Journal articles on the topic 'WI 810'
To see the other types of publications on this topic, follow the link: WI 810.
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 50 journal articles for your research on the topic 'WI 810.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
Campbell, Tyler A., Benjamin R. Laseter, W. Mark Ford, Richard H. Odom, and Karl V. Miller. "Abiotic Factors Influencing Deer Browsing in West Virginia." Northern Journal of Applied Forestry 23, no. 1 (March 1, 2006): 20–26. http://dx.doi.org/10.1093/njaf/23.1.20.
Abstract:
Abstract We present a comparison of woody browse availability and white-tailed deer (Odocoileus virginianus) use among clearcut interiors, skidder trail edges, and mature forest and an evaluation of the relative importance of aboitic factors in predicting browsing pressure within regenerating clearcuts in the central Appalachians of West Virginia. We sampled 810 1-m2 plots in or adjacent to nine regenerating clearcuts (8–19 ha) during the summer of 2001. Availability and use of woody browse did not differ between clearcut interior and skidder trail plots for any species observed. Plots in the adjacent mature forest had less woody browse availability and higher utilization. Overall use of available woody browse in clearcuts was >15%. Combining all woody species, elevation (wI = 0.618) and distance to mature forest (wI = 0.379) were more important than landform index, plot surface shape, aspect, and slope in predicting deer browsing pressure in regenerating clearcuts. We believe that without management activities aimed at reducing deer browsing, in many parts of this region the ability of forest managers to regenerate stands will be jeopardized and the forested ecosystem will be compromised.
2
Hakim, M. L., T. Alam, M. H. Baharuddin, and M. T. Islam. "Frequency Integration of Dual-band Hexagonal Metamaterial Resonator antenna for Wi-Fi and 5G Wireless Communication." Journal of Physics: Conference Series 2250, no. 1 (April 1, 2022): 012001. http://dx.doi.org/10.1088/1742-6596/2250/1/012001.
Abstract:
Abstract The integration of 5G mm-wave and Wi-Fi frequency bands becomes significant for upcoming 5G wireless applications for providing a large frequency ratio. This work presents a frequency reconfigurable hexagonal metamaterial resonator (HMR) antenna for Wi-Fi and a 5G mm-wave frequency band. A PIN diode is utilized to link up a microstrip patch antenna (MPA) with HMR to achieve integration of the Wi-Fi frequency band. The resonant frequency of the proposed antenna is 5 GHz (Wi-Fi) and 27.87 GHz with peak gain 2.33 dB and 7.12 dB, respectively. The operating bandwidth of the proposed antenna is 800 MHz (4.5-5.3 GHz) and 1020 MHz (27.35-28.37 GHz). The rogers RT5880 substrate with thickness 0.508 mm, dielectric constant 2.2, and loss tangent 0.009 has been used for designing the antenna. The overall size of the antenna is 30×23×0.508 mm3.
3
Chen, Hongkai, Sirajum Munir, and Shan Lin. "RFCam." Proceedings of the ACM on Interactive, Mobile, Wearable and Ubiquitous Technologies 6, no. 2 (July 4, 2022): 1–29. http://dx.doi.org/10.1145/3534588.
Abstract:
As cameras and Wi-Fi access points are widely deployed in public places, new mobile applications and services can be developed by connecting live video analytics to the mobile Wi-Fi-enabled devices of the relevant users. To achieve this, a critical challenge is to identify the person who carries a device in the video with the mobile device's network ID, e.g., MAC address. To address this issue, we propose RFCam, a system for human identification with a fusion of Wi-Fi and camera data. RFCam uses a multi-antenna Wi-Fi radio to collect CSI of Wi-Fi packets sent by mobile devices, and a camera to monitor users in the area. With low sampling rate CSI data, RFCam derives heterogeneous embedding features on location, motion, and user activity for each device over time, and fuses them with visual user features generated from video analytics to find the best matches. To mitigate the impacts of multi-user environments on wireless sensing, we develop video-assisted learning models for different features and quantify their uncertainties, and incorporate them with video analytics to rank moments and features for robust and efficient fusion. RFCam is implemented and tested in indoor environments for over 800 minutes with 25 volunteers, and extensive evaluation results demonstrate that RFCam achieves real-time identification average accuracy of 97.01% in all experiments with up to ten users, significantly outperforming existing solutions.
4
Ancans, Guntis, Vjaceslavs Bobrovs, Arnis Ancans, and Evaldas Stankevicius. "Analysis on Interference Impact of Wi-Fi on Digital Terrestrial Television Broadcasting." International Journal of Interdisciplinary Telecommunications and Networking 8, no. 1 (January 2016): 35–44. http://dx.doi.org/10.4018/ijitn.2016010104.
Abstract:
Transition from Analogue Terrestrial Television Broadcasting to Digital Terrestrial Television Broadcasting (DTTB) in the 470-862 MHz band made available amount of spectrum so-called digital dividend for other services i.e. 790-862 MHz band (800 MHz) to mobile service. Recently the 694-790 MHz band (700 MHz) was also allocated to mobile service in ITU Region 1. Spectrum allocated to a broadcasting service but not used locally is called as TV white spaces (TVWS). It is possible to introduce TVWS services in 470-790 MHz band under the condition that other services in this band already operating, or planned in the country and in neighboring countries, are adequately protected and this use does not violate the current ITU Radio Regulations. TVWS under some conditions locally could be used for mobile communication systems e.g. unlicensed Wireless Fidelity (Wi-Fi) using cognitive radio. As TVWS are located in the UHF band, the use of TVWS can provide significantly better coverage and wall penetration inside buildings than 2.4 GHz and 5 GHz range Wi-Fi frequencies. The exact amount of available spectrum for TVWS at any location will be dependent upon each country national situation e.g. DTTB planning configuration, other services use in the band. In case of deploying Wi-Fi in the TVWS the interference impact of Wi-Fi on DTTB has to be taken into account. The aim of this paper is to analyze the interference impact of Wi-Fi on DTTB. In this paper the interference occurring probability in DTTB receiver was evaluated by using Spectrum Engineering Advanced Monte-Carlo Analysis Tool (SEAMCAT).
5
Shur, Pavel Z., Darya N. Lir, Vadim B. Alekseev, Anastasiya O. Barg, Ilia V. Vindokurov, and Ekaterina V. Khrushcheva. "Work intensity and work modification amid implementation of anti-epidemic activities." Hygiene and sanitation 102, no. 10 (November 20, 2023): 1069–77. http://dx.doi.org/10.47470/0016-9900-2023-102-10-1069-1077.
Abstract:
Introduction. Assessment of work intensity (WI) is challenged by several methodical complications. It may involve certain underestimation of an actual hazard category of working conditions and fails to consider work modification.
Materials and methods. The study relies on using analytical, sociological, and statistical methods. To test the selected approach, a sample was created from workers with mostly mental work (n=137, 77% females). Their average age was 43.9±8.0 years; average work experience was 14.5±3.7 years.
Results. In this article, we suggest certain approaches to assessing WI. They include self-assessment of a factor using a specifically designed questionnaire; they clarify indicators that describe WI; when assessing working conditions, they rely on matrices of interrelated indicators. This procedure makes it possible to estimate levels of individual components and create an integral WI profile as well as identify contributions made by various intensity types to its overall structure. When testing the procedure, we established workers with mostly mental work to tend to have harmful working conditions as per WI factor (the hazard category 3.1 in 24.8% of the cases; 3.2, 56.9% of the cases; and the hazard category 3.3 in 17.5% of the cases). Mental (28.6±6.1%) and sensory (24.0±7.0%) loads are limiting components. Amid implementation of anti-epidemic activities, work regime was established as the most sensitive WI component (its contribution grew from 11.1±6.0 to 16.0±5.7%, p<0.05). Working conditions moved to a higher hazard category for 35.8% workers.
Limitations. Assessment of working conditions uses threshold values introduced more than 30 years ago and can be adjusted for the existing employment conditions. The testing was accomplished on a rather small sample, which was biased as per gender and included workers with different occupations and positions.
Conclusion. The suggested approaches offer wider opportunities to assess working conditions as per WI with respect to some occupations. This may substantiate a list of indicators that should be regulated by the existing sanitary legislation. Investigation of possible modification of factors during the pandemic makes it possible to describe eligibility of anti-epidemic activities without any deterioration of working conditions.
6
Lee, Seungeun, So-Yeon Lee, Joon-Yong Jung, Yoonho Nam, Hyeon Jun Jeon, Chan-Kwon Jung, Seung-Han Shin, and Yang-Guk Chung. "Ensemble learning-based radiomics with multi-sequence magnetic resonance imaging for benign and malignant soft tissue tumor differentiation." PLOS ONE 18, no. 5 (May 31, 2023): e0286417. http://dx.doi.org/10.1371/journal.pone.0286417.
Abstract:
Many previous studies focused on differentiating between benign and malignant soft tissue tumors using radiomics model based on various magnetic resonance imaging (MRI) sequences, but it is still unclear how to set up the input radiomic features from multiple MRI sequences. Here, we evaluated two types of radiomics models generated using different feature incorporation strategies. In order to differentiate between benign and malignant soft tissue tumors (STTs), we compared the diagnostic performance of an ensemble of random forest (R) models with single-sequence MRI inputs to R models with pooled multi-sequence MRI inputs. One-hundred twenty-five STT patients with preoperative MRI were retrospectively included and consisted of training (n = 100) and test (n = 25) sets. MRI included T1-weighted (T1-WI), T2-weighted (T2-WI), contrast-enhanced (CE)-T1-WI, diffusion-weighted images (DWIs, b = 800 sec/mm2) and apparent diffusion coefficient (ADC) maps. After tumor segmentation on each sequence, 100 original radiomic features were extracted from each sequence image and divided into three-feature sets: T features from T1- and T2-WI, CE features from CE-T1-WI, and D features from DWI and ADC maps. Four radiomics models were built using Lasso and R with four combinations of three-feature sets as inputs: T features (R-T), T+CE features (R-C), T+D features (R-D), and T+CE+D features (R-A) (Type-1 model). An ensemble model was built by soft voting of five, single-sequence-based R models (Type-2 model). AUC, sensitivity, specificity, and accuracy of each model was calculated with five-fold cross validation. In Type-1 model, AUC, sensitivity, specificity, and accuracy were 0.752, 71.8%, 61.1%, and 67.2% in R-T; 0.756, 76.1%, 70.4%, and 73.6% in R-C; 0.750, 77.5%, 63.0%, and 71.2% in R-D; and 0.749, 74.6%, 61.1%, and 68.8% R-A models, respectively. AUC, sensitivity, specificity, and accuracy of Type-2 model were 0.774, 76.1%, 68.5%, and 72.8%. In conclusion, an ensemble method is beneficial to incorporate features from multi-sequence MRI and showed diagnostic robustness for differentiating malignant STTs.
7
Rubio, Leticia, Ramona Díaz-Vico, Inés Smith-Fernández, Aníbal Smith-Fernández, Juan Suárez, Stella Martin-de-las-Heras, and Ignacio Santos. "Spectrophotometric Color Measurement to Assess Temperature of Exposure in Cortical and Medullar Heated Human Bones: A Preliminary Study." Diagnostics 10, no. 11 (November 20, 2020): 979. http://dx.doi.org/10.3390/diagnostics10110979.
Abstract:
Heated-bone color changes may provide information about temperature of exposure, with interest for anthropologists and forensic experts. The aim of this study was to assess heat-induced color changes by spectrophotometry in cortical and medullar human bones heated at different temperatures and times. CIELAB (International Commission on Illumination-LAB) color parameters (L*, a*, and b*) and whiteness (WI) and yellowness (YI) indexes were obtained by spectrophotometry in the cortical and medullar zones of 36 bone sections exposed at 200, 400, 600, and 800 °C for 30 and 60 min. The accuracy of color-based temperature estimations was evaluated by Receiver Operating Characteristics (ROC) analysis. Chromaticity a* showed the best significant discrimination power with the area under the ROC curve (AUC) values ranged from 0.9 to 1.0 in cortical zones and 0.7 to 1.0 in medullar zones for all temperatures of exposures and both time of exposures. Chromaticity b*, and WI and YI indexes showed an AUC of 1.0 at 400, 600, and 800 °C for 30 and 60 min in the cortical and medullar zones. The spectrophotometric color parameters provided a highly accurate estimation of the temperature of exposure to discriminate between temperatures and exposure times in the cortical and medullar zones. Spectrophotometric bone color measurement in cortical and medullar zones can be an objective and reproducible method to estimate the temperature of exposition, and it can be considered useful for forensic and anthropological purposes.
8
Bhawiyuga, A., R. A. Sabriansyah, W. Yahya, and R. E. Putra. "A Wi-Fi based Electronic Road Sign for Enhancing the Awareness of Vehicle Driver." Journal of Physics: Conference Series 801 (January 2017): 012085. http://dx.doi.org/10.1088/1742-6596/801/1/012085.
9
Sulistiyadi, Akhmad Haris, Ari Suwondo, and Sugiyanto Sugiyanto. "Optimalisasi Informasi Citra T1 W1 Post-Contrast Dengan Fat Saturation dan Pengaturan Time Repetition: Studi pada Pemeriksaan Magnetic Resonance Imaging Brain dengan Kasus Tumor." Jurnal Imejing Diagnostik (JImeD) 1, no. 1 (July 2, 2015): 36–43. http://dx.doi.org/10.31983/jimed.v1i1.3149.
