Contents
Academic literature on the topic 'Washington (N.H.)'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the lists of relevant articles, books, theses, conference reports, and other scholarly sources on the topic 'Washington (N.H.).'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Journal articles on the topic "Washington (N.H.)"
1
Beutel, Marc W., Lanka DeSilva, and Louis Amegbletor. "Direct Measurement of Mercury Deposition at Rural and Suburban Sites in Washington State, USA." Atmosphere 12, no. 1 (December 30, 2020): 35. http://dx.doi.org/10.3390/atmos12010035.
Full textAbstract:
Because of mercury’s (Hg) capacity for long-range transport in the atmosphere, and its tendency to bioaccumulate in aquatic biota, there is a critical need to measure spatial and temporal patterns of Hg atmospheric deposition. Dry deposition of Hg is commonly calculated as the product of a measured atmospheric concentration and an assumed deposition velocity. An alternative is to directly assess Hg deposition via accumulation on surrogate surfaces. Using a direct measurement approach, this study quantified Hg deposition at a rural site (Pullman) and suburban site (Puyallup) in Washington State using simple, low-cost equipment. Dry deposition was measured using an aerodynamic “wet sampler” consisting of a Teflon plate, 35 cm in diameter, holding a thin layer (2.5 mm) of recirculating acidic aqueous receiving solution. In addition, wet Hg deposition was measured using a borosilicate glass funnel with a 20-cm-diameter opening and a 1 L Teflon sampling bottle. Hg deposition was estimated based on changes in total Hg in the aqueous phase of the samplers. Dry Hg deposition was 2.4 ± 1.4 ng/m2·h (average plus/minus standard deviation; n = 4) in Pullman and 1.3 ± 0.3 ng/m2·h (n = 6) in Puyallup. Wet Hg deposition was 7.0 ± 4.8 ng/m2·h (n = 4) in Pullman and 1.1 ± 0.2 ng/m2·h (n = 3) in Puyallup. Relatively high rates of Hg deposition in Pullman were attributed to regional agricultural activities that enhance mercury re-emission and deposition including agricultural harvesting and field burning. Hg concentration in precipitation negatively correlated with precipitation depth, indicating that Hg was scavenged from the atmosphere during the beginning of storm events. Because of their relative simplicity and robustness, direct measurement approaches such as those described in this study are useful in assessing Hg deposition, and for comparing results to less direct estimates and model estimates of Hg deposition.
2
Gibson, Glenys D., and Fu-Shiang Chia. "Description of a new species of Haminoea, Haminoea callidegenita (Mollusca: Opisthobranchia), with a comparison with two other Haminoea species found in the northeast Pacific." Canadian Journal of Zoology 67, no. 4 (April 1, 1989): 914–22. http://dx.doi.org/10.1139/z89-133.
Full textAbstract:
A new species of Haminoea (Opisthobranchia: Cephalaspidea), Haminoea callidegenita, is described from Washington State, U.S.A. Diagnostic features are reddish brown colour, deeply bifurcate cephalic shield, reddish ovate shell with imperforate apex, tubular Hancock's organ, unarmed penis, unilobular prostate, and radula formula n.l.l.l.n (n from 12 to 21), with bicuspid first lateral uncini. The development of H. callidegenita is unusual among the Opisthobranchia in that the hatching stage includes both lecithotrophic veligers and juveniles from each egg mass. Diagnostic features were examined among animals from different populations of H. callidegenita and two other Haminoea species found in the northeast Pacific: H. vesicula Gould, 1855 and H. virescens Sowerby, 1833. Shell shape was slightly variable among individuals of all three species and radula morphologies were variable among populations of H. vesicula. Fingerlike papillae were noted on the gizzard plates and are suggested as a diagnostic character.
3
Kim, Sangmi, Eun-Ok Im, Jianghong Liu, and Connie Ulrich. "Maternal Age Patterns of Preterm Birth: Exploring the Moderating Roles of Chronic Stress and Race/Ethnicity." Annals of Behavioral Medicine 54, no. 9 (February 22, 2020): 653–64. http://dx.doi.org/10.1093/abm/kaaa008.
