To see the other types of publications on this topic, follow the link: Washington (N.H.).
Journal articles on the topic 'Washington (N.H.)'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 50 journal articles for your research on the topic 'Washington (N.H.).'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
Beutel, Marc W., Lanka DeSilva, and Louis Amegbletor. "Direct Measurement of Mercury Deposition at Rural and Suburban Sites in Washington State, USA." Atmosphere 12, no. 1 (December 30, 2020): 35. http://dx.doi.org/10.3390/atmos12010035.
Full textAbstract:
Because of mercury’s (Hg) capacity for long-range transport in the atmosphere, and its tendency to bioaccumulate in aquatic biota, there is a critical need to measure spatial and temporal patterns of Hg atmospheric deposition. Dry deposition of Hg is commonly calculated as the product of a measured atmospheric concentration and an assumed deposition velocity. An alternative is to directly assess Hg deposition via accumulation on surrogate surfaces. Using a direct measurement approach, this study quantified Hg deposition at a rural site (Pullman) and suburban site (Puyallup) in Washington State using simple, low-cost equipment. Dry deposition was measured using an aerodynamic “wet sampler” consisting of a Teflon plate, 35 cm in diameter, holding a thin layer (2.5 mm) of recirculating acidic aqueous receiving solution. In addition, wet Hg deposition was measured using a borosilicate glass funnel with a 20-cm-diameter opening and a 1 L Teflon sampling bottle. Hg deposition was estimated based on changes in total Hg in the aqueous phase of the samplers. Dry Hg deposition was 2.4 ± 1.4 ng/m2·h (average plus/minus standard deviation; n = 4) in Pullman and 1.3 ± 0.3 ng/m2·h (n = 6) in Puyallup. Wet Hg deposition was 7.0 ± 4.8 ng/m2·h (n = 4) in Pullman and 1.1 ± 0.2 ng/m2·h (n = 3) in Puyallup. Relatively high rates of Hg deposition in Pullman were attributed to regional agricultural activities that enhance mercury re-emission and deposition including agricultural harvesting and field burning. Hg concentration in precipitation negatively correlated with precipitation depth, indicating that Hg was scavenged from the atmosphere during the beginning of storm events. Because of their relative simplicity and robustness, direct measurement approaches such as those described in this study are useful in assessing Hg deposition, and for comparing results to less direct estimates and model estimates of Hg deposition.
2
Gibson, Glenys D., and Fu-Shiang Chia. "Description of a new species of Haminoea, Haminoea callidegenita (Mollusca: Opisthobranchia), with a comparison with two other Haminoea species found in the northeast Pacific." Canadian Journal of Zoology 67, no. 4 (April 1, 1989): 914–22. http://dx.doi.org/10.1139/z89-133.
Full textAbstract:
A new species of Haminoea (Opisthobranchia: Cephalaspidea), Haminoea callidegenita, is described from Washington State, U.S.A. Diagnostic features are reddish brown colour, deeply bifurcate cephalic shield, reddish ovate shell with imperforate apex, tubular Hancock's organ, unarmed penis, unilobular prostate, and radula formula n.l.l.l.n (n from 12 to 21), with bicuspid first lateral uncini. The development of H. callidegenita is unusual among the Opisthobranchia in that the hatching stage includes both lecithotrophic veligers and juveniles from each egg mass. Diagnostic features were examined among animals from different populations of H. callidegenita and two other Haminoea species found in the northeast Pacific: H. vesicula Gould, 1855 and H. virescens Sowerby, 1833. Shell shape was slightly variable among individuals of all three species and radula morphologies were variable among populations of H. vesicula. Fingerlike papillae were noted on the gizzard plates and are suggested as a diagnostic character.
3
Kim, Sangmi, Eun-Ok Im, Jianghong Liu, and Connie Ulrich. "Maternal Age Patterns of Preterm Birth: Exploring the Moderating Roles of Chronic Stress and Race/Ethnicity." Annals of Behavioral Medicine 54, no. 9 (February 22, 2020): 653–64. http://dx.doi.org/10.1093/abm/kaaa008.
Full textAbstract:
Abstract Background Despite the suggested contribution of cumulative chronic stress to the racial/ethnic disparities in preterm birth (PTB), it is unclear how chronic stress, maternal age, and race/ethnicity are linked underlying PTB. Purpose We investigated the moderating effect of chronic stress on the maternal age–PTB association among non-Hispanic (N-H) White, N-H Black, Hispanic, and Asian women. Methods We analyzed the Washington State’s Pregnancy Risk Assessment Monitoring System data linked with birth certificates. The sample included women aged 18 years or older who birthed the first, singleton baby without birth defects. Chronic stress was measured by race/ethnicity-specific chronic stress indices. A maternal age–chronic stress interaction was modeled to predict PTB by logistic regression stratified by race/ethnicity. In subanalysis, the moderating role of racism was investigated in the maternal age–chronic stress interaction among three minority groups combined. Results Women’s maternal age trajectory of PTB varied by their race/ethnicity and chronic stress level. N-H White and N-H Black women showed a steeper maternal age-related increase in PTB (weathering) under higher chronic stress, indicating a chronic stress’ cumulative effect with maternal age. Besides, the extent of weathering was amplified by racism on top of chronic stress, particularly among N-H Black women. Conclusions These results show that both chronic stress and racism may develop accelerated PTB risk among minority women. Future research should use more objective and accurate chronic stress measures to ascertain the complex relationships among chronic stress, racial discrimination, and maternal age underlying the racial/ethnic differentials in PTB.
4
Kim, Sangmi, Eun-Ok Im, Jianghong Liu, and Connie Ulrich. "Factor Structure for Chronic Stress Before and During Pregnancy by Racial/Ethnic Group." Western Journal of Nursing Research 41, no. 5 (July 18, 2018): 704–27. http://dx.doi.org/10.1177/0193945918788852.
Full textAbstract:
This study aimed to explore race/ethnicity-specific dimensionalities of chronic stress before and during pregnancy for non-Hispanic (N-H) White, N-H Black, Hispanic, and Asian women in the United States. This study analyzed the data among 6,850 women from the New York City and Washington State Pregnancy Risk Assessment Monitoring System (2004-2007) linked with birth certificates. Separate exploratory factor analysis was conducted by race/ethnicity using a maximum-likelihood extraction method with 26 chronic stress items before and during pregnancy. Correlations and internal consistency reliabilities among items and latent factors determined race/ethnicity-specific factor structures of chronic stress. Chronic stress was race/ethnicity-distinctive and multidimensional with low correlations among the factors ( r = .07-.28, p < .05). Despite financial hardship, perceived isolation, and physical violence underlying chronic stress among the racial/ethnic groups, intergroup variations existed under each group’s cultural or sociopolitical contexts. This study could help develop targeted strategies to intervene with women’s chronic stressors before childbirth.
5
Shelley, Rowland M. "The milliped order Callipodida in western North America (Schizopetalidae: Tynommatinae), and a summary of the New World fauna." Insect Systematics & Evolution 27, no. 1 (1996): 25–64. http://dx.doi.org/10.1163/187631296x00197.
Full textAbstract:
AbstractIn western North America, the milliped order Callipodida is represented by the Colactidini, Tynommatini stat. n., and Diactidini tribus n., in the subfamily Tynommatinae, family Schizopetalidae; a coordinate tribe, the Texophonini, occurs on the Gulf Coast of south Texas. The Tynommatini consists of two genera and four species: Tynomma mutans (Chamberlin), T. magnum Buckett & Gardner, and T. gardneri sp. n., occurring around Monterey and San Pablo/San Francisco Bays, California, and Idrionaria dineh gen. n. & sp. n., in Washington County, Utah. The Colactidini ranges from Durango, Mexico, to central Utah and California east of the Sierra Nevada, with disjunct areas in southern California and Baja California, the latter extending northward to metropolitan San Diego. It is represented by two genera and 6 species: Colactis Loomis: C. tiburona (Chamberlin), utorum (Chamberlin), and protenta and quadrata, both by Loomis; and Heptium Loomis: H. carinellum and scamillatum, both by Loomis. The Diactidini, occupying coastal southern California and the adjacent fringe of Baja California, is comprised of three genera and 10 species: Diactis Loomis: D. soleata, triangula, and frondifera, all by Loomis, and amniscela, cupola, jacinto, procera, and strumella, all spp. n.; Florea sinuata gen. n. & sp. n.; and Caliactis bistolata gen. n. & sp. n. The following new synonymies are proposed: C. yuma Chamberlin, sideralis Loomis, and loomisi Hoffman under C. tiburona; C. briggsi Shear and saxetana and baboquivari, both by Loomis, under C. utorum; H. canum Chamberlin under H. carinellum; and Etiron paroicum and pearcei, both by Chamberlin, under D. triangula and T. mutans, respectively. The eastern Nearctic callipodid fauna is summarized and significant new localities are reported; Tetracion antraeum Hoffman, stat. n., is elevated from a subspecies of T. jonesi Hoffman.
6
Hawkins, Melissa, Sarah Irvine Belson, Robin McClave, Lauren Kohls, Sarah Little, and Anastasia Snelling. "Healthy Schoolhouse 2.0 Health Promotion Intervention to Reduce Childhood Obesity in Washington, DC: A Feasibility Study." Nutrients 13, no. 9 (August 25, 2021): 2935. http://dx.doi.org/10.3390/nu13092935.
Full textAbstract:
Childhood obesity prevalence trends involve complex societal and environmental factors as well as individual behaviors. The Healthy Schoolhouse 2.0 program seeks to improve nutrition literacy among elementary school students through an equity-focused intervention that supports the health of students, teachers, and the community. This five-year quasi-experimental study follows a baseline–post-test design. Research activities examine the feasibility and effectiveness of a professional development series in the first program year to improve teachers’ self-efficacy and students’ nutrition literacy. Four elementary schools in Washington, DC (two intervention, two comparison) enrolled in the program (N = 1302 students). Demographic and baseline assessments were similar between schools. Teacher participation in professional development sessions was positively correlated with implementing nutrition lessons (r = 0.6, p < 0.001, n = 55). Post-test student nutrition knowledge scores (W = 39985, p < 0.010, n = 659) and knowledge score changes (W = 17064, p < 0.010, n = 448) were higher among students in the intervention schools. Students who received three nutrition lessons had higher post knowledge scores than students who received fewer lessons (H(2) =22.75, p < 0.001, n = 659). Engaging teachers to implement nutrition curricula may support sustainable obesity prevention efforts in the elementary school environment.
7
Clark, Harry F. "Zionism lobbies the empires." Journal of Contemporary Iraq & the Arab World 14, no. 3 (September 1, 2020): 266–86. http://dx.doi.org/10.1386/jciaw_00034_5.
Full textAbstract:
Review of: A Broken Trust: Sir Herbert Samuel, Zionism and the Palestinians, Sahar Huneidi, foreword by Walid Khalidi (2001)London: I. B. Tauris, 340 pp.,ISBN 978-1-86064-172-5, h/bk, out-of-printThe Palestine Deception, 1915‐1923: The McMahon-Hussein Correspondence, the Balfour Declaration, and the Jewish National Home, J. M. N. Jeffries, edited and with an introduction by William M. Mathew (2014)Washington, DC: Institute for Palestine Studies-USA, 175 pp.,ISBN 978-0-88728-320-8, p/bk, $16.00Palestine. The Reality. The Inside Story of the Balfour Declaration 1917‐1938, J. M. N. Jeffries, with a new introduction by Ghada Karmi (2017)Northampton, MA: Olive Branch Press, 800 pp.,ISBN 978-1-56656-024-5, p/bk, $30Israel’s Armor: The Israel Lobby and the First Generation of the Palestine Conflict, Walter L. Hixson (2019)Cambridge and New York: Cambridge University Press, 324 pp.,ISBN 978-1-108-70532-5, p/bk, $29.99
8
Boardman, Pete. "Twenty-one new species of craneflies (Diptera: Tipulidae and Limoniidae), and a new fold-wing cranefly (Diptera: Ptychopteridae) from Mount Kupe, Cameroon, with notes on eighteen other species new to the country from the same location." Entomologist's Monthly Magazine 156, no. 3 (July 31, 2020): 163–206. http://dx.doi.org/10.31184/m00138908.1563.4042.
