To see the other types of publications on this topic, follow the link: Virové infekce.
Journal articles on the topic 'Virové infekce'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 50 journal articles for your research on the topic 'Virové infekce.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
Rainetová, Petra. "Viral intestinal infections - viral gastroenteritides." Pediatrie pro praxi 18, no. 1 (April 4, 2017): 44–49. http://dx.doi.org/10.36290/ped.2017.009.
Full text
2
Beneš, Jiří, and Dana Nováková. "Pathogenesis of covid-19: principles of viral infection and immune response." Intervenční a akutní kardiologie 20, no. 2 (July 9, 2021): 73–77. http://dx.doi.org/10.36290/kar.2021.023.
Full text
3
Boštíková, Vanda, Petr Prášil, Miloslav Salavec, and Pavel Boštík. "Selected viral and bacterial infections transmitted perinatally - part three toxoplasmosis." Pediatrie pro praxi 17, no. 2 (May 9, 2016): 77–79. http://dx.doi.org/10.36290/ped.2016.016.
Full text
4
Focà, Alfredo, Maria Carla Liberto, Angela Quirino, Nadia Marascio, Emilia Zicca, and Grazia Pavia. "Gut Inflammation and Immunity: What Is the Role of the Human Gut Virome?" Mediators of Inflammation 2015 (2015): 1–7. http://dx.doi.org/10.1155/2015/326032.
Full textAbstract:
The human virome comprises viruses that infect host cells, virus-derived elements in our chromosomes, and viruses that infect other organisms, including bacteriophages and plant viruses. The development of high-throughput sequencing techniques has shown that the human gut microbiome is a complex community in which the virome plays a crucial role into regulation of intestinal immunity and homeostasis. Nevertheless, the size of the human virome is still poorly understood. Indeed the enteric virome is in a continuous and dynamic equilibrium with other components of the gut microbiome and the gut immune system, an interaction that may influence the health and disease of the host. We review recent evidence on the viruses found in the gastrointestinal tract, discussing their interactions with the resident bacterial microbiota and the host immune system, in order to explore the potential impact of the virome on human health.
5
Pleško, I. Mavric, M. Viršcek Marn, Z. Miladinovic, and J. Zindovic. "First Report of Peach latent mosaic viroid in Peach Trees in Montenegro." Plant Disease 96, no. 1 (January 2012): 150. http://dx.doi.org/10.1094/pdis-06-11-0487.
Full textAbstract:
Peach latent mosaic viroid (PLMVd) and Hop stunt viroid (HSVd) are known to infect stone fruit species worldwide. The viroid infection can be latent or induce a variety of disease symptoms. Stone fruit samples were collected in Montenegro for a Plum pox virus (PPV) survey in 2007. Thirteen samples infected with PPV, taken from 12-year-old peach trees (Prunus persica (L.) Batsch, cv. Elegant Lady) in the area of Cemovsko field, were tested for the presence of PLMVd and HSVd by reverse transcription (RT)-PCR. Mild or severe mosaic, chlorotic rings, and fruit deformations were observed on some trees. Total RNA was extracted from all samples with a RNeasy Plant Mini Kit (Qiagen, Chatsworth, CA) and RT-PCR was performed. Samples were tested for HSVd and PLMVd infection using primer pairs RF-43/RF-44 for PLMVd (1) and VP-19/VP-20 for HSVd (2). Amplification products of approximately 348 bp were obtained from nine samples with PLMVd primers. Amplification products from seven samples were successfully cloned into pGEM-T Easy Vector (Promega, Madison, WI) and used for transformation of Escherichia coli. At least four clones of each sample were sequenced. Obtained sequences were 337 and 338 nucleotides long and shared 90.3 to 100% identity. Consensus sequences of each sample were deposited in GenBank under Accession Nos. JF927892–JF927898. They showed 92.6 to 97.9% identity among each other, 94 to 98% identity with the PLMVd isolate G sequence (Accession No. EF591868) and 91.8 to 94.4% identity with PLMVd sequence M83545. HSVd was not detected in analyzed samples. PLMVd infections were found on peach trees in an area where approximately 40% of the peach production is located. Therefore, PLMVd infections can pose a threat to peach production in Montenegro. To our knowledge this is the first report of PLMVd infection of peach in Montenegro. References: (1) S. Ambrós et al. J. Virol. 72:7397, 1998. (2) S. A. Kofalvi et al. J. Gen. Virol. 78:3177, 1997.
6
Venkataraman, Srividhya, Uzma Badar, Erum Shoeb, Ghyda Hashim, Mounir AbouHaidar, and Kathleen Hefferon. "An Inside Look into Biological Miniatures: Molecular Mechanisms of Viroids." International Journal of Molecular Sciences 22, no. 6 (March 10, 2021): 2795. http://dx.doi.org/10.3390/ijms22062795.
Full textAbstract:
Viroids are tiny single-stranded circular RNA pathogens that infect plants. Viroids do not encode any proteins, yet cause an assortment of symptoms. The following review describes viroid classification, molecular biology and spread. The review also discusses viroid pathogenesis, host interactions and detection. The review concludes with a description of future prospects in viroid research.
7
Cho, Won, Yeonhwa Jo, Kyoung-Min Jo, and Kook-Hyung Kim. "A Current Overview of Two Viroids That Infect Chrysanthemums: Chrysanthemum stunt viroid and Chrysanthemum chlorotic mottle viroid." Viruses 5, no. 4 (April 17, 2013): 1099–113. http://dx.doi.org/10.3390/v5041099.
Full text
8
Mukhopadhya, Indrani, Jonathan P. Segal, Simon R. Carding, Ailsa L. Hart, and Georgina L. Hold. "The gut virome: the ‘missing link’ between gut bacteria and host immunity?" Therapeutic Advances in Gastroenterology 12 (January 2019): 175628481983662. http://dx.doi.org/10.1177/1756284819836620.
Full textAbstract:
The human gut virome includes a diverse collection of viruses that infect our own cells as well as other commensal organisms, directly impacting on our well-being. Despite its predominance, the virome remains one of the least understood components of the gut microbiota, with appropriate analysis toolkits still in development. Based on its interconnectivity with all living cells, it is clear that the virome cannot be studied in isolation. Here we review the current understanding of the human gut virome, specifically in relation to other constituents of the microbiome, its evolution and life-long association with its host, and our current understanding in the context of inflammatory bowel disease and associated therapies. We propose that the gut virome and the gut bacterial microbiome share similar trajectories and interact in both health and disease and that future microbiota studies should in parallel characterize the gut virome to uncover its role in health and disease.
9
Adkar-Purushothama, Charith Raj, and Jean-Pierre Perreault. "Impact of Nucleic Acid Sequencing on Viroid Biology." International Journal of Molecular Sciences 21, no. 15 (August 1, 2020): 5532. http://dx.doi.org/10.3390/ijms21155532.
Full textAbstract:
The early 1970s marked two breakthroughs in the field of biology: (i) The development of nucleotide sequencing technology; and, (ii) the discovery of the viroids. The first DNA sequences were obtained by two-dimensional chromatography which was later replaced by sequencing using electrophoresis technique. The subsequent development of fluorescence-based sequencing method which made DNA sequencing not only easier, but many orders of magnitude faster. The knowledge of DNA sequences has become an indispensable tool for both basic and applied research. It has shed light biology of viroids, the highly structured, circular, single-stranded non-coding RNA molecules that infect numerous economically important plants. Our understanding of viroid molecular biology and biochemistry has been intimately associated with the evolution of nucleic acid sequencing technologies. With the development of the next-generation sequence method, viroid research exponentially progressed, notably in the areas of the molecular mechanisms of viroids and viroid diseases, viroid pathogenesis, viroid quasi-species, viroid adaptability, and viroid–host interactions, to name a few examples. In this review, the progress in the understanding of viroid biology in conjunction with the improvements in nucleotide sequencing technology is summarized. The future of viroid research with respect to the use of third-generation sequencing technology is also briefly envisaged.
10
Eiras, Marcelo, Maria Luisa P. N. Targon, Thor V. M. Fajardo, Ricardo Flores, and Elliot W. Kitajima. "Citrus exocortis viroid and Hop Stunt viroid Doubly infecting grapevines in Brazil." Fitopatologia Brasileira 31, no. 5 (October 2006): 440–46. http://dx.doi.org/10.1590/s0100-41582006000500002.