Full textAbstract:
Abstract Background Despite the suggested contribution of cumulative chronic stress to the racial/ethnic disparities in preterm birth (PTB), it is unclear how chronic stress, maternal age, and race/ethnicity are linked underlying PTB. Purpose We investigated the moderating effect of chronic stress on the maternal age–PTB association among non-Hispanic (N-H) White, N-H Black, Hispanic, and Asian women. Methods We analyzed the Washington State’s Pregnancy Risk Assessment Monitoring System data linked with birth certificates. The sample included women aged 18 years or older who birthed the first, singleton baby without birth defects. Chronic stress was measured by race/ethnicity-specific chronic stress indices. A maternal age–chronic stress interaction was modeled to predict PTB by logistic regression stratified by race/ethnicity. In subanalysis, the moderating role of racism was investigated in the maternal age–chronic stress interaction among three minority groups combined. Results Women’s maternal age trajectory of PTB varied by their race/ethnicity and chronic stress level. N-H White and N-H Black women showed a steeper maternal age-related increase in PTB (weathering) under higher chronic stress, indicating a chronic stress’ cumulative effect with maternal age. Besides, the extent of weathering was amplified by racism on top of chronic stress, particularly among N-H Black women. Conclusions These results show that both chronic stress and racism may develop accelerated PTB risk among minority women. Future research should use more objective and accurate chronic stress measures to ascertain the complex relationships among chronic stress, racial discrimination, and maternal age underlying the racial/ethnic differentials in PTB.
4
Kim, Sangmi, Eun-Ok Im, Jianghong Liu, and Connie Ulrich. "Factor Structure for Chronic Stress Before and During Pregnancy by Racial/Ethnic Group." Western Journal of Nursing Research 41, no. 5 (July 18, 2018): 704–27. http://dx.doi.org/10.1177/0193945918788852.
Full textAbstract:
This study aimed to explore race/ethnicity-specific dimensionalities of chronic stress before and during pregnancy for non-Hispanic (N-H) White, N-H Black, Hispanic, and Asian women in the United States. This study analyzed the data among 6,850 women from the New York City and Washington State Pregnancy Risk Assessment Monitoring System (2004-2007) linked with birth certificates. Separate exploratory factor analysis was conducted by race/ethnicity using a maximum-likelihood extraction method with 26 chronic stress items before and during pregnancy. Correlations and internal consistency reliabilities among items and latent factors determined race/ethnicity-specific factor structures of chronic stress. Chronic stress was race/ethnicity-distinctive and multidimensional with low correlations among the factors ( r = .07-.28, p < .05). Despite financial hardship, perceived isolation, and physical violence underlying chronic stress among the racial/ethnic groups, intergroup variations existed under each group’s cultural or sociopolitical contexts. This study could help develop targeted strategies to intervene with women’s chronic stressors before childbirth.
5
Shelley, Rowland M. "The milliped order Callipodida in western North America (Schizopetalidae: Tynommatinae), and a summary of the New World fauna." Insect Systematics & Evolution 27, no. 1 (1996): 25–64. http://dx.doi.org/10.1163/187631296x00197.
Full textAbstract:
AbstractIn western North America, the milliped order Callipodida is represented by the Colactidini, Tynommatini stat. n., and Diactidini tribus n., in the subfamily Tynommatinae, family Schizopetalidae; a coordinate tribe, the Texophonini, occurs on the Gulf Coast of south Texas. The Tynommatini consists of two genera and four species: Tynomma mutans (Chamberlin), T. magnum Buckett & Gardner, and T. gardneri sp. n., occurring around Monterey and San Pablo/San Francisco Bays, California, and Idrionaria dineh gen. n. & sp. n., in Washington County, Utah. The Colactidini ranges from Durango, Mexico, to central Utah and California east of the Sierra Nevada, with disjunct areas in southern California and Baja California, the latter extending northward to metropolitan San Diego. It is represented by two genera and 6 species: Colactis Loomis: C. tiburona (Chamberlin), utorum (Chamberlin), and protenta and quadrata, both by Loomis; and Heptium Loomis: H. carinellum and scamillatum, both by Loomis. The Diactidini, occupying coastal southern California and the adjacent fringe of Baja California, is comprised of three genera and 10 species: Diactis Loomis: D. soleata, triangula, and frondifera, all by Loomis, and amniscela, cupola, jacinto, procera, and strumella, all spp. n.; Florea sinuata gen. n. & sp. n.; and Caliactis bistolata gen. n. & sp. n. The following new synonymies are proposed: C. yuma Chamberlin, sideralis Loomis, and loomisi Hoffman under C. tiburona; C. briggsi Shear and saxetana and baboquivari, both by Loomis, under C. utorum; H. canum Chamberlin under H. carinellum; and Etiron paroicum and pearcei, both by Chamberlin, under D. triangula and T. mutans, respectively. The eastern Nearctic callipodid fauna is summarized and significant new localities are reported; Tetracion antraeum Hoffman, stat. n., is elevated from a subspecies of T. jonesi Hoffman.