Abstract:
Background: Fat saturation is an alternative technique to improve image information in T1 WI post contrast MRI of brain tumor. It can increase lesion conspituity by suppressing normal tissue’s signal. To optimize image information by using fat saturation, selection of Fat Saturation type and Time Repetition (TR) value are important.Objectives: to analyze the differences in T1 WI post-contrast image information in MRI of brain tumor in various type of Fat Saturation and TR value.Methods: Experimental study with factorial design conducted in Telogorejo Hospital-Semarang. Nine combinations (9 groups) of three Fat Saturation types (none, weak, and strong) by three TR values (700 ms, 750 ms, and 800 ms) were given to 12 patients of MRI brain tumor. Image informations were assessed by measuring SNR (white matter, gray matter, lesions, surrounding tissue), CNR (white matter- gray matter, white matter-CSF, gray matter-CSF, lesion- surrounding tissue), lesion conspituity, artifacts, and contrast image in general.Results: The results showed that there were significant differences in SNR of white matter, gray matter, and in surrounding tissue (p 0.05); CNR of white matter-CSF, gray matter-CSF, lesion-tissue surrounding tissue (p 0.05); and lesion conspituity (p 0.05) between groups with no sat fat, weak fat sat, and strong fat sat. There were significant differences in SNR of white matter, gray matter, and surrounding tissue (p 0.05); and CNR of white matter-CSF, gray matter-CSF, and lesion- surrounding tissue (p 0.05) between group TR 700 ms, TR 750 ms, and TR 800 ms.Conclusion: Combination of strong fat saturation and TR 700 ms can produce the most optimal image information.
10
Dzierzbicka-Glowacka, L., A. Lemieszek, M. Kalarus, and I. M. Żmijewska. "Modelling the population dynamics of <i>Temora longicornis</i> in the Basin Gdańsk (southern Baltic Sea)." Biogeosciences Discussions 10, no. 7 (July 22, 2013): 12347–84. http://dx.doi.org/10.5194/bgd-10-12347-2013.
Abstract:
Abstract. The ecosystem model 3-D CEMBS connected with the population model, described in this paper, was used to determine the temporal distributions of T. longicornis in the Gdańsk Basin (the southern Baltic Sea) divided into the coastal zone P2 (the Gulf of Gdańsk) and the open sea P1 (Gdańsk Deep). The population model for T. longicornis consists of twelve equations for twelve states of variables, six for the mass Wi and six for the abundance Zi, i.e. two states of variables Wi and Zi, for each of the six model stages of the development; the stages were grouped as follows: eggs – Egg, stages not taking food – NI–NII, subsequent stages of nauplii – NIII–NVI, two copepodid stages – CI–CIII and CIV–CV and the last stage of adult organisms – CVI. Seasonal dynamics of T. longicornis is described by average changes in the total biomass as a sum of biomass of the examined ontogenesis stages, which are the sum of the products of the mass Wi and the abundance Zi of individual organisms at a given stage. The empirical verification of the population model based on in situ data obtained from the analysis of biological material collected in 2010–2011 in the region of Gdańsk Deep (P1) and in the western part of Gdańsk Bay (P2), and in 2006–2007 – only in Gdańsk Bay (P2). The highest values of the modelled T. longicornis biomass occurred in the period of high temperatures, i.e. in summer, in June 2010 and July 2011 in the Bay of Gdańsk – at station P2, and between late June and early July, and for almost the whole summer in Gdańsk Deep – at station P1, and amounted to respectively ca. 5200 mgw.w. m–2 and 6300 mgw.w. m–2 at station P2 and 24 500 mgw.w. m–2 and 27 800 mgw.w. m–2 at station P1. In 2006 and 2007 at station P2 the highest numerical values were recorded between late July and early August, exactly at the same time as environmental data, and amounted to 4300 mgw.w. m–2 and 5800 mgw.w. m–2, respectively. The results determined from the model are 0.25–2 times higher compared to in situ data. The most similar values were obtained for 2007.
11
Bahaweres, R. B., S. Mokoginta, and M. Alaydrus. "Comparison of methods for localizing the source position of deauthentication attacks on WAP 802.11n using Chanalyzer and Wi-Spy 2.4x." Journal of Physics: Conference Series 801 (January 2017): 012056. http://dx.doi.org/10.1088/1742-6596/801/1/012056.
12
Zheng, Y., M. A. Terry, C. A. Danford, L. J. Ewing, S. M. Sereika, R. W. Goode, A. Mori, and L. E. Burke. "Experiences of Daily Weighing Among Successful Weight Loss Individuals During a 12-Month Weight Loss Study." Western Journal of Nursing Research 40, no. 4 (December 14, 2016): 462–80. http://dx.doi.org/10.1177/0193945916683399.
Abstract:
The purpose of the study was to describe participants’ experience of daily weighing and to explore factors influencing adherence to daily weighing among individuals who were successful in losing weight during a behavioral weight loss intervention. Participants completed a 12-month weight loss intervention study that included daily self-weighing using a Wi-Fi scale. Individuals were eligible to participate regardless of their frequency of self-weighing. The sample ( N = 30) was predominantly female (83.3%) and White (83.3%) with a mean age of 52.9 ± 8.0 years and mean body mass index of 33.8 ± 4.7 kg/m2. Five main themes emerged: reasons for daily weighing (e.g., feel motivated, being in control), reasons for not weighing daily (e.g., interruption of routine), factors that facilitated weighing, recommendations for others about daily weighing, and suggestions for future weight loss programs. Our results identified several positive aspects to daily self-weighing, which can be used to promote adherence to this important weight loss strategy.
13
M.Prameela and R.Selvi. "Water Filtering and Management System using IoT." EDXJL International Journal on Innovations and Advanced Research 01, no. 01 (2023): 32–40. http://dx.doi.org/10.59599/edxjl-ijiar.2022.1106.
Abstract:
Water scarcity is the lack of enough water (quantity) or the lack of access to safe water (quality). The problem of water scarcity is growing every day. Clean and safe drinking water is scarce. Current water purification methods such as reverse osmosis and vacuum distillation are energy intensive. High pressure (800 to 1180psi) is needed for water purification in these methods. A membrane of micro porous filtration has large pore size and rejects only a certain amount of solutes. The proposed work is to reveal the potential of nano materials in water and the aim for proper water distribution in the environment, as well as avoid the wastage of water like unexpected leak ageing and cross connection or illegal connections in pipelines which can also to check the contaminates of water using flow meters, temperature, TDS, Salinity, pH which interface with Wi-Fi module through the controller and it monitors water supply time
14
M.Prameela and R.Selvi. "Water Filtering and Management System using IoT." EDXJL International Journal on Innovations and Advanced Research 01, no. 02 (2023): 31–36. http://dx.doi.org/10.59599/edxjl-ijiar.2022.1204.
Abstract:
Water scarcity is the lack of enough water (quantity) or the lack of access to safe water (quality). The problem of water scarcity is growing every day. Clean and safe drinking water is scarce. Current water purification methods such as reverse osmosis and vacuum distillation are energy intensive. High pressure (800 to 1180psi) is needed for water purification in these methods. A membrane of micro porous filtration has large pore size and rejects only a certain amount of solutes. The proposed work is to reveal the potential of nano materials in water and the aim for proper water distribution in the environment, as well as avoid the wastage of water like unexpected leak ageing and cross connection or illegal connections in pipelines which can also to check the contaminates of water using flow meters, temperature, TDS, Salinity, pH which interface with Wi-Fi module through the controller and it monitors water supply time.
15
Barney, Abigail L., Arturo Macias Franco, Aghata Elins Moreira da Silva, Felipe Henrique De Moura, and Mozart Fonseca. "PSIX-14 The Influence of Previous Plane of Nutrition on Feedlot Performance, Water Intake and Carcass Characteristics of Beef Steers." Journal of Animal Science 100, Supplement_3 (September 21, 2022): 366–67. http://dx.doi.org/10.1093/jas/skac247.669.
Abstract:
Abstract The objective of this study was to evaluate how the background diet can affect the feedlot performance and carcass characteristics of finishing steers. Crossbred Angus steers (n = 24; 298.01 ± 10.17 kg) were fed either a low plane of nutrition (LP, n =12 ; triticale only, 91g/kg CP, 0.25Mcal/kg NEm, and 0.10Mcal/kg NEg) or adequate plane of nutrition (AP, n =12; 850g/kg alfalfa and 150g/kg beardless wheat, 126.2g/kg, 0.25Mcal/kg NEm, and 0.13 Mcal/kg NEg) during the background phase (85d). After this period, body weight (BW) of LP (362.81 kg ± 10.237) was less than the BW of AP (405.97kg ± 10.237). Animals were then transitioned to a finishing diet (800 g/kg whole corn and 200 g/kg alfalfa; 108 g/kg, 0.97Mcal/kg NEm, and 0.65 Mcal/kg NEg) and fed for 105d. Water intake (WI) and dry matter intake (DMI) were individually measured daily. Animals were then havested, and hot carcass weight (HCW) was obtained. Carcasses were chilled for 24 h, and qualified personnel measured longissimus dorsi area via direct grid reading between the 12th and 13th rib, USDA marbling score and yield grades. Differences amongst treatments were compared via orthogonal contrast using the GLIMMIX procedure of SAS (version 9.4). No differences were observed for WI, DMI, final BW and average daily gain among groups. Carcass characteristics such as HCW, yield grade, rib eye area, and dressing percentage were also similar between groups. On the other hand, animals previously on LP had a reducedr marbling score (421.11) than the AP treatment (493.21) (P = 0.0014). Therefore, even though the previous plane of nutrition did not affect intakes, performance, and carcass characteristics, the decreased amount of nutrients during the background decreased marbling of LP animals, which affects the final quality grade of the carcass as well as price per kg of carcass.
16
Gryz, Krzysztof. "6. Problematyka oceny w budynkach użyteczności publicznej oddziaływania na pracowników promieniowania elektromagnetycznego systemów radiokomunikacyjnych." Podstawy i Metody Oceny Środowiska Pracy 38, no. 4 (December 30, 2022): 99–109. http://dx.doi.org/10.54215/pimosp/6.114.2022.
Abstract:
Przedstawiono charakterystykę systemów radiokomunikacyjnych emitujących promieniowanie elektromagnetyczne (PR-EM) rozpoznane w budynkach użyteczności publicznej. Zaprezentowano wyniki badań PR-EM w budynkach użyteczność publicznej w środowisku miejskim, charakteryzującym się największym zagęszczeniem anten nadawczych oraz PR-EM o najbardziej złożonym widmie częstotliwości. Wykazano, że głównymi źródłami ekspozycji na PR-EM w budynkach są zewnętrzne stacje bazowe sieci telefonii mobilnej 4G/5G (pasma downlink: GSM 900 oraz LTE 800, 1800, 2100 i 2600) i naziemnych nadajników radiowo-telewizyjnych (FM i TV VHF i UHF), o ile są one zlokalizowane na terenie miasta, oraz wewnętrzne sieci lokalnej łączności między urządzeniami i dostępu do Internetu (Wi-Fi 2,4GHz i 5GHz). Wyniki badań wykazały, że w typowych warunkach lokalizacji zewnętrznych anten systemów radiokomunikacyjnych ekspozycja na PR-EM w budynkach użyteczności publicznej nie przekraczała dolnego limitu strefy pośredniej (ekspozycja pomijalna określona przez prawo pracy). W przypadku lokalizacji wewnątrz budynków źródeł PR-EM mogą one mieć najistotniejszy udział w profilu występującej tam ekspozycji. Zaprezentowano również kluczowe elementy postępowania podczas oceny i ograniczania PR-EM w budynkach użyteczności publicznej.
17
Gonçalves Licursi de Mello, Rafael, Anne Claire Lepage, and Xavier Begaud. "A Low-Profile, Triple-Band, and Wideband Antenna Using Dual-Band AMC." Sensors 23, no. 4 (February 8, 2023): 1920. http://dx.doi.org/10.3390/s23041920.
Abstract:
When a wideband antenna is backed by an artificial magnetic conductor (AMC) reflector, the bandwidth is reduced. With the optimization of the shape of the AMC it is possible to exhibit multiband behavior, but the problem becomes complex if the bands are also intended to be wide. In this study, a methodology that exploits both the expected in-band and out-of-band behaviors of a dual-band AMC was used to design a low-profile, triple-band, and wideband directive antenna. The methodology was validated with a prototype suitable for the European standards of 4G/5G and Wi-Fi 2.4/5/6E, operating within the following bands: 2.4–2.7 GHz, 3.4–3.8 GHz, and 5.17–6.45 GHz. The measured results showed respective peak values of 8.0, 9.1, and 10.5 dBi for the broadside realized gain, front-to-back ratios larger than 19 dB, cross-polarized levels lower than -18 dB, and stable half-power beamwidths within each band. Furthermore, 3 dB gain bandwidths of 34.4%, 19.7%, and 31.0% were also measured.
18
Sitompul, Peberlin Parulian, Timbul Manik, Mario Batubara, and Bambang Suhandi. "Radio Frequency Interference Measurements for a Radio Astronomy Observatory Site in Indonesia." Aerospace 8, no. 2 (February 17, 2021): 51. http://dx.doi.org/10.3390/aerospace8020051.