Full textAbstract:
Viroids, non-protein-coding small (246-401 nt) circular single-stranded RNAs with autonomous replication, are currently classified into two families. Within the family Pospiviroidae, Citrus exocortis viroid (CEVd) belongs to the genus Pospiviroid while Hop stunt viroid (HSVd) is the single member of the genus Hostuviroid. These pathogens are distributed worldwide and infect a large number of hosts. In Brazil, isolates of CEVd and HSVd have been detected in both citrus and grapevine. To characterize and study the genetic variability of these viroids, total RNA from leaves of grapevine Vitis vinifera 'Cabernet Sauvignon' and V. labrusca 'Niagara Rosada' from Bento Gonçalves, RS, was used as a template for RT-PCR amplification with specific primers for the five viroids described infecting grapevines [HSVd, CEVd, Grapevine yellow speckle viroid 1 (GYSVd-1), Grapevine yellow speckle viroid 2 (GYSVd-2) and Australian grapevine viroid (AGVd)]. Leaf samples of Citrus medica infected with CEVd from São Paulo were also analyzed. The resulting products were separated by agarose gel electrophoresis and DNA fragments of the expected size were eluted, cloned and sequenced. The grapevine samples analyzed were doubly infected by CEVd and HSVd. A phylogenetic analysis showed that the Brazilian grapevine HSVd variants clustered with other grapevine HSVd variants, forming a specific group separated from citrus variants, whereas the Brazilian CEVd variants clustered with other citrus and grapevine variants.
11
Wei, Shuang, Ruiling Bian, Ida Bagus Andika, Erbo Niu, Qian Liu, Hideki Kondo, Liu Yang, et al. "Symptomatic plant viroid infections in phytopathogenic fungi." Proceedings of the National Academy of Sciences 116, no. 26 (June 10, 2019): 13042–50. http://dx.doi.org/10.1073/pnas.1900762116.
Full textAbstract:
Viroids are pathogenic agents that have a small, circular noncoding RNA genome. They have been found only in plant species; therefore, their infectivity and pathogenicity in other organisms remain largely unexplored. In this study, we investigate whether plant viroids can replicate and induce symptoms in filamentous fungi. Seven plant viroids representing viroid groups that replicate in either the nucleus or chloroplast of plant cells were inoculated to three plant pathogenic fungi,Cryphonectria parasitica,Valsa mali, andFusarium graminearum. By transfection of fungal spheroplasts with viroid RNA transcripts, each of the three, hop stunt viroid (HSVd), iresine 1 viroid, and avocado sunblotch viroid, can stably replicate in at least one of those fungi. The viroids are horizontally transmitted through hyphal anastomosis and vertically through conidia. HSVd infection severely debilitates the growth ofV. malibut not that of the other two fungi, while inF. graminearumandC. parasitica, with deletion of dicer-like genes, the primary components of the RNA-silencing pathway, HSVd accumulation increases. We further demonstrate that HSVd can be bidirectionally transferred betweenF. graminearumand plants during infection. The viroids also efficiently infect fungi and induce disease symptoms when the viroid RNAs are exogenously applied to the fungal mycelia. These findings enhance our understanding of viroid replication, host range, and pathogenicity, and of their potential spread to other organisms in nature.
12
Hassan, M., P. Rysanek, and F. Di Serio. "First Report of Peach latent mosaic viroid and Hop stunt viroid Infecting Peach Trees in the Czech Republic." Plant Disease 87, no. 12 (December 2003): 1537. http://dx.doi.org/10.1094/pdis.2003.87.12.1537b.
Full textAbstract:
Peach latent mosaic viroid (PLMVd) and Hop stunt viroid (HSVd) are known to naturally infect stone fruits, but their contemporary presence in peach trees has been reported only recently (3). During a field validation of detection methods developed for sanitary screening of propagation material, PLMVd and HSVd, alone or in mixed infections, were detected in peach trees grown in the trial orchard of the Czech University of Agriculture in Prague. Leaf samples were collected in September 2002 from symptomless trees of peach cultivars imported from the United States (cvs. Sunhaven, Redhaven, Fairhaven, Cresthaven, Dixired, Halehaven, and NJC 103), Slovakia (cv. Luna), and a tree of Chinese wild peach, Prunus davidiana, and analyzed by reverse transcription-polymerase chain reaction (RT-PCR). PLMVd cDNA was amplified as previously reported (2) or by using two sets of primer pairs designed to amplify partial cDNAs, one reverse primer R: GTTTCTACGG CGGTACCTGA, complementary to the nucleotide positions 204 to 223 and forward primers F1: CGTATCTCAACGCCTCATCA, homologous to the positions 109 to 128, and F2: CTGCAGTTCCCGCTAGAAAG, homologous to the positions 15 to 34 of PLMVd reference sequence (2). The two pairs using the R sequence produced the expected size PCR products of 115 and 209 bp, respectively. RT-PCR for HSVd detection was performed as reported (1). The same total RNA preparations were also analyzed by molecular hybridization with nonisotopic riboprobes specific for each viroid. With minor exceptions, both methods gave similar results. Of 66 tested trees, 5 were infected with PLMVd, 46 were infected with PLMVd and HSVd, and 15 were free of both viroids. Viroid free plants included cvs. Luna, Cresthaven, Dixired, and Halehaven and the species P. davidiana. The high number of infections by both viroids was unexpected because mixed infections are generally rare (3). Most likely, mixed infections occurred during field manipulations and propagation of infected materials. To our knowledge, this is the first report of PLMVd in the Czech Republic. Although further investigations are needed to ascertain the spread of stone fruit viroids in the Czech Republic, our results also report an unusually high incidence of mixed infections of peach trees in this country. These results stress the need for a certification program to help control the spread of stone fruit viroids in the Czech Republic. References: (1) K. Amari et al. J. Gen. Virol. 82:953, 2001. (2) A. M. Shamloul et al. Acta Hort. 386:522, 1995. (3) M. Tessitori et al. Plant Dis. 86:329, 2001.
13
Cottilli, Patrick, Borja Belda-Palazón, Charith Raj Adkar-Purushothama, Jean-Pierre Perreault, Enrico Schleiff, Ismael Rodrigo, Alejandro Ferrando, and Purificación Lisón. "Citrus exocortis viroid causes ribosomal stress in tomato plants." Nucleic Acids Research 47, no. 16 (August 8, 2019): 8649–61. http://dx.doi.org/10.1093/nar/gkz679.
Full textAbstract:
Abstract Viroids are naked RNAs that do not code for any known protein and yet are able to infect plants causing severe diseases. Because of their RNA nature, many studies have focused on the involvement of viroids in RNA-mediated gene silencing as being their pathogenesis mechanism. Here, the alterations caused by the Citrus exocortis viroid (CEVd) on the tomato translation machinery were studied as a new aspect of viroid pathogenesis. The presence of viroids in the ribosomal fractions of infected tomato plants was detected. More precisely, CEVd and its derived viroid small RNAs were found to co-sediment with tomato ribosomes in vivo, and to provoke changes in the global polysome profiles, particularly in the 40S ribosomal subunit accumulation. Additionally, the viroid caused alterations in ribosome biogenesis in the infected tomato plants, affecting the 18S rRNA maturation process. A higher expression level of the ribosomal stress mediator NAC082 was also detected in the CEVd-infected tomato leaves. Both the alterations in the rRNA processing and the induction of NAC082 correlate with the degree of viroid symptomatology. Taken together, these results suggest that CEVd is responsible for defective ribosome biogenesis in tomato, thereby interfering with the translation machinery and, therefore, causing ribosomal stress.
14
Ding, Biao, and Asuka Itaya. "Viroid: A Useful Model for Studying the Basic Principles of Infection and RNA Biology." Molecular Plant-Microbe Interactions® 20, no. 1 (January 2007): 7–20. http://dx.doi.org/10.1094/mpmi-20-0007.
Full textAbstract:
Viroids are small, circular, noncoding RNAs that currently are known to infect only plants. They also are the smallest self-replicating genetic units known. Without encoding proteins and requirement for helper viruses, these small RNAs contain all the information necessary to mediate intracellular trafficking and localization, replication, systemic trafficking, and pathogenicity. All or most of these functions likely result from direct interactions between distinct viroid RNA structural motifs and their cognate cellular factors. In this review, we discuss current knowledge of these RNA motifs and cellular factors. An emerging theme is that the structural simplicity, functional versatility, and experimental tractability of viroid RNAs make viroid-host interactions an excellent model to investigate the basic principles of infection and further the general mechanisms of RNA-templated replication, intracellular and intercellular RNA trafficking, and RNA-based regulation of gene expression. We anticipate that significant advances in understanding viroid-host interactions will be achieved through multifaceted secondary and tertiary RNA structural analyses in conjunction with genetic, biochemical, cellular, and molecular tools to characterize the RNA motifs and cellular factors associated with the processes leading to systemic infection.