Full textAbstract:
Following the award of a Winston Churchill Memorial Trust (WCMT) Fellowship the author was able to visit the Charles P. Alexander (1889–1981) collection at the Smithsonian Institution, Washington D. C. to study craneflies gifted to him from fieldwork in Cameroon. They were collected by Malaise trap in forest clearings near streams on Mount Kupe, near Nyasoso, Cameroon. 21 new species of cranefly (Diptera: Tipulidae and Limoniidae): Dolichopeza (Dolichopeza) vicki sp. n., Nephrotoma mawdsleyi sp. n., Baeoura nyasosoensis sp. n.,Ellipteroides (Ellipteroides) nigromaculatus sp. n., Hovamyia gelhausi sp. n.,Limnophilomyia (Limnophilomyia) alexanderi sp. n., Ormosia (Neserioptera) cameroonensis sp. n., Afrolimnophila mederosi sp. n., A. oosterbroeki sp. n., Neolimnomyia kupensis sp. n., Pseudolimnophila (Pseudolimnophila) staryi sp. n., Achyrolimonia prycei sp. n., Dicranomyia (Dicranomyia) tuberculata sp. n., D. (Idioglochina) stubbsi sp. n., Elephantomyia (Elephantomyia) gilsonae sp. n., Libnotes (Afrolimonia) trimaculata sp. n., Metalimnobia (Tricholimnobia) krameri sp. n., Thaumastoptera (Thaumastoptera) churchilli sp. n., Toxorhina (Ceratocheilus) holvia sp. n., Trentepohlia (Trentepohlia) zorro sp. n., and Trichoneura (Xipholimnobia) jacksoni, and a new species of fold-wing cranefly (Diptera: Ptychopteridae): Ptychoptera (Ptychoptera) fasbenderi sp. n., are described. 18 species of cranefly known from elsewhere in the Afrotropical region are recorded here from Cameroon for the first time: Gonomyia (Leiponeura) hyperion Alexander, 1956, Limnophilomyia (Limnophilomyia) medleriana Alexander, 1976, Styringomyia vittata Edwards, 1914, Afrolimnophila hartwigi (Alexander, 1974), A. urundiana (Alexander, 1955), Austrolimnophila (Phragmocrypta) fulani Alexander, 1974, Hexatoma (Eriocera) brevifurca Alexander, 1956, H. (E.) trichoneura Alexander, 1956, H. (E.) tumidiscapa (Alexander, 1920), Medleromyia nigeriana Alexander, 1974, Achyrolimonia recurvans (Alexander, 1919), Atypopthalmus (Atypopthalmus) submendicus tuberculifer (Alexander, 1956), Dicranomyia (Dicranomyia) redundans (Alexander, 1956), Libnotes (Afrolimonia) rhanteria (Alexander, 1920), L. (A.) illiterata (Alexander, 1937), Limonia woosnami (Alexander, 1920), Orimarga (Protorimarga) bequaertiana (Alexander, 1930) and Toxorhina (Ceratocheilus) nigripleura (Alexander, 1920). In total 40 species are presented as new for Cameroon. A further 23 species already known from Cameroon were identified, and are listed here as some of them have not been recorded since their original description close to, or in some cases over, a hundred years ago.
9
Reid, Neill, and Gary Wegner. "H-Alpha Emission in Hot Degenerates and OB Subdwarfs." International Astronomical Union Colloquium 114 (1989): 396–400. http://dx.doi.org/10.1017/s0252921100099954.
Full textAbstract:
Based on observations obtained using the 60-inch telescope at Palomar Observatory which is jointly owned by the California Institute of Technology and the Carnegie Institution of Washington and on observations obtained with the 200-inch Hale telescope which is owned by the California Institute of Technology.The intial observations of white dwarf stars and their immediate precursors, the hot subdwarfs, suggested that these stars possess the simplest (and, aesthetically, the most pleasing) spectra of any astronomical object. The high gravity leads to the spectrum being dominated, in the most stars, by broad lines of either hydrogen or helium, depending on the composition of the photospheric layers, with a few stars exhibiting lines from both species. However, the more detailed observations of recent years have revealed a higher degree of complexity. In particular, absorption lines of high excitation species (N V, C IV, etc.) have been detected in the ultraviolet spectra of several hot white dwarfs (Bruhweiler & Kondo, 1982) and, most recently, high resolution optical spectra have shown that one of the latter stars, the hottest known DA, G191-B2B, exhibits significant emission in the core of the H-alpha absorption line (Reid &: Wegner, 1988). Following up the latter observation, we have obtained high resolution spectra of a number of hot subdwarfs, with temperatures ranging from ~ 20,000K to more than 60,000 K. Most of these stars also exhibit Baimer emission, at Hβ as well as Hα in at least one case. We suggest the temperature reversal in the stellar atmosphere may be a function of the He/H ratio at the level of the photosphere.
10
Crosslin, J. M. "First Report of Potato mop-top virus on Potatoes in Washington State." Plant Disease 95, no. 11 (November 2011): 1483. http://dx.doi.org/10.1094/pdis-06-11-0536.
Full textAbstract:
In April of 2011, approximately 10% of the tubers of potato (Solanum tuberosum L.) cv. Alturas, grown in central Washington State and collected from a commercial potato storage facility, were observed to have internal brown spots and arcs typical of infection by either Tobacco rattle virus (TRV) or Potato mop-top virus (PMTV). Ten tubers showing symptoms ranging from a few brown spots to large (2 cm) concentric arcs were tested by reverse transcription (RT)-PCR with primers specific for TRV (3) or PMTV (PMTV2 forward, AGAGCAGCCGTCGAGAATAG; PMTV3 reverse, TCGTCCACCTCTGCGAGTTG). Two symptomless tubers from the same lot were also tested. All symptomatic tubers tested negative for TRV, but eight of the symptomatic tubers were positive for PMTV, as evidenced by production of the expected 416-bp amplified DNA product. The symptomless tubers were negative for both viruses. The eight symptomatic tubers that were positive for PMTV by RT-PCR were also positive for PMTV by ELISA using a commercially available kit (Adgen, Ayr, Scotland). The symptomless tubers were negative for PMTV by ELISA. The 416-bp amplicons obtained with the PMTV primers from two tubers were cloned and three clones of each were sequenced. The consensus sequences for the two samples differed by only one nucleotide and sequences were deposited in GenBank as Accession Nos. JN132116 and JN132117. BLAST analysis showed the sequences were 99 to 100% identical to a portion of the coat protein gene of numerous PMTV isolates. These results confirm that PMTV is present in central Washington State. The virus has been known to affect potatoes in Maine for several years (2) and was recently confirmed in North Dakota (1). PMTV was reportedly found in potatoes grown in numerous locations in the United States, but the specific locations were not reported (4). PMTV is transmitted by the soilborne powdery scab pathogen, Spongospora subterranea, which is widespread in the region of the state where the virus-infected tubers were grown. The confirmation of PMTV in Washington State alerts growers, fieldmen, and diagnostic laboratories to the presence of this potentially serious virus in a major potato-production area of the United States. References: (1) N. David et al. Plant Dis. 94:1506, 2010. (2) D. H. Lambert et al. Plant Dis. 87:872, 2003. (3) D. J. Robinson. J. Virol. Methods 40:57, 1992. (4) H. Xu et al. Plant Dis. 88:363, 2004.
11
Rocha Júnior, Fernando Soares, Vânia Meneghini da Rocha, and Marcelo Macedo. "COMPARTILHAMENTO DE CONHECIMENTO EM UMA PEQUENA EMPRESA DE PRODUTOS ORTOPÉDICOS: ANÁLISE DAS PERCEPÇÕES DOS COLABORADORES." International Journal of Knowledge Engineering and Management 9, no. 25 (December 14, 2021): 127–43. http://dx.doi.org/10.47916/ijkem-vol9n25-2020-81913.
Full textAbstract:
O objetivo central deste artigo é tentar compreender por meio da visão dos colaboradores de uma pequena empresa de produtos ortopédicos, as suas principais percepções, relacionadas ao compartilhamento de conhecimento organizacional. O método escolhido para a pesquisa é qualitativo com a tipologia qualitativa básica. Para a análise de resultados, foi utilizada a técnica de análise temática de Braun e Clarke. Os principais resultados encontrados demonstram que o compartilhamento de conhecimento na organização é realizado por intermédio da utilização das tecnologias de comunicações comuns ao público, assim como, com a realização frequente da técnica de brainstorming, conversas rápidas e outras estratégias para resolução de problemas conforme identificados nesta pesquisa. Referências Alavi, M., & Leidn, D. E. (2001). Knowledge management and knowledge management systems: Conceptual foundations and research issues. MIS Quarterly, 25, 107–136. Allameh, S. M.; Khozani, M. K.; Baniasadi, B. (2020) Consequences of knowledge processes in small businesses: the role of knowledge acquisition, dynamic capabilities, knowledge sharing and creativity. Int. J. Process Management and Benchmarking, Vol. 10, No. 1. Braun, V.; Clarke, V. (2012) Thematic analysis. In: Cooper, H. et al. (Eds.). APA handbook of research methods in psychology, v. 2, Research designs: Quantitative, qualitative, neuropsychological, and biological. Washington, DC: American Psychological Association, v. 2 p. 57-71. Creswell, J. W. (2007) Projeto de pesquisa: Métodos qualitativo, quantitativo e misto. 2. ed. Porto Alegre: Artmed. Cummings, J. (2003) Knowledge Sharing: A Review of the Literature. Washington D. C.: The World Bank Operations Evaluation Department. Dalkir, K. (2005) Knowledge Management in Theory and Practice. Oxford, UK: Elsevier. Drucker, P. F. (1993) Sociedade Pós-Capitalista. São Paulo: Pioneira. Gold H. A.; Malhotra, A; Segars, A, H.; (2001). Knowledge management: An Organizational Capabilities Perspective. Journal of Management Information Systems, 18 (1), 185-214. Gray, C. (2006). Absorptive capacity, knowledge management and innovation in entrepreneurial small firms. International Journal of Entrepreneurial Behavior & Research, 12 (6),345-360. Harel, R.; Schwartz, D.; Kaufmann, D. (2020) Sharing knowledge processes for promoting innovation in small businesses. European Journal of Innovation Management. ISO 30401:2018. (2018) International Organization For Standardization. Knowledge Management Systems – Requirements. Genebra: ISO. Kayas, O, G.; Wright, G. (2018) Knowledge Management and Organisational Culture. The Palgrave Handbook of Knowledge Management. ISBN 978-3-319-71434-9 (eBook). Merriam, S. B. (2009) Qualitative research: a guide to design and implementation. San Francisco: Jossey-Bass/Wiley, 2009. Morgan, G. (1980) Paradigms, metaphors, and puzzle solving in organization theory. Administrative Science Quarterly, v. 25, n. 4, p. 605-622. Na Ubon, A.; Kimble, C. (2002) Knowledge Management in Online Distance Education. Proceedings of the 3rd International Conference Networked Learning, University of Sheffield, UK, pp. 465-473. Ngah e Ibrahim (2010). The Effect of Knowledge Sharing on Organizational Performance in Small and Medium Enterprises. Santos, N.; Rados, G. J. V. (2020) Fundamentos teóricos de gestão do conhecimento. E-book. – 1. ed. – Florianópolis: Pandion, 114 p. Takeuchi, H.; Nonaka, I. (2008) Criação e dialética do conhecimento. In: Takeuchi, H.; Nonaka, I. Gestão do conhecimento. Porto Alegre: Bookman. Utami, Y.; Rofik, M.; Cahyaningtyas, N. W.; Darminto, D. P. (2021). Impact of Knowledge Sharing and Innovation on Small Business Performance. CISIS 2020: Complex, Intelligent and Software Intensive Systems pp 408-411.
12
Coblentz, Bruce E. "Invasive Species in the Pacific Northwest P Dee Boersma, Sarah H Reichard, Amy N Van Buren . Editors. 2006. University of Washington Press. Seattle, Washington. Softcover, XXVI +. 285ISBN: 0-295-98596-8. US $29.95." Northwestern Naturalist 89, no. 2 (September 2008): 119–20. http://dx.doi.org/10.1898/1051-1733(2008)89[119:isitpn]2.0.co;2.
Full text
13
Pozdeyev, Nikita, Arpit Patel, Paul S. Pottinger, Michael Leu, and Thomas H. Payne. "Adherence to Recommended Post-Splenectomy Immunizations to Reduce the Risk of Sepsis: The University of Washington Experience." American Journal of Medical Quality 35, no. 5 (January 15, 2020): 405–10. http://dx.doi.org/10.1177/1062860619897289.
Full textAbstract:
Immunizations against Streptococcus pneumoniae, Neisseria meningitidis, and Haemophilus influenzae type b are recommended for patients undergoing splenectomy to decrease the risk of developing overwhelming infections. The authors sought to determine adherence to these recommendations by providers at UW Medicine. Regional immunization records for patients who underwent splenectomy between October 2015 and January 2019 were analyzed to measure compliance with immunization guidelines from the US Centers for Disease Control and Prevention (CDC). Among 253 patients who underwent splenectomy, 38 (15%) received all 7 immunizations against S pneumoniae, N meningitidis, and H influenzae type b recommended by the CDC; 95% of patients received at least 1 pneumococcal vaccine; 26% percent of patients did not receive MenB-4C vaccine. Many patients (3% to 10%) received redundant immunizations not in accordance with CDC recommendations. Development of state and national immunization registries and systems to improve adherence with post-splenectomy immunization guidelines may reduce risk for life-threatening infections.
14
Köhler, W. "N. R. Rose and H. Friedman (Editors), Manual of Clinical Immunology. 932 S., 192 Abb., 151 Tab. Washington 1976: American Society for Microbiology. $ 20.00." Zeitschrift für allgemeine Mikrobiologie 17, no. 7 (January 24, 2007): 578. http://dx.doi.org/10.1002/jobm.19770170720.
Full text
15
Chen, Allen M., Carol Felix, and Sophia Hsu. "Patient- versus physician-reported toxicities among survivors of head and neck cancer after chemoradiation: Prospective evaluation of screening methodologies." Journal of Clinical Oncology 34, no. 3_suppl (January 20, 2016): 150. http://dx.doi.org/10.1200/jco.2016.34.3_suppl.150.