Abstract:
We report on the measurements of radio frequency interference (RFI) at Mount Timau, Kupang, Indonesia, which is intended to host a future radio astronomy observatory. These measurements were taken twice in October 2020 and December 2020 to obtain the RFI environment, at frequencies between 70 and 7000 MHz. Due to the limitations of the measurement data, the results presented in this paper are based on peak detection rather than statistical analysis. Based on the measurement results, the frequency interval between 70–88 MHz and 120–150 MHz is relatively quiet, and the frequency range of 150–300 MHz is relatively clear. The frequency interval of 300 to 800 MHz is relatively quiet, except at the frequency of 600 MHz. The frequency range of 800–1400 MHz is also relatively quiet. The predominant terrestrial services in this band are at 840 MHz, with an amplitude around 32 dB, and 916 MHz, with an amplitude around 12 dB, and the global system for mobile (GSM) signals around 954 MHz have an amplitude around 20 dB above the noise floor. The frequency range of 1400–7000 MHz is also relatively quiet. In this band frequency, we can see RFI at 2145 and 2407 MHz, emitted by local Wi-Fi, and at 2683 MHz, with amplitudes of 18, 40 and 15 dB, respectively, from the noise level. We conclude that, for this period, the frequency band allocated for astronomy can possibly be used for radio telescope development.
19
García García, Samuel, Eduardo Alanís Rodríguez, Ernesto Rubio Camacho, Oscar Aguirre Calderón, José Israel Yerena Yamallel, Luis Gerardo Cuéllar Rodríguez, and Alejandro Chávez-Costa. "Distribución espacial de Pinus y Quercus en un gradiente altitudinal de bosque templado en Guadalupe y Calvo, Chihuahua." Revista Mexicana de Ciencias Forestales 15, no. 81 (January 24, 2024): 33–58. http://dx.doi.org/10.29298/rmcf.v15i81.1426.
Abstract:
El objetivo del estudio fue determinar los patrones de distribución espacial de las especies de Pinus y Quercus a lo largo de un gradiente altitudinal en un bosque templado del noroeste de México. Se analizó la uniformidad de los individuos (Wi), la mezcla de especies (Mi) y la dominancia dimensional (Ui) mediante parámetros estructurales basados en las relaciones con los cuatro vecinos más cercanos. Los datos se obtuvieron de 37 sitios de muestreo en tres niveles altitudinales (Nivel 1: 2 200-2 600 m, Nivel 2: 2 600-2 800 m y Nivel 3: 2 800-3 200 m), lo que generó un total de 979 grupos estructurales para todas las especies. Pinus contribuyó con 191, 51 y 41 grupos en los niveles 1, 2 y 3; mientras que Quercus aportó 192, uno y cero, respectivamente. Pinus evidenció tendencia hacia la aleatoriedad, y los encinos también en el Nivel 1, aunque en este análisis se observó que a mayor altitud Pinus tiende hacia una distribución regular. La mezcla de especies fue de media a alta para Pinus, lo cual indica que sus individuos están rodeados de árboles de especies diferentes, y con Quercus ocurrió al contrario. La dominancia dimensional reveló que los ejemplares de Pinus tienen mayor altura que los del género Quercus en todo el gradiente, especialmente en el Nivel 1. Este enfoque proporciona una comprensión exacta de la función que cumplen las especies en la dinámica de los ecosistemas forestales.
20
Huang, He, Jingyuan Li, Jianping Lan, Yanmin Zhao, and Xiaoyu Lai. "The Underlying Mechanism of Telomere Maintenance in Human Bone Marrow-Derived Mesenchymal Stem Cells." Blood 108, no. 11 (November 16, 2006): 4252. http://dx.doi.org/10.1182/blood.v108.11.4252.4252.
Abstract:
Abstract Objective: Human bone marrow-derived mesenchymal stem cells(MSCs) are thought to be promising tools in cell and gene therapy. Unfortunately, the low frequency of MSCs in bone marrow and rapid aging in in vitro expansion, which profoundly compromise their proliferative capacity, give rise to a huge hindrance for their clinical use. Previous study indicated that MSCs would undergo quick telomere shortening as well as reduced replicative capacity during in vitro expansion. These findings suggested that MSCs’ telomere loss might be associated with their decreased proliferative and differentiative potentials. However, the mechanisms by which MSCs maintain their telomere homeostasis have not yet been fully addressed to date. In the present study, we compared the telomere length, the distribution pattern of telomeric repeat binding factor 1(TRF1) between MSCs and other telomerase-positive cells or telomerase-negative cells, detected extrachromosomal telomeric repeat DNA (ECTR DNA) in MSCs and the variation of telomerase activity during cell cycle progression in order to unveil the mystery of telomere regulation in MSCs. METHODS: MSCs were isolated from healthy human bone marrow (n=34) by the plastic adherence protocols and identified by flow cytometry with markers of CD14, CD45, CD44, HLA-DR, CD34, CD29 and CD166. Telomere length and ECTR DNA were detected with Southern hybridization. The TRF1 distribution were probed with immunofluorescence staining. Telomeric repeat amplification protocol (TRAP ) and/or semi-quantitive Western blot assay were performed to determine the telomerase activity in MSCs, MSCs-derived adipocytes and telomerase levels during cell cycle progression. MSCs were synchronized by serum starvation and Aphidicolin treatment for the aforementioned assay. RESULTS: The mean telomere restriction fragment (mTRF) in MSCs was 8.0 kbp( range, 2.7 kbp-18.0 kbp), similar to telomerase-positive HeLa cells 6.0 kbp (range, 2.7 kbp-8.6 kbp) and 293T cells 5.0 kbp(range, 2.7 kbp-8.6 kbp); while the mTRF in telomerase-negative cells WI-38–2RA was 21.2 kb (range 2.0 kbp->21.2 kbp). The results indicated that telomere length in MSCs and HeLa cells were shorter and relatively more homogeneous than WI-38–2RA cells. TRF1 did not coincide with promyelocytic leukemia (PML) nuclear body in MSCs and HeLa cells while it exclusively did in WI-38–2RA cells. ECTR DNA was negative in MSCs and HeLa cells but positive in WI-38–2RA cells. Detected by TRAP, telomerase activity in MSCs(n=34) was negative with relative telomerase activity (RTA) of 1.44%±0.77%, but it was positive in MSCs-derived adipocytes (n=3) with RTA of 11.80±2.52%(P<0.001). Moreover, a cell cycle-dependent expression profile of telomerase was found in MSCs when they were synchronized by serum starvation and Aphidicolin treatment. Untreated MSCs expressed extremely low level of telomerase probed by Western blot with the 2C4 mAb, but the telomerase level had significantly increased when these cells were trapped in S phase. CONCLUSION: Since MSCs possessed similar features to telomerase-positive cells in telomere length, TRF1 localization pattern and ECTR DNA which were distinct from telomerase-negative ALT cells, and they had increased telomerase activity following differentiation into adipocytes and entrance into S phase, We postulated that the telomere in MSCs was maintained by telomerase pathway other than ALT pathway. The telomerase expression level of MSCs was tightly regulated with cell cycle progression.
21
Tetyannikov, N. V. "Evaluation of yield and stability of spring barley mutants of M5-M7 generations." Pomiculture and small fruits culture in Russia 76 (April 12, 2024): 27–38. http://dx.doi.org/10.31676/2073-4948-2024-76-27-38.
Abstract:
Yield is an important indicator when creating new varieties of crops. Seeking high and stable yields is considered essential in barley breeding. The stability of the studied genotypes was analyzed using various statistical indicators, namely, bᵢ, S²dᵢ, Wi2, σ2i, CV. The experiment was conducted to evaluate yield and stability of barley mutants of M5-M7 generations by parametric statistics. The experiment involved 40 mutants of spring barley belonging to the two-row subsp. distichon L. and six-row subsp. vulgare obtained after mutagenic treatment with phosphemide in two concentrations. The research was carried out in 2020‒2022 on the experimental plot of Federal Horticultural Center for Breeding, Agrotechnology and Nursery (Moscow region, Russia). Phenotypic manifestation of the considered traits and yield varied depending on the year of the experiment. Mutants G3, G5, G7, G16, G19, G20, G22, G23, G24, G27, G29, G33, G34, G40 were characterized by a statistically significant excess of control samples on the weight of 1000 grains. The yield of the studied mutants obtained from the Zernogradsky 813 sample was noted in the range of 282.0– 317.9 g/m2, Dz02-129 had 137.2–201.5 g/m2, C.I.10995 had 90.9–282.7 g/m2, a high variability of this trait was observed with the coefficient of variation equal to 71.02 – 152.42%. The highest value of pair correlation of yield was registered with grain weight per plant (r=0.370) and weight of 1000 grains (r=0.371). Strong conjugation was found between bi and CV (r=0.659); S²di and Wi 2 (r=0.885), σ2i (r=0.885); σ2i and Wi 2 (r=1.000). In addition, a close correlation of yield was noted with bᵢ (r=0.459), S²di (r=0.462), Wi2 (r=0.470), σ2 (r=0.470). Mutants G4, G28, G29 were characterized by relatively stable yields. The complex of economic traits combined with high yield potential was possessed by two-row G1, G2, G40 and multi-row G16, G23 to be recommended for use in the breeding process for high productivity.
22
Budin, Stephanie Lynn. "A. Glazebrook and M.M. Henry Eds.Greek Prostitutes in the Ancient Mediterranean: 800 BCE – 200 CE. Madison WI: University of Wisconsin Press, 2011. Pp. xi + 324, illus. £23.50. 9780299235642." Journal of Hellenic Studies 133 (2013): 221–22. http://dx.doi.org/10.1017/s0075426913000621.
23
Legey, Ângela Luiza Cunha, Aichely Rodrigues da Silva, Aline Daniela da Cruz e. Silva, Christiane Opuszka Machado, Sarina Giongo Antoniassi, and Doroteia Aparecida Höfelmann. "Desigualdades socioeconômicas e espaciais nas condições de acesso à internet por adolescentes de escolas estaduais." Research, Society and Development 10, no. 2 (February 18, 2021): e34410212703. http://dx.doi.org/10.33448/rsd-v10i2.12703.
Abstract:
Objetivou-se analisar condições de acesso à internet por adolescentes de escolas estaduais de Curitiba (PR), e identificar desigualdades de acordo com características demográficas dos alunos e renda do entorno escolar. Associações entre condições de acesso e renda investigadas por 1) modelos de regressão logística multinível para estimar as razões de chance (OR) e intervalos de confiança de 95% (IC95%); e 2) índices de Moran Global e local. Nas escolas 1.232 alunos preencheram o questionário. O dispositivo de acesso à internet mais frequente foi o celular (75,4%), seguido do computador (27,3%) e tablet (8,4%); 81,0% referiram acessar à internet no domicílio, 25,1% redes wi-fi; 77,2% relataram acesso diário, e 53,1% dispositivo próprio. As chances de acessar à internet pelo celular (OR 1,94 IC95%1,25; 3,01), diariamente (OR 3,37; IC95% 1,38; 8,20), e com dispositivos próprios (OR 1,81 IC95%1,00-3,27) aumentaram com a renda do entorno escolar, enquanto o uso do computador foi menor nos tercis de maior renda (OR 0,61 IC95% 0,41; 0,91). Observou-se correlação espacial inversa entre renda e uso do celular (-0,26) e tablet (-0,29), e positiva para computador (0,31) e uso diário da internet (0,30). Destaca-se desigualdades nas condições de acesso à internet com características dos alunos e renda.
24
Ndisya, John, Ayub Gitau, Duncan Mbuge, Arman Arefi, Liliana Bădulescu, Elke Pawelzik, Oliver Hensel, and Barbara Sturm. "Vis-NIR Hyperspectral Imaging for Online Quality Evaluation during Food Processing: A Case Study of Hot Air Drying of Purple-Speckled Cocoyam (Colocasia esculenta (L.) Schott)." Processes 9, no. 10 (October 11, 2021): 1804. http://dx.doi.org/10.3390/pr9101804.
Abstract:
In this study, hyperspectral imaging (HSI) and chemometrics were implemented to develop prediction models for moisture, colour, chemical and structural attributes of purple-speckled cocoyam slices subjected to hot-air drying. Since HSI systems are costly and computationally demanding, the selection of a narrow band of wavelengths can enable the utilisation of simpler multispectral systems. In this study, 19 optimal wavelengths in the spectral range 400–1700 nm were selected using PLS-BETA and PLS-VIP feature selection methods. Prediction models for the studied quality attributes were developed from the 19 wavelengths. Excellent prediction performance (RMSEP < 2.0, r2P > 0.90, RPDP > 3.5) was obtained for MC, RR, VS and aw. Good prediction performance (RMSEP < 8.0, r2P = 0.70–0.90, RPDP > 2.0) was obtained for PC, BI, CIELAB b*, chroma, TFC, TAA and hue angle. Additionally, PPA and WI were also predicted successfully. An assessment of the agreement between predictions from the non-invasive hyperspectral imaging technique and experimental results from the routine laboratory methods established the potential of the HSI technique to replace or be used interchangeably with laboratory measurements. Additionally, a comparison of full-spectrum model results and the reduced models demonstrated the potential replacement of HSI with simpler imaging systems.
25
Mohapatra, S., S. Das, J. R. Panda, S. Sahu, and S. Raghavan. "Dual band Orthogonal Polarized 2-port MIMO Antenna for Cognitive Radio Applications." Advanced Electromagnetics 13, no. 1 (January 28, 2024): 1–8. http://dx.doi.org/10.7716/aem.v13i1.2164.
Abstract:
An arrangement of orthogonally aligned antennas over two planes of a substrate is designed in this paper. The design is a novel miniaturized cognitive model operating at LTE, C-band and X-band with sufficient band stop notch. The antenna is etched over a 0.8 mm thick FR-4 Epoxy substrate of dimension 15 mm x 15 mm. On one side the antenna is a hexagonal slotted microstrip antenna and on the other side is a partial CPW type hexagonal patch antenna. The top hexagonal patch antenna is a wide band from 1800 MHz to 12000 MHz. With the use of a slot on the patch creates one notch from 2240 MHz to 5090 MHz and another notch is created at 6200 MHz to 8100 MHz. Thus, the working bands comprise of LTE 1900, Wi-Fi 5G and X-band under a single polarization. Similarly, the second antenna has its first resonance at LTE 1900 and the second resonance at X-band with a polarization orthogonal to the antenna at top. Being a miniaturized antenna, the cognitive radio provides gain ranging from 2.0 dB at lower frequency to 5.4 dB at higher frequency. The isolation over the operating bands suggests non-interference between the antennas.
26
Magamedov, S. S., B. М. Medvedeva, and M. G. Lapteva. "The Utility of Multiparametric MRI or Difffferentiating Adrenal Adenomas from Adrenal Metastases." Journal of oncology: diagnostic radiology and radiotherapy 5, no. 1 (March 16, 2022): 53–64. http://dx.doi.org/10.37174/2587-7593-2022-5-1-53-64.
Abstract:
Purpose: To evaluate the possibility of multiparametric MRI in the differential diagnosis of benign adrenal adenomas and adrenal metastases.Material and methods: In our study we evaluated 27 adenomas and 13 adrenal metastases using MRI in 35 patients who underwent examination and treatment at the basis of the N.N. Blokhin National Research Center of Oncology during the follow-up period from 2019 to 2021. The following parameters were evaluated: contours, homogeneity (homogeneous and heterogeneous), T2-weighted SI ratio (isointensive, moderately hyperintensive or sharply hyperintensive) relative to muscle and spleen, signal intensity (SI) decrease on chemical-shift MRI, measurement of the chemical-shift SI index, adrenal-to-spleen SI ratio, areas under the ROC curve (AUC) for contrast-enhanced MRI, absolute and relative percentage wash-out. Sensitivity, specificity, and positive and negative predictive values were calculated. DWI with b-values 400 and 800 s/mm2 and ADCs imaging were measured in adrenal lesions.Results: Metastases were subjectively more heterogeneous than adenomas (76.9 % vs 63 % of cases, p = 0.0181). Adenomas had higher T2-weighted SI (average value = 228; range from 91 to 732) than metastases (average value = 331; range from 114 to 581), both quantitatively (p = 0.0326) and subjectively by visual assessment (p = 0.0171).According to the T1-WI out-of-phase data, a more intense MR signal was observed in metastases (average value 162; range from 102 to 242) compared with adenomas (average value = 74; range from 17 to 183) (p < 0.0001), which was confirmed by normalization to muscle (p < 0.0001) and spleen (p = 0.0002). Adrenal metastases were characterized by a significantly lower chemical shift index (average value = 3.8; range from –16.4 to 47.8; p < 0.0001) compared with adenomas (average value 55.4; range from –4.2 to 85.5), and a higher chemical shift index in the ratio adrenal gland/spleen (p = 0.0079). There were no significant difference in the value of ADC-cards of adenomas and adrenal metastases. However, a higher level of SI on DWI at b = 800 s/ mm2 without normalization (p = 0.0262) and with normalization to muscle (p = 0.0064) and spleen (p = 0.0007) was evaluated in metastases, as well as on DWI at b = 400 s/mm2 with normalization for muscle (p = 0.0086) and spleen (p = 0.035). On native T1-WI FS, there was a lower level of SI revealed in adenomas compared to adrenal metastases (p = 0.0025), which was confirmed by normalization to the muscle (p = 0.0028) and spleen (p = 0.0035). In the venous and delayed phases of scanning the SI in adenomas was also lower than in metastases both without normalization (p = 0.0123 and p = 0.007, respectively), and with normalization to the muscle (p = 0.013 and p = 0.0011, respectively) and the spleen (p = 0.0084 and p = 0.0012, respectively). However, the SI in the arterial phase of scanning with and without normalization, the accumulation of MRCS in all phases of MRI scanning, the absolute and relative percentage wash-out of MRCS and the area under the MRCS accumulation curve in the groups had no statistically significant difference.
27
Ngurah Widyantara, I. Gusti, Latif Budi Suparma, and Imam Muthohar. "STABILITAS MARSHALL DAN KETAHANAN DEFORMASI WARM MIX ASPHALT MENGGUNAKAN ADITIF ZYCOTHERM." INERSIA: lNformasi dan Ekspose hasil Riset teknik SIpil dan Arsitektur 14, no. 1 (April 30, 2018): 48–61. http://dx.doi.org/10.21831/inersia.v14i1.19494.
Abstract:
ABSTRACTWarm Mix Asphalt (WMA) is produced at mixing temperatures between 20°C-40°C lower than Hot Mix Asphalt (HMA). Zycotherm added ingredients is one of the additives used in Warm Mix Asphalt. This study aims to assess Marshall stability and resistance to deformation by using asphalt type AC 60/70 ex Shell and Zycotherm additives on warm asphalt mixtures. In this study, the test was carried out on a layer of (AC-WC) to four mixed variations ie HMA-0, WMA-1, WMA-2, WMA-3 with 0% Zycotherm content; 0.10%; 0.15% and 0.20%. Mixed performance is measured by Marshall and Wheel Tracking Machine (WTM) testing. Based on the result of Gyropac test, with Workability Index (WI) value approach, the mixing temperature and compaction of WMA-1, WMA-2 and WMA-3 mixture are respectively obtained temperature 130/120°C, 130/120°C and 140/130° C. The Marshall test, the stability value of all mixtures fulfilled the minimum specification requirement of 800 kg, with the greatest stability value obtained from WMA-1 mixture of 1325 kg with additive content of 0.10%. The results of the Wheel Tracking Machine (WTM) test, a mixture that has resistance to deformation is a mixture of WMA-1 has the smallest deformation value of 1.93 mm, the largest dynamic stability of 1400 traje / mm and the smallest deformation velocity of 0.030 mm / min. That the use of Zycotherm is suitable for use in AC-WC warm mixture, with the optimum value of Zycotherm 0,10%. The use of excessive Zycotherm content results in a poor AC-WC warm mixture performance.Keywords: Dynamic Stability, Marshall, Warm Mix, Wheel Tracking Machine, Zycotherm. ABSTRAKWarm Mix Asphalt (WMA) diproduksi pada suhu pencampuran antara 20°C-40°C lebih rendah daripada Hot Mix Asphalt (HMA). Bahan tambah Zycotherm merupakan salah satu aditif yang digunakan dalam Warm Mix Asphalt. Kajian ini bertujuan untuk mengkaji stabilitas Marshall dan ketahanan terhadap deformasi dengan menggunakan bahan perekat aspal jenis AC 60/70 ex Shell dan aditif Zycotherm pada campuran aspal hangat. Pada kajian ini, pengujian dilakukan pada lapis aus (AC-WC) terhadap empat variasi campuran yaitu HMA-0, WMA-1, WMA-2, WMA-3 dengan kadar Zycotherm 0%; 0,10%; 0,15% dan 0,20%. Kinerja campuran diukur berdasarkan pengujian Marshall dan Wheel Tracking Machine (WTM). Berdasarkan hasil pengujian Gyropac, dengan pendekatan nilai Workability Index (WI) diperoleh suhu pencampuran dan pemadatan campuran WMA-1, WMA-2 dan WMA-3 secara berurutan diperoleh suhu 130/120°C, 130/120°C dan 140/130°C. Pengujian Marshall diperoleh nilai stabilitas semua campuran memenuhi ketentuan spesifikasi yaitu minimum 800 kg, dengan nilai stabilitas terbesar diperoleh dari campuran WMA-1 sebesar 1325 kg dengan kadar aditif 0,10%. Hasil pengujian Wheel Tracking Machine (WTM), campuran yang memiliki ketahanan terhadap deformasi adalah campuran WMA-1 memiliki nilai deformasi yang paling kecil sebesar 1,93 mm, stabilitas dinamis terbesar sebesar 1400 lintasan/mm dan kecepatan deformasi terkecil sebesar 0,030 mm/menit. Bahwa penggunaan Zycotherm cocok digunakan pada campuran hangat AC-WC, dengan nilai optimum penggunaan Zycotherm sebanyak 0,10%. Penggunaan kadar Zycotherm yang berlebihan menghasilkan performa campuran hangat AC-WC yang kurang baik.Kata kunci: Stabilitas Dinamis, Marshall, Warm Mix, Whell Tracking Machine, Zycotherm.
28
Huang, Lu, Baoguo Yu, Hongsheng Li, Heng Zhang, Shuang Li, Ruihui Zhu, and Yaning Li. "HPIPS: A High-Precision Indoor Pedestrian Positioning System Fusing WiFi-RTT, MEMS, and Map Information." Sensors 20, no. 23 (November 27, 2020): 6795. http://dx.doi.org/10.3390/s20236795.
Abstract:
In order to solve the problem of pedestrian positioning in the indoor environment, this paper proposes a high-precision indoor pedestrian positioning system (HPIPS) based on smart phones. First of all, in view of the non-line-of-sight and multipath problems faced by the radio-signal-based indoor positioning technology, a method of using deep convolutional neural networks to learn the nonlinear mapping relationship between indoor spatial position and Wi-Fi RTT (round-trip time) ranging information is proposed. When constructing the training dataset, a fingerprint grayscale image construction method combined with specific AP (Access Point) positions was designed, and the representative physical space features were extracted by multi-layer convolution for pedestrian position prediction. The proposed positioning model has higher positioning accuracy than traditional fingerprint-matching positioning algorithms. Then, aiming at the problem of large fluctuations and poor continuity of fingerprint positioning results, a particle filter algorithm with an adaptive update of state parameters is proposed. The algorithm effectively integrates microelectromechanical systems (MEMS) sensor information in the smart phone and the structured spatial environment information, improves the freedom and positioning accuracy of pedestrian positioning, and achieves sub-meter-level stable absolute pedestrian positioning. Finally, in a test environment of about 800 m2, through a large number of experiments, compared with the millimeter-level precision optical dynamic calibration system, 94.2% of the positioning error is better than 1 m, and the average positioning error is 0.41 m. The results show that the system can provide high-precision and high-reliability location services and has great application and promotion value.
29
Karpowicz, Jolanta. "Warunki koegzystencji ludzi z infrastrukturą elektromagnetycznych technologii radiokomunikacyjnych w wybranych mikrośrodowiskach." Podstawy i Metody Oceny Środowiska Pracy 40, no. 1 (March 29, 2024): 7–27. http://dx.doi.org/10.54215/pimosp/1.119.2024.
Abstract:
This is a study of how people coexisting with the infrastructure of electromagnetic mobile communication technologies emitting radio waves in the work and living environment: (i) in passenger trains, (ii) in shopping centres and (iii) in passenger cars. It revealed significantly different trends, over the last five years (2018-2023), in the structure of exposure to radio waves, with slight changes in the level of total exposure in analysed environments used by workers and the public. The observed changes are related to the spread of mobile access to fast data transfer and increased speed of transmission from personal devices (terminals such as smartphones or tablets). The results from shopping centres showed dominant downlink-components of exposure (from base stations) and a broadening of their frequency band (due to the spread of LTE subscription services using the 2100 and 2600 MHz bands) in 2023, along with reduced uplink-components (from terminals) and components related to local hotspots of non-subscription networks (Wi-Fi). A broadening of the frequency band was also observed in measurements from passenger trains, but with the dominant uplink-components of exposure, regardless of the availability of local hotspots. In passenger cars, exposure to external radio waves (downlink components) also broadened in the frequency band (in the LTE 800 and 2600 MHz bands). A reduction in exposure fluctuations over time was found in all the studied microenvironments. This implies that different measures are necessary to reduce workers’ exposure, along with different methods of identifying and assessing the parameters there.
30
Italiano, Cristina, Muhammad Arsalan Ashraf, Lidia Pino, Carmen Williana Moncada Quintero, Stefania Specchia, and Antonio Vita. "Rh/CeO2 Thin Catalytic Layer Deposition on Alumina Foams: Catalytic Performance and Controlling Regimes in Biogas Reforming Processes." Catalysts 8, no. 10 (October 11, 2018): 448. http://dx.doi.org/10.3390/catal8100448.
Abstract:
: The application of ceramic foams as structured catalyst supports is clearly expanding due to faster mass/heat transfer and higher contact efficiency than honeycomb monoliths and, mainly, packed beds. In this paper, alumina open-cell foams (OCFs) with different pore density (20, 30 and 40 ppi) were coated with Rh/CeO2 catalyst via a two steps synthesis method involving: (i) the solution combustion synthesis (SCS) to in-situ deposit the CeO2 carrier and (ii) the wet impregnation (WI) of the Rh active phase. The catalytic coatings were characterized in terms of morphology and adhesion properties by SEM/EDX analysis and ultrasounds test. Permeability and form coefficient were derived from pressure drop data. Catalytic performance was evaluated towards biogas Steam Reforming (SR) and Oxy-Steam Reforming (OSR) processes at atmospheric pressure by varying temperature (800–900 °C) and space velocity (35,000–140,000 NmL·g−1·h−1). Characteristics time analysis and dimensionless numbers were calculated to identify the controlling regime. Stability tests were performed for both SR and OSR over 200 h of time-on-stream (TOS) through consecutive start-up and shut-down cycles. As a result, homogenous, thin and high-resistance catalytic layers were in situ deposited on foam struts. All structured catalysts showed high activity, following the order 20 ppi < 30 ppi ≈ 40 ppi. External interphase (gas-solid) and external diffusion can be improved by reducing the pore diameter of the OCF structures. Anderson criterion revealed the absence of internal heat transfer resistances, as well as Damköhler and Weisz-Prater numbers excluded any internal mass transfer controlling regime, mainly due to thin coating thickness provided by the SCS method. Good stability was observed over 200 h of TOS for both SR and OSR processes.
31
Balzarolo, M., L. Vescovo, A. Hammerle, D. Gianelle, D. Papale, and G. Wohlfahrt. "On the relationship between ecosystem-scale hyperspectral reflectance and CO<sub>2</sub> exchange in European mountain grasslands." Biogeosciences Discussions 11, no. 7 (July 1, 2014): 10323–63. http://dx.doi.org/10.5194/bgd-11-10323-2014.
Abstract:
Abstract. In this paper we explore the use of hyperspectral reflectance measurements and vegetation indices (VIs) derived therefrom in estimating carbon dioxide (CO2) fluxes (net ecosystem exchange – NEE; gross primary production – GPP), and some key ecophysiological variables related to NEE and GPP (light use efficiency – ε; initial quantum yield – α; and GPP at saturating light – GPPmax) for grasslands. Hyperspectral reflectance data (400–1000 nm), CO2 fluxes and biophysical parameters were measured at three grassland sites located in European mountain regions. The relationships between CO2 fluxes, ecophysiological variables and VIs derived using all two-band combinations of wavelengths available from the whole hyperspectral data space were analysed. We found that hyperspectral VIs generally explained a large fraction of the variability in the investigated dependent variables and that they generally exhibited more skill in estimating midday and daily average GPP and NEE, as well as GPPmax, than α and ε. Relationships between VIs and CO2 fluxes and ecophysiological parameters were site-specific, likely due to differences in soils, vegetation parameters and environmental conditions. Chlorophyll and water content related VIs (e.g. CI, NPCI, WI), reflecting seasonal changes in biophysical parameters controlling the photosynthesis process, explained the largest fraction of variability in most of the dependent variables. A limitation of the hyperspectral sensors is that their cost is still high and the use laborious. At the eddy covariance with a limited budget and without technical support, we suggest to use at least dual or four channels low cost sensors in the the following spectral regions: 400–420 nm; 500–530 nm; 750–770 nm; 780–800 nm and 880–900 nm. In addition, our findings have major implications for up-scaling terrestrial CO2 fluxes to larger regions and for remote and proximal sensing sampling and analysis strategies and call for more cross-site synthesis studies linking ground-based spectral reflectance with ecosystem-scale CO2 fluxes.
32
Bourgoyne, Kesler, Langley Sampognaro, Anand Bhat, Juanita Valdes Camacho, Maroun Mhanna, and David Kaufman. "Health disparities in hymenoptera venom allergy management." Allergy and Asthma Proceedings 45, no. 1 (January 1, 2024): 50–52. http://dx.doi.org/10.2500/aap.2024.45.230071.
Abstract:
Background: Hymenoptera venom anaphylaxis (HVA) is reported in up to 3% of stings and accounts for approximately 40 US deaths annually. HVA patients require immediate availability of epinephrine and Allergist referrals for consideration of venom immunotherapy. Data regarding epinephrine autoinjector prescriptions, Allergist referral rates, and potential racial disparities are limited. Objective: The primary objective was to determine if there were statistically significant differences in epinephrine autoinjector prescriptions and Allergist referrals between white and African American patients. The secondary objectives were to determine if there were statistically significant differences between adult and pediatric patients and to determine if there were significant differences between epinephrine prescriptions between patients with and without Allergist referrals. Method: This study is a retrospective, descriptive chart review analyzing patients seen between January 01, 2019 and December 31, 2021. Data were obtained utilizing the Epic Systems (Verona, WI) application Slicer Dicer. Individual chart review was performed for age, race, epinephrine autoinjector prescription, and Allergist referral. Results: 342 patients were identified as having HVA. White patients (60 out of 219; 27.4%) were more likely to get epinephrine autoinjector prescriptions than African American patients (17 out of 109; 15.6%) (p = 0.018). Adult patients (25 out of 314; 8.0%) were less likely than pediatric patients (8 out of 28; 28.6%) to have Allergist referrals (p = 0.004). Patients with Allergist referrals (25 out of 32; 78.1%) were more likely to be prescribed an epinephrine autoinjector than patient without Allergist referrals (54 out of 310; 17.4%) (p < 0.00001). Conclusion: Epinephrine autoinjector prescriptions and Allergist referrals are low overall in HVA. Racial disparities were identified with African American patients being significantly less likely to receive epinephrine autoinjector prescriptions. Additionally, adult patients, who may be at increased risk, were less likely to receive Allergist referrals.
33
Hoogmoed, Marinus S. "Dixon, J.R., Soini, P. (1986): The reptiles of the upper Amazon basin, Iquitos region, Peru, I-VII. Milwaukee Public Museum, 800 W Wells St., Milwaukee, WI 53233, U.S.A. 154 pp, 41 figs., 3 tabs., price: U.S. $ 14.95." Amphibia-Reptilia 9, no. 3 (1988): 315–17. http://dx.doi.org/10.1163/156853888x00422.
34
Semenov, Andriy, Olena Semenova, Bogdan Pinaiev, Roman Kulias, and Oleksandr Shpylovyi. "Development of a flexible antenna-wristband for wearable wrist-worn infocommunication devices of the LTE standard." Technology audit and production reserves 3, no. 1(65) (June 30, 2022): 20–26. http://dx.doi.org/10.15587/2706-5448.2022.261718.
Abstract:
The object of research is the process of radiation of electromagnetic waves from a flexible antenna-wristband. The subject of research is the wave parameters and directional properties of a flexible antenna-wristband. The existing problem is that it is necessary to ensure the electromagnetic compatibility of the radio frequency units of the wrist-worn infocommunication device. This problem is due to the fact that LTE/NB-IoT, Bluetooth/Wi-Fi, and GPS antennas must be placed inside the small-sized case of the infocommunication device. To solve this problem, let’s propose a simple and cheap version of a broadband flexible bracelet antenna for LTE networks, located outside the device case. As a basis for the development of a flexible antenna-wristband, the authors chose a patch antenna, which is the base of the theory of microstrip antennas. This is due to the fact that the theoretical material is well developed for the calculation and study of the patch antenna. Structurally, a patch antenna consists of an upper metal layer that emits electromagnetic waves, a solid dielectric base, and a lower metal layer that acts as a reflector. With the classical approach to constructing a patch antenna, the width and length of its upper layer are commensurate, and its lower metal layer has geometric dimensions much larger than the upper metal layer. In contrast to the classical design, the authors proposed a new shape of the patch antenna, in which the length of the upper layer of the radiation surface is much greater than its width (5–6 times), and the lower metal layer has dimensions slightly larger than the dimensions of the upper layer. The authors have developed a flexible antenna-wristband for the frequency range of 800–1300 MHz with a wave impedance of 50 ohms, 118.7×23 mm of the upper metal layer, and 124.7×25 mm of the lower metal layer. The length of the microstrip feed line of the antenna is 54.6 mm, its width is 2 mm, and the length of the insert is 51.6 mm. The flexible antenna-wristband is connected to the printed circuit board of the infocommunication device by soldering or using a mini-coaxial cable. The authors developed an experimental layout of a flexible antenna-wristband and studied its wave and directional properties. It has been established that in the frequency range 800–1300 MHz the voltage standing wave ratio coefficient of this antenna does not exceed 3.5. The flexible antenna-wristband has directional properties, which allows reducing the level of electromagnetic radiation in the direction of the human body.
35
Scheer, Tanja S. "Prostitutes - (A.) Glazebrook, (M.M.) Henry (edd.) Greek Prostitutes in the Ancient Mediterranean 800 BCE – 200 CE. Pp. xii + 324, ills. Madison, WI and London: The University of Wisconsin Press, 2011. Paper, US$29.95. ISBN: 978-0-299-23564-2." Classical Review 62, no. 2 (September 12, 2012): 540–43. http://dx.doi.org/10.1017/s0009840x12000959.
36
Tarasova, I. V., N. V. Volf, D. S. Kupriyanova, O. A. Trubnikova, and O. L. Barbarash. "Changes in event-related synchronization/desynchronization of brain electric activity in cardiosurgical patients with postoperative cognitive dysfunction." Сибирский научный медицинский журнал 41, no. 2 (April 28, 2021): 12–20. http://dx.doi.org/10.18699/ssmj20210202.
Abstract:
Aim of the study was to analyze the event-related synchronization/desynchronization of brain electrical activity during visual selection task in patients underwent on-pump coronary artery bypass grafting (CABG) with and without postoperative cognitive dysfunction (POCD). Material and methods. The study included 32 men who underwent on-pump CABG, mean age 57.2 ± 6.08 years. All patients carried out extended neuropsychological testing, a multi-channel computer electroencephalography (EEG) 3-5 days before CABG and on the 7-10th day after the surgery. The POCD was determined according to the criterion: 20 % decrease in the cognitive indicator compared to that at baseline on 20 % of the tests included in the neuropsychological battery. Monopolar EEGs were recorded in 62 sites of 10-20 system with NEUVO encephalograph (Compumedics, USA) during cognitive task performing in patients wi h and without POCD. Statistical processing was performed using the STATISTICA 10.0. Results. It was found that the POCD patients had less pronounced theta desynchronization in the left frontal-central regions during the stage of 200-400 ms at the 7-10 days after CABG in comparison to patients without cognitive decline. Moreover, in the left parietal leads POCD patients had decreased theta desynchronization during the stage of 200-400 ms even before the surgery. At the 7-10 days after CABG, only the patients without POCD had a decrease of event-related theta activity in the left parietal leads compared with baseline. During the stage of 600-800 ms, the POCD patients had a lower degree of theta-desynchronization of both frontal-central and parietal regions of right hemisphere compared to patients without cognitive decline. Conclusion. The cognitive decline in patients after CABG determined according to neuropsychological testing is accompanied by pathological changes in the event-related theta activity. An analysis of event-related synchronization/desynchronization can be used both as predictor of postoperative cognitive impairment and as objective marker of POCD.
37
Chandel, V., V. Hallan, and A. A. Zaidi. "Natural Occurrence of a Potyvirus on Murraya koenigii in India." Plant Disease 89, no. 8 (August 2005): 909. http://dx.doi.org/10.1094/pd-89-0909a.
Abstract:
Murraya koenigii (L.) Spreng., a small, strong-smelling umbrageous tree with subcampanulate white flowers belonging to the family Rutaceae, is native to India and southeastern Asia (2). It is distributed across the Indian subcontinent excluding the higher elevations of the Himalayas. In India, the leaves are mainly used for culinary purposes. The leaves are commonly known as curry leaves or ‘sweet neem’. The whole plant including bark, root, leaves, fruits, and fruit pulp is used medicinally. This plant was reported to be a host of Citrus tristeza virus (1). In a survey of potyvirus incidence in the northwestern Himalaya foothills of the Kangra and Hamirpur districts in the state of Himachal Pradesh in 2004, M. koenigii plants showing mosaic symptoms on leaves, typical of a virus infection, were frequently observed. Symptomatic leaves were tested for the presence of several viruses using enzyme-linked immunosorbent assay with specific antibodies. Positive results were obtained with potyvirus group specific antibodies (Agdia, Elkhardt, IN) in triplicate analyses of 5 of 15 leaf samples tested. To further identify the infecting virus, RNA from plants was tested using universal potyvirus primer pair P9502 and CPUP (3) and reverse transcription-polymerase chain reaction to amplify a genome fragment encoding portions of the coat protein and the 3′UTR (3). An amplification product of the expected size (~800 bp) was obtained. The product was cloned into the pGem-T easy vector (Promega, Madison, WI), and three clones were sequenced. The sequence (GenBank Accession No. AJ852504) had 92% identity to Chili vein banding mottle virus, a potyvirus infecting pepper reported from Thailand (GenBank Accession No. U72193). To our knowledge, this is the first report of a potyvirus naturally occurring on a Murraya sp. References: (1) K. Balaram and K. Ramakrishnan. Curr. Sci. 48:453, 1979. (2) J. D. Hooker. Flora British India 1:502, 1875. (3) R. A. A. van der Vlugt et al. Phytopathology. 89:148, 1999.
38
Ling, K. S., and W. Zhang. "First Report of Pepino mosaic virus Infecting Tomato in Mexico." Plant Disease 95, no. 8 (August 2011): 1035. http://dx.doi.org/10.1094/pdis-04-11-0334.
Abstract:
Pepino mosaic virus (PepMV) (genus Potexvirus) was first reported in Europe to be infecting greenhouse tomatoes (Solanum lycopersicum) in 2000 (3). Subsequently, it has also been identified in Canada and the United States (1) and has become widespread on greenhouse tomatoes in many countries. In early spring of 2010, symptoms including chlorotic mosaic or chlorotic patches on leaves, necrotic stems, and fruit deformation or marbling were noted. Approximately 50% of plants in a greenhouse in Jocotitlan, Mexico exhibited symptoms. Twenty-three symptomatic samples in four separate collections between April 2010 and January 2011 all tested positive for the presence of PepMV by ELISA and/or Agristrips (BioReba, Switzerland). Two symptomless samples were negative for PepMV. Biological inoculation with the isolate MX10-05 to three Nicotiana benthamiana and three tomato cv. Horizon plants all resulted in chlorotic mosaic symptoms on the systemic leaves and PepMV on the inoculated plants was confirmed by ELISA. To determine the genotype of PepMV in MX10-05, two primer sets targeting different part of the virus genome (separated by 2,744 nt) were selected for reverse transcription (RT)-PCR using total plant RNA extracted with the RNeasy Plant Mini Kit (Qiagen, Valencia, CA). A RT-PCR product (840 bp) was obtained using the first primer set (PepMV-Ch2.F541: 5′CATGGAACCAGCTGATGTGA and PepMV-Ch2.R1380: 5′TCTTTGTATATGGTCGCAGC) targeting the 5′ portion of the RNA-dependent RNA polymerase (RdRp) gene. The PCR product was cloned in pCR2.1 using the TOPO TA cloning system (Invitrogen, Carlsbad, CA) and a single clone was sequenced in both directions (Functional Biosciences, Madison, WI). After primer trimming, the 800-bp sequence (GenBank Accession No. JF811600) was shown in BLASTn to have its highest nucleotide sequence identity (99.4%) to the type PepMV-CH2 (DQ000985), 98% to other CH2/US2 isolates, 85% to US1, and 84% to EU. Another RT-PCR product (also 840 bp) was generated using the second primer set (PepMV-Ch2.F4081: 5′AAAAACGCTGTACCCAAAAC and PepMV-Ch2.R4920: 5′CAGAAATGTGTTCAGAGGGG) targeting the 3′ portion of RdRp and TGB1 genes. This second genome segment enables the differentiation of the CH2 and US2 genotypes. The resulting 800 bp (JF811600) had the highest nucleotide sequence identity (99.5%) to the type PepMV CH2, 97% to other CH2 isolates, 83% to US2, and only 81% to the EU genotype. Taken together, these sequence analyses support the identification of MX10-05 as a PepMV-CH2 isolate (2). However, the presence of other PepMV genotypes cannot be excluded once sequences from other isolates are obtained and analyzed. To our knowledge, this is the first report of PepMV on greenhouse tomatoes in Mexico. References: (1). C. J. French et al. Plant Dis. 85:1121, 2001. (2). K.-S. Ling. Virus Genes 34:1, 2007. (3). R. A. A. van der Vlugt et al. Plant Dis. 84:103, 2000.
39
Abba, Sani, and Chinaka Ihechukwu Light. "IoT-Based Framework for Smart Waste Monitoring and Control System: A Case Study for Smart Cities." Engineering Proceedings 2, no. 1 (November 14, 2020): 90. http://dx.doi.org/10.3390/ecsa-7-08224.
Abstract:
Environmental sanitation is very essential for healthy living. In our daily livelihood, garbage bins are usually kept without proper monitoring until they are filled to the point of overflowing onto the surroundings and spilling out, resulting in environmental pollution, which has serious health-related issues to human beings and the environment. For smart cities, garbage bins need to be monitored and controlled to ensure a healthy and clean environment. In the present technological advancement, real-time monitoring and control of waste disposal is a challenging area that needs urgent attention by the research community. The traditional approach of monitoring waste in garbage bins placed in strategic locations is a very tedious and inefficient way that consumes time, human effort, and cost, and this is also not in agreement with smart city requirements. This research paper presents the design and implementation of an internet of things (IoT) based Arduino microcontroller working with the ultrasonic sensors that detects the level of waste in the garbage bin placed in garbage locations and constantly at regular intervals display the status information as “filled”, “half-filled”, or “empty” on an LCD screen, as well as send the content level information at those intervals to a central web-server system that displays the garbage bin levels graphically. This is achieved using a microcontroller, a Wi-Fi module, and ultrasonic sensors. The programming of the Arduino Uno microcontroller was done with an Arduino IDE and embedded C programming language. The communication with the web server was done using the hypertext preprocessor PHP scripting programming language. The prototype was designed and simulated using Proteus 8.0 professional simulation software. This process helps to automate garbage bin monitoring and control. Experimental results demonstrate a promising solution to waste management and control. A number of testing runs were performed to evaluate the device workability in real situations. The measured distances from the garbage bins were transmitted to a website; this web page performs analytic and visualization and displays a bar chart showing the levels of the garbage waste, time, and location in real time for viewing. The proposed prototype is an innovative system that will help to keep the smart cities clean and tidy using ultrasonic sensors.
40
Arun Kumar, N., M. Lakshmi Narasu, U. B. Zehr, and K. S. Ravi. "First Report of Tobacco streak virus Infecting Guizotia abyssinica from India." Plant Disease 91, no. 3 (March 2007): 330. http://dx.doi.org/10.1094/pdis-91-3-0330a.
Abstract:
Guizotia abyssinica (L.f.) Cass. (niger), an important oil seed crop grown in India, is used in foods, paints, soaps, and as an illuminant. During a survey conducted in 2004 to monitor Tobacco streak virus (TSV) in Helianthus annuus L. (sunflower) and Arachis hypogaea L. (groundnut), typical symptoms of leaf and petiole necrosis were observed in niger plants from Karnataka State, India. The field-collected samples reacted with TSV-specific polyclonal antiserum in direct antigen coated (DAC)-ELISA. Indicator host species were mechanically inoculated with extracts from symptomatic leaves and grown under greenhouse conditions. The inoculations resulted in local necrotic lesions on Vigna unguiculata cv. C-152 (cowpea), Gomphrena globosa, and Nicotiana tabacum cv. Xanthi (tobacco) at 3 to 4 days postinoculation (dpi) and systemic mosaic mottling on sunflower and G. globosa at 7 to 9 dpi. To identify the virus at the molecular level, total RNA was isolated (RNeasy kit, Qiagen Inc., Chatsworth, CA) from the virus-inoculated cowpea leaf and used for reverse transcription-PCR using TSV CP (coat protein) specific primers (2). The resulting ~720-bp amplicon corresponding to the CP gene of TSV was cloned into pGem-T vector (Promega, Madison, WI) and sequenced. The resulting sequence of the TSV-niger isolate (TSV-NG) comprised 717 nucleotides encoding 238 amino acid residues of the viral coat protein (GenBank Accession No. DQ864458). Comparison of the sequence with those of other TSV CP gene indicated 98.5 to 99.3% nucleotide and 97.9 to 99.6% amino acid sequence identity with TSV isolates from India (1,2; GenBank Accession Nos. AF505073, AY061930, AY061929, AF515823, AF515824, and AF515825). The sequence of TSV-NG had 89.5 and 80.0% amino acid identity with TSV-WC, type strain from the United States (GenBank Accession No. X00435) and TSV-BR, isolate from Brazil (GenBank Accession No. AY354406), respectively. On the basis of symptoms, transmission, and serological and molecular data, the causal agent of necrosis in niger was identified as a strain of TSV widely prevalent in other oil seed and vegetable crops in India. The new report of Tobacco streak virus infecting niger from India, indicated the expansion of host range among oil seed crops. References: (1) A. I. Bhat et al. Indian J Biotechnol. 1:350, 2002. (2) K. S. Ravi et al. Plant Pathol. 50:800, 2001.
41
Kopysov, A. N., and A. Yu Shaimov. "Determination of Packet Data Transmission Parameters when Working in the Meter Range." Intellekt. Sist. Proizv. 20, no. 2 (June 26, 2022): 128–37. http://dx.doi.org/10.22213/2410-9304-2022-2-128-137.
Abstract:
The article considers the possibility of organizing packet TCP/IP exchange in the channel of the frequency range from 30 to 300 MHz, as a basis for implementing a secure VPN connection between two subscribers within one of the communication network modes. The VPN connection, when considered, is a TCP/IP packet transmission, the only difference is that a new special header is attached to the original packet, as well as to the cryptographic encryption of the original packet. Hence, VPN tunnel can be represented as a TCP/IP connection. TCP/IP protocol stacks are oriented to support high-speed interfaces operating at high frequencies (for example, Ethernet/Wi-Fi, speeds from 100 Gb/s, 2.4 GHz frequency). The main problem of such a packet implementation at relatively low frequencies (30-300 MHz) is the sufficient instability of mobile MV radio communication (communication in the meter wave range) at a given frequency range and low transmission rate (up to 32 Kb/s), as a result of which there may be a high probability of data bit errors, loss of information packets and huge time delays in the exchange. The Reno model is used as a model for evaluating packet transmission [rec. ITU-T Y.1541, RFC2001] and such regulated indicators [rec. ITU-T 1.1540, ITU-T Y.1541], as: channel bandwidth, signal-to-noise ratio (SNR), transmission delay (IPTD), transmission delay variation (IPDV), transmission error rate (IPER), packet loss rate (IPLR, SER), maximum packet transport unit (MTU). The simulation of a low-speed communication line with the characteristics: length up to 5 km, transmission speed from 300 bits/s to 32,000 bits/s (V.21 - V.34bis modem protocols), the sizes of transmitted packets is 72, 576 and 1500 bytes (threshold values of the maximum unit of packet transportation), transmitter power 2 W, the signal-code construction is a 4-FSK signal with Reed-Muller encoding RM(30, 14). Based on the analysis of the data obtained, three categories of channels were identified: 'bad' - low signal-to-noise ratio (2-5 dB), high packet loss (above 10%) and long transmission delay (above 400 ms); 'medium' - SNR from 5 to 10 dB, packet loss less than 1%, the delay varies from 400 to 800 ms; 'good' is a channel passing through all regulated TCP/IP parameters, the OSH is more than 10 dB, the error probability is less than 0.1%, the delay fits into the regulated 400 ms.
42
Bashey, Asad, Xu Zhang, Lawrence Morris, Kent Holland, Lizamarie Bachier-Rodriguez, Melhem M. Solh, and Scott R. Solomon. "Impact of Allograft T-Cell (CD3) Dose on Outcomes When CD34 Cell Dose Is Capped: Analysis of 811 Consecutive Allogeneic PBSC Transplants from a Single Center." Blood 142, Supplement 1 (November 28, 2023): 2182. http://dx.doi.org/10.1182/blood-2023-180383.
Abstract:
G-CSF mobilized PBSC allografts contain higher T-cell doses than bone marrow grafts and have been associated with a significantly higher risk of chronic GVHD. Higher CD34+ cell content in PBSC grafts has also been shown to predict higher rates of chronic GVHD and associated mortality 1,2 To mitigate this risk our center adopted a policy of capping CD34+ cell dose at 5 x 10e6/kg recipient weight for unmanipulated PBSC grafts. For this study, we assessed the effect of T-cell (CD3) dose administered under this capped CD34 strategy, on GVHD and other transplant outcomes. Consecutive first PBSC allografts for hematologic malignancy performed using the CD34 cap strategy between 2010 and 2022 (n=811) were included in this analysis. GVHD prophylaxis was tacrolimus/methotrexate for MRD and MUD and post-transplant cyclophosphamide based for Haplo. Patients receiving anti-T cell serotherapy or ex-vivo T-depletion were excluded. GVHD was uniformly assessed and graded by a dedicated practitioner for all cases. Patient characteristics were: median age 55 (18-80); 57% male; race -white 74%, black 21%, Asian 5%; diagnosis AML 38%, ALL 18%, MDS 18%, NHL 10%; donor type haplo 42%, MRD 32%, MUD 26%, %; high/v. high 25%, low/intermediate 73%; HCT-CI (0-2) 43%, (>3)57%, regimen - myeloablative 48%, RIC 31%, NMA 21%). Median follow-up for survivors was 64 (16-151) months. Median CD34 and CD3 doses infused were 5.0 x 10e6/kg (min 1.59) and 17.3 x 10e7/kg (range 1.2-83.3) respectively. Median CD3 dose infused were higher with female donors (20.5 vs 15.5 x 10e7/kg, p<0.001) and older donors (18.6 vs 15.9 x 10e7 for donors aged >38 vs <38, p<0.001). The effect of Infused CD3 dose was assessed in terciles (ranges 1.2-13.5, 13.6-22, 22.1-83.3 x 10e7/kg). Median peripheral blood donor CD3 chimerism was 100% for all CD3 dose terciles at d 30, through 180 post-transplant. On univariate analysis - estimated 3-year survival, DFS, NRM, relapse and acute GVHD incidence were not significantly different between the low, middle and high CD3 terciles. In contrast, the cumulative incidence (CI) of moderate-to-severe chronic GVHD at 3 years was significantly higher in the highest vs lowest tercile (36.8% vs 28.6%, p=0.042) (Fig 1), while severe chronic GVHD (14.5% vs 13%) was not significantly different. On stratified Cox multivariable analysis comparing the highest to the lowest CD3 dose terciles - survival, DFS, NRM, relapse and acute GVHD were not significantly different. Moderate-to-severe chronic GVHD was significantly higher in the highest versus lowest tercile (HR 1.53, p=0.005). In order to address specific effects of CD3 dose for particular donor groups, we analyzed incidence of chronic GVHD by CD3 dose terciles separately for the three donor types (MRD n=258, MUD n=210 and Haplo n=343). Whereas the CI of moderate-to-severe chronic GVHD was not significantly different for lowest versus highest CD3 tercile in MRD and Haplo transplant recipients, it was significantly higher for MUD recipients (50% vs 26%, p=0.008, GRFS 29% vs 9%, p=0.005). On multivariable analysis, risk of moderate-to-severe chronic GVHD was significantly higher for the highest versus lowest CD3 dose terciles (HR 2.62, p=0.002) and for the middle vs lowest terciles (HR1.77, p=0.043) in MUD patients (Fig 1). In contrast, CD3 dose had no significant impact on chronic GVHD for MRD and Haplo recipients. This large retrospective analysis of PBSC allografts using a CD34 cap (<5 x 10e6/kg) shows that this approach produced infused CD3 doses ranging between 1.2 and 83.3 x 10e6 /kg. The median and upper limit of infused CD3 dose was lower than previously reported by studies with no CD34 cap 2,3. CD3 dose had a significant impact on the rate of moderate-to-severe chronic GVHD in MUD recipients. A prospective comparison of capped versus uncapped CD34 dosing may help determine the value of this strategy in mitigating GVHD risk of PBSC grafts. These data suggest the need for more aggressive GVHD prophylaxis in patients infused with higher CD3 doses in MUD patients. 1. Mohty M, Bilger K, Jourdan E, et al. Leukemia. 2003;17(5):869-875. 2. Zaucha JM, Gooley T, Bensinger WI, et al. Blood. 2001;98(12):3221-3227. 3. Saad A, Lamb L, Wang T, et al. Biol Blood Marrow Transplant. 2019;25(9):1875-1883.
43
Palhao, M. P., M. A. Beg, M. T. Rodrigues, R. R. Araújo, J. H. M. Viana, A. M. Borges, and O. J. Ginther. "219 FOLLICLE AND HORMONE DYNAMICS IN SINGLE- v. DOUBLE-OVULATING HEIFERS." Reproduction, Fertility and Development 22, no. 1 (2010): 267. http://dx.doi.org/10.1071/rdv22n1ab219.
Abstract:
The present experiment used the Day 4 ablation model for increasing the incidence of double ovulations in heifers. The objective was to compare follicle growth and plasma hormone concentrations associated with single v. double ovulations. Follicles ≥5 mm were ablated at 4 days post-ovulation to induce a prominent FSH surge and a new follicular wave, and 2 injections of PGF2 (12 h apart) were given 2 days later (Day 6) to favor ovulation. Beginning on Day 5, the 3 largest follicles of the induced wave were scanned twice a day until 36 h after the next ovulation. Blood samples were taken at 6-h intervals starting when the largest follicle reached ≥8.0 mm (expected deviation at 8.5 mm; Ginther et al. 1996) and continued until 36 h after the next ovulation. Concentrations of LH and FSH were measured by validated RIA for cattle (LH measured by Ginther et al. 1999; FSH measured by Adams et al. 1992) and concentrations of oestradiol measured by a commercially available RIA kit (Siddiqui et al. 2009). From a total of 31 heifers, 16 (52%) or 15 (48%) developed a single or more than 1 dominant (≥ 10 mm) follicle in the follicular wave after ablation, respectively. For heifers with 2 dominant follicles, the second-largest follicle ovulated in 9 (60%) heifers and the overall double ovulation rate was 29% (9/31). Follicle diameters and plasma hormone concentrations were compared between single ovulators (n = 12) and double ovulators (n = 8). Diameter of the preovulatory follicles did not increase between the LH peak and ovulation in either the single or double ovulations. In double ovulators, the interval from follicle deviation to the peak of the preovulatory LH surge was shorter (1.9 ± 0.2 days v. 2.5 ± 0.2 days; P < 0.02) and the diameter of the largest preovulatory follicle was smaller (12.2 ± 0.5 mm v. 13.3 ± 0.3 mm; P < 0.02) than in single ovulators, respectively. The LH concentrations of the preovulatory surge did not differ between single and double ovulators for 24 h on each side of the peak (main effect of hour only; P < 0.0001). When data were normalized to the LH peak, the peak of the preovulatory FSH and estradiol surges occurred in synchrony with the peak of LH surge for both groups. A group effect (P < 0.0001) for FSH resulted from a lower concentration averaged over hours in double ovulators. Estradiol showed a group by hour interaction (P < 0.008), reflecting greater concentrations in the double ovulators before and at peak. In conclusion, an increased Supported by the Eutheria Foundation, Cross Plains, WI, USA. Submission supported by FAPEMIG.
44
Verstegen, J., and A. Rozner. "87 OVARIAN RESERVE, EMBRYO PRODUCTION, AND THEIR CORRELATION WITH ANTI-MÜLLERIAN HORMONE (AMH) IN HOLSTEIN COWS." Reproduction, Fertility and Development 27, no. 1 (2015): 136. http://dx.doi.org/10.1071/rdv27n1ab87.
Abstract:
Anti-Müllerian hormone (AMH) is a small peptide hormone that has been associated with ovarian follicular reserve in humans and in some animal species including bovine. Profiles of AMH, as well as the relationship between serum AMH to oocyte number and in vivo embryo production, were evaluated in Holstein cows. AMH levels were determined in 15 unstimulated cows at monthly intervals for 4 months and in 394 male and 399 female developing Holstein animals from birth to adulthood. Also, AMH was measured in 41 heifers at the time of ovum pick-up (OPU) and 125 heifers at the time of embryo flushing. Superovulation was induced before OPU or embryo flushing using a modified Ovsynch protocol with 4 days of decreasing FSH (Pluset H®, MOFA Global, Verona, WI, USA). Blood samples were collected using serum tubes and spun within 2 h. The samples were stored at –20°C until evaluated for AMH using the AMH-Bovine specific immunoassay® (MOFA Global). AMH levels in males and females peaked at 2 months of age and then decrease as they reached adulthood. The average AMH level of adult cows was stable for each of the 4 monthly measurements, with a high correlation between all values per animal (r2 = 0.9077; P < 0.01), suggesting that AMH levels are consistent for at least 4 consecutive months. However, AMH levels were lowest during the summer months, suggesting a seasonal change in AMH secretion. Animals repeatedly ovarian stimulated showed decreasing AMH levels (509 ± 295, 299 ± 210, 211 ± 119) with subsequent stimulations. There was also a significant decrease in the number of embryos recovered (5.7 ± 4, 2.2 ± 1.9; P = 0.02); however, the number of oocytes was not altered by multiple stimulations (9.9 ± 9.8, 8.1 ± 6.2; P = 0.57). Because AMH and embryo numbers decreased after multiple stimulations, the first AMH value and results of the first OPU or embryo flush were used for the correlation of AMH to the number of oocytes or embryos. Animals were separated into 3 AMH categories: low (<100), normal (100–400), and high (>400 pg mL–1). High AMH OPU animals had significantly higher numbers of oocytes than the normal or low AMH groups (13.8 ± 9.2, 9.2 ± 5.3, 5.6 ± 3.9; P = 0.001). High AMH flushed animals had significantly higher numbers of embryos than animals with low AMH (10.9 ± 8.0, 5.7 ± 5; P = 0.002). Statistical analyses were performed using Statview 5. Differences were determined using Student's t-test; P < 0.05 was considered significant. In conclusion, AMH serum concentrations are consistent over multiple months; however, blood should not be taken for animal selection by AMH after ovarian stimulations have begun and should be interpreted with caution during the summer months. AMH is highly associated with superovulation response and oocyte and embryo production and should improve efficiency of multiple-ovulation embryo transfer.
45
Kameyama, Y., G. Shimoi, H. Ohnishi, R. Hashizume, and M. Ito. "104 ASYMMETRICAL DISTRIBUTION OF MITOCHONDRIAL DNA INTO BLASTOMERES OF TWO-AND FOUR-CELL MOUSE EMBRYOS." Reproduction, Fertility and Development 20, no. 1 (2008): 132. http://dx.doi.org/10.1071/rdv20n1ab104.
Abstract:
Mammalian embryos are thought to cleave equally during early development. Therefore, the contents including organelles such as mitochondria (mt) in oocytes are supposed to be delivered symmetrically into each blastomere of the resulting embryo. However, a recent report showed higher oxygen consumption, ATP production, and mt distribution in trophectoderms from mouse blastocysts than that in inner cell masses (Houghton 2006 Differentiation 74, 11–18). We hypothesized that this phenomenon could be preceded by the asymmetrical mt distribution into blastomeres at earlier stages. Oocytes, 2-cell embryos, and 4-cell embryos from BDF1 were measured to determine volumes, ATP contents, and mtDNA copy numbers in the whole egg and individual blastomeres that had been separated in Ca/Mg-free KSOM with added 0.02% EDTA. The volumes of blastomeres were calculated by the sphere volume formula. The ATP contents were determined using a luminometer and commercial kits (BacTiter-Glo, Promega, Madison, WI, USA). The mtDNA copy numbers were quantified absolutely using real-time PCR. The data was analyzed by 1-way ANOVA followed by Fisher's least significant difference test. We found about a 10% difference in volume between the largest and the smallest blastomeres from a 4-cell embryo. At the 4-cell stage, the largest blastomeres were significantly larger than the middle-sized and smallest blastomeres, and the next largest blastomeres were significantly larger than the smallest blastomeres (largest: 41 093 µm3, next largest: 39 671 µm3, middle-sized: 37 725 µm3, smallest: 36 518 µm3; n = 25). The procedure for separation of blastomeres did not significantly reduce theATP contents of embryos. We observed the same pattern of significant differences in theATP contents among the 4 blastomeres at the 4-cell stage (largest: 0.141 pmol, next largest: 0.124 pmol, middle-sized: 0.112 pmol, smallest: 0.098 pmol, n = 27). The largest blastomeres from 4-cell embryos contained about 1.4-fold higherATP than the smallest blastomeres. There was no significant difference in the mtDNA copy numbers in oocytes (n = 7), whole 2-cell embryos (n = 6), whole 4-cell embryos (n = 13), the sum of 2 blastomeres from the same 2-cell embryo (n = 6), and the sum of 4 blastomeres from the same 4-cell embryo (n = 6; 245 071 � 22 696, 267 567 � 30 989, 262 931 � 12 952, 239 717 � 16 813, 247 012 � 16 166, respectively; � SEM). However, the larger blastomere of 2-cell embryo had a higher mtDNA copy number than the smaller blastomeres (largest: 137 100 � 11 493, smallest: 102 617 � 6205; P < 0.05). The largest blastomeres of 4-cell embryo had about 1.4 times (P < 0.05) higher mtDNA copy numbers than the smallest blastomeres (largest: 72 072 � 4112, next largest: 66 198 � 5767, middle-sized: 57 596 � 3922, smallest: 51 146 � 3081). We found differences in volumes, ATP contents, and mtDNA copy numbers among blastomeres from the same embryos at the 4-cell stage. These qualitative differences could be related to embryonic metabolism in mouse early development.
46
Gamarra, G., A. Gallegos, E. Alvarado, M. Asparrin, and W. Vivanco. "159 TECHNIQUES FOR OVUM PICK-UP IN GONADOTROPIN-TREATED ALPACAS." Reproduction, Fertility and Development 20, no. 1 (2008): 159. http://dx.doi.org/10.1071/rdv20n1ab159.
Abstract:
The objective of the present study was to evaluate the quantity and quality of oocytes collected when using 2 methods for ovum pick-up and 2 different regimens for ovarian stimulation in live alpaca donors. Thirty-four non-pregnant female alpacas of 3 to 5 years of age maintained at 4100 m elevation in southern Peru were randomly distributed into 4 experimental groups. Groups 1 (n = 8) and 3 (n = 9) received an intravaginal device containing 0.78 mg of progesterone (Cue-Mate�, Bioniche Animal Health, Belleville, Ontario, Canada) plus an i.m. injection of 1 mg of estradiol benzoate on Day 0; the intravaginal device was removed on Day 7. Groups 2 (n = 7) and 4 (n = 10) received an i.m. injection of 3.1 mg of LH (Lutropin�, Bioniche Animal Health) on Day 0. Females received 700 IU of eCG (Pregnecol�, Bioniche Animal Health) i.m. on Day 7 (Groups 1 and 3) or Day 2 (Groups 2 and 4). In all groups, oocyte collection was done 2 days after the injection of eCG. Groups 1 and 2 were subjected to ventral laparotomy aspirating the oocytes from follicles >3 mm in diameter using a 10-mL hypodermic syringe containing 1 mL of aspiration media (Ringer's lactate solution plus 10% bovine serum) and connected to an 18 G � 1 inch aspiration needle. After collection, the follicular fluid was searched and the COC were graded. Groups 3 and 4 were subjected to ovum pick-up by transvaginal recovery using an ultrasound scanner (Parus 240�, Pie Medical, Maastricht, the Netherlands) equipped with a vaginal probe of 7.5 MHz (MEVA�, Pie Medical) and a 17G � 55 cm aspiration needle introduced through a needle guide. Follicles >3 mm in diameter were aspirated into 50-mL centrifuge tubes containing 5 mL of aspiration media with 75 IU mL–1 of heparin. The aspirated fluid was filtered and rinsed using an embryo filter (EmCon�, Immunosystems, Menomonie, WI), and COC were searched and graded under a microscope based on the intactness of the cumulus cell layers. Data were analyzed by ANOVA. There were no differences (P > 0.05) between groups in the mean number of follicles aspirated per donor (11.0, 13.8, 9.4, and 9.1 for Groups 1 to 4 respectively), and in the mean number of COC recovered per donor (7.6, 7.0, 6.0, and 6.1 respectively for Groups 1 to 4). The proportions of good quality COC were significantly (P < 0.01) different between surgical (81.0 and 79.5% for Groups 1 and 2) and transvaginal/ultrasound-guided (7.4% for Group 3) methods of collection; however, they were similar to the proportion in Group 4 (64.9%) retrievals. The results show that in the absence of an intravaginal device, a similar quantity and quality of alpaca oocytes can be collected when using a surgical approach or minimally invasive ultrasound-guided transvaginal follicular aspiration.
47
Kameyama, Y., G. Shimoi, S. Kubo, and R. Hashizume. "102 REPEATED OVARIAN STIMULATIONS BY EXOGENOUS GONADOTROPIN COULD ALTER ATP CONTENT AND MITOCHONDRIAL DISTRIBUTION IN MOUSE OOCYTES." Reproduction, Fertility and Development 25, no. 1 (2013): 198. http://dx.doi.org/10.1071/rdv25n1ab102.
Abstract:
Ovarian stimulation (OS) by exogenous gonadotropin enhances the availability of mammalian oocytes but compromises their developmental competence (Combelles and Albertini 2003 Biol. Reprod. 68, 812–821). Recently, several studies have reported mitochondrial function-related abnormalities in oocytes after single and repeated OSs. Because mitochondria can directly influence fertilization outcomes (El Shourbagy et al. 2006 Reproduction 131, 233–245), this study aimed to determine the relationship between mitochondria-related parameters and developmental competence on the basis of ATP content, mitochondrial DNA (mtDNA) copy number, mitochondrial distribution, and IVF results for oocytes after repeated OSs. Ovulated oocytes were recovered from ICR female mice treated with 7.5 IU of eCG and 5 IU of hCG at an interval of 48 h in 1 (control) to 3 stimulation cycles, which were performed at intervals of either 5 or 10 d (n = 15–25 in each treatment group). The ATP content in oocytes was determined using a luminometer and commercial kits (BacTiter-Glo; Promega, WI, USA; n = 15–29 in each treatment group). The mtDNA copy number in oocytes was quantified by performing absolute quantification with real-time PCR (n = 4–8 in each treatment group). Mitochondrial distribution in oocytes stained by rhodamine123 was observed under a confocal microscope (n = 12–26 in each treatment group). These analyses were performed only for morphologically normal oocytes. The data were analyzed by one-way ANOVA, followed by Fisher’s least significant difference, or by the chi-square test. Some mice did not ovulate in the third stimulation cycle for both intervals (5-d interval, 32%; 10-d interval, 80%). The mean numbers of ovulated oocytes gradually decreased with progression of the stimulation cycles. The ATP content of the oocytes significantly decreased both in the second and third stimulation cycles, performed with a 5-d interval (control, 1.038 ± 0.117 pmol; second cycle, 0.852 ± 0.189 pmol; third cycle, 0.932 ± 0.272 pmol). The mean mtDNA copy number in oocytes did not change significantly but varied widely in the third stimulation cycle (control, 146 000 ± 21 000; 5-d interval, 135 000 ± 35 000; 10-d interval: 148 000 ± 50 000; mean ± SD). The mitochondrial staining patterns were classified into homogeneous, aggregation, and perinuclear accumulation. The rates of aggregation and perinuclear accumulation increased after repeated stimulation cycles. The blastocyst rates did not significantly differ among the treatment groups after IVF (75–82%). Repeated OSs not only decreased the number of ovulated oocytes but also caused changes related with mitochondrial function, even in the morphologically normal ovulated oocytes. Translocation of active mitochondria, which are associated with energy production, has some functional correlation with successful pre-implantation development (Suzuki et al. 2006 J. Mamm. Ova. Res. 23, 128–134). Changes in mitochondrial distribution might compensate for the negative effect of the decrease in ATP content and low mtDNA copy number after repeated OSs to help reach the blastocyst stage.
48
Ortel, Thomas L., Ian Welsby, David F. Kong, John A. Heit, Elizabeth Krakow, Nicole Whitlatch, Gowthami M. Arepally, Grace Lee, Shahar Bar-Yosef, and Eliot C. Williams. "HIT Antibody Seropositivity and Thromboembolic Events After Cardiac Surgery." Blood 118, no. 21 (November 18, 2011): 1159. http://dx.doi.org/10.1182/blood.v118.21.1159.1159.
Abstract:
Abstract Abstract 1159 Background. Heparin induced thrombocytopenia (HIT) is an immune disorder where platelets are activated by antibodies to a complex of platelet factor 4 antigen and heparin (PF4/H), leading to thrombocytopenia (HIT) and, potentially, thrombosis (HITT). Documentation of anti-PF4/H antibodies in addition to the appropriate clinical findings is essential for making a diagnosis of HIT. In the post-cardiac bypass surgery setting, however, the frequency of elevated anti-PF4/H antibodies is high, whereas the frequency of clinical HIT or HITT is relatively uncommon. Several studies have shown that the presence of anti-PF4/H antibodies may be associated with an increased frequency of adverse outcomes, even in the absence of clinical HIT. The primary objective of this study was to determine the relationship between a positive PF4/H antibody in the postoperative setting with adverse thromboembolic events occurring up to 3 months after cardiac surgery. Methods. Patients undergoing cardiac surgery who were not going to be treated with chronic anticoagulation postoperatively were eligible for this multi-center prospective cohort study. Data were collected daily during hospitalization, and then at 30 and 90 days after surgery using a structured interview format with a standardized questionnaire that included all thrombotic as well as hemorrhagic events, platelet counts, and utilization of antithrombotics in the postoperative setting. The primary outcome variable was a composite endpoint comprising arterial and venous thrombotic events and other miscellaneous events compatible with HIT, as well as death attributable to an event compatible with HIT. Citrated plasma was collected at baseline, pre-discharge (∼4–5 days after surgery), and the 30 day follow-up visit, processed, and stored at −80°C for testing. Laboratory analyses included an anti-PF4/H antibody ELISA (GTI, Waukesha, WI) on all samples, a high-heparin confirmatory test on samples with an OD reading >0.40, and a serotonin release assay (SRA) on all postoperative samples with an OD reading >0.40. A sample size of 800 patients was estimated in order to detect a 3% difference in thromboembolic events assuming a 2 to 10-fold increase risk attributable to seropositivity. Chi-squared testing was used to test the relationship between the primary outcome and postoperative anti-PF4/H levels. Results. Informed consent was obtained from 1030 eligible patients between August 2006 and May 2009, and laboratory and follow-up data were analyzable for 1016 patients. Thirty-day antibody data were available for 888 patients, and fully complete laboratory and 90-day follow-up data were available for 815 patients. The average age was 62 ± 12 years, and 73% of participants were male. A total of 769 patients underwent coronary artery bypass grafting and 237 underwent valve repair or replacement. During the entire study period, there were 17 (1.7%) deaths, 46 thromboembolic events in 44 patients (4.3%), and 25 hemorrhagic events in 24 patients (2.4%). Using an OD cutoff of 0.40 for the ELISA, 339 patients (33.4%) were positive for anti-PF4/H antibodies at the time of discharge, and 630 patients (62%) were positive by day 30. There was no correlation between seropositivity for anti-PF4/H antibodies at the day of discharge or at day 30 and the primary outcome (p=0.47 and 0.73, respectively). Incorporating the high-heparin confirmatory step did not improve the relationship between positive antibody results and the primary outcome. Using a higher cut-off value for the anti-PF4/H antibody ELISA of 1.0 decreased the number of patients with positive results (96 patients at the time of discharge [9.4%] and 221 patients at the 30-day follow-up visit [21.8%]), but this did not improve the relationship between antibody positivity at the day of discharge or day 30 and the primary clinical endpoint, since most patients with the primary endpoint had an ELISA OD below 1.0 (75th percentile of 0.90; 90th percentile of 1.22). Similarly, using the SRA did not identify a relationship between assay results and outcome. Conclusions. The presence of anti-PF4/H antibodies in the postoperative setting following cardiac bypass surgery is not associated with an increased risk for thromboembolic complications. Positive anti-PF4/H results in this clinical setting should be interpreted with caution and only in the context of clinical suspicion for HIT. Disclosures: Ortel: Instrumentation Laboratory: Consultancy; Eisai: Research Funding; GSK: Research Funding. Welsby:CSL Behring: Speaker; CSL Behring: Membership on an entity's Board of Directors or advisory committees; NovoNordisk: Principal Investigator. Heit:Daiichi Sankyo: Honoraria; Ortho-McNeil Janssen: Honoraria; Covidien: Honoraria.
49
Melzer, M. J., J. Shimabukuro, M. H. Long, S. C. Nelson, A. M. Alvarez, W. B. Borth, and J. S. Hu. "First Report of Capsicum chlorosis virus Infecting Waxflower (Hoya calycina Schlecter) in the United States." Plant Disease 98, no. 4 (April 2014): 571. http://dx.doi.org/10.1094/pdis-06-13-0588-pdn.
Abstract:
In February 2013, an ornamental waxflower (Hoya calycina Schlecter) with leaves displaying concentric chlorotic and necrotic rings surrounding sunken, necrotic lesions typical of tospovirus infection was observed at a community garden in Honolulu, HI. Symptomatic leaf tissue tested negative for Tomato spotted wilt virus (TSWV), a common tospovirus in Hawaii, using a TSWV ImmunoStrips (AgDia, Elkhart, IN) assay following the manufacturer's instructions. Double-stranded RNAs were isolated from a symptomatic leaf and reverse transcribed using random primers (2). The cDNA was then used as template in a universal tospovirus PCR assay using primers gL3637 and gL4435c, which amplify sequences of the L segment encoding the RNA-dependent RNA polymerase of tospoviruses (1). An ~800-bp product was amplified and cloned using pGEM-T Easy (Promega, Madison, WI). Three clones were selected and found to be identical by dye-terminator sequencing performed at the University of Hawaii's Advanced Studies in Genomics, Proteomics, and Bioinformatics laboratory. Following primer sequence trimming, the 773-bp sequence (GenBank Accession No. KF030938) was found to be 97, 88, and 87% identical to Capsicum chlorosis virus (CaCV; a tentative species in the family Bunyaviridae, genus Tospovirus) strains Ch-Har (GU199334), TwTom1 (HM021140), and AIT (DQ256124), respectively. To confirm the presence of CaCV, the cDNA was also used as template in a universal tospovirus PCR assay with primers 3′T12 and TsMCR2 which amplify a region of the S segment of tospoviruses (3). The amplification product from this assay was cloned and sequenced as described above and found to be 93 to 98% identical to CaCV nucleotide sequences present in GenBank. Attempts to detect the CaCV strain in waxflower using a watermelon silver mottle virus and groundnut bud necrosis virus triple antibody sandwich ELISA (AgDia) were unsuccessful. No other plants in the community garden had typical tospovirus-like symptoms; however, samples from tomato (Solanum lycopersicum L.; two samples), chili pepper (Capsicum spp.; four samples), eggplant (Solanum melongena L.; one sample), and passionfruit (Passiflora edulis Sims; one sample) with virus-like symptoms were collected from the garden and had RNA isolated using a NucleoSpin RNA II kit (Macherey-Nagel, Bethlehem, PA). No tospoviruses were detected in any of these samples with the RT-PCR assay using primers gL3637 and gL4435. The waxflower plant infected with CaCV was immediately removed by community garden members and destroyed, preventing any additional serological or biological assays to be performed. CaCV is transmitted by several species of thrips, including Thrips palmi, which is present in Hawaii. Waxflower is not native to Hawaii and it is unclear whether CaCV entered Hawaii in this plant or whether it was infected by viruliferous thrips. A survey for CaCV in known hosts is essential to determine the geographic distribution of CaCV in Hawaii, as this virus poses a considerable threat to tomato, chili pepper, and phalaenopsis orchid production in Hawaii and the United States. References: (1) F.-H. Chu et al. Phytopathology 91:361, 2001. (2) M. J. Melzer et al. Virus Genes 40:111, 2010. (3) M. Okuda and K. Hanada. J. Virol. Methods 96:149, 2001.
50
Jessee, Erin. "Kristin Conner Doughty, Remediation in Rwanda: grassroots legal forums. Philadelphia PA: University of Pennsylvania Press (hb US$65 – 978 0 812 24783 1). 2016, 283 pp.Bert Ingelaere, Inside Rwanda's Gacaca Courts: seeking justice after genocide. Madison WI: University of Wisconsin Press (hb US$64.95 – 978 0 299 30970 1; pb US$21.95 – 978 0 299 30974 9). 2017, 234 pp." Africa 89, no. 03 (July 16, 2019): 608–10. http://dx.doi.org/10.1017/s0001972019000548.