6
Hawkins, Melissa, Sarah Irvine Belson, Robin McClave, Lauren Kohls, Sarah Little, and Anastasia Snelling. "Healthy Schoolhouse 2.0 Health Promotion Intervention to Reduce Childhood Obesity in Washington, DC: A Feasibility Study." Nutrients 13, no. 9 (August 25, 2021): 2935. http://dx.doi.org/10.3390/nu13092935.
Full textAbstract:
Childhood obesity prevalence trends involve complex societal and environmental factors as well as individual behaviors. The Healthy Schoolhouse 2.0 program seeks to improve nutrition literacy among elementary school students through an equity-focused intervention that supports the health of students, teachers, and the community. This five-year quasi-experimental study follows a baseline–post-test design. Research activities examine the feasibility and effectiveness of a professional development series in the first program year to improve teachers’ self-efficacy and students’ nutrition literacy. Four elementary schools in Washington, DC (two intervention, two comparison) enrolled in the program (N = 1302 students). Demographic and baseline assessments were similar between schools. Teacher participation in professional development sessions was positively correlated with implementing nutrition lessons (r = 0.6, p < 0.001, n = 55). Post-test student nutrition knowledge scores (W = 39985, p < 0.010, n = 659) and knowledge score changes (W = 17064, p < 0.010, n = 448) were higher among students in the intervention schools. Students who received three nutrition lessons had higher post knowledge scores than students who received fewer lessons (H(2) =22.75, p < 0.001, n = 659). Engaging teachers to implement nutrition curricula may support sustainable obesity prevention efforts in the elementary school environment.
7
Clark, Harry F. "Zionism lobbies the empires." Journal of Contemporary Iraq & the Arab World 14, no. 3 (September 1, 2020): 266–86. http://dx.doi.org/10.1386/jciaw_00034_5.
Full textAbstract:
Review of: A Broken Trust: Sir Herbert Samuel, Zionism and the Palestinians, Sahar Huneidi, foreword by Walid Khalidi (2001)London: I. B. Tauris, 340 pp.,ISBN 978-1-86064-172-5, h/bk, out-of-printThe Palestine Deception, 1915‐1923: The McMahon-Hussein Correspondence, the Balfour Declaration, and the Jewish National Home, J. M. N. Jeffries, edited and with an introduction by William M. Mathew (2014)Washington, DC: Institute for Palestine Studies-USA, 175 pp.,ISBN 978-0-88728-320-8, p/bk, $16.00Palestine. The Reality. The Inside Story of the Balfour Declaration 1917‐1938, J. M. N. Jeffries, with a new introduction by Ghada Karmi (2017)Northampton, MA: Olive Branch Press, 800 pp.,ISBN 978-1-56656-024-5, p/bk, $30Israel’s Armor: The Israel Lobby and the First Generation of the Palestine Conflict, Walter L. Hixson (2019)Cambridge and New York: Cambridge University Press, 324 pp.,ISBN 978-1-108-70532-5, p/bk, $29.99
8
Boardman, Pete. "Twenty-one new species of craneflies (Diptera: Tipulidae and Limoniidae), and a new fold-wing cranefly (Diptera: Ptychopteridae) from Mount Kupe, Cameroon, with notes on eighteen other species new to the country from the same location." Entomologist's Monthly Magazine 156, no. 3 (July 31, 2020): 163–206. http://dx.doi.org/10.31184/m00138908.1563.4042.