15
Nome, C. F., L. V. Difeo, A. Giayetto, M. Rossini, S. Frayssinet, and A. Nieto. "First Report of Pear blister canker viroid in Pear Trees in Argentina." Plant Disease 95, no. 7 (July 2011): 882. http://dx.doi.org/10.1094/pdis-03-11-0154.
Full textAbstract:
During December 2009 and January 2010, pear trees (Pyrus communis L.) from five orchards located in Allen (Alto Valle) and one in Rio Colorado, both in Rio Negro Province in Argentina, were randomly sampled for Pear blister canker viroid (PBCVd). Ninety-six trees were tested, 20 of cv. Williams, 4 of Abate Fetel, 30 of D'Anjou, and 38 of Packhamn, that showed no symptoms of PBCVd, plus four trees of cv. Red Bartlett that exhibited symptoms of bark pustules and rounded, scaly cankers varying from 2 to 6 cm in diameter on the stems. Purified dsRNA from leaves of 96 trees were analyzed by dot-blot hybridization with a specific probe for PBCVd (2). Of the plants tested, 18 were positive for PBCVd. Three of the positive dsRNAs, with a higher dot-blot signal, were analyzed by electrophoresis in 5% nondenaturing polyacrylamide and a second denaturing polyacrylamide gel. A band, in the portion of viroids migration, was detected with ethidium bromide. The segment corresponding to the three bands was excised and electroeluted. Two-step reverse transcription (RT)-PCR was performed using Moloney-murine leukemia virus (M-MLV) reverse-transcriptase (Promega Corporation, Madison, WI), retrotranscriptase, and PBCVd primers F-5′-GCGGGACAGAAGACGAGGCTCAGGCAGGAAGCAAC-3′ and R-5′-TATAAAAGAAAAAAGCGCTTCGGCGGTGCTCGGG-3′ (3). The product was legated into pUC 19 vector (Fermentas Inc., Glen Burnie, MD) and cloned following the manufacturer's instructions. Four clones were sequenced by the Unidad de Genómica, Instituto de Biotecnología (Argentina) and the sequences were analyzed with the Lasergene Biocomputing Software for Windows (version 8.0.2; DNASTAR, Madison, WI). The four partial sequences of 296 nucleotides from the local sequences were identical to each other and had the highest nucleotide identity (99.7%) with the Spanish PBCVd (GenBank Accession No. D12823). The local sequence was submitted to GenBank (Accession No. HQ606079). PBCVd is a member of the genus Apscaviroid within the family Pospiviroidae. PBCVd is a 316-nucleotide viroid responsible for pear blister canker disease. It causes pustules, cankers, and/or bark symptoms on the pear indicators A 20 and Fieud 37, whereas infections on most commercial pear cultivars remain symptomless (1). These lesions are entry points for other pathogens to infect the plant. This research indicates the need to test pear propagation material in Argentina, since this is the primary way of spreading this pathogen. To our knowledge, this is the first report of PBCVd in Argentina. References: (1) J. Desvignes et al. Plant Dis. 83:419, 1999. (2) R. Flores et al. J. Gen. Virol. 72:1199, 1991. (3) C. Hernandez et al. J. Gen. Virol. 73:2503, 1992.
16
Jiang, D. M., S. F. Li, F. H. Fu, Z. J. Wu, and L. H. Xie. "First Report of Coleus blumei viroid 5 from Coleus blumei in India and Indonesia." Plant Disease 97, no. 4 (April 2013): 561. http://dx.doi.org/10.1094/pdis-09-12-0815-pdn.
Full textAbstract:
Coleus blumei, which was found originally in Indonesia, is an ornamental plant grown worldwide. It can be infected by several viroids of the genus Coleviroid, family Pospiviroidae. Six main viroids that infect coleus have been reported: Coleus blumei viroid 1 through 6 (CbVd-1 ~ CbVd-6). Although CbVd-1 was first reported in a commercial coleus in Brazil in 1989 (1), and then in Germany, Japan, Canada, Korea, China, and India, CbVd-5 was reported only in China in 2009 (2). Symptoms caused by CbVd-5 varied depending on different cultivars, and in case of an unknown cultivar of “Red with dark green edge,” are very clear albino symptoms. From 2010 to 2011, 60 and 3 leaf samples of coleus were collected from Hyderabad, India, and Java, Indonesia, respectively, and subjected to low molecular weight RNA extraction according to Li et al. (3). The results of dot-blot hybridization using CbVd-5 cRNA probes and RT-PCR using CbVd-5 specific primers (CbVd-5-PF: 5′-TGACTAGAACAGTAGTAAAG-3′ / CbVd-5-PR: 5′-AATTGAGGTCAAACCTCTTT-3′) demonstrated that 28 out of the 60 samples from India and all three samples from Indonesia were positive for CbVd-5. The resulting RT-PCR fragments from one sample selected randomly from each country were cloned into the pMD18-T vector (Takara) and transformed into E. coli DH5α competent cells. Five positive clones of each sample were sequenced. The result of sequence analysis revealed that the similarities of CbVd-5 between the sequences we obtained and the reference sequence (GenBank Accession No. NC003683) were 97.8 to 100%. Bioassay using nine viroid-free coleus plants from three cultivars (three from each cultivar), inoculated with CbVd-5 infectious clones by stem slashing, demonstrated that CbVd-5 could induce albino symptom on the leaves of the unknown cultivar “Red with dark green edge” 2 months after inoculation. To our knowledge, this is the first report of CbVd-5 from India and Indonesia, and the second report of CbVd-5 in the world. Considering the effect of CbVd-5 on the appearance of coleus and its recombination ability, a certification program may be needed to control the spread of this viroid. References: (1) M. E. N. Fonseca et al. Fitopatol. Bras. 14:94, 1989. (2) W. Y. Hou et al. Arch. Virol. 154:315, 2009. (3) S. F. Li et al. Ann. Phytopathol. Soc. Jpn. 61:381, 1995.
17
Nuraini, Ayu Nindita, Evan Purnama Ramdan, and Erniawati Diningsih. "IDENTIFIKASI VIROID PENYEBAB PENYAKIT KERDIL PADA KRISAN MENGGUNAKAN RT-PCR." Jurnal Pertanian Presisi (Journal of Precision Agriculture) 4, no. 1 (2020): 10–17. http://dx.doi.org/10.35760/jpp.2020.v4i1.2786.
Full textAbstract:
Bunga krisan merupakan tanaman hias populer di Indonesia. Saat ini telah dilaporkan 14 jenis virus yang dapat menginfeksi tanaman krisan, sehingga akan menurunkan hasil bunga krisan. Oleh karena itu, pada penelitian ini akan diidentifikasi penyakit tanaman krisan yang disebabkan oleh virus dengan menggunakan teknik RT-PCR. Penelitian diawali dengan pengamatan gejala penyakit pada daun yang diindikasikan terinfeksi virus. Sampel daun bergejala kemudian diambil untuk diidentifikasi dengan teknik RT-PCR meliputi proses ekstrasi total DNA dan ampilifikasi nukleotida dengan menggunakan pasangan primer berupa primer forward (F) (5’-CAACTGAAGCTTCAACGCCTT-3’) dan primer reverse (R) (5’-AGGATTACTCCTGTCTCGCA-3’). Hasil penelitian menunjukkan bahwa gejala yang diamati pada daun krisan adalah warna kuning pada daun dan kerdil pada tanaman krisan diduga adanya infeksi CSVd (Chrysantenum Stunt Viroid). Konfirmasi melalui teknik RT-PCR teridentifikasi bahwa gejala tersebut disebabkan oleh CSVd dengan teramplifikasinya cDNA CSVd pada ukuran 250 bp.
18
Adkar-Purushothama, Charith Raj, Pavithran Sridharan Iyer, Teruo Sano, and Jean-Pierre Perreault. "sRNA Profiler: A User-Focused Interface for Small RNA Mapping and Profiling." Cells 10, no. 7 (July 13, 2021): 1771. http://dx.doi.org/10.3390/cells10071771.