Full textAbstract:
150 Background: This study sought to compare the incidence of late toxicities among survivors of head and neck cancer treated by definitive chemoradiation using patient-reported versus physician-reported methodologies. Methods: Two validated quality of life instruments, the University of Washington Quality of Life questionnaire (UW-QOL) and the Functional Assessment of Cancer Therapy for Head and Neck questionnaire (FACT-H&N) were administered to patients returning for follow-up after chemoradiation for head and neck cancer. Only patients who had been clinically without evidence of disease for greater than 6 months were sampled. Scores were compared to physician-reported toxicities, which were recorded blindly and independently after each patient visit, using the National Cancer Institute’s Common Toxicity Criteria (version 4.0). Two by two contingency tables were constructed to assess differences between patient- and physician-reported responses using Fisher’s exact test. Results: Fifty patients (35 male; 15 females) completed both instruments. While 78% of patients reported an inability “to swallow certain solid foods” and 70% reported difficulty to “swallow naturally and easily” using the self-reported UW-QOL and FACT-H&N surveys, respectively, the incidence of grade 2+ esophageal dysfunction as reported by physicians was only 48% (p < 0.001). While 60% of patients reported “too little saliva” and 50% acknowledged having problems with "voice quality and strength" using the UW-QOL and FACT-H&N surveys, only 20% and 30%, respectively, were scored as having grade 2+ xerostomia and laryngeal toxicity. Significant discordance was also observed between patient- and physician-reported toxicities with respect to the domains of appearance (p = 0.02), pain (p = 0.01), activity/energy (p < 0.001), and mood (p = 0.001). Conclusions: Late toxicities are frequently under-reported by physicians after chemoradiation for head and neck cancer. The true incidence and severity of these treatment-related toxicities, with respect to both functional and psychosocial impairment, among survivors may be better evaluated by patient-reported methods.
16
Jungerman, Ivy, Julia Toyota, Neyller Patriota Montoni, Elma Heitmann Mares Azevedo, Renata Ligia Vieira Guedes, Aline Damascena, Derek Lowe, José Guilherme Vartanian, Simon N. Rogers, and Luiz Paulo Kowalski. "Patient Concerns Inventory for head and neck cancer: Brazilian cultural adaptation." Revista da Associação Médica Brasileira 63, no. 4 (April 2017): 311–19. http://dx.doi.org/10.1590/1806-9282.63.04.311.
Full textAbstract:
Summary Objective: The purpose of this study was to translate, culturally validate and evaluate the Patients Concerns Inventory - Head and Neck (PCI-H&N) in a consecutive series of Brazilian patients. Method: This study included adult patients treated for upper aerodigestive tract (UADT) cancer. The translation and cultural adaptation of the PCI-H&N followed internationally accepted guidelines and included a pretest sample of patients that completed the first Brazilian Portuguese version of the PCI. Use, feasibility and acceptability of the PCI were tested subsequently in a consecutive series of UADT cancer patients that completed the final Brazilian Portuguese version of the PCI and a Brazilian Portuguese version of the University of Washington Quality of Life Questionnaire (UW-QOL). Associations between physical and socio-emotional composite scores from the UW-QOL and the PCI were analyzed. Results: Twenty (20) patients participated in the pretest survey (translation and cultural adaptation process), and 84 patients were analyzed in the cultural validation study. Issues most selected were: fear of cancer returning, dry mouth, chewing/eating, speech/voice/being understood, swallowing, dental health/teeth, anxiety, fatigue/tiredness, taste, and fear of adverse events. The three specialists most selected by the patients for further consultation were speech therapist, dentist and psychologist. Statistically significant relationships between PCI and UW-QOL were found. Conclusion: The translation and cultural adaptation of the PCI into Brazilian Portuguese language was successful, and the results demonstrate its feasibility and usefulness, making this a valuable tool for use among the Brazilian head and neck cancer population.
17
Greybush, Steven J., Sue Ellen Haupt, and George S. Young. "The Regime Dependence of Optimally Weighted Ensemble Model Consensus Forecasts of Surface Temperature." Weather and Forecasting 23, no. 6 (December 1, 2008): 1146–61. http://dx.doi.org/10.1175/2008waf2007078.1.
Full textAbstract:
Abstract Previous methods for creating consensus forecasts weight individual ensemble members based upon their relative performance over the previous N days, implicitly making a short-term persistence assumption about the underlying flow regime. A postprocessing scheme in which model performance is linked to underlying weather regimes could improve the skill of deterministic ensemble model consensus forecasts. Here, principal component analysis of several synoptic- and mesoscale fields from the North American Regional Reanalysis dataset provides an objective means for characterizing atmospheric regimes. Clustering techniques, including K-means and a genetic algorithm, are developed that use the resulting principal components to distinguish among the weather regimes. This pilot study creates a weighted consensus from 48-h surface temperature predictions produced by the University of Washington Mesoscale Ensemble, a varied-model (differing physics and parameterization schemes) multianalysis ensemble with eight members. Different optimal weights are generated for each weather regime. A second regime-dependent consensus technique uses linear regression to predict the relative performance of the ensemble members based upon the principal components. Consensus forecasts obtained by the regime-dependent schemes are compared using cross validation with traditional N-day ensemble consensus forecasts for four locations in the Pacific Northwest, and show improvement over methods that rely on the short-term persistence assumption.
18
Lavigne, Marie. "RICHARDSON, Richard W. Jonas H. HARALZ. Moving to the Market : The World Bank in Transition. Washington, DC, Overseas Development Council, Policy Essay n°17, 1995, 106p." Études internationales 27, no. 2 (1996): 446. http://dx.doi.org/10.7202/703613ar.
Full text
19
Echelmeyer, Keith A., Barclay Kamb, and Barclay Kamb. "Stress-Gradient Coupling in Glacier Flow: II. Longitudinal Averaging in the Flow Response to Small Perturbations in Ice Thickness and Surface Slope." Journal of Glaciology 32, no. 111 (1986): 285–98. http://dx.doi.org/10.3189/s0022143000015616.
Full textAbstract:
AbstractAs a result of the coupling effects of longitudinal stress gradients, the perturbations ∆u in glacier-flow velocity that result from longitudinally varying perturbations in ice thickness ∆h and surface slope ∆α are determined by a weighted longitudinal average of ϕh∆h and ϕα∆α, where ϕh and ϕα are “influence coefficients” that control the size of the contributions made by local ∆h and ∆α to the flow increment in the longitudinal average. The values of ϕh and ϕα depend on effects of longitudinal stress and velocity gradients in the unperturbed datum state. If the datum state is an inclined slab in simple-shear flow, the longitudinal averaging solution for the flow perturbation is essentially that obtained previously (Kamb and Echelmeyer, 1985) with equivalent values for the longitudinal coupling length l and with ϕh = n + 1 and ϕα + n, where n is the flow-law exponent. Calculation of the influence coefficients from flow data for Blue Glacier, Washington, indicates that in practice ϕα differs little from n, whereas ϕh can differ considerably from n + 1. The weighting function in the longitudinal averaging integral, which is the Green’s function for the longitudinal coupling equation for flow perturbations, can be approximated by an asymmetric exponential, whose asymmetry depends on two “asymmetry parameters” μ and σ, where μ is the longitudinal gradient of ℓ(= dℓ/dx). The asymmetric exponential has different coupling lengths ℓ+ and ℓ− for the influences from up-stream and from down-stream on a given point of observation. If σ/μ is in the range 1.5–2.2, as expected for flow perturbations in glaciers or ice sheets in which the ice flux is not a strongly varying function of the longitudinal coordinate x, then, when dℓ/dx > 0, the down-stream coupling length ℓ+ is longer than the up-stream coupling length ℓ−, and vice versa when dℓ/dx < 0. Flow-, thickness- and slope-perturbation data for Blue Glacier, obtained by comparing the glacier in 1957–58 and 1977–78, require longitudinal averaging for reasonable interpretation. Analyzed on the basis of the longitudinal coupling theory, with 4ℓ + 1.6 km up-stream, decreasing toward the terminus, the data indicate n to be about 2.5, if interpreted on the basis of a response factor Ѱ + 0.85 derived theoretically by Echelmeyer (unpublished) for the flow response to thickness perturbations in a channel of finite width. The data contain an apparent indication that the flow response to slope perturbations is distinctly smaller, in relation to the response to thickness perturbations, than is expected on a theoretical basis (i.e. ϕα/ ϕh + (n/n + 1) for a slab). This probably indicates that the effective ℓ is longer than can be tested directly with the available data set owing to its limited range in x.
20
Alzeer, Abdulaziz, Abdullah Al Arifi, Mohsen El-Hazmi, Arjumand S. Warsy, and Eric S. Nylen. "Thermal regulatory dysfunction of growth hormone in classical heat stroke?" European Journal of Endocrinology 134, no. 6 (June 1996): 727–30. http://dx.doi.org/10.1530/eje.0.1340727.
Full textAbstract:
Alzeer A, Al Arifi A, El-Hazmi M, Warsy AS, Nylen ES. Thermal regulatory dysfunction of growth hormone in classical heat stroke? Eur J Endocrinol 1996;134:727–30. ISSN 0804–4643 Growth hormone (GH) secretion associated with classical (non-exertional) heat stroke (HS) was evaluated in 26 HS victims and 10 control (non heat-exhausted) subjects during the annual Hajj in Makkah, Saudi Arabia. On admission to the HS treatment unit, the GH level was 1.54 ± 0.14 ng/ml (approximately 3.5-fold higher in the HS victims compared to controls; p = 0.005). The GH levels subsequently declined by 78% by 24 h. The categorized GH response was significantly associated with survival for those subjects with a GH level of < 5.53 ng/ml by 6 h (chi-squared test; p = 0.06). In those patients who died (N = 6), there was a continued increase in GH levels from the time of admission, which peaked at 6 h. In those patients who survived, the GH levels peaked at the time of admission and declined rapidly thereafter. There was a direct correlation of age and GH level upon admission (p = 0.02), as well as to peak GH (p = 0.041). However, there was no relationship of GH level to either body core temperature or the cooling time. In summary, HS induced significant GH secretion. The degree of GH response was not related to the body core temperature and was more pronounced in older individuals and in those that died. Although patients with GH deficiency and HS are characterized by anhidrosis/hypohidrosis, there does not appear to be dysfunction of GH response to heat stress-associated HS. In contrast, a vigorous GH response at 6 h suggested a worse outcome. ES Nylen, Rm GE 246, VAMC, 50 Irving St, NW Washington, DC 20422, USA
21
Cramer, C. S., S. Bag, H. F. Schwartz, and H. R. Pappu. "Susceptibility of Onion Relatives (Allium spp.) to Iris yellow spot virus." Plant Disease 95, no. 10 (October 2011): 1319. http://dx.doi.org/10.1094/pdis-11-10-0819.
Full textAbstract:
Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus) is becoming an increasingly important constraint to the production of bulb and seed onions (Allium cepa L.) in many onion-growing regions of the continental United States and the world (4). During an evaluation of onion germplasm for susceptibility to IYSV, six other Allium species (A. altaicum, A. galanthum, A. roylei, A. schoenoprasum, A. tuberosum, and A. vavilovii) were also evaluated under natural field conditions. In July 2010, symptoms suggestive of IYSV infection (straw-colored necrotic lesions) were observed on leaves of these Allium spp. in experimental plots in Las Cruces, NM. IYSV was detected in symptomatic leaves of A. altaicum, A. vavilovii, A. tuberosum, A. schoenoprasum and A. roylei with a commercially available ELISA kit (Agdia Inc., Elkhart, IN). IYSV infection was confirmed by reverse transcription (RT)-PCR with forward and complementary primers 5′-CTCTTAAACACATTTAACAAGCAC-3′ and 5′-TAAAACAAACATTCAAACAA-3′ flanking the nucleocapsid (N) gene encoded by the small RNA of IYSV as previously described (1,3). Amplicons, approximately 1.1 kb long, were obtained from all symptomatic Allium spp. samples but not from healthy samples or water controls. Sequencing of selected amplicons confirmed IYSV infection. The highest nucleotide identity of 98% was shared with IYSV isolates from Japan (GenBank Accession No. AB180921). A. altaicum, A. vavilovii, and A. pskemense were previously reported from Washington to be susceptible to IYSV (2). Current findings expand the list of Allium spp. that are susceptible to IYSV and underscores the need for continued screening of other members of the genus to find sources of resistance to IYSV. References: (1) H. R. Pappu et al. Arch. Virol. 151:1015, 2006. (2) H. R. Pappu et al. Plant Dis. 90:378, 2006. (3) H. R. Pappu et al. Plant Dis. 92:588, 2008. (4) H. R. Pappu et al. Virus Res. 141:219, 2009.
22
Morriss, Matthew C., Leif Karlstrom, Morgan W. M. Nasholds, and John A. Wolff. "The Chief Joseph dike swarm of the Columbia River flood basalts, and the legacy data set of William H. Taubeneck." Geosphere 16, no. 4 (May 14, 2020): 1082–106. http://dx.doi.org/10.1130/ges02173.1.