Full textAbstract:
Following the award of a Winston Churchill Memorial Trust (WCMT) Fellowship the author was able to visit the Charles P. Alexander (1889–1981) collection at the Smithsonian Institution, Washington D. C. to study craneflies gifted to him from fieldwork in Cameroon. They were collected by Malaise trap in forest clearings near streams on Mount Kupe, near Nyasoso, Cameroon. 21 new species of cranefly (Diptera: Tipulidae and Limoniidae): Dolichopeza (Dolichopeza) vicki sp. n., Nephrotoma mawdsleyi sp. n., Baeoura nyasosoensis sp. n.,Ellipteroides (Ellipteroides) nigromaculatus sp. n., Hovamyia gelhausi sp. n.,Limnophilomyia (Limnophilomyia) alexanderi sp. n., Ormosia (Neserioptera) cameroonensis sp. n., Afrolimnophila mederosi sp. n., A. oosterbroeki sp. n., Neolimnomyia kupensis sp. n., Pseudolimnophila (Pseudolimnophila) staryi sp. n., Achyrolimonia prycei sp. n., Dicranomyia (Dicranomyia) tuberculata sp. n., D. (Idioglochina) stubbsi sp. n., Elephantomyia (Elephantomyia) gilsonae sp. n., Libnotes (Afrolimonia) trimaculata sp. n., Metalimnobia (Tricholimnobia) krameri sp. n., Thaumastoptera (Thaumastoptera) churchilli sp. n., Toxorhina (Ceratocheilus) holvia sp. n., Trentepohlia (Trentepohlia) zorro sp. n., and Trichoneura (Xipholimnobia) jacksoni, and a new species of fold-wing cranefly (Diptera: Ptychopteridae): Ptychoptera (Ptychoptera) fasbenderi sp. n., are described. 18 species of cranefly known from elsewhere in the Afrotropical region are recorded here from Cameroon for the first time: Gonomyia (Leiponeura) hyperion Alexander, 1956, Limnophilomyia (Limnophilomyia) medleriana Alexander, 1976, Styringomyia vittata Edwards, 1914, Afrolimnophila hartwigi (Alexander, 1974), A. urundiana (Alexander, 1955), Austrolimnophila (Phragmocrypta) fulani Alexander, 1974, Hexatoma (Eriocera) brevifurca Alexander, 1956, H. (E.) trichoneura Alexander, 1956, H. (E.) tumidiscapa (Alexander, 1920), Medleromyia nigeriana Alexander, 1974, Achyrolimonia recurvans (Alexander, 1919), Atypopthalmus (Atypopthalmus) submendicus tuberculifer (Alexander, 1956), Dicranomyia (Dicranomyia) redundans (Alexander, 1956), Libnotes (Afrolimonia) rhanteria (Alexander, 1920), L. (A.) illiterata (Alexander, 1937), Limonia woosnami (Alexander, 1920), Orimarga (Protorimarga) bequaertiana (Alexander, 1930) and Toxorhina (Ceratocheilus) nigripleura (Alexander, 1920). In total 40 species are presented as new for Cameroon. A further 23 species already known from Cameroon were identified, and are listed here as some of them have not been recorded since their original description close to, or in some cases over, a hundred years ago.
9
Reid, Neill, and Gary Wegner. "H-Alpha Emission in Hot Degenerates and OB Subdwarfs." International Astronomical Union Colloquium 114 (1989): 396–400. http://dx.doi.org/10.1017/s0252921100099954.
Full textAbstract:
Based on observations obtained using the 60-inch telescope at Palomar Observatory which is jointly owned by the California Institute of Technology and the Carnegie Institution of Washington and on observations obtained with the 200-inch Hale telescope which is owned by the California Institute of Technology.The intial observations of white dwarf stars and their immediate precursors, the hot subdwarfs, suggested that these stars possess the simplest (and, aesthetically, the most pleasing) spectra of any astronomical object. The high gravity leads to the spectrum being dominated, in the most stars, by broad lines of either hydrogen or helium, depending on the composition of the photospheric layers, with a few stars exhibiting lines from both species. However, the more detailed observations of recent years have revealed a higher degree of complexity. In particular, absorption lines of high excitation species (N V, C IV, etc.) have been detected in the ultraviolet spectra of several hot white dwarfs (Bruhweiler & Kondo, 1982) and, most recently, high resolution optical spectra have shown that one of the latter stars, the hottest known DA, G191-B2B, exhibits significant emission in the core of the H-alpha absorption line (Reid &: Wegner, 1988). Following up the latter observation, we have obtained high resolution spectra of a number of hot subdwarfs, with temperatures ranging from ~ 20,000K to more than 60,000 K. Most of these stars also exhibit Baimer emission, at Hβ as well as Hα in at least one case. We suggest the temperature reversal in the stellar atmosphere may be a function of the He/H ratio at the level of the photosphere.
10
Crosslin, J. M. "First Report of Potato mop-top virus on Potatoes in Washington State." Plant Disease 95, no. 11 (November 2011): 1483. http://dx.doi.org/10.1094/pdis-06-11-0536.