Full textAbstract:
Viroids are circular, highly structured, single-stranded, non-coding RNA pathogens known to infect and cause disease in several plant species. They are known to trigger the host plant’s RNA silencing machinery. The detection of viroid-derived small RNAs (vd-sRNA) in viroid-infected host plants opened a new avenue of study in host–viroid pathogenicity. Since then, several viroid research groups have studied the vd-sRNA retrieved from different host–viroid combinations. Such studies require the segregation of 21- to 24-nucleotide long small RNAs (sRNA) from a deep-sequencing databank, followed by separating the vd-sRNA from any sRNA within this group that showed sequence similarity with either the genomic or the antigenomic strands of the viroid. Such mapped vd-sRNAs are then profiled on both the viroid’s genomic and antigenomic strands for visualization. Although several commercial interfaces are currently available for this purpose, they are all programmed for linear RNA molecules. Hence, viroid researchers must develop a computer program that accommodates the sRNAs derived from the circular viroid genome. This is a laborious process, and consequently, it often creates a bottleneck for biologists. In order to overcome this constraint, and to help the research community in general, in this study, a python-based pattern matching interface was developed so as to be able to both profile and map sRNAs on a circular genome. A “matching tolerance” feature has been included in the program, thus permitting the mapping of the sRNAs derived from the quasi-species. Additionally, the “topology” feature allows the researcher to profile sRNA derived from both linear and circular RNA molecules. The efficiency of the program was tested using previously reported deep-sequencing data obtained from two independent studies. Clearly, this novel software should be a key tool with which to both evaluate the production of sRNA and to profile them on their target RNA species, irrespective of the topology of the target RNA molecule.
19
Kaczorowska, Joanna, and Lia van der Hoek. "Human anelloviruses: diverse, omnipresent and commensal members of the virome." FEMS Microbiology Reviews 44, no. 3 (March 19, 2020): 305–13. http://dx.doi.org/10.1093/femsre/fuaa007.
Full textAbstract:
ABSTRACT Anelloviruses are small, single stranded circular DNA viruses. They are extremely diverse and have not been associated with any disease so far. Strikingly, these small entities infect most probably the complete human population, and there are no convincing examples demonstrating viral clearance from infected individuals. The main transmission could be via fecal-oral or airway route, as infections occur at an early age. However, due to the lack of an appropriate culture system, the virus–host interactions remain enigmatic. Anelloviruses are obviously mysterious viruses, and their impact on human life is not yet known, but, with no evidence of a disease association, a potential beneficial effect on human health should also be investigated.
20
Liu, X. L., Q. Wei, B. Hong, and X. T. Zhao. "First Report of Potato virus Y Strain N-Wilga Infecting Chrysanthemum in China." Plant Disease 98, no. 11 (November 2014): 1589. http://dx.doi.org/10.1094/pdis-02-14-0154-pdn.
Full textAbstract:
Chrysanthemum (Chrysanthemum morifolium Ramat.) is a commercially important ornamental grown worldwide, and is also extensively used as an edible and medicinal plant. In the present work, viruses and viroids infecting chrysanthemum were investigated in China in 2012 and 2013. Typical viral symptoms were observed in field-grown chrysanthemum with leaf yellowing and mottled leaves in Wenjiang District, Sichuan Province, China. The incidence of these symptoms in the field was 12.3%. Chrysanthemum virus B (CVB), Tomato aspermy virus (TAV), Cucumber mosaic virus (CMV), Tobacoo mosaic virus (TMV), Chrysanthemum stunt viroid (CSVd), and Chrysanthemum chlorotic mottle viroid (CChMVd), which had previously been reported to infect chrysanthemum in China (2,3), were not detected by RT-PCR assay. Since these symptomatic chrysanthemum plants grew next to a tobacco field, viruses affecting tobacco were suspected as possible cause. Sixteen symptomatic leaves and 12 non-symptomatic leaves were collected and tested for Potato virus Y (PVY) presence using commercial PVY-specific DAS-ELISA kits (Catalog no. PSA20001, Agdia) Six samples were found positive for PVY. RT-PCR tests using specific primers for CP gene (CP-F 5′-ACTGTGATGAATGGGCTTATG-3′; CP-R 5′-GGCATATATGGTTCCTTTTTG-3′) (4) amplified a single, expected 218-bp DNA fragment from chrysanthemum extracts from all six samples positive for PVY in ELISA. These six PCR fragments were sequenced and found 100% identical to each other. The sequence (GenBank Accession No. KJ174515) shared 99% identity with corresponding sequences of several PVY isolates (NC_001616, EF026076, HM590407, and JQ924288). The same six positive samples were subjected to a multiplex RT-PCR assay (1) to identify the PVY strain type, and all six PVY samples from Sichuan were found to belong to the PVYN-Wi strain. To our knowledge, this is the first report of the PVYN-Wi strain infecting chrysanthemum in Sichuan, China. References: (1) M. Chikh Ali et al. Plant Dis. 10:1370, 2013. (2) E. A. Nassar et al. Int. J. Virol. 8:14, 2012. (3) H. Yamamoto et al. J. Gen. Plant Pathol. 71:156, 2005. (4) J. Q. Zhang et al. J. Phytopathol. 161:92, 2013.
21
Dissanayaka Mudiyanselage, Shachinthaka, Jie Qu, Nancy Tian, Jian Jiang, and Ying Wang. "Potato Spindle Tuber Viroid RNA-Templated Transcription: Factors and Regulation." Viruses 10, no. 9 (September 17, 2018): 503. http://dx.doi.org/10.3390/v10090503.
Full textAbstract:
Viroids are circular noncoding RNAs that infect plants. Without encoding any protein, these noncoding RNAs contain the necessary genetic information for propagation in hosts. Nuclear-replicating viroids employ DNA-dependent RNA polymerase II (Pol II) for replication, a process that makes a DNA-dependent enzyme recognize RNA templates. Recently, a splicing variant of transcription factor IIIA (TFIIIA-7ZF) was identified as essential for Pol II to replicate potato spindle tuber viroid (PSTVd). The expression of TFIIIA-7ZF, particularly the splicing event, is regulated by a ribosomal protein (RPL5). PSTVd modulates its expression through a direct interaction with RPL5 resulting in optimized expression of TFIIIA-7ZF. This review summarizes the recent discoveries of host factors and regulatory mechanisms underlying PSTVd-templated transcription processes and raises new questions that may help future exploration in this direction. In addition, it briefly compares the machinery and the regulatory mechanism for PSTVd with the replication/transcription system of human hepatitis delta virus.
22
Tessitori, Matilde, Serena Rizza, Antonella Reina, Giovanni Causarano, and Francesco Di Serio. "The genetic diversity of Citrus dwarfing viroid populations is mainly dependent on the infected host species." Journal of General Virology 94, no. 3 (March 1, 2013): 687–93. http://dx.doi.org/10.1099/vir.0.048025-0.
Full textAbstract:
As with viruses, viroids infect their hosts as polymorphic populations of variants. Identifying possible sources of genetic variability is significant in the case of the species Citrus dwarfing viroid (CDVd) which has been proposed as a dwarfing agent for high-density citrus plantings. Here, a natural CDVd isolate (CMC) was used as an inoculum source for long-term (25 years) and short-term (1 year) bioassays in different citrus host species. Characterization of progenies indicated that the genetic stability of CDVd populations was high in certain hosts (trifoliate orange, Troyer citrange, Etrog citron, Navelina sweet orange), which preserve viroid populations similar to the original CMC isolate even after 25 years. By contrast, CDVd variant populations in Interdonato lemon and Volkamer lemon were completely different to those in the inoculated sources, highlighting how influential the host is on the genetic variability of CDVd populations. Implications for risk assessment of CDVd as a dwarfing agent are discussed.
23
Yang, Y. A., H. Q. Wang, R. Guo, Z. M. Cheng, S. F. Li, and T. Sano. "First Report of Hop stunt viroid in Apricot in China." Plant Disease 90, no. 6 (June 2006): 828. http://dx.doi.org/10.1094/pd-90-0828c.