Full textAbstract:
Abstract The Miocene Columbia River Basalt Group (CRBG) is the youngest and best studied continental flood basalt province on Earth. The 210,000 km3 of basaltic lava flows in this province were fed by a series of dike swarms, the largest of which is the Chief Joseph dike swarm (CJDS) exposed in northeastern Oregon and southwestern Washington. We present and augment an extensive data set of field observations, collected by Dr. William H. Taubeneck (1923–2016; Oregon State University, 1955–1983); this data set elucidates the structure of the CJDS in new detail. The large-scale structure of the CJDS, represented by 4279 mapped segments mostly cropping out over an area of 100 × 350 km2, is defined by regions of high dike density, up to ∼5 segments/km−2 with an average width of 8 m and lengths of ∼100–1000 m. The dikes in the CJDS are exposed across a range of paleodepths, from visibly feeding surface flows to ∼2 km in depth at the time of intrusion. Based on extrapolation of outcrops, we estimate the volume of the CJDS dikes to be 2.5 × 102–6 × 104 km3, or between 0.1% and 34% of the known volume of the magma represented by the surface flows fed by these dikes. A dominant NNW dike segment orientation characterizes the swarm. However, prominent sub-trends often crosscut NNW-oriented dikes, suggesting a change in dike orientations that may correspond to magmatically driven stress changes over the duration of swarm emplacement. Near-surface crustal dilation across the swarm is ∼0.5–2.7 km to the E-W and ∼0.2–1.3 km to the N-S across the 100 × 350 km region, resulting in strain across this region of 0.4%–13.0% E-W and 0.04%–0.3% N-S. Host-rock partial melt is rare in the CJDS, suggesting that only a small fraction of dikes were long-lived.
23
Rashidi, Armin, Kiran R. Vij, Richard S. Buller, Kristine M. Wylie, Gregory A. Storch, and John F. DiPersio. "The Value of Tissue Polymerase Chain Reaction Testing for the Diagnosis of Tissue-Invasive Cytomegalovirus Disease Following Allogeneic Hematopoietic Cell Transplantation." Blood 128, no. 22 (December 2, 2016): 3420. http://dx.doi.org/10.1182/blood.v128.22.3420.3420.
Full textAbstract:
Abstract Background: CMV disease is a major complication of allogeneic hematopoietic cell transplantation (HCT). Our widely used diagnostic modalities (H&E-based morphology and CMV IHC) are suboptimal in accuracy and frequently equivocal. Furthermore, current therapies for CMV disease are toxic and can cause serious complications such as prolonged neutropenia or progressive renal insufficiency. As a result, more accurate diagnosis that would help avoid potentially toxic treatments in patients who are truly negative for disease is highly desirable. The purpose of this study was to evaluate whether CMV PCR performed on formalin-fixed paraffin-embedded (FFPE) tissue offers additional diagnostic value to H&E/IHC in allogeneic HCT recipients. Methods: Following the approval by our institutional review board, the electronic medical records of all adult patients who underwent an allogeneic HCT at Washington University School of Medicine (St. Louis, MO) between 2010 and 2015 and had a post-transplant upper/lower endoscopy were retrospectively reviewed. An additional inclusion criterion was the availability of CMV DNA PCR on the blood within 7 days of biopsy.FFPE specimens were reviewed by a pathologist who was blinded to clinical and molecular results. The specimens were reviewed for H&E-based morphology and IHC findings. Tissue PCR was performed by a laboratory technician who was blinded to clinical, H&E, and IHC findings. Results: A total of 151 samples were included. Concurrent CMV viremia was present in 38% of cases. According to H&E/IHC results, cases were classified as double-positive (n = 17), double-negative (n = 105), or equivocal (n = 29) (Table 1). In receiver operating characteristic curve analysis for classification of H&E/IHC-concordant cases using tissue PCR, the optimal cycle threshold (Ct) value was 40 (area under the curve = 0.91, P < 0.001, sensitivity 94%, specificity 79%, positive predictive value 42%, and negative predictive value 99%; Figure 1). Using this cutoff, 45% of equivocal cases were classified as negative, suggesting that anti-CMV treatment in almost half of H&E/IHC-equivocal cases is unnecessary and potentially detrimental. Among viremic, H&E/IHC-concordant cases, tissue PCR with a cutoff Ct of 40 had a sensitivity of 100%, specificity of 50%, PPV of 44%, and NPV of 100%. Among non-viremic, H&E/IHC-concordant cases, these numbers were 80%, 91%, 36%, and 99%, respectively. In this analysis on viremic cases, all double-positive and 50% of double-negative cases were classified positive, while 31% of equivocal cases were classified negative. In non-viremic patients, 91% of double-negatives, 20% of double-positives, and 62% of equivocal cases were classified negative. Conclusions: Tissue PCR is a useful adjunct to H&E and IHC, particularly in H&E/IHC-equivocal cases, and can help avoid unnecessary, potentially toxic, anti-CMV treatment in cases without tissue-invasive disease. We propose the following algorithm: (i) If the cost and labor associated with tissue PCR on all patients are prohibitive, start with H&E and IHC. Perform tissue PCR in H&E/IHC-equivocal cases and consider this test also in non-viremic, H&E/IHC-positive cases. In all other cases forgo tissue PCR. (ii) If the cost and labor are not prohibitive, perform PCR on all cases. A negative PCR rules out CMV disease. In PCR-positive cases, use H&E/IHC results and treat only if H&E and IHC are both positive. One limitation of our study is related to using FFPE specimens rather than the real-life fresh tissue. Our results warrant testing in prospective studies. Disclosures DiPersio: Incyte Corporation: Research Funding.
24
Dung, J. K. S., L. M. Carris, and P. B. Hamm. "First Report of Ustilago cynodontis Causing Smut of Cynodon dactylon in Washington State, United States." Plant Disease 98, no. 2 (February 2014): 280. http://dx.doi.org/10.1094/pdis-05-13-0560-pdn.
Full textAbstract:
Bermudagrass (Cynodon dactylon) is an important warm-season perennial turf and forage grass that is typically grown in warm, tropical and subtropical climates. Smutted inflorescences of bermudagrass were observed and collected in Benton County, Washington, United States, in October of 2012 in an unmanaged, naturalized area located near the banks of the Columbia River and adjacent to large expanses of managed turf containing bermudagrass. The climate in this area is favorable to bermudagrass due to the relatively mild winters and hot, dry summers that usually occur in this region. The infected plants occurred in patches alongside healthy plants and several disease foci were observed along a 100-m transect of non-contiguous bermudagrass. The disease was severe wherever it occurred. Diseased inflorescences were covered with black-brown teliospores, distorted, and frequently failed to fully emerge and develop. Teliospores (n = 80) were irregularly globose to subglobose, 5.3 to 7.0 × 4.5 to 6.2 μm (mean 6.4 × 5.9 μm) and 6.2 to 8.8 × 5.3 to 7.0 μm (mean 7.0 × 6.5 μm), with a smooth wall approximately 1 μm thick, and were consistent with previous descriptions of Ustilago cynodontis teliospores (1,3). Teliospores germinated within 24 h when plated on 0.2% malt agar at 16°C and produced 4-celled basidia in a 3+1 arrangement, also consistent with U. cynodontis (3). Basidia gave rise to lateral and terminal, ovoid to long ellipsoidal basidiospores. Basidiospores budded or germinated by hyphae from which lateral or terminal aerial sporidia developed as previously described (3,4). DNA was extracted from sporidia of three single-spored isolates grown in malt extract broth. Complete nucleotide sequences of the 5.8S ribosomal RNA coding region and partial sequences of the internal transcribed spacer (ITS) regions 1 and 2 were obtained from the three isolates using ITS1 and ITS4 primers. The corresponding regions of the three aligned sequences (GenBank Accession Nos. KC920742 to KC920744) were identical and exhibited 99 to 100% identity with U. cynodontis strains previously deposited in GenBank (HM143013, AY740168, AF038825, and AY345000). Representative specimens were deposited in the WSU Mycological Herbarium as WSP 72345 to WSP 72348. This is the first report of U. cynodontis causing smut on bermudagrass in Washington State and represents the northernmost record of this fungus in North America (2). The occurrence of U. cynodontis in Washington State suggests that the pathogen may exist in other hot and dry areas of northwestern North America where bermudagrass is found associated with turf in recreational, landscape, or natural settings. References: (1) S. D. Brook. Trans. R. Soc. N. Z. 84:643, 1957. (2) D. F. Farr and A. Y. Rossman. Fungal Databases, Systematic Mycology and Microbiology Laboratory, ARS, USDA. Online. Retrieved from http://nt.ars-grin.gov/fungaldatabases , April 18, 2013. (3) C. T. Ingold. Trans. Br. Mycol. Soc. 83:251, 1984. (4) C. T. Ingold. Trans. Br. Mycol. Soc. 89:471, 1987.
25
Gelles, Richard J. "Reason to Hope: A Psychosocial Perspective On Violence and Youth, edited by Leonard D. Eron, Jacqueline H. Gentry, and Peggy Schlegel. Washington DC, American Psychological Association." Aggressive Behavior 22, no. 4 (1996): 311–13. http://dx.doi.org/10.1002/(sici)1098-2337(1996)22:4<311::aid-ab7>3.0.co;2-n.
Full text
26
Mock, Amy. "Book Review : Teaching About Job Hazards: A Guide for Workers and Their Health Providers, N. Wallerstein and H. Rubinstein, American Public Health Association, Washington, D.C., 1993, 170 pp." Health Education Quarterly 21, no. 1 (April 1994): 127–29. http://dx.doi.org/10.1177/109019819402100112.
Full text
27
Rawlings, Meredith. "Nobody’s Perfect Living and Growing with Children who have Special Needs. N. Miller (1994). Baltimore, Washington, D.C.: Paul H Brookes Publishers Australian Distributors: Maclennan and Petty Price: $49.00." Australasian Journal of Special Education 19, no. 1 (1995): 65. http://dx.doi.org/10.1017/s1030011200023344.
Full text
28
Smiley, R. W., G. P. Yan, and Z. A. Handoo. "First Record of the Cyst Nematode Heterodera filipjevi on Wheat in Oregon." Plant Disease 92, no. 7 (July 2008): 1136. http://dx.doi.org/10.1094/pdis-92-7-1136b.
Full textAbstract:
Plant and soil samples from an irrigated winter wheat (Triticum aestivum) field near Imbler (Union County), OR were evaluated for root diseases during April 2007. The field exhibited patches with as much as 90% plant mortality. Previous crops were winter wheat (2004), chickpea (Cicer arietinum, 2005), and spring wheat (cv. Jefferson, 2006). Stubble was baled and removed, and the field was cultivated before replanting to winter wheat cv. Chukar in October. Patches of stunted seedlings (three- to five-leaf stage) appeared in March 2007. Stunted seedlings exhibited chlorotic or necrotic lower leaves, healthy younger leaves, few or no tillers, rotting of lower culms and crowns, and light brown roots with little or no branching. Signs and symptoms of fungal pathogens (Pythium spp., Gaeumannomyces graminis var. tritici, Rhizoctonia solani AG-8, and Typhula incarnata) were present on affected plants. Most small grain fields in Union County are infested with Heterodera avenae (4) but none of the roots, on either healthy or stunted plants, exhibited the bushy branching pattern typical of sites where H. avenae females penetrate and encyst. Extraction of motile nematodes (Whitehead tray method) from soil revealed high populations of Pratylenchus neglectus (6,560/kg of soil), Tylenchorhynchus spp. (2,369/kg of soil), and a species initially thought to be H. avenae (3,098 juveniles/kg of soil). Cysts were also extracted. During PCR-restriction fragment length polymorphism identification (1) of H. avenae collected in Oregon, Washington, and Idaho, four restriction enzymes applied to amplified DNA of cysts from the Imbler field consistently revealed a pattern identical to that of a H. filipjevi DNA standard and distinct from patterns of H. avenae, H. schachtii, and H. latipons. DNA standards were obtained from R. Rivoal, INRA, Rennes, France. Morphological evidence confirmed that the specimens were H. filipjevi, a member of the ‘H. avenae Group’ of cereal cyst nematodes (2,3). Measurements of second-stage juveniles (n = 15) included length of body (range = 530 to 570 μm, mean = 549, st. dev. = 13.0), stylet (22.5 to 24.5, 23.2, 0.6) with anchor-shaped basal knobs, tail (52.5 to 62.5, 57.4, 2.7), and hyaline tail terminal (30 to 38, 33.5, 2.6). The lateral field had four lines of which the inner two were more distinct. Shapes of the tail, tail terminus, and stylet knobs were also consistent with H. filipjevi. Cysts (n = 10) were lemon shaped and light brown. The cyst wall had a zigzag pattern. The vulval cone was bifenestrate with horseshoe-shaped semifenestra. The cysts were characterized by body length including neck (range = 718 to 940 μm, mean = 809.7, st. dev. = 61.8), body width (395 to 619, 504, 71.2), L/W ratio = (1.1 to 2.2, 1.4, 0.3), neck length (75 to 140, 103.2, 22.1) and width (50 to 95, 71.4, 10.9), fenestra length (50 to 65 μm, 56.5, 6.6) and width (27 to 40, 29.0, 3.8), heavy underbridge (60 to 80, 69, 8.5), vulval slit (7.5 to 8.5, 7.8, 0.4), and many bullae. As described for H. filipjevi, cysts hatched much more readily and at lower temperatures than populations of H. avenae. Detection of H. filipjevi in Oregon represents a new record for the occurrence of this species in the United States and for North America. The pathotype and resistance genes for incorporation into wheat, barley, and oat are being identified. References: (1) S. Bekal et al. Genome 40:479, 1997. (2) Z. A. Handoo. J. Nematol. 34:250, 2002. (3) R. Holgado et al. J. Nematol. Morphol. Syst. 7:77, 2004. (4) R. W. Smiley et al. J. Nematol. 37:297, 2005.
29
Dung, J. K. S., D. A. Johnson, and B. K. Schroeder. "First Report of Pectobacterium wasabiae Causing Aerial Stem Rot of Potato in Washington State." Plant Disease 96, no. 12 (December 2012): 1819. http://dx.doi.org/10.1094/pdis-05-12-0444-pdn.
Full textAbstract:
Aerial stem rot of potato (Solanum tuberosum), also known as bacterial stem rot, is often caused by the pectolytic bacteria Pectobacterium (Erwinia) carotovorum subsp. carotovorum, P. atrosepticum, or Dickeya spp. (3). A survey was carried out in August 2008 in ‘Russet Burbank’ potato fields exhibiting aerial stem rot symptoms in the Columbia Basin of Washington State. One bacterial strain isolated during the survey, PwO405, exhibited pectolytic ability on crystal violet pectate (CVP) agar and potato slices and failed to grow at 37°C, but physiological tests did not conclusively distinguish the bacterium as P. atrosepticum (1). The bacterium was positive for ONPG, N-acetylglucosaminyl transferase, gelatin liquefaction, and acid production from D-galactose, lactose, melibiose, raffinose, citrate, and trehalose. The bacterium was negative for indole production and acid production from maltose, α-methyl-D-glucoside, sorbitol, D-arabitol, inositol, inulin, and melezitose. Molecular identification of the bacterium was performed with 16S rRNA, aconitase (acnA), and malate dehydrogenase (mdh) coding sequences as previously described (2,4). Partial sequences of 16S rRNA (1,408 bp) and acnA (412 bp) genes (GenBank Accession Nos. JQ723958 and JQ723959, respectively) exhibited 99% shared identities with P. wasabiae strain WPP163, while the mdh sequence (435 bp) (GenBank Accession No. JQ723960) exhibited 100% shared identity with mdh sequences from three P. wasabiae strains (NZEC9, NZEC10, and NZEC8974). Maximum parsimony analysis using concatenated acnA and mdh sequences from this study and Pectobacterium sequences previously deposited in GenBank (2,4) clustered strain PwO405 with other P. wasabiae strains. Three 7-week-old ‘Russet Norkotah’ potato plants were wound-inoculated by inserting a sterile 23 gauge needle just above a central leaf axil at a depth of 1 mm. A 10-μl drop of inoculum (104 CFU) was placed on the wound. Plants were exposed to a 24-h leaf wetness period (90 to 100% RH in a mist chamber) and lesions were measured. All three inoculated plants exhibited aerial stem rot symptoms similar to those observed in the field, including brown water-soaked lesions that spread acropetally and basipetally. Upon drying, the lesions became shriveled and turned dark brown to black. Some plants exhibited hollowing of the stems and unilateral wilt on the side of the lesion. Symptoms were not observed on water-inoculated controls. The bacteria that were reisolated into pure culture from all three inoculated stems caused pitting on CVP and exhibited the same morphology as the original culture and were confirmed as P. wasabiae using 16S rRNA, acnA, and mdh coding sequences, fulfilling Koch's postulates. Stem rot ability of the bacterium was also confirmed on four potato cultivars: ‘Ranger Russet,’ ‘Russet Burbank,’ ‘Russet Norkotah,’ and ‘Umatilla Russet’ by wound-inoculating six single-stem plants of each cultivar as described above. To our knowledge, this is the first report of aerial stem rot of potato caused by P. wasabiae in Washington State. References: (1) S. De Boer and A. Kelman. Page 56 in: Laboratory Guide for Identification of Plant Pathogenic Bacteria, 3rd ed. N. Schaad et al., ed. APS Press, St. Paul, 2001. (2) A. Pitman et al. Eur. J. Plant Pathol. 32:211, 2010. (3) M. Powelson and G. Franc. Page 10 in: Compendium of Potato Diseases. W. Stevenson et al., ed. APS Press, St. Paul, 2002. (4) M. Yap et al. Appl. Environ. Microbiol. 70:3013, 2004.
30
Goodyear, Albert C. "Lindenmeier, 1934—1974: Concluding Report on Investigations. Edwin N. Wilmsen and Frank H. H. RobertsJr. , Smithsonian Contributions to Anthropology, No. 24, Smithsonian Institution Press, Washington, D.C., 1984. xvi + 187 pp., figures, maps, tables, appendix, literature cited. $27.50 (paper)." American Antiquity 51, no. 1 (January 1986): 205. http://dx.doi.org/10.2307/280434.
Full text
31
Finlay, M., M. Wilson, J. A. Erwin, D. A. Hansen, M. E. Layton, R. M. Quock, and H. Van Dongen. "0730 Individuals Receiving Methadone For Medication-Assisted Treatment Of Opioid Use Disorder Show Evidence Of Respiratory Depression." Sleep 43, Supplement_1 (April 2020): A278. http://dx.doi.org/10.1093/sleep/zsaa056.726.
Full textAbstract:
Abstract Introduction A well-established consequence of opiate use is respiratory depression during sleep, with a high prevalence of central sleep apneas. Medication-assisted treatment (MAT) is a widely used therapy for opioid use disorder (OUD) designed to reduce withdrawal symptoms and drug cravings. We investigated the presence of respiratory depression during sleep in patients receiving methadone-based opioid replacement treatment as part of a MAT program for OUD. Methods N=6 individuals (5 females, ages 43.8±12.8y, BMI 27.2±4.1kg/m2), who were within 90 days of methadone initiation, underwent in-laboratory overnight polysomnography (8h TIB, 22:00-06:00). Apneaic and hypopneic events were determined using AASM criteria. Results The average Apnea-Hypopnea Index (AHI) was 16.5±9.0 events/h, with 2 individuals exceeding the threshold of moderate sleep apnea (>15 events/h). 89.5% of the observed apnea-hypopnea events occurred during NREM sleep. Of all events, 57.1±16.3% were central apneas; and of all obstructive, central, and mixed apnea events, 93.0±14.3% were central apneas. Conclusion Individuals with OUD receiving methadone-based MAT may be at risk of respiratory depression during sleep, as evidenced by the frequent occurrence of central sleep apneas. Such risk could be a contributing factor in opioid overdose deaths. Currently, performing respiratory assessments during sleep is not considered standard of care in MAT programs. Our preliminary data suggest that monitoring and treatment of respiratory depression during sleep may be indicated in OUD patients on methadone-based MAT. Support Supported in part by a seed grant from the Washington State University Office of Research Advancement and Partnerships.
32
Repasky, Kevin S., John A. Reagan, Amin R. Nehrir, David S. Hoffman, Michael J. Thomas, John L. Carlsten, Joseph A. Shaw, and Glenn E. Shaw. "Observational Studies of Atmospheric Aerosols over Bozeman, Montana, Using a Two-Color Lidar, a Water Vapor DIAL, a Solar Radiometer, and a Ground-Based Nephelometer over a 24-h Period." Journal of Atmospheric and Oceanic Technology 28, no. 3 (March 1, 2011): 320–36. http://dx.doi.org/10.1175/2010jtecha1463.1.
Full textAbstract:
Abstract Coordinated observational data of atmospheric aerosols were collected over a 24-h period between 2300 mountain daylight time (MDT) on 27 August 2009 and 2300 MDT on 28 August 2009 at Bozeman, Montana (45.66°N, 111.04°W, elevation 1530 m) using a collocated two-color lidar, a diode-laser-based water vapor differential absorption lidar (DIAL), a solar radiometer, and a ground-based nephelometer. The optical properties and spatial distribution of the atmospheric aerosols were inferred from the observational data collected using the collocated instruments as part of a closure experiment under dry conditions with a relative humidity below 60%. The aerosol lidar ratio and aerosol optical depth retrieved at 532 and 1064 nm using the two-color lidar and solar radiometer agreed with one another to within their individual uncertainties while the scattering component of the aerosol extinction measured using the nephelometer matched the scattering component of the aerosol extinction retrieved using the 532-nm channel of the two-color lidar and the single-scatter albedo retrieved using the solar radiometer. Using existing aerosol models developed with Aerosol Robotic Network (AERONET) data, a thin aerosol layer observed over Bozeman was most likely identified as smoke from forest fires burning in California; Washington; British Columbia, Canada; and northwestern Montana. The intrusion of the thin aerosol layer caused a change in the atmospheric radiative forcing by a factor of 1.8 ± 0.5 due to the aerosol direct effect.
33
Shahzad, Moazzam, Muhammad Arslan, Zehra Naseem, Sakina Abbas, Naira Fatima, Ali Hussain, Tayyaba Ali, et al. "Top 100 Cited Articles on Hematopoietic Stem Cell Transplantation: A Bibliometric Analysis." Blood 138, Supplement 1 (November 5, 2021): 4790. http://dx.doi.org/10.1182/blood-2021-145500.
Full textAbstract:
Abstract Background: Research performance is evaluated by bibliometric analysis of citations, and this can help to identify the most impactful articles in the field of hematopoietic stem cell transplantation (HSCT). We conducted a bibliometric analysis to identify scholarly impact and factors associated with the top 100 cited articles on HSCT. Methods: Thomas Reuters Web of Science core collection (WoS) was accessed in January 2021 and a title-specific search was conducted using the keywords "hematopoietic stem-cell transplantation ", "transplantation, hematopoietic stem cell," "stem cell transplantation, hematopoietic," "bone-marrow transplantation," "transplantation, bone marrow," "grafting, bone marrow," "transplantation bone marrow cell," "bone marrow cell transplantation," "stem cell transplant," "allogeneic hematopoietic stem cell transplant," "autologous hematopoietic stem cell transplant". Non-Human and non-HSCT studies were excluded. A total of 39,406 records were identified and a list of the top 100 articles was made. Articles included in our study were characterized by the number of citations, year of publication, topic, study design, authors, h-index, and institutions. Data were analyzed using SPSS in April 2021. Bivariate analyses, using chi-square and t-test, and linear regression analyses were performed. Results: The 100 most cited articles in the field were published over 52 years from 1968 to 2020, with a maximum number of articles (n=40) published in the 1990s decade. Top-100 articles were cited 62,002 times with a median citation count of 465 (range 336-2240). The top-cited articles originated from 12 countries and the United States (US) contributed 69 articles. The University of Washington Fred Hutchinson Cancer Center (n=15) was the leading institution. Blood (n=32) and New England Journal of Medicine (n=31) made the greatest contribution, and 41 manuscripts were clinical trials. In a multivariate regression model, the first author's h-index (regression coefficient 5.46, 95% confidence interval 2.99-7.93, p<0.001) correlated with the citation count while gender, journal impact factor, years since publication, and the number of authors did not have a significant association. Conclusion: Our study highlights the most influential articles on clinical HSCT, centralization of research to North American and European institutions, and provides valuable insight for future research needs of the specialty. Figure 1 Figure 1. Disclosures Abhyankar: Incyte/Therakos: Consultancy, Research Funding, Speakers Bureau. McGuirk: Novartis: Research Funding; Pluristem Therapeutics: Research Funding; Juno Therapeutics: Consultancy, Honoraria, Research Funding; Astelllas Pharma: Research Funding; Magenta Therapeutics: Consultancy, Honoraria, Research Funding; Allovir: Consultancy, Honoraria, Research Funding; Gamida Cell: Research Funding; EcoR1 Capital: Consultancy; Bellicum Pharmaceuticals: Research Funding; Novartis: Research Funding; Fresenius Biotech: Research Funding; Kite/ Gilead: Consultancy, Honoraria, Other: travel accommodations, expense, Kite a Gilead company, Research Funding, Speakers Bureau.
34
Alpert, Peter. "Invasive Species in the Pacific Northwest. Edited by P D Boersma, , S H Reichard, and , A N Van Buren; photographs edited by Rebecca L Gamboa. Seattle (Washington): University of Washington Press. $29.95 (paper). xxvi + 285 p; ill.; no index. ISBN: 0‐295‐98596‐8. 2006." Quarterly Review of Biology 82, no. 3 (September 2007): 302–3. http://dx.doi.org/10.1086/523200.
Full text
35
Yunita Murdiyaningrum and Novrian Satria Perdana. "Operational Cost Requirements Analysis in Early Childhood Education." JPUD - Jurnal Pendidikan Usia Dini 14, no. 1 (April 30, 2020): 58–70. http://dx.doi.org/10.21009/jpud.141.05.
Full textAbstract:
The government is attempting to obtain the access of Early Childhood Education pro- grams providing educational assistance. Unfortunately, the government has spent funds to calculate the unit costs that should not occur in the real world of education. In consequence, the aims of this study are to (1) calculate the amount of operational unit costs for Early Childhood Education pro- grams, and (2) enumerate variations and projections of the amount of the operational unit costs in Early Childhood Education programs by region category. This study uses quantitative data with pop- ulation of all Early Childhood Education institutions in Indonesia. The unit of analysis of this re- search is Early Childhood Education institutions consisting of kindergarten, Playgroup, Daycare, and ECCD units. The findings are that the highest operating unit cost is in TPA because there is a full day of service. Next is a Kindergarten institution because at this institution already has a special curriculum to prepare the child proceed to the level of basic education. Then the unit cost is the highest area in the eastern region. Recommendation in determining the amount of financial assistance it is necessary to consider the amount of operational unit costs so that the purpose of providing fi- nancial assistance is to improve access and quality can be achieved.