Full textAbstract:
In April of 2011, approximately 10% of the tubers of potato (Solanum tuberosum L.) cv. Alturas, grown in central Washington State and collected from a commercial potato storage facility, were observed to have internal brown spots and arcs typical of infection by either Tobacco rattle virus (TRV) or Potato mop-top virus (PMTV). Ten tubers showing symptoms ranging from a few brown spots to large (2 cm) concentric arcs were tested by reverse transcription (RT)-PCR with primers specific for TRV (3) or PMTV (PMTV2 forward, AGAGCAGCCGTCGAGAATAG; PMTV3 reverse, TCGTCCACCTCTGCGAGTTG). Two symptomless tubers from the same lot were also tested. All symptomatic tubers tested negative for TRV, but eight of the symptomatic tubers were positive for PMTV, as evidenced by production of the expected 416-bp amplified DNA product. The symptomless tubers were negative for both viruses. The eight symptomatic tubers that were positive for PMTV by RT-PCR were also positive for PMTV by ELISA using a commercially available kit (Adgen, Ayr, Scotland). The symptomless tubers were negative for PMTV by ELISA. The 416-bp amplicons obtained with the PMTV primers from two tubers were cloned and three clones of each were sequenced. The consensus sequences for the two samples differed by only one nucleotide and sequences were deposited in GenBank as Accession Nos. JN132116 and JN132117. BLAST analysis showed the sequences were 99 to 100% identical to a portion of the coat protein gene of numerous PMTV isolates. These results confirm that PMTV is present in central Washington State. The virus has been known to affect potatoes in Maine for several years (2) and was recently confirmed in North Dakota (1). PMTV was reportedly found in potatoes grown in numerous locations in the United States, but the specific locations were not reported (4). PMTV is transmitted by the soilborne powdery scab pathogen, Spongospora subterranea, which is widespread in the region of the state where the virus-infected tubers were grown. The confirmation of PMTV in Washington State alerts growers, fieldmen, and diagnostic laboratories to the presence of this potentially serious virus in a major potato-production area of the United States. References: (1) N. David et al. Plant Dis. 94:1506, 2010. (2) D. H. Lambert et al. Plant Dis. 87:872, 2003. (3) D. J. Robinson. J. Virol. Methods 40:57, 1992. (4) H. Xu et al. Plant Dis. 88:363, 2004.
Books on the topic "Washington (N.H.)"
1
Krone, Sally, and Ronald Jager. A Sacred Deposit: The Meetinghouse in Washington, N. H. Town of Washington, New Hampshire, 1989.
Find full text
2
Jager, Grace, and Ronald Jager. Portrait of a Hill Town: A History of Washington, N. H., 1876-1976. Town of Washington, New Hampshire, 1998.
Find full text
3
Washington, N. Public Debate on the Immortality of the Soul, Between T. H. Dunn, (Christadelphian) and N. Washington, M. D. (Wesleyan Methodist) Held in the Village of Waterloo, Ont. , on the 6th, 7th, 8th, 9th and 10th of July 1874 [microform]. Creative Media Partners, LLC, 2021.
Find full textConference papers on the topic "Washington (N.H.)"
1
Sin Wu, Yi, Chun Yen Chen, Chang Teng-, and Yee Pay Wuang. "Cool Guy's Adventure: A Sensory Integration Game Designed for Children with Attention Deficit Hyperactivity Disorder (ADHD)." In 15th International Conference on Applied Human Factors and Ergonomics (AHFE 2024). AHFE International, 2024. http://dx.doi.org/10.54941/ahfe1004904.
Full textAbstract:
This paper offers an interactive scenario of Cool Guy's Adventure for children with Attention Deficit Hyperactivity Disorder (ADHD) based on sensory integration (SIT). We present a design framework that allows occupational therapists to arrange and combine game units and difficulty levels. ADHD is one of the most common neurodevelopmental disorders of childhood. Many studies have utilized HCI technology to assist and treat patients with various mental conditions, helping them lead healthier lives. However, there has been limited attention given to the development of HCI technologies to support children with ADHD. The game was developed using the Unity3D game engine and Microsoft Kinect®, each game design focuses on sensory integration training and enhances the child's intrinsic motivation: Throw the perfect ball, Play hopscotch, and Capture treasure. We present assessments and results after testing a sample of children (n=4), aged 8, with or without ADHD.■ References[1]Fage C., Pommereau L., Consel C., Balland E. and Sauzéon H. 2014. The 16th International ACM SIGACCESS Conference on Computers and Accessibility Tablet-based Activity Schedule for Children with Autism in Mainstream Environment. Rochester, USA, 145-152. DOI: https://doi.org/10.1145/2858036.2858245[2]Sonne T. and Jensen M. M. 2016. Evaluating the ChillFish Biofeedback Game with Children with ADHD. In Proceedings of the 2016 ACM Interaction Design and Children (IDC), Manchester, United Kingdom, 529-534. DOI: https://doi.org/10.1145/2930674.2935981[3]American Psychiatric Association. 2013. Diagnostic and Statistical Manual of Mental Disorders. Fifth edition: DSM-5, Washington, p.991.[4]Liao M.-N. 2016. Co-creation - Exploration and Research on The Joint Decision-making Mode of Interdisciplinary Cooperation. Master’s thesis. National Yunlin University of Science and Technology.
2
Wir-Konas, Agnieszka, and Kyung Wook Seo. "Between territories: Incremental changes to the domestic spatial interface between private and public domains." In 24th ISUF 2017 - City and Territory in the Globalization Age. Valencia: Universitat Politècnica València, 2017. http://dx.doi.org/10.4995/isuf2017.2017.6061.
Full textAbstract:
Between territories: Incremental changes to the domestic spatial interface between private and public domains. Agnieszka Wir-Konas¹, Kyung Wook Seo¹ ¹Department of Architecture and Built Environment, Northumbria University, Newcastle upon Tyne. Newcastle City Campus, 2 Ellison Pl, Newcastle upon Tyne NE1 8ST. E-mail: agnieszka.wir-konas@northumbria.ac.uk, kyung.seo@northumbria.ac.uk Keywords (3-5): building-street interface, incremental change, micro-morphology, private-public boundary, territory Conference topics and scale: Urban form and social use of space In this paper we investigate incremental changes to the relationship between private and public territory on the micro-morphological scale of the residential building-street interface. The building-street interface lies on the edge between two distinctively different spatial domains, the house and the street, and provides a buffer which may be adjusted to aid the transition from private to public territory. The structure of the space impacts both domains: it provides a fit transition from the private dwelling to the public territory, creates a space for probabilistic encounters between inhabitants and strangers, and maintains the liveability of the public street. The aim of this paper is threefold: Firstly, we recognise morphological differences in the structure of the interfaces and the way the transition from private to public territory was envisioned and designed in different societal periods. Secondly, we study incremental changes to the interface, representing individual adjustments to the private-public boundary, in order to recognize common types of adaptations to the existing structure of the interface. The history of changes to each individual building and building-street interface was traced by analysing planning applications and enforcements publicly provided by the city council. Lastly, we compare the capacity of each building-street interface to accommodate incremental change to the public-private transition. We argue that studying the incremental change of the interface and the capacity of each interface to accommodate micro-scale transformations aids in the understanding of the complex social relationship between an individual and a collective in the urban environment. References (180 words) Conzen, M. R. G. (1960). Alnwick, Northumberland: a study in town-plan analysis. Transactions and Papers (Institute of British Geographers) 27, iii-122. Gehl, J. (1986) ‘Soft edges in residential streets’. Scandinavian Housing and Planning Research 3(2), 89-192 Gehl, J. (2013) Cities for People (Island Press, Washington DC). Habraken, N. J. and Teicher, J. (2000) The structure of the ordinary: form and control in the built environment (MIT press, Cambridge). Hillier, B. and Hanson, J. (1984) The Social Logic of Space (Cambridge: Cambridge University Press). Jacobs, J. (1961) The Death and Life of Great American Cities (Middlesex: Penguin, Harmondsworth). Lawrence, R. J. (1987) Housing, dwellings and homes: Design theory, research and practice (John Wiley, Chichester). Palaiologou, G., Griffiths, S., and Vaughan, L. (2016), ‘Reclaiming the virtual community for spatial cultures: Functional generality and cultural specificity at the interface of building and street’. Journal of Space Syntax 7(1), 25-54. Whitehand, J. W. R. and Morton, N. J. and Carr, C. M. H. (1999) ‘Urban Morphogenesis at the Microscale: How Houses Change’, Environment and Planning B: Planning and Design 26(4), 503-515.