Full textAbstract:
Hop stunt viroid (HSVd), a member of the family Pospiviroidae, was first described as the causal agent of hop stunt disease in Japan. It has since been found in a wide range of hosts including herbaceous and woody hosts (e.g., hop, cucumber, grapevine, citrus, plum, peach, pear, apricot, almond, and pomegranate). It was also detected and characterized in apricot where infection appears to be latent (1). The viroid occurs frequently in apricot. In southeastern Spain, the presence of HSVd was found to infect 81% of apricot trees (2). Apricots originated in China and are extensively cultivated, but HSVd infection in this host has not been reported. In September 2005, a single symptomatic apricot tree, ‘Yin Bai’, one of the most popular and widely grown cultivars in China, was discovered at the Institute of Fruit Science in Changping District in Beijing, Peoples Republic of China. Observed symptoms included a number of yellow spots with an irregular border that scattered in an irregular manner over the leaf surface. Total RNA was extracted and used for return-polyacrylamide gel electrophoresis and reverse transcription-polymerase chain reaction (RT-PCR) (4). Results of both assays were positive for HSVd. A 297-bp full-length DNA fragment was amplified by RT-PCR using primers R1 (5′-GCTGGATTCTGAGAAGAGTT-3′) complementary to HSVd residues 87–106 for the RT reaction, followed by R2 (5′-AACCCGGGGCTCCTTTCTCA-3′) complementary to HSVd residues 67–84 and forward primer F3 (5′-AACCCGGGGCAACTCTTCTC-3′) residues 79–96 for PCR. The primers are located in the strictly conserved central region of the conserved HSVd group and contain the unique endonuclease restriction site SmaI. The amplified products were cloned into pGEM-T (Promega, Madison, WI) and selected for further analysis on the basis of the results of restriction digests. Six individual clones were sequenced and three different sequences were obtained. Nucleic acid sequence (GenBank Accession No. DQ362901) obtained from one clone was 99.3% (nucleotide changes T206→C, C233→T) identical to HSVd.apr8 (GenBank Accession No. Y09349) (3). Sequence (GenBank Accession No. DQ362904) obtained from three clones was 99.7% (nucleotide change C233→T) and a third sequence (GenBank Accession No. DQ362905) obtained from two clones was 99.3% (nucleotide changes G107→A, C233→T) identical to HSVd.apr8. Further investigation is necessary to determine whether the symptoms observed are associated with the viroid infection. To our knowledge, this is the first report of HSVd isolated from apricot in China. References: (1) N. Astruc et al. Eur. J. Plant Pathol. 102:837, 1996. (2) M. C. Cañzres et al. Acta Hortic. 472:581, 1998. (3) S. A. Kofalvi et al. J. Gen. Virol. 78:3177, 1997. (4) S. F. Li et al. Ann. Phytopathol. Soc. Jpn. 61:381, 1995.
24
Gandía, Mónica, Lucía Bernad, Luis Rubio, and Núria Duran-Vila. "Host Effect on the Molecular and Biological Properties of a Citrus exocortis viroid Isolate from Vicia faba." Phytopathology® 97, no. 8 (August 2007): 1004–10. http://dx.doi.org/10.1094/phyto-97-8-1004.
Full textAbstract:
Citrus exocortis viroid (CEVd) is the casual agent of citrus exocortis disease, and has been found in naturally infected citrus and noncitrus hosts. Field isolates of CEVd may infect susceptible hosts as a complex of genetically related sequence variants (haplotypes). In the present work, a CEVd isolate recovered from a symptomless broad bean plant was characterized as a heterogeneous population with a nucleotide diversity of 0.026, which did not contain a predominant haplotype. When nucleic acid extracts of this infected broad bean were used to inoculate tomato, the plants displayed symptoms and the CEVd population was more homogeneous, with a nucleotide diversity of 0.007. However, when nucleic acid extracts from this tomato isolate were back inoculated to new broad bean plants, this isolate did not revert to the original population, because it showed low nucleotide diversity (0.001) and induced symptoms in the broad bean plants. Symptomless broad bean plants may act as reservoirs of highly heterogeneous populations of CEVd variants, providing an excellent inoculum source in terms of its potential to infect a broad range of putative hosts. The epidemiological implications are discussed.
25
Oda, Takanori, Shosuke Imai, Shunzo Chiba, and Kenzo Takada. "Epstein–Barr Virus Lacking Glycoprotein gp85 Cannot Infect B Cells and Epithelial Cells." Virology 276, no. 1 (October 2000): 52–58. http://dx.doi.org/10.1006/viro.2000.0531.
Full text
26
Urooj, Madiha, Uzma Arif, and Anisa Intikhab. "A BRIEF REVIEW FOR IDENTIFICATION AND DETECTION OF POTATO VIRUSES." World Journal of Biology and Biotechnology 1, no. 1 (April 15, 2016): 33. http://dx.doi.org/10.33865/wjb.001.01.0003.
Full textAbstract:
Potato is ranked fourth among the food crop and fifth for human consumption. It provides more yield and calories production as compare to cereals. Fungal, viral, viroid, bacteria, nematode, phytoplasmas and abiotic factors play a pivotal role for yield reduction of potato crop. Viruses known to infect potato in Pakistan include PVA, PVM, PVS, PVX, PVY, PLRV and PMTV. Increasing incidence of PVX and PVY in main potato growing areas of Pakistan is getting an alarming position and PLRV has caused significant yield losses. Present review article demonstrate different techniques for diagnostics of major potato viruses.
27
Gautier, R., A. Jiang, V. Rousseau, R. Dornburg, and T. Jaffredo. "Avian Reticuloendotheliosis Virus Strain A and Spleen Necrosis Virus Do Not Infect Human Cells." Journal of Virology 74, no. 1 (January 1, 2000): 518–22. http://dx.doi.org/10.1128/jvi.74.1.518-522.2000.
Full textAbstract:
ABSTRACT Spleen necrosis virus (SNV) andReticuloendotheliosis virus strain A (REV-A) belong to the family of reticuloendotheliosis viruses and are 90% sequence related. SNV-derived retroviral vectors produced by the REV-A-based D17.2G packaging cell line were shown to infect human cells (H.-M. Koo, A. M. C. Brown, Y. Ron, and J. P. Dougherty, J. Virol. 65:4769–4776, 1991), while similar vectors produced by another SNV-based packaging cell line, DSH134G, are not infectious in human cells (reviewed by R. Dornburg, Gene Ther. 2:301–310, 1995). Here we describe a careful reevaluation of the infectivity of vectors produced from the most commonly used REV-A- or SNV-based packaging cells obtained from various sources with, among them, one batch of D17.2G packaging cells obtained from the American Type Culture Collection. None of these packaging cells produced vectors able to infect human cells. Thus, contrary to previously published data, we conclude that REV-based vectors are not infectious in human cells.
28
Di Serio, Francesco, Silvia Ambrós, Teruo Sano, Ricardo Flores, and Beatriz Navarro. "Viroid Diseases in Pome and Stone Fruit Trees and Koch’s Postulates: A Critical Assessment." Viruses 10, no. 11 (November 7, 2018): 612. http://dx.doi.org/10.3390/v10110612.
Full textAbstract:
Composed of a naked circular non-protein-coding genomic RNA, counting only a few hundred nucleotides, viroids—the smallest infectious agents known so far—are able to replicate and move systemically in herbaceous and woody host plants, which concomitantly may develop specific diseases or remain symptomless. Several viroids have been reported to naturally infect pome and stone fruit trees, showing symptoms on leaves, fruits and/or bark. However, Koch’s postulates required for establishing on firm grounds the viroid etiology of these diseases, have not been met in all instances. Here, pome and stone fruit tree diseases, conclusively proven to be caused by viroids, are reviewed, and the need to pay closer attention to fulfilling Koch’s postulates is emphasized.
29
Matsushita, Yosuke, and Kumar K. R. Penmetcha. "In Vitro-Transcribed Chrysanthemum stunt viroid RNA Is Infectious to Chrysanthemum and Other Plants." Phytopathology® 99, no. 1 (January 2009): 58–66. http://dx.doi.org/10.1094/phyto-99-1-0058.
Full textAbstract:
Chrysanthemum stunt viroid (CSVd), a noncoding RNA, is known to cause chrysanthemum stunt disease, which affects the yield of flowers. To gain insights into CSVd replication, infection, and the reasons for the spreading of CSVd disease in chrysanthemum plants, we prepared linear CSVd RNA and analyzed its ability to cause disease in chrysanthemum plants. We found that linear CSVd replicated as efficiently as CSVd RNA isolated from the infected chrysanthemum plants. Additionally, the linear CSVd RNA was evaluated for its ability to infect other plants as well, which revealed that CSVd has a wide host range for its replication. Importantly, the CSVd isolated from these hosts is infectious to chrysanthemum plants, and thus potentially contributes to the spreading of the disease to chrysanthemum plants.
30
Hall, Roy A., and Jody Hobson-Peters. "Newly discovered mosquito viruses help control vector-borne viral diseases." Microbiology Australia 39, no. 2 (2018): 72. http://dx.doi.org/10.1071/ma18020.
Full textAbstract:
Many well-known mosquito-borne viruses such as dengue, Zika, West Nile, chikungunya and Ross River viruses can be transmitted to vertebrates and are associated with disease in man or animals. However, the use of deep sequencing and other open-minded approaches to detect viruses in mosquitoes have uncovered many new RNA viruses, most of which do not infect vertebrates. The discovery of these ‘insect-specific' viruses (ISVs) has redefined the mosquito virome and prompted the lines of viral taxonomic classification to be redrawn1,2. Despite their benign phenotype, ISVs have become a hot topic of research, with recent studies indicating they have significant application for biotechnology.
31
Catalán, Pablo, Santiago F. Elena, José A. Cuesta, and Susanna Manrubia. "Parsimonious Scenario for the Emergence of Viroid-Like Replicons De Novo." Viruses 11, no. 5 (May 9, 2019): 425. http://dx.doi.org/10.3390/v11050425.
Full textAbstract:
Viroids are small, non-coding, circular RNA molecules that infect plants. Different hypotheses for their evolutionary origin have been put forward, such as an early emergence in a precellular RNA World or several de novo independent evolutionary origins in plants. Here, we discuss the plausibility of de novo emergence of viroid-like replicons by giving theoretical support to the likelihood of different steps along a parsimonious evolutionary pathway. While Avsunviroidae-like structures are relatively easy to obtain through evolution of a population of random RNA sequences of fixed length, rod-like structures typical of Pospiviroidae are difficult to fix. Using different quantitative approaches, we evaluated the likelihood that RNA sequences fold into a rod-like structure and bear specific sequence motifs facilitating interactions with other molecules, e.g., RNA polymerases, RNases, and ligases. By means of numerical simulations, we show that circular RNA replicons analogous to Pospiviroidae emerge if evolution is seeded with minimal circular RNAs that grow through the gradual addition of nucleotides. Further, these rod-like replicons often maintain their structure if independent functional modules are acquired that impose selective constraints. The evolutionary scenario we propose here is consistent with the structural and biochemical properties of viroids described to date.
32
Gobatto, Danielle, Lucas Araújo de Oliveira, Daniel Andrade de Siqueira Franco, Nubia Velásquez, José-Antonio Daròs, and Marcelo Eiras. "Surveys in the Chrysanthemum Production Areas of Brazil and Colombia Reveal That Weeds Are Potential Reservoirs of Chrysanthemum Stunt Viroid." Viruses 11, no. 4 (April 17, 2019): 355. http://dx.doi.org/10.3390/v11040355.
Full textAbstract:
The stunting disease, incited by chrysanthemum stunt viroid (CSVd), has become a serious problem in chrysanthemum production areas worldwide. Here we identified 46 weed species from chrysanthemum fields in two producing regions of the State of São Paulo, Brazil. The mechanical inoculation of these weeds with a Brazilian CSVd isolate revealed that this viroid was able to infect 17 of these species, in addition to chrysanthemum, tomato and potato. Plants of Oxalis latifolia and chrysanthemum naturally infected with CSVd were found in chrysanthemum fields in Colombia, which is the first CSVd report in that country. Therefore, weeds have the potential to act as reservoirs of CSVd in the field. These results are the first reports of experimental CSVd infection in the following species: Amaranthus viridis, Cardamine bonariensis, Chamaesyce hirta, Conyza bonariensis, Digitaria sanguinalis, Gomphrena globosa, Helianthus annuus, Lupinus polyphyllus, Mirabilis jalapa, Oxalis latifolia, Portulaca oleracea and Catharanthus roseus. The phylogenetic analyses of the CSVd variants identified herein showed three groups with Brazilian CSVd variants distributed in them all, which suggests that Brazilian CSVd isolates may have different origins through successive introductions of infected germplasm of chrysanthemum in Brazil.
33
Mehle, N., I. Gutiérrez-Aguirre, N. Prezelj, D. Delić, U. Vidic, and M. Ravnikar. "Survival and Transmission of Potato Virus Y, Pepino Mosaic Virus, and Potato Spindle Tuber Viroid in Water." Applied and Environmental Microbiology 80, no. 4 (December 13, 2013): 1455–62. http://dx.doi.org/10.1128/aem.03349-13.
Full textAbstract:
ABSTRACTHydroponic systems and intensive irrigation are used widely in horticulture and thus have the potential for rapid spread of water-transmissible plant pathogens. Numerous plant viruses have been reported to occur in aqueous environments, although information on their survival and transmission is minimal, due mainly to the lack of effective detection methods and to the complexity of the required transmission experiments. We have assessed the role of water as a source of plant infection using three mechanically transmissible plant pathogens that constitute a serious threat to tomato and potato production: pepino mosaic virus (PepMV), potato virus Y (PVY), and potato spindle tuber viroid (PSTVd). PepMV remains infectious in water at 20 ± 4°C for up to 3 weeks, PVY (NTN strain) for up to 1 week, and PSTVd for up to 7 weeks. Experiments using a hydroponic system show that PepMV (Ch2 genotype) and PVY (NTN strain) can be released from plant roots into the nutrient solution and can infect healthy plants through their roots, ultimately spreading to the green parts, where they can be detected after a few months. In addition, tubers developed on plants grown in substrate watered with PSTVd-infested water were confirmed to be the source of viroid infection. Our data indicate that although well-known pathways of virus spread are more rapid than water-mediated infection, like insect or mechanical transmission through leaves, water is a route that provides a significant bridge for rapid virus/viroid spread. Consequently, water should be taken into account in future epidemiology and risk assessment studies.
34
Adkar-Purushothama, C. R., H. Nagaraja, M. Y. Sreenivasa, and T. Sano. "First Report of Coleus blumei viroid Infecting Coleus in India." Plant Disease 97, no. 1 (January 2013): 149. http://dx.doi.org/10.1094/pdis-08-12-0715-pdn.
Full textAbstract:
Members of the genus Coleviroid (Coleus blumei viroid [CbVd]), family Pospiviroidae have been reported to infect Coleus (Solenostemon sp.). CbVd-1 was first reported from Brazil, CbVd-2, -3, and -4 were first reported from Germany, whereas CbVd-5 and -6 were recently identified in China (2). In India, Coleus is extensively cultivated as an ornamental plant in home gardens. In March to June 2012, Coleus leaf samples with irregular chlorotic spots/patches were collected from home gardens of two different districts of Karnataka (Kodagu and Mysore districts), India, suspecting the presence of Coleus blumei viroids (CbVd 1 to 6). Low molecular weight RNAs were extracted using 2% CTAB buffer containing 1.4 M NaCl, 20 mM EDTA, pH 8.0 and 100 mM Tris-Cl, pH 8.0 (1). Viroid-like RNA was enriched by fractionation 2M LiCl soluble nucleic acids (4). A DNA fragment with the expected size of CbVd-1 was detected in 10 (including both districts) of 14 analyzed (incident rate of 71%) from reverse transcription (RT)-PCR assay using Coleviroid specific primers (forward 5′-TGGATCCAGCGCTGCAACGGAATCCA-3′ and reverse 5′-TTGGATCCGCCAGGGAACCCAGGTAAG-3′). RT was performed at 37°C for 60 min in 25 μl reaction mix containing 5 μl RNA extracts, 1 μl reverse primer, 1× first strand buffer, 10 mM dNTPs, and 200U M-MuLV-RT (Invitrogen, USA). For PCR, 2 μl RT was mixed in 25 μl PCR mix containing 0.2 μM each forward and reverse primers and 2U LA Taq (Takara-Bio, Japan) according to the manufacturer's instruction. PCR parameter was one cycle at 94°C for 2 min, 35 cycles at 94°C for 45 s, 53°C for 30 s, and 72°C for 60 s, followed by final extension at 72°C for 10 min (4). Sequence analysis of cloned amplicons detected CbVd-1 in India. To confirm the sequence of the primer regions, an additional set of tail-tail primers were designed, CbVd1-136F (5′-CTTCGTGGAACGGCTCCGCG-3′) and CbVd1-136Rev (5′-GAAGAAGCCGAAGCAACTCTC-3′) and were used for RT-PCR. Amplified products were cloned, sequenced and compared with previously obtained data. Further, the presences of CbVd-1 in Coleus samples was confirmed by a RNA gel blot assay using digoxigenin-labeled CbVd-1 cRNA probe (3). Alignment of 19 sequences obtained from four representative Coleus samples found the presence of two sequence variants of CbVd-1, namely Ind-1 (GenBank Accession No. AB740017) and Ind-2 (AB740018). Ind-1 was found to differ from Ind-2 by two nucleotide substitutions at position 40 (C to T) and 211 (T to C). BLAST analysis of Ind-1 showed 100% sequence similarity with CbVd-1 isolates from China (DQ178399) and South Korea (EU 410620), whereas Ind-2 was 99% identical to these two Chinese and Koreans isolates. Furthermore, 97% and 96% sequence identity with CbVd 1-RL RNA (Accession no. X95366) was observed for Ind-1 and Ind-2, respectively. Isolates from India were 88% similar with Coleus blumei viroid 1-RG (X95291). To the best of our knowledge, this is the first molecular evidence for the presence of CbVd-1 infecting Coleus in India. Coleus harbors various viroid species and CbVd-1, reported widely, can transmit efficiently through seed and also could infect the other herbaceous plants (3). This report from India will contribute further understanding of a potential risk of Coleus viroids in ornamental species. References: (1) J. J. Doyle and J. L. Doyle. Phytochem. Bull. 19:11, 1987. (2) F. H. Fu et al. Plant Dis. 95:494, 2011. (3) Ishiguro et al. Ann. Phytopathol. Soc. Jpn. 62:84, 1996. (4) S.-F. Li et al., Plant Pathol. 55:565, 2006.
35
Vandegrift, Kurt J., and Amit Kapoor. "The Ecology of New Constituents of the Tick Virome and Their Relevance to Public Health." Viruses 11, no. 6 (June 7, 2019): 529. http://dx.doi.org/10.3390/v11060529.
Full textAbstract:
Ticks are vectors of several pathogens that can be transmitted to humans and their geographic ranges are expanding. The exposure of ticks to new hosts in a rapidly changing environment is likely to further increase the prevalence and diversity of tick-borne diseases. Although ticks are known to transmit bacteria and viruses, most studies of tick-borne disease have focused upon Lyme disease, which is caused by infection with Borrelia burgdorferi. Until recently, ticks were considered as the vectors of a few viruses that can infect humans and animals, such as Powassan, Tick-Borne Encephalitis and Crimean–Congo hemorrhagic fever viruses. Interestingly, however, several new studies undertaken to reveal the etiology of unknown human febrile illnesses, or to describe the virome of ticks collected in different countries, have uncovered a plethora of novel viruses in ticks. Here, we compared the virome compositions of ticks from different countries and our analysis indicates that the global tick virome is dominated by RNA viruses. Comparative phylogenetic analyses of tick viruses from these different countries reveals distinct geographical clustering of the new tick viruses. Some of these new tick RNA viruses (notably severe fever with thrombocytopenia syndrome virus and Heartland virus) were found to be associated with serious human diseases. Their relevance to public health remains unknown. It is plausible that most of these newly identified tick viruses are of endogenous origin or are restricted in their transmission potential, but the efforts to identify new tick viruses should continue. Indeed, future research aimed at defining the origin, the ecology and the spillover potential of this novel viral biodiversity will be critical to understand the relevance to public health.
36
Scheets, Kay, Roya Khosravi-Far, and Robert C. Nutter. "Transcripts of a Maize Chlorotic Mottle Virus cDNA Clone Replicate in Maize Protoplasts and Infect Maize Plants." Virology 193, no. 2 (April 1993): 1006–9. http://dx.doi.org/10.1006/viro.1993.1216.
Full text
37
Navarro, Beatriz, Andreas Gisel, Pedro Serra, Michela Chiumenti, Francesco Di Serio, and Ricardo Flores. "Degradome Analysis of Tomato and Nicotiana benthamiana Plants Infected with Potato Spindle Tuber Viroid." International Journal of Molecular Sciences 22, no. 7 (April 2, 2021): 3725. http://dx.doi.org/10.3390/ijms22073725.
Full textAbstract:
Viroids are infectious non-coding RNAs that infect plants. During infection, viroid RNAs are targeted by Dicer-like proteins, generating viroid-derived small RNAs (vd-sRNAs) that can guide the sequence specific cleavage of cognate host mRNAs via an RNA silencing mechanism. To assess the involvement of these pathways in pathogenesis associated with nuclear-replicating viroids, high-throughput sequencing of sRNAs and degradome analysis were carried out on tomato and Nicotiana benthamiana plants infected by potato spindle tuber viroid (PSTVd). Both hosts develop similar stunting and leaf curling symptoms when infected by PSTVd, thus allowing comparative analyses. About one hundred tomato mRNAs potentially targeted for degradation by vd-sRNAs were initially identified. However, data from biological replicates and comparisons between mock and infected samples reduced the number of bona fide targets—i.e., those identified with high confidence in two infected biological replicates but not in the mock controls—to only eight mRNAs that encode proteins involved in development, transcription or defense. Somewhat surprisingly, results of RT-qPCR assays revealed that the accumulation of only four of these mRNAs was inhibited in the PSTVd-infected tomato. When these analyses were extended to mock inoculated and PSTVd-infected N. benthamiana plants, a completely different set of potential mRNA targets was identified. The failure to identify homologous mRNA(s) targeted by PSTVd-sRNA suggests that different pathways could be involved in the elicitation of similar symptoms in these two species. Moreover, no significant modifications in the accumulation of miRNAs and in the cleavage of their targeted mRNAs were detected in the infected tomato plants with respect to the mock controls. Taken together, these data suggest that stunting and leaf curling symptoms induced by PSTVd are elicited by a complex plant response involving multiple mechanisms, with RNA silencing being only one of the possible components.
38
Nebbak, Amira, Sonia Monteil-Bouchard, Jean-Michel Berenger, Lionel Almeras, Philippe Parola, and Christelle Desnues. "Virome Diversity among Mosquito Populations in a Sub-Urban Region of Marseille, France." Viruses 13, no. 5 (April 27, 2021): 768. http://dx.doi.org/10.3390/v13050768.
Full textAbstract:
Some mosquito species have significant public health importance given their ability to transmit major diseases to humans and animals, making them the deadliest animals in the world. Among these, the Aedes (Ae.) genus is a vector of several viruses such as Dengue, Chikungunya, and Zika viruses that can cause serious pathologies in humans. Since 2004, Ae. albopictus has been encountered in the South of France, and autochthonous cases of Dengue, Chikungunya, and Zika diseases have recently been reported, further highlighting the need for a comprehensive survey of the mosquitoes and their associated viruses in this area. Using high throughput sequencing (HTS) techniques, we report an analysis of the DNA and RNA viral communities of three mosquito species Ae. albopictus, Culex (Cx.) pipiens, and Culiseta (Cs.) longiareolata vectors of human infectious diseases in a small sub-urban city in the South of France. Results revealed the presence of a significant diversity of viruses known to infect bacteria, plants, insects, and mammals. Several novel viruses were detected, including novel members of the Rhabdoviridae, Totiviridae, Iflaviviridae, Circoviridae, and Sobemoviridae families. No sequence related to major zoonotic viruses transmitted by mosquitoes was detected. The use of HTS on arthropod vector populations is a promising strategy for monitoring the emergence and circulation of zoonoses and epizooties. This study is a contribution to the knowledge of the mosquito microbiome.
39
Mason, Peter W., Barry Baxt, Fred Brown, James Harber, Andrew Murdin, and Eckard Wimmer. "Antibody-Complexed Foot-and-Mouth Disease Virus, but Not Poliovirus, Can Infect Normally Insusceptible Cells via the Fc Receptor." Virology 192, no. 2 (February 1993): 568–77. http://dx.doi.org/10.1006/viro.1993.1073.
Full text
40
Parker, John S. L., William J. Murphy, Dai Wang, Stephen J. O'Brien, and Colin R. Parrish. "Canine and Feline Parvoviruses Can Use Human or Feline Transferrin Receptors To Bind, Enter, and Infect Cells." Journal of Virology 75, no. 8 (April 15, 2001): 3896–902. http://dx.doi.org/10.1128/jvi.75.8.3896-3902.2001.
Full textAbstract:
ABSTRACT Canine parvovirus (CPV) enters and infects cells by a dynamin-dependent, clathrin-mediated endocytic pathway, and viral capsids colocalize with transferrin in perinuclear vesicles of cells shortly after entry (J. S. L. Parker and C. R. Parrish, J. Virol. 74:1919–1930, 2000). Here we report that CPV and feline panleukopenia virus (FPV), a closely related parvovirus, bind to the human and feline transferrin receptors (TfRs) and use these receptors to enter and infect cells. Capsids did not detectably bind or enter quail QT35 cells or a Chinese hamster ovary (CHO) cell-derived cell line that lacks any TfR (TRVb cells). However, capsids bound and were endocytosed into QT35 cells and CHO-derived TRVb-1 cells that expressed the human TfR. TRVb-1 cells or TRVb cells transiently expressing the feline TfR were susceptible to infection by CPV and FPV, but the parental TRVb cells were not. We screened a panel of feline-mouse hybrid cells for susceptibility to FPV infection and found that only those cells that possessed feline chromosome C2 were susceptible. The feline TfR gene (TRFC) also mapped to feline chromosome C2. These data indicate that cell susceptibility for these viruses is determined by the TfR.
41
CHEN, FENG, and CURTIS A. SUTTLE. "Evolutionary Relationships among Large Double-Stranded DNA Viruses That Infect Microalgae and Other Organisms as Inferred from DNA Polymerase Genes." Virology 219, no. 1 (May 1996): 170–78. http://dx.doi.org/10.1006/viro.1996.0234.
Full text
42
Hassen, I. Fekih, S. Roussel, J. Kummert, H. Fakhfakh, M. Marrakchi, and M. H. Jijakli. "Peach latent mosaic viroid Detected for the First Time on Almond Trees in Tunisia." Plant Disease 89, no. 11 (November 2005): 1244. http://dx.doi.org/10.1094/pd-89-1244a.
Full textAbstract:
Almond (Prunus dulcis Mill) is an important crop in countries of the Mediterranean area. Until now, among viroids, only Hop stunt viroid (HSVd) is known to infect cultivated almond trees (2). In 2004, a survey of almond trees was carried out in orchards in different regions of Tunisia, a major producing and exporting country of almond. Symptoms such as mosaic and necrotic lesions, potentially caused by the Peach latent mosaic viroid (PLMVd), were observed on leaves of cultivated almond trees. Since PLMVd was recently detected in peach and pear trees in Tunisia (4), the presence of this viroid in almond trees was studied. The detection method on the basis of one-tube reverse transcription-polymerase chain reaction (RT-PCR) assays was previously described and validated for the detection of this viroid in fruit trees (4). Amplification products were obtained by using previously reported primer pairs of PLMVd (1). Positive controls included RNA preparations of twigs of PLMVd-infected GF 305 peach seedlings. These materials, provided by B. Pradier (Station de Quarantaine des Ligneux, Lempdes, France), were positive as revealed by chip budding on peach seedling indicator plants grown under greenhouse conditions. RT-PCR analysis of nucleic acid preparations from leaves of almond showed specific amplification products with the expected size of 337 bp for two almond trees among 17 trees tested. Nucleotide sequence analyses of cloned amplification products obtained with the PLMVd primers confirmed a size of 337 bp and revealed a sequence similar to sequences from other PLMVd isolates previously characterized. The sequences shared 94 to 98% identity with the reference isolates of PLMVd from peach (EMBL Accession No. M83545, AF170511, AF170514, and AY685181). The two infected almond trees are proximal to each other and peach trees infected with PLMVd. This suggests that one tree may have served as a source of inoculum for the other through agronomic practices such as pruning or the aphid Myzus percicae (3). Alternatively, PLMVd may have originated in an unknown host and was then transmitted to almond trees. Our investigation shows that almond is a new host for PLMVd. References: (1) N. Astruc. Eur. J. Plant Pathol. 102:837, 1996. (2) M. C. Cañizares et al. Eur. J. Plant Pathol. 105:553, 1999. (3) J. C. Desvignes et al. Phytoma 444:70, 1992. (4) I. Fekih Hassen et al. Plant Dis. 88:1164, 2004.
43
Schickli, Jeanne H., Larissa B. Thackray, Stanley G. Sawicki, and Kathryn V. Holmes. "The N-Terminal Region of the Murine Coronavirus Spike Glycoprotein Is Associated with the Extended Host Range of Viruses from Persistently Infected Murine Cells." Journal of Virology 78, no. 17 (September 1, 2004): 9073–83. http://dx.doi.org/10.1128/jvi.78.17.9073-9083.2004.
Full textAbstract:
ABSTRACT Although murine coronaviruses naturally infect only mice, several virus variants derived from persistently infected murine cell cultures have an extended host range. The mouse hepatitis virus (MHV) variant MHV/BHK can infect hamster, rat, cat, dog, monkey, and human cell lines but not the swine testis (ST) porcine cell line (J. H. Schickli, B. D. Zelus, D. E. Wentworth, S. G. Sawicki, and K. V. Holmes, J. Virol. 71:9499-9507, 1997). The spike (S) gene of MHV/BHK had 63 point mutations and a 21-bp insert that encoded 56 amino acid substitutions and a 7-amino-acid insert compared to the parental MHV strain A59. Recombinant viruses between MHV-A59 and MHV/BHK were selected in hamster cells. All of the recombinants retained 21 amino acid substitutions and a 7-amino-acid insert found in the N-terminal region of S of MHV/BHK, suggesting that these residues were responsible for the extended host range of MHV/BHK. Flow cytometry showed that MHV-A59 bound only to cells that expressed the murine glycoprotein receptor CEACAM1a. In contrast, MHV/BHK and a recombinant virus, k6c, with the 21 amino acid substitutions and 7-amino-acid insert in S bound to hamster (BHK) and ST cells as well as murine cells. Thus, 21 amino acid substitutions and a 7-amino-acid insert in the N-terminal region of the S glycoprotein of MHV/BHK confer the ability to bind and in some cases infect cells of nonmurine species.
44
Tuffereau, Christine, Jacqueline Benejean, Anne-Marie Roque Alfonso, Anne Flamand, and Mark C. Fishman. "Neuronal Cell Surface Molecules Mediate Specific Binding to Rabies Virus Glycoprotein Expressed by a Recombinant Baculovirus on the Surfaces of Lepidopteran Cells." Journal of Virology 72, no. 2 (February 1, 1998): 1085–91. http://dx.doi.org/10.1128/jvi.72.2.1085-1091.1998.
Full textAbstract:
ABSTRACT The existence of specific rabies virus (RV) glycoprotein (G) binding sites on the surfaces of neuroblastoma cells is demonstrated.Spodoptera frugiperda (Sf21) cells expressing G of the RV strain CVS (Gcvs-Sf21 cells) bind specifically to neuroblastoma cells of different species but not to any other cell type (fibroblast, myoblast, epithelial, or glioma). Attachment to mouse neuroblastoma NG108-15 cells is abolished by previous treatment of Gcvs-Sf21 cells with anti-G antibody. Substitutions for lysine at position 330 and for arginine at position 333 in RV G greatly reduce interaction between Gcvs-Sf21 cells and NG108-15 cells. These data are consistent with in vivo results: an avirulent RV mutant bearing the same double mutation is not able to infect sensory neurons or motoneurons (P. Coulon, J.-P. Ternaux, A. Flamand, and C. Tuffereau, J. Virol. 72:273–278, 1998) after intramuscular inoculation into a mouse. Furthermore, infection of NG108-15 cells by RV but not by vesicular stomatitis virus leads to a reduction of the number of binding sites at the neuronal-cell surface. Our data strongly suggest that these specific attachment sites on neuroblastoma cells represent a neuronal receptor(s) used by RV to infect certain types of neurons in vivo.
45
Nayfach, Stephen, David Páez-Espino, Lee Call, Soo Jen Low, Hila Sberro, Natalia N. Ivanova, Amy D. Proal, et al. "Metagenomic compendium of 189,680 DNA viruses from the human gut microbiome." Nature Microbiology 6, no. 7 (June 24, 2021): 960–70. http://dx.doi.org/10.1038/s41564-021-00928-6.
Full textAbstract:
AbstractBacteriophages have important roles in the ecology of the human gut microbiome but are under-represented in reference databases. To address this problem, we assembled the Metagenomic Gut Virus catalogue that comprises 189,680 viral genomes from 11,810 publicly available human stool metagenomes. Over 75% of genomes represent double-stranded DNA phages that infect members of the Bacteroidia and Clostridia classes. Based on sequence clustering we identified 54,118 candidate viral species, 92% of which were not found in existing databases. The Metagenomic Gut Virus catalogue improves detection of viruses in stool metagenomes and accounts for nearly 40% of CRISPR spacers found in human gut Bacteria and Archaea. We also produced a catalogue of 459,375 viral protein clusters to explore the functional potential of the gut virome. This revealed tens of thousands of diversity-generating retroelements, which use error-prone reverse transcription to mutate target genes and may be involved in the molecular arms race between phages and their bacterial hosts.
46
Hardmeier, Isabelle, Nadja Aeberhard, Weihong Qi, Katja Schoenbaechler, Hubert Kraettli, Jean-Michel Hatt, Cornel Fraefel, and Jakub Kubacki. "Metagenomic analysis of fecal and tissue samples from 18 endemic bat species in Switzerland revealed a diverse virus composition including potentially zoonotic viruses." PLOS ONE 16, no. 6 (June 16, 2021): e0252534. http://dx.doi.org/10.1371/journal.pone.0252534.
Full textAbstract:
Many recent disease outbreaks in humans had a zoonotic virus etiology. Bats in particular have been recognized as reservoirs to a large variety of viruses with the potential to cross-species transmission. In order to assess the risk of bats in Switzerland for such transmissions, we determined the virome of tissue and fecal samples of 14 native and 4 migrating bat species. In total, sequences belonging to 39 different virus families, 16 of which are known to infect vertebrates, were detected. Contigs of coronaviruses, adenoviruses, hepeviruses, rotaviruