocabulary size. Apart from that, there were other additional factors that also influenced students' reading skill proficiency, which included poor grammar, passive engagement in the classroom, lack of exercise, lack of educational resources, and rewards for teachers. This study also proposes a number of appropriate measures to address this problem from the students’ aspects and the teachers’ aspects. From the students’ aspects, it is proposed that the reading resources are diversified such as the use of the electronic medium as an alternative reading medium. Whereas from the teachers’ aspects, it is proposed that the methodologies used in T&L activities are strengthened. It is hoped that this study will improve the level of reading skill proficiency among students in Tongxin Arabic.
44
Chen, Shisheng, Kuniaki Mihara, Nyuk Hien Wong, Jason Kai Wei Lee, and Chun Liang Tan. "A Semi-Automatic Data Management Framework for Studying Thermal Comfort, Cognitive Performance, Physiological Performance, and Environmental Parameters in Semi-Outdoor Spaces." Sustainability 15, no. 1 (December 22, 2022): 183. http://dx.doi.org/10.3390/su15010183.
Full textAbstract:
Semi-outdoor space can be used as an alternative to short-term office activities to save office energy consumption and promote a healthy and nature-based working environment. This study evaluated the suitability of semi-outdoor space in four aspects including environmental measurements, physiological measurements, subjective measurements and cognitive performance tests. However, the manual processing and analysis of such multidimensional data can be time-consuming and error-prone. Hence, the objective of this study was to develop a semi-automatic method to manage and analyze the data from different instruments and platforms and two open-source applications (a stroop color and word test and a digit span test) for cognitive performance tests. These codes were critical to the success of the project, providing an effective framework for data extraction, data pre-processing, data analysis and performance tests. Eighty-nine people participated in the experiment of evaluation of thermal comfort, cognitive performance, physiological performance and environmental parameters in semi-outdoor spaces in a tropical setting. Each participant received cognitive tests to assess their selective attention, short-term memory, concentration and creativity quotient. Concurrently, qualitative measurements were conducted to assess thermal sensation, thermal comfort and thermal acceptability. The heart rate, skin temperature, and skin conductance of participants were measured throughout the experiments. Microclimatic variables such as illuminance, noise levels, dry-bulb air temperature, global temperature, relative humidity, air speed, and air direction were monitored simultaneously. To understand the effects of semi-outdoor spaces on participant performance, this study recorded participant performance in different environments through controlled experiments. Data related to participants in different settings include those shared (e.g., environmental measurement), and data unique to each participant (e.g., physiological performance). The results revealed that the subjects’ cognitive and physiological performance did not change significantly after switching to the semi-outdoor space due to the availability of natural and mechanical ventilation, suggesting that short-term office activities in the semi-outdoor space are feasible in the tropics.
45
Carneiro, Rayonil G., and Gilberto Fisch. "Observational analysis of the daily cycle of the planetary boundary layer in the central Amazon during a non-El Niño year and El Niño year (GoAmazon project 2014/5)." Atmospheric Chemistry and Physics 20, no. 9 (May 12, 2020): 5547–58. http://dx.doi.org/10.5194/acp-20-5547-2020.
Full textAbstract:
Abstract. The Amazon biome contains more than half of the remaining tropical forests of the planet and has a strong impact on aspects of meteorology such as the planetary boundary layer (PBL). In this context, the objective of this study was to conduct observational evaluations of the daily cycle of the height of the PBL during its stable (night) and convective (day) phases from data that were measured and/or estimated using instruments such as a radiosonde, sodar, ceilometer, wind profiler, lidar and microwave radiometer installed in the central Amazon during 2014 (considered a typical year) and 2015 during which an intense El Niño–Southern Oscillation (ENSO) event predominated during the GoAmazon experiment. The results from the four intense observation periods (IOPs) show that during the day and night periods, independent of dry or rainy seasons, the ceilometer is the instrument that best describes the depth of the PBL when compared with in situ radiosonde measurements. Additionally, during the dry season in 2015, the ENSO substantially influenced the growth phase of the PBL, with a 15 % increase in the rate compared to the same period in 2014.
46
Mills, T., K. Morgan, L. Parsons, and A. Wheaton. "Measurement and Calculation of Total Plant Water Use of Citrus." HortScience 33, no. 3 (June 1998): 490d—490. http://dx.doi.org/10.21273/hortsci.33.3.490d.
Full textAbstract:
This preliminary study serves to parameterize a modified Penman–Monteith equation for young citrus trees. Two-year-old citrus trees (`Hamlin' grafted on Carrizo citrange) were planted individually into 1500-L (1.5-m-diameter) plastic pots in late Oct. 1997. Pots were placed upon industrial scales with a maximum weight capacity of 2270 ± 0.05 kg. Continuous weight measurements were made every minute and average half-hourly values recorded. An automated weather station was located within 10 m of the pots and half hourly values of temperature, humidity, wind speed, rainfall, and net radiation were recorded. Meteorological data, coupled with diurnal measurements of stomatal conductance taken periodically throughout the experimental period and leaf area for each tree allow calcuatiion of total plant water use using a modified Penman–Monteith equation. These calculation may be cross-checked using weight change measurements. Such model parameterization for citrus will aid irrigation management of citrus in the field as it provides a link between the physiological and meteorological aspects which drive plant water use.
47
Elnabawi, Mohamed H., and Neveen Hamza. "Outdoor Thermal Comfort: Coupling Microclimatic Parameters with Subjective Thermal Assessment to Design Urban Performative Spaces." Buildings 10, no. 12 (December 11, 2020): 238. http://dx.doi.org/10.3390/buildings10120238.
Full textAbstract:
Thermal comfort plays a main role in encouraging people to use outdoor spaces, specifically in hot arid and humid climates. The reconciliation of climatic aspects during the urban design phase is limited in implementation, due to the need for multidisciplinary collaboration between desperate scientific fields of climatology, urban planning, and urban environmental modelling. This paper aims to create an integrated interface between the microclimate, outdoor thermal comfort, and design guidelines. The investigation combines subjective and objective approaches, including on-site field measurements, a structured questionnaire using the seven-point American Society of Heating, Refrigerating and Air-Conditioning Engineers (ASHRAE 55) thermal sensation votes, and a correlation study of these votes and the microclimatic parameters. Pedestrian thermal comfort was then examined under six shading scenarios, addressing the form and opening of shading devices using computational fluid dynamics. Modelling is based on four dependent variables: wind velocity, ventilation flow rate, air temperature, and the physiological equivalent temperature (PET) index. Findings indicate that the form and location of apertures of the shading devices were the dominant factors in achieving thermal comfort on the urban scale, and led to a reduction in air temperature and a physiological equivalent temperature of 2.3–2.4 °C. Subjective votes indicate that people who live in hot arid climates have a wider range of adaptation and tolerance to local climatic conditions Accordingly, a psychometric chart, for the case study outdoor thermal comfort was developed.
48
Shestakova, Anna, Felipe Lorenzo, Tsewang Tashi, Lucie Lanikova, Carl T. Wittwer, and Josef T. Prchal. "Tibetan PHD2D4E High Altitude Adapted Gene Can be Rapidly Detected By High Resolution Melting Assay." Blood 124, no. 21 (December 6, 2014): 4875. http://dx.doi.org/10.1182/blood.v124.21.4875.4875.
Full textAbstract:
Abstract High altitude is accompanied by hypoxia. Acute and chronic hypoxia induces a number of compensatory physiological responses mediated by hypoxia-inducible factors (HIFs) that regulate erythropoiesis, iron and energy metabolism, and other essential organismal responses. Excessive HIF responses occurring at high altitude may be accompanied by morbidity (polycythemia and pulmonary hypertension) or mortality (brain and pulmonary edema). HIFs are down regulated by two principal factors, i.e. prolyl hydroxylases (PHDs) and von Hippel Lindau proteins (VHL). Tibetans have lived at 3,000-5,000 meters for approximately 20,000 years and have acquired a number of beneficial genetic adaptations which appear to prevent negative responses to hypoxia at high-altitude. Deciphering these genetic changes is crucial to improve our understanding of the underlying hypoxia-mediated response mechanisms and to develop targeted therapies. We recently identified the first Tibetan-specific mutation, PHD2D4E, caused by a missense mutation (rs186996510) in EGLN1. PHD2D4E has an allelic frequency of ~85% in Tibetans and a low Km for oxygen, accounting for the protection of Tibetans from high-altitude polycythemia. Other effects of PHD2D4E on HIF-regulated pathophysiology remain to be delineated. A 77% GC-rich area surrounds rs186996510, resulting in a low success rate of detecting the mutation by Sanger sequencing or next-generation sequencing. PHD2D4E was unreported in published whole-genome analyses of Tibetans (Xin Yi et. al. Science 2010). Here we describe a high-resolution melting assay of a small PCR product for targeted genotyping of rs186996510. The single base-pair change (G to C) is visualized by melting small amplicons in the presence of a fluorescent DNA-binding dye. Heterozygotes are differentiated from homozygous genotypes by a pronounced change in the shape of the melting curve caused by the formation of heteroduplexes. However, wild type and homozygous variants are difficult to distinguish by melting alone, and require an additional step of a second melting analysis after mixing with known wild type DNA. Upon melting these mixtures, homozygotes appear as heterozygous melting curves, while wild type genotypes will remain wild type (Figure 1). We developed and validated a high resolution melting assay for rapid genotyping of PHD2D4E suitable for population and disease association studies. In our ongoing analyses, we genotyped DNA from over 300 Tibetans residing at sea level, 1300 meters, 1730-2300 meters and 4320 meters, and are correlating the allelic frequency of PHD2D4E with hematocrit levels. The high resolution melting assay for genotyping PHD2D4E is a simple, accurate, rapid, and inexpensive approach to identify SNP-targeted mutations, especially suitable for a large number of samples such as needed for population studies, without the expense and time required for sequencing studies. Figure 1. High resolution melting analysis of rs186996510 using a 48-base a pair PCR product amplified with primers Forward 5Õ AACGCTCTCACGCCGCCATGGCCAATGA 3Õ and Reverse 5Õ GCCGGGCCCGCCGCT 3Õ. Rapid-cycle PCR amplification and melting analysis were performed in a LS32 real-time instrument. Amplicons from homozygous, heterozygous and wild-type genotypes, and a mixture of wild-type and homozygous products were melted in the presence of a saturating DNA dye (LCGreen). High resolution melting curves and derivative plot are shown. Heterozygotes, or mixed wild type and homozygous variant produce a large change in the shape of the melting curve (red) in comparison to wild-type and homozygous variant (black). Figure 1. High resolution melting analysis of rs186996510 using a 48-base a pair PCR product amplified with primers Forward 5Õ AACGCTCTCACGCCGCCATGGCCAATGA 3Õ and Reverse 5Õ GCCGGGCCCGCCGCT 3Õ. Rapid-cycle PCR amplification and melting analysis were performed in a LS32 real-time instrument. Amplicons from homozygous, heterozygous and wild-type genotypes, and a mixture of wild-type and homozygous products were melted in the presence of a saturating DNA dye (LCGreen). High resolution melting curves and derivative plot are shown. Heterozygotes, or mixed wild type and homozygous variant produce a large change in the shape of the melting curve (red) in comparison to wild-type and homozygous variant (black). Disclosures Wittwer: BioFire Diagnostics: Aspects of melting analysis Patents & Royalties, Membership on an entity's Board of Directors or advisory committees, Research Funding.
49
Lopushanskaya, Anna-Mariia Sergeevna. "On the problem of vocal and instrumental breathing in music." PHILHARMONICA. International Music Journal, no. 1 (January 2022): 13–18. http://dx.doi.org/10.7256/2453-613x.2022.1.34156.
Full textAbstract:
The object of the study is the actual process of breathing in performing practice. The subject of research in this article is the main approaches to the formation of a musician's performing breathing. The purpose of the undertaken research is to identify the specifics of the breathing of vocalists and performers on wind instruments, in particular, flautists. This will make it possible to create the necessary recommendations to improve the effectiveness of the educational process of wind instrument performers (in particular flutists). The methodology of the study was made up of complex and comparative approaches to the study of the problem posed. The methods of research of the problem posed were analysis, synthesis, methods of systematization and generalization. The novelty of the study is to identify common trends in the production of breathing for vocalists and instrumentalists. The main provisions of the work can be used in pedagogical practice, in the process of improving the methodology of performing breathing. The results of the undertaken research reveal the necessity of staging different types of breathing in vocalists and performers on the flute, the choice of which depends on the nature and content of the performed repertoire. Conclusions: both vocal and instrumental performance requires a conscious approach to the use of a particular type of breathing so that it is as natural as possible and does not lead to muscle clamps. Also, learning to work with breathing should not be limited exclusively to the aspects of proper inhalation or exhalation - no less important is the appropriate use of breathing in accordance with the style of the piece being performed.
50
Baumann, Florian. "Europe’s Way to Energy Security: The Outer Dimension of Energy Security: From Power Politics to Energy Governance." European Foreign Affairs Review 15, Issue 1 (February 1, 2010): 77–95. http://dx.doi.org/10.54648/eerr2010005.
Full textAbstract:
Abstract. European integration with its common markets for coal and nuclear fuels and, nowadays, ambitions of a comprehensive energy policy makes Europe one of the most interesting regions with regard to energy security. However, not only the European Union (EU) but also the International Atomic Energy Agency (IAEA) and the North Atlantic Treaty Organization (NATO) are or will be relevant actors in the global struggle for affordable, sustainable, and sufficient supplies of energy. All three have developed more or less distinctive instruments to secure their members access to energy. Nevertheless, there are three problems that prohibit the Europeans from being important players in global energy politics. First, the EU Member States do not have sufficient indigenous reserves of energy and thus are dependent on foreign suppliers. Second, Europe and its partners lack, as of yet, a comprehensive strategy for dealing with the external aspects of energy politics, including supply security as well as the political and economic challenges of import dependency and energy cut-offs. Third, only if inner-EU coherence can be established – and later on, regional and global energy governance – will the problem of energy security be resolvable. Finally, a coherent, internal EU position will be necessary to establish regional and global energy governance – the key to stabilizing future energy relations.