Keywords: Early Childhood Education, Operational Unit Cost, Fund Aid
Reference
Afmansyah, T. H. (2019). Efektifitas Dan Efisiensi Pembiayaan Pendidikan. INA-Rxiv Paper. https://doi.org/10.31227/osf.io/5ysw4
Akdon. (2015). Manajemen Pembiayaan Pendidikan. Bandung: PT Remaja Rosdakarya.
Aos, S., & Pennucci, A. (2013). K–12 CLASS SIZE REDUCTIONS AND STUDENT OUTCOMES: A REVIEW OF THE EVIDENCE AND BENEFIT–COST ANALYSIS. Washington State Institute for Public Policy, (13), 1–12.
Azhari, U. L., & Kurniady, D. A. (2016). Manajemen Pembiayaan Pendidikan, Fasilitas Pembelajaran, Dan Mutu Sekolah. Jurnal Administrasi Pendidikan, 23(2).
Belsky, J., Steinberg, L., & Draper, P. (1991). Childhood experience, interpersonal development, and reproductive strategy: An evolutionary theory of socialization. Child Development, 62(4), 647.
Bijanto. (2018). Mengakreditasi PAUD dan PNF. Retrieved from
https://banpaudpnf.kemdikbud.go.id/berita/mengakreditasi-paud-dan-pnf
Brinkman, S. A., Hasan, A., Jung, H., Kinnell, A., Nakajima, N., & Pradhan, M. (2017). The role of preschool quality in promoting child development: evidence from rural Indonesia*. European Early Childhood Education Research Journal, 25(4), 483–505. https://doi.org/10.1080/1350293X.2017.1331062
Campbell-Barr, V. (2019). Interpretations of child centred practice in early childhood education and care. Compare, 49(2), 249–265. https://doi.org/10.1080/03057925.2017.1401452
Chandrawaty, Ndari, S. S., Mujtaba, I., & Ananto, M. C. (2019). Children’s Outdoor Activities and Parenting Style in Children’s Social Skill. Jurnal Pendidikan Usia Dini, 13(November), 217–231. https://doi.org/https://doi.org/10.21009/JPUD.132.02
Chrystiana, N., & Alip, M. (2014). Komponen Biaya Dan Biaya Satuan Operasi Pendidikan Taman Kanak-Kanak (Studi Kasus Di 3 Taman Kanak-Kanak). Jurnal Akuntabilitas Manajemen Pendidikan, 2(1), 70–80. https://doi.org/10.21831/amp.v2i1.2410
Denboba, A., Hasan, A., & Wodon, Q. (2015). Early Childhood Education and Development in
Indonesia. In World Bank http://ideas.repec.org/b/wbk/wbpubs/22376.html
Publications. Retrieved from
Firdaus, N. M., & Ansori, A. (2019). Optimizing Management of Early Childhood Education in Community Empowerment. Journal of Nonformal Education, 5(1), 89–96. https://doi.org/10.15294/jne.v5i1.18532
Harris, D. N. (2009). Toward policy-relevant benchmarks for interpreting effect sizes: Combining effects with costs. Educational Evaluation and Policy Analysis, 31(1), 3–29. https://doi.org/10.3102/0162373708327524
Hasan, A., Jung, H., Kinnell, A., Maika, A., Nakajima, N., & Pradhan, M. (2019). Built to Last Sustainability of Early Childhood Education Services in Rural Indonesia. Retrieved from http://www.worldbank.org/prwp.
Heckman, J. J., Moon, S. H., Pinto, R., Savelyev, P. A., & Yavitz, A. (2010). The rate of return to the HighScope Perry Preschool Program. Journal of Public Economics, 94(1–2), 114– 128. https://doi.org/10.1016/j.jpubeco.2009.11.001
Hollands, F., Bowden, A. B., Belfield, C., Levin, H. M., Cheng, H., Shand, R., ... Hanisch-Cerda, B. (2014). Cost-Effectiveness Analysis in Practice: Interventions to Improve High School Completion. Educational Evaluation and Policy Analysis, 36(3), 307–326. https://doi.org/10.3102/0162373713511850
Howard, S. J., & Melhuish, E. (2017). An Early Years Toolbox for Assessing Early Executive Function, Language, Self-Regulation, and Social Development: Validity, Reliability, and Preliminary Norms. Journal of Psychoeducational Assessment, 35(3), 255–275. https://doi.org/10.1177/0734282916633009
Institute of Medicine (Author), National Research Council (Author), Division of Behavioral and Social Sciences and Education (Author), and Families Board on Children, Youth (Author), C. on S. B.-C. M. for the E. of E. C. I. (Author). (2009). Strengthening Benefit-Cost Analysis for Early Childhood Interventions: Workshop Summary (A. Beatty, Ed.). Washington DC: National Academies Press.
Keith, R. s. (2018). The Cost of Inequality: The Importance Of Investing In High Quality Early Childhood Education Programs (University of Colorado Springs; V ol. 53). https://doi.org/10.1017/CBO9781107415324.004
Lamy, C. E. (2014). American Children in Chronic Poverty: Complex Risks, Benefit-Cost Analyses, and Untangling the Knot. United Kingdom: Lexington Books; Reprint edition.
Levin, by H. M., McEwan, P. J., Belfield, C. R., Bowden, A. B., & Shand, R. D. (2017).
Economic Evaluation in Education: Cost-Effectiveness and Benefit-Cost Analysis (Third Edit). California: Sage Publication.
Levin, H. (2001). Waiting for godot: Cost-effectiveness analysis in education. New Directions for Evaluation, 2001(90), 55–68. https://doi.org/10.1002/ev.12
Lovchinov, V. A., Mädge, H., & Christensen, A. N. (1984). On the thermodynamic properties of Vnx. In Materials Letters (Vol. 2). https://doi.org/10.1016/0167-577X(84)90080-6
Mujahidun. (2016). Pmerataan Pendidikan Anak Bangsa: Pendidikan Gratis Versus Kapitalisme Pendidikan. Tarbiyatuna, 7(1), 38–52.
Nakajima, N., Hasan, A., Jung, H., Brinkman, S., Pradhan, M., & Angela Kinnel. (2016). Investing in school readiness : an analysis of the cost-effectiveness of early childhood education pathways in rural Indonesia. World Bank Research Working Paper, (September), 1–45. Retrieved from http://documents.worldbank.org/curated/en/656521474904442550/Investing-in-school- readiness-an-analysis-of-the-cost-effectiveness-of-early-childhood-education-pathways-in- rural-Indonesia
Pidarta, M. (2013). Landasan Kependidikan Stimulus Ilmu Pendidikan Bercorak Indonesia. Jakarta: Rineka Cipta.
SISDIKNAS, U. (2003). Undang-undang Sisdiknas No 20 Tahun 2003. (1).
Suyadi, S. (2017). Perencanaan dan Asesmen Perkembangan Pada Anak Usia Dini. Golden Age: Jurnal Ilmiah Tumbuh Kembang Anak Usia Dini, 1(1), 65–74. Retrieved from http://ejournal.uin-suka.ac.id/tarbiyah/index.php/goldenage/article/view/1251
Tedjawati, J. M. (2013). Pendanaan Pendidikan Anak Usia Dini. Jurnal Pendidikan Dan Kebudayaan, 19(3), 346. https://doi.org/10.24832/jpnk.v19i3.294
UNESCO. (2013). Why every child deserves a quality education. 1–16. Retrieved from https://unesdoc.unesco.org/ark:/48223/pf0000223826
West, A., & Noden, P. (2019). ‘Nationalising’ and Transforming the Public Funding of Early Years Education (and care) in England 1996–2017. British Journal of Educational Studies, 67(2), 145–167. https://doi.org/10.1080/00071005.2018.1478058
West, A., Roberts, J., & Noden, P. (2010). Funding Early Years Education And Care: Can A Mixed Economy Of Providers Deliver Universal High Quality Provision? British Journal of Educational Studies, 58(2), 155–179. https://doi.org/10.1080/00071000903520850
36
Mathiasen, R. L., J. R. Allison, and B. W. Geils. "Western Dwarf Mistletoe Parasitizing Colorado Blue Spruce and Norway Spruce in California." Plant Disease 82, no. 3 (March 1998): 351. http://dx.doi.org/10.1094/pdis.1998.82.3.351e.
Full textAbstract:
Western dwarf mistletoe (Arceuthobium campylopodum Engelm.), a common parasite of ponderosa pine (Pinus ponderosa Dougl. ex Laws.) and Jeffrey pine (Pinus jeffreyi Grev. & Balf.), was found parasitizing planted Colorado blue spruce (Picea pungens Engelm.) and Norway spruce (Picea abies (L.) H. Karsten) in Upper Cuddy Valley, CA (Kern County, T. 9 N., R. 21 W., Sec. 25). One tree greater than 6 m in height of each spruce species was infected and both trees were within 12 m of a Jeffrey pine severely infected with western dwarf mistletoe. Five to 10 branches were infected on each tree and a few of these had abundant mistletoe shoot production, which allowed identification of the parasite. This is the first report of western dwarf mistletoe on Colorado blue spruce. Although this is the first report of natural infection of Norway spruce in California, this mistletoe/host combination has been reported by Weir from artificial inoculation (2) and collected by Russell in central Washington (1). We recommend that these spruce species not be planted within 15 m of pines infected with western dwarf mistletoe. Specimens of western dwarf mistletoe on Colorado blue spruce and Norway spruce were collected and deposited at the Deaver Herbarium, Northern Arizona University, Flagstaff. References: (1) F. G. Hawksworth and D. Wiens. 1996. Dwarf Mistletoes: Biology, Pathology, and Systematics. USDA Agric. Handb. 709. (2) J. R. Weir. Bot. Gaz. 56:1, 1918.
37
Mabe, Nathaniel W., Min Huang, Daniel A. Schaefer, Guillermo N. Dalton, Giulia Digiovanni, Gabriela Alexe, Anna C. Geraghty, et al. "Abstract PR003: Lineage plasticity dictates responsiveness to anti-GD2 therapy in neuroblastoma." Cancer Research 82, no. 23_Supplement_2 (December 1, 2022): PR003. http://dx.doi.org/10.1158/1538-7445.cancepi22-pr003.
Full textAbstract:
Abstract Epigenetic dysregulation is frequently observed in the disease pathology of pediatric cancers, including neuroblastoma, the most common extracranial solid tumor in pediatric patients. Neuroblastoma tumors co-opt developmentally linked adrenergic or mesenchymal super-enhancer landscapes that rewire their transcriptional programs. Here, we describe that the lineage commitment to a mesenchymal epigenetic state is an important mechanism of resistance to anti-GD2 therapy through loss of GD2 antigen, a ganglioside glycolipid expressed on the cell surface. Low GD2 expression was significantly correlated with the mesenchymal state in a large panel of neuroblastoma cell lines and a forced adrenergic-to-mesenchymal transition conferred downregulation of GD2 and resistance to anti-GD2 antibody. Mechanistically, low-GD2 expressing cell lines demonstrated significantly reduced expression of the ganglioside synthesis enzyme ST8SIA1 (GD3 synthase), resulting in a bottlenecking of GD2 synthesis. Genome-wide CRISPR/Cas9 screening to identify regulators of GD2 in neuroblastoma revealed that the ablation of the polycomb repressive complex 2 (PRC2) significantly upregulates GD2 expression in GD2-low cells. Pharmacologic inhibition of EZH2 resulted in epigenetic rewiring of mesenchymal neuroblastoma cells into an adrenergic-like state, re-expressed ST8SIA1, and restored surface expression of GD2 and sensitivity to anti-GD2 antibody. These data identify developmental lineage as a key determinant of sensitivity to anti-GD2 based immunotherapies and credential PRC2 inhibitors for clinical testing in combination with anti-GD2 antibody to enhance outcomes for children with neuroblastoma. Citation Format: Nathaniel W. Mabe, Min Huang, Daniel A. Schaefer, Guillermo N. Dalton, Giulia Digiovanni, Gabriela Alexe, Anna C. Geraghty, Delan Khalid, Marius M. Mader, Michal Sheffer, Miles H. Linde, Nghi Ly, Maria Caterina Rotiroti, Benjamin A. H. Smith, Marius Wernig, Carolyn R. Bertozzi, Michelle Monje, Constantine Mitsiades, Ravindra Majeti, Ansuman T. Satpathy, Kimberly Stegmaier, Robbie G. Majzner. Lineage plasticity dictates responsiveness to anti-GD2 therapy in neuroblastoma. [abstract]. In: Proceedings of the AACR Special Conference: Cancer Epigenomics; 2022 Oct 6-8; Washington, DC. Philadelphia (PA): AACR; Cancer Res 2022;82(23 Suppl_2):Abstract nr PR003.
38
Powell, M., B. Gundersen, C. Miles, K. Coats, and D. A. Inglis. "First Report of Verticillium Wilt on Lettuce (Lactuca sativa) in Washington Caused by Verticillium tricorpus." Plant Disease 97, no. 7 (July 2013): 996. http://dx.doi.org/10.1094/pdis-12-12-1166-pdn.
Full textAbstract:
Symptoms of Verticillium wilt were observed on lettuce (Lactuca sativa L.) harvested from high tunnel and open field experimental plots in annual, consecutive spring plantings in western Washington from 2010 to 2012. Leaves had v-shaped, chlorotic lesions, and yellow or brown vascular tissue was noted in the crowns. Total disease incidence increased from 0.2% in 2010 to 1.9% in 2011 and to 14.4% in 2012. Verticillium spp. obtained from infected crown tissues and cultured on half-strength potato dextrose agar medium produced yellow pigment, black microsclerotia, white mycelia, tan chlamydospores, and uniseptate conidia averaging 10.6 × 3.7 μm. Isolates were identified tentatively as Verticillium tricorpus I. (3). Three isolates, Vt.Ls.2010, Vt.Ls.2011-1, and Vt.Ls.2011-2, were evaluated for pathogenicity on 4-week-old ‘Coastal Star’ seedlings in two greenhouse trials. In Trial I, four replicates of two duplicate plants per each isolate, and in Trial II, five replicates of one plant per each isolate were inoculated with conidial suspensions adjusted to 2.0 × 106 and 5.0 × 106 conidia/ml, respectively. Additionally, in each trial, two sets of control treatments of five plants each were inoculated with either an isolate of V. dahliae at the same conidial concentration or with sterile water. Root tips were cut and exposed to the suspensions for 5 s, then seedlings were transplanted into Sunshine Mix #1 (SunGro Horticulture Distribution Inc., Bellevue, WA), and kept in a greenhouse at 17.7 ± 3.4°C. Plants were harvested 8 to 9 weeks post-inoculation, and symptoms were rated visually. Vt.Ls.2010, Vt.Ls.2011-1, and Vt.Ls.2011-2 caused chlorosis and vascular discoloration on 25, 13, and 13% of the plants in Trial I; and 40, 60, and 20% of plants in Trial II, respectively. V. dahliae caused similar symptoms on 25 and 40% of the plants in the two trials, respectively, but these plants had greater intensity and length of vascular discoloration compared with the three test isolates. None of the water control plants were symptomatic. All V. tricorpus isolates were recovered from inoculated plants, and colony morphologies were similar to the original isolates. The internal transcribed spacer (ITS) rDNA of isolate Vt.Ls.2010 was amplified with ITS4 and ITS6 primer sets. ITS rDNA sequences between Vt.Ls.2010 and two isolates of V. tricorpus in GenBank (Accession Nos. FJ900211 and AB353343) were 100% identical. V. tricorpus is considered a weak pathogen of lettuce crops in California (2), but authors in Japan recently reported pathogenic isolates of V. tricorpus on lettuce (4). To our knowledge, this is the first report of Verticillium wilt caused by V. tricorpus in Washington. Lettuce is the number two crop grown in high tunnels in the United States (1), and cropping lettuce continuously in them can increase the risk of this and other soilborne pathogens. References: (1) E. E. Carey et al. HortTechnology 19:37, 2009. (2) Q.-M. Qin et al. Plant Dis. 92:69, 2008. (3) H. C. Smith. N. Z. J. Agric. Res. 8:450, 1965. (4) T. Usami et al. J. Gen. Plant Pathol. 77:17, 2010.
39
Sudhakar, N., D. Nagendra-Prasad, N. Mohan, and K. Murugesan. "First Report of Cucumber mosaic virus Subgroup II Infecting Lycopersicon esculentum in India." Plant Disease 90, no. 11 (November 2006): 1457. http://dx.doi.org/10.1094/pd-90-1457b.
Full textAbstract:
During a survey in January 2006 near Salem in Tamil Nadu (south India), Cucumber mosaic virus was observed infecting tomatoes with an incidence of more than 70%. Plants exhibiting severe mosaic, leaf puckering, and stunted growth were collected, and the virus was identified using diagnostic hosts, evaluation of physical properties of the virus, compound enzyme-linked immunosorbent assay (ELISA) (ELISA Lab, Washington State University, Prosser), reverse-transcription polymerase chain reaction (RT-PCR), and restriction fragment length polymorphism analysis (DSMZ, S. Winter, Germany). To determine the specific CMV subgroup, total RNA was extracted from 50 infected leaf samples using the RNeasy plant RNA isolation kit (Qiagen, Hilden, Germany) and tested for the presence of the complete CMV coat protein gene using specific primers as described by Rizos et al. (1). A fragment of the coat protein was amplified and subsequently digested with MspI to reveal a pattern of two fragments (336 and 538 bp), indicating CMV subgroup II. No evidence of mixed infection with CMV subgroup I was obtained when CMV isolates representing subgroups I (PV-0419) and II (PV-0420), available at the DSMZ Plant Virus Collection, were used as controls. Only CMV subgroup I has been found to predominantly infect tomato in the Indian subcontinent, although Verma et al. (2) identified CMV subgroup II infecting Pelargonium spp., an ornamental plant. To our knowledge, this is the first report of CMV subgroup II infecting tomato crops in India. References: (1) H. Rizos et al. J. Gen. Virol. 73:2099, 1992. (2) N. Verma et al. J. Biol. Sci. 31:47, 2006.
40
Sabelli, C., P. Orlandi, and G. Vezzalini. "Coquandite, Sb6O8(SO4).H2O, a new mineral from Pereta, Tuscany, Italy, and two other localities." Mineralogical Magazine 56, no. 385 (December 1992): 599–603. http://dx.doi.org/10.1180/minmag.1992.056.385.16.
Full textAbstract:
AbstractCoaquandite, a new antimony oxy-sulphate hydrate, occurs as spheroidal knobs of silky fibres or, rarely, as tiny transparent colourless lamellar crystals on stibnite at the Pereta mine, Tuscany, Italy; it is associated with klebelsbergite, peretaite, valentinite, sulfur, gypsum, stibiconite, and senarmontite. Coquandite is triclinic P1, with a 11.434(7), b 29.77(4), c 11.314(4) Å, α 91.07(7)°, β 119.24(3)° γ 92.82(1)° . It has a cell volume of 3352(5)Å3 with Z = 12 and a calculated density of 5.78 g cm−3. The crystals, elongated along [001] and flattened on {010}, display polysynthetic twinning with (010) as the twin plane. Optically, they are biaxial (+) with z ≈ c, 2V ≫ 60° n = 2.08(5). The strongest lines of the X-ray powder pattern are [d in Å, (I), (hkl)] 14.84(50)(020), 9.27(41)(111, 110), 6.81(67)130, 3.304(93)(090), 3.092(100)(330).Coquandite has also been found at the Cetine mine, Tuscany, Italy, and at the Lucky Knock mine, Tonasket, Okanogan County, Washington, USA. 22 microprobe chemical analyses (elemental microanalysis for H) gave Sb2O3 88.91, SO3 8.35, CaO 0.04, Na2O 0.03, H2O 1.43, total 98.76 wt.%, corresponding to the empirical formula (Sb + S = 7) Sb5.98Ca0.01Na0.01O7.96(SO4)1.02.0·78H2O, and to the idealised formula Sb6O8(SO4).H2O. The I.R. spectrum, which confirms the presence of water in the formula, is given.A partial structural arrangement is also given: the Sb polyhedra lie in nine layers perpendicular to [010] and form 'hexagonally' shaped groups surrounded by SO4 tetrahedra.
41
Kruk, Michael C., Kyle Hilburn, and John J. Marra. "Using Microwave Satellite Data to Assess Changes in Storminess over the Pacific Ocean." Monthly Weather Review 143, no. 8 (August 1, 2015): 3214–29. http://dx.doi.org/10.1175/mwr-d-14-00280.1.
Full textAbstract:
Abstract This study analyzes 25 years of Special Sensor Microwave Imager (SSM/I) retrievals of rain rate and wind speed to assess changes in storminess over the open water of the Pacific Ocean. Changes in storminess are characterized by combining trends in both the statistically derived 95th percentile exceedance frequencies of rain rate and wind speed (i.e., extremes). Storminess is computed annually and seasonally, with further partitioning done by phase of the El Niño–Southern Oscillation (ENSO) index and the Pacific decadal oscillation (PDO) index. Overall, rain-rate exceedance frequencies of 6–8 mm h−1 cover most of the western and central tropical Pacific, with higher values present around the Philippines, Japan, Mexico, and the northwest coast of Australia. Wind speed exceedance frequencies are a strong function of latitude, with values less (greater) than 12 m s−1 equatorward (poleward) of 30°N/S. Statistically significant increasing trends in rain rate were found in the western tropical Pacific near the Caroline Islands and the Solomon Islands, and in the extratropics from the Aleutian Islands down the coast along British Columbia and Washington State. Statistically significant increasing trends in wind speed are present in the equatorial central Pacific near Kiribati and the Republic of the Marshall Islands (RMI), and in the extratropics along the west coast of the United States and Canada. Thus, while extreme rain and winds are both increasing across large areas of the Pacific, these areas are modulated according to the phase of ENSO and the PDO, and their intersection takes aim at specific locations.
42
Täufel, A. "Enzymatic Degradation of Insoluble Carbohydrates. ACS Symposium Series 618. Edited by J. N. Saddler and M. H. Penner. IX and 374 pages, numerous figures and tables. American Chemical Society, Washington, DC, 1995. Price 91.95 $." Food / Nahrung 41, no. 4 (1997): 246. http://dx.doi.org/10.1002/food.19970410419.
Full text
43
Coulter, John. "Integrating Biodiversity in Agricultural Intensification: Towards Sound Practices. By J. P. Srivastava, N. J. H. Smith and D. A. Forno. Washington DC: The World Bank (1999), pp. 41, US$22.00. ISBN 0-8213-4263-0." Experimental Agriculture 36, no. 4 (October 2000): 521. http://dx.doi.org/10.1017/s0014479700301089.
Full text
44
Pujianti, Yuli, Hapidin Hapidin, and Indah Juniasih. "The The Effectiveness of Using Mind Mapping Method to Improve Child Development Assessment." JPUD - Jurnal Pendidikan Usia Dini 13, no. 1 (April 30, 2019): 172–86. http://dx.doi.org/10.21009/10.21009/jpud.131.13.
Full textAbstract:
This study aims to determine the effectiveness of using mind mapping method in improving early childhood educator’s skill in mastering the child development assessment. This research is quasi-experimental using a pre-test and post-test design. The population was the entire classes of early childhood education training held by LPK Yayasan Indonesia Mendidik Jaka Sampurna at Cileungsi, Bogor. The participants were 45 early childhood educators. This study used three research methods which are implemented from learning methods in child development assessment was as pre-test and post-test. Data were collected by using two instruments to measure early childhood educators for child development assessment. The data were analysed by using t-test to measures the differences data in pre-test and post-test. The results showed that the use of mind mapping methods can help early childhood educators to improve their mastery of the development assessment concept which averages 51.9 percent. It showed significant results with ttest value is 18,266 (N = 10, α = 0,0). This capacity building is reinforced by various qualitative findings which arise from early childhood educators’ awareness to change the old learning style into learning by mind mapping method as a learning method that follows how the brain works. This study also found that early childhood educators as adults who are in the stage of formal thinking have shown an understanding that mind mapping method are appropriate, fast, easy and practical in mastering various development assessment concepts. Early childhood educators believe that they can use the method for mastering other material concepts.
Keywords: Assessment, Brain-based teaching, Mind mapping
References
Anthony, J. N. (2001). Educational Assesment of Student. New Jersey: Merril Prentice Hall.
Armstrong, T. (2009). Multiples Intelligences in the Classroom. Virginia: SCD.
Bagnato, S. J. (2007). Authentic Assessment for Early Childhood Intervention. New York: The Guilford Press.
Bellman, M., & Byrne, O. (2013). Developmental assessment of children, (January), 4–9. https://doi.org/10.1136/bmj.e8687
Blessing, O. O., & Olufunke, B. T. (2015). Comparative Effect of Mastery Learning and Mind Mapping Approaches in Improving Secondary School Students’ Learning Outcomes in Physics. Science Journal of Education, 3(4), 78–84.
Bowman, B. T., Donovan, M. S., & Burns, M. S. (2001). Eager to Learn. Eager to Learn. Washington DC: NAtional Academy Press. https://doi.org/10.17226/9745
Bricker, D., & Squires, J. (1999). Ages and stages questionnaires: A parent completed, child-monitoring system (2nd editio). Baltimore, MD: Brookes Publishing.
Buzan, T. & Buzan, B. (1996). The mind map book: How to use radiant thinking to maximize your brain’s untapped potential. New York: Plume.
Buzan, T. (1974). Use Your Head. Innovative Learning and Thinking Techniques to Fulfil Your Mental Potential. BBC books.
Choo, Y. Y., Yeleswarapu, S. P., How, C. H., & Agarwal, P. (2019). Developmental assessment: practice tips for primary care physicians. Singapore Medical Journal, 60(2), 57–62. https://doi.org/10.11622/smedj.2019016
DIKMAS, D. (2015). Pedoman Penilaian Hasil Pembelajaran. Jakarta, Indonesia.
Feeney, S. D. C., & Moravcik, E. (2006). Who Am I in The Live Of Children. New Jersey: Pearson Merill Prentice Hall.
Gall, M. D., Gall, J. P., & Borg, W. R. (2007). Educational Research: An Introduction (4th ed.). New York: Longman Inc.
Goel, P. S., & N. Singh. (1998). Creativity and innovation in durable product development. Computers & Industrial Engineering, 35(1–2), 5–8. https://doi.org/http://dx.doi.org/10.1016/S0360- 8352(98)00006-0
Hartati, S. (2012). Tingkat Pengetahuan Guru TK tentang Asesmen Perkembangan Anak Usia Dini di TK Kelurahan Rawamangun, DKI Jakarta. Jakarta.
Indonesia, D. P. dan K. Menteri Pendidikan dan Kebudayaan, Pub. L. No. No. 146 (2014). Indonesia.
Jensen, E. (2008). Brain-Based Learning. Pembelajaran Berbasis Kemampuan Otak. Yogyakarta: Pustaka Pelajar.
Jones, B. D., Ruff, C., Tech, V., Snyder, J. D., Tech, V., Petrich, B., … Koonce, C. (2012). The Effects of Mind Mapping Activities on Students ’ Motivation. International Journal for the Scholarship of Teaching and Learning, 6(1).
Kostelnik, M. J., Soderman, A. K., & Whiren, A. P. (2007). Developmentally Approriate Curriculum, Best Practice In Early Childhood Education. New Jersey: Pearson Education Inc.
Lienhard, D. A. (n.d.). Roger Sperry ? s Split Brain Experiments ( 1959 ? 1968 ). The Embryo Project Encyclopedia.
Meisels, S. J. (2001). Fusing assessment and intervention: Changing parents’ and providers’ views of young children. ZERO TO THREE, 4–10.
NAEYC. (2003). Early Childhood Curriculum, Assessment, and Program Evaluation.
Riswanto, & Putra, P. P. (2012). The Use of Mind Mapping Strategy in the Teaching of Writing at SMAN 3 Bengkulu , Indonesia. International Journal of Humanities and Social Science, 2(21), 60–68.
Sandy, M. G. (1992). Pice of Mind. Jakarta: Gramedia Pustaka Utama.
Slentz, K. L. (2008). A Guide to Assessment in Early Childhood. Washington: Washington State.
Suyadi, S. (2017). Perencanaan dan Asesmen Perkembangan Pada Anak Usia Dini. Golden Age: Jurnal Ilmiah Tumbuh Kembang Anak Usia Dini, 1(1), 65–74. Retrieved from http://ejournal.uin-suka.ac.id/tarbiyah/index.php/goldenage/article/view/1251
Thomas, H. S. (2007). Today’s topics on creativity engineering system division. Massachusetts.
Thornton, S. (2008). Understanding Human Development. New York: Palgrave, Macmillan.
Windura, S. (2013). Mind Map Langkah Demi Langkah. Jakarta: Elex Media Computindo.
Wortham, S. C. (2005). Assesment in Early Childhood Education. NewJersey: Pearson.
Wycoff, J. (1991). Mindmapping: Your Personal Guide to Exploring Creativity and Problem-Solving. Berkley; Reissue edition.
Yunus, M. M., & Chien, C. H. (2016). The Use of Mind Mapping Strategy in Malaysian University English Test (MUET) Writing. Creative Education, 76, 619–662.
45
Woodward, J. E., T. B. Brenneman, R. C. Kemerait, A. K. Culbreath, and J. R. Clark. "First Report of Botrytis Blight of Peanut Caused by Botrytis cinerea in Georgia." Plant Disease 89, no. 8 (August 2005): 910. http://dx.doi.org/10.1094/pd-89-0910c.
Full textAbstract:
Because of the importance of spotted wilt caused by Tomato spotted wilt virus (TSWV), most peanut (Arachis hypogaea L.) breeding programs in the southeastern United States are focusing on developing resistance to TSWV. Many of the cultivars with improved resistance to TSWV are late maturing, requiring 150 days to reach optimum maturity. This factor could greatly impact disease problems at harvest. During November of 2004, an unknown disease was observed on peanut cvs. Georgia 02-C and Hull in a commercial field in Appling County. Symptoms included wilting stems with water-soaked lesions and a dense, gray mold growing on infected tissues. Final disease incidence was less than 5%. For isolation, diseased tissue was surface sterilized by soaking in 0.5% sodium hypochlorite for 1 min, air dried, plated on potato dextrose agar (PDA), and incubated at 20°C. Botrytis cinerea Pers.:Fr., causal agent of Botrytis blight, was isolated from the margins of infected tissue. Mycelia were initially white but became gray after 72 h at which time tall, branched, septate conidiophores formed. Mature, unicellular, ellipsoid, hyaline conidia (8.9 × 10.4 μm) formed in botryose heads (1). Hard, black, irregular-shaped sclerotia formed after 2 weeks. Stems of greenhouse-grown peanut plants (cv. Georgia Green) were inoculated with PDA plugs colonized with either B. cinerea or B. allii Munn. Inoculations were made 3 cm below the last fully expanded leaf on wounded and nonwounded tissue. Noncolonized PDA plugs served as controls (n = 9). Plants were arranged in a dew chamber at 20°C in a randomized complete block design. Lesions and spore masses identical to those observed in the field appeared 3 to 5 days after being inoculated with B. cinerea. The B. allii inoculations caused only superficial lesions. After 5 days, mean lesion lengths for B. cinerea were 59 and 37 mm for wounded and nonwounded inoculations, respectively. B. cinerea was recovered from 100% of the symptomatic tissues. Botrytis blight is considered a late-season disease that occurs in cool, wet weather (3). Symptoms similar to those of Botrytis blight were observed on mature and over-mature peanut in Georgia and have been cited as “unpublished observations” (2); however, to our knowledge, this is the first report of the disease in Georgia. Although Botrytis blight is not considered a major peanut disease, it may become more prevalent at harvest as producers utilize late-maturing cultivars to manage spotted wilt. References: (1) H. L. Barnett and B. B. Hunter. Illustrated Guide of Imperfect Fungi. 4th ed. The American Phytopathological Society, St. Paul, MN, 1998. (2) K. H. Garren and C. Wilson. Peanut Diseases. Pages 262–333 in: The Peanut, the Unpredictable Legume. The National Fertilizer Assoc. Washington D.C. 1951. (3) D. M. Porter. Botrytis blight. Pages 10–11 in: Compendium of Peanut Diseases. 2nd ed. N. Kokalis-Burelle et al., eds. The American Phytopathological Society, St. Paul, MN. 1997.
46
Sampangi, R. K., S. K. Mohan, and H. R. Pappu. "Identification of New Alternative Weed Hosts for Iris yellow spot virus in the Pacific Northwest." Plant Disease 91, no. 12 (December 2007): 1683. http://dx.doi.org/10.1094/pdis-91-12-1683b.
Full textAbstract:
Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus) is an economically important viral pathogen of onion bulb and seed crops in several parts of the United States and the world (1). IYSV is primarily transmitted by onion thrips (Thrips tabaci) and there is no evidence of seed transmission (1). However, susceptible cultivated and weed species could serve as reservoirs of inoculum from which thrips could acquire the virus to introduce and spread it in onion fields. Samples from asymptomatic and symptomatic volunteer onion plants in some of the commonly cultivated crops in the region (corn, wheat, grapes, mint, carrot, alfalfa, and sugar beets) and several common weeds in and around onion bulb and seed fields with a history of IYSV in Idaho and Washington were collected during the months of July, August, September and October of 2006. More than 175 samples from 35 plant species were analyzed for IYSV by a commercially available ELISA kit (Agdia Inc., Elkhart, IN). With the exception of a few volunteer onions, none of the other plant species had any symptoms of virus infection. Symptoms on volunteer onions included characteristic diamond-shaped lesions. To confirm the presence of IYSV in the ELISA-positive samples, total nucleic acids were extracted (2) and used in a reverse transcription (RT)-PCR assay (3). The primer pair consisted of 5′-TAA AAC AAA CAT TCA AAC AA-3′ and 5′-CTC TTA AAC ACA TTT AAC AAG CAC-3′. This primer pair flanks the nucleocapsid (N) gene of IYSV and generates an approximate 1.2-kb amplicon (3) that includes the complete N gene. An amplicon of expected size was obtained from each IYSV-positive sample. The amplicons were cloned and sequenced. There was a 95% sequence identity with known IYSV sequences. While several weed species gave ELISA values that suggested the presence of IYSV, results of RT-PCR assays failed to confirm the presence of the virus. This discrepancy between ELISA and RT-PCR results could be due to nonspecific reaction in ELISA (4) or difficulty associated with obtaining RT-PCR-quality templates for amplification. Only volunteer onions and the following weeds tested positive for IYSV by ELISA and RT-PCR: redroot pigweed (Amaranthus retroflexus), puncturevine (Tribulus terrestris), kochia (Kochia scoparia), prickly lettuce (Lactuca serriola), and common lambsquarters (Chenopodium album). Of these, redroot pigweed was recently reported to be ELISA-positive for IYSV (1). This information on the wider natural host range of IYSV, including potential alternative hosts that could serve as virus reservoirs, is useful for a better understanding of the disease epidemiology and in developing an integrated management strategy for reducing the impact of this disease. References: (1) D. Gent et al. Plant Dis. 90:1468, 2006. (2) H. R. Pappu et al. HortScience 40:697, 2005. (3) H. R. Pappu et al. Arch. Virol. 151:1015, 2006. (4) T. N. Smith et al. Plant Dis. 90:729, 2006.
47
Lockhart, B. E., and J. A. Westendorp. "Anemone - an Additional Perennial Ornamental Host of Tobacco Rattle Virus in the U.S." Plant Disease 82, no. 6 (June 1998): 712. http://dx.doi.org/10.1094/pdis.1998.82.6.712b.
Full textAbstract:
A previous report (1) drew attention to the occurrence in the U.S. of tobacco rattle tobravirus (TRV) in several perennial ornamentals that move freely in international trade. Here we report the occurrence of TRV in an additional host plant of this type. The virus was identified in anemone (Anemone × hybrida cv. Honorine Jobert) with leaf symptoms consisting of chlorotic blotches, chlorotic line patterns, and distortion. Characteristic tobravirus-like particles with modal lengths of 50, 80, 130, and 180 nm were observed by electron microscopy in partially purified extracts of symptomatic but not of asymptomatic plants. These particles reacted specifically with antibodies to TRV and pea early-browning (PEBV) tobraviruses in immunoelectron microscopic (IEM) assays, produced typical TRV-induced symptoms in Nicotiana benthamiana and N. clevelandii, in which similar particles were detected by IEM, but, like other TRV isolates, did not infect pea (2). No other viruslike particles were observed in partially purified extracts of symptomatic anemone plants. This is the first report of TRV infection in anemone. While TRV occurs widely in Europe, it had been identified previously in the U.S. only in Oregon, Washington, and California (1,2,3). This virus is an important pathogen of several crops, including potato. Several areas of the Midwest, including Minnesota and Wisconsin, have significant seed-potato industries, and further introduction and possible dissemination of TRV pose potential regulatory and quarantine issues. This example of the movement of an exotic pathogen of potential economic importance into new areas underlines the need for closer monitoring of plant material entering international trade in an era of increasing globalization. References: (1) B. E. Lockhart et al. Plant Dis. 79:1249, 1995. (2) B. E. L. Lockhart and H. U. Fischer. Phytopathology 66:1391, 1976. (3) J. M. Crosslin and P. E. Thomas. Am. Potato J. 72:605, 1995.
48
Ozsoy, S., M. B. Morris, and M. L. Day. "111. THE ROLE OF L-PROLINE IN PREIMPLANTATION MOUSE EMBRYO DEVELOPMENT IN VITRO." Reproduction, Fertility and Development 22, no. 9 (2010): 29. http://dx.doi.org/10.1071/srb10abs111.
Full textAbstract:
Amino acids are known to play important roles in preimplantation embryo development, including regulation of cell volume and metabolism. Inclusion of l-glutamine, glycine and betaine in embryo culture medium has been shown to improve development in vitro by acting as organic osmolytes, thereby regulating cell volume. The purpose of the present study was to examine the effect of l-proline on preimplantation mouse embryo development in vitro. One-cell stage embryos were cultured in modified HTF, at low density (1 embryo/100 μL) and high density (1 embryo/μL) in the presence and absence of amino acids. Development of the embryos was scored every 24 h until the blastocyst stage. At low density, l-proline significantly increased the proportion of embryos developing to the blastocyst stage. This effect was abolished by culture at high density, suggesting that l-proline was activating a pathway similar to that involved in autocrine signalling by trophic factors in the preimplantation embryo. The improvement in development observed in the presence of l-proline was not due to its action as an organic osmolyte since the osmolality of the medium was 270 mOsm. Furthermore, glycine and betaine, which are known to act as osmolytes in embryos, had no effect on blastocyst development. In embryonic stem cells L-proline is taken up by an amino acid transporter and is involved in the regulation of growth and differentiation (1). The present data suggest that l-proline may have a similar, important role in preimplantation development. (1) JM Washington, J Rathjen, F Felquer, A Lonic, MD Bettess, N Hamra, L Semendric, BSN Tan, J-A Lake, RA Keough, MB Morris and PD Rathjen (2010) Am J Physiol Cell Physiol 298: C982–C992.
49
Phillips, David R. "Book reviews : Gribble, J. N. and Preston, S. H., editors, 1993: The epidemiological transition - policy and plan ning implications for developing countries. Washington, DC: National Academy Press. xiv + 271 pp. £34.95, paper. ISBN: 0 309 04839 7." Progress in Human Geography 19, no. 2 (June 1995): 295–96. http://dx.doi.org/10.1177/030913259501900217.
Full text
50
Wenk, Michael S. "Environmental Protection and the Social Responsibility of Firms: Perspectives for Law, Economics, and Business. B. L. Hay, R. N. Stavins, and R. H. K. Vietor, eds. 2005. RFF Press, Washington, DC. 240 pp. $80 cloth, $39.95 paperback." Environmental Practice 8, no. 3 (September 2006): 197–98. http://dx.doi.org/10.1017/s1466046606240262.
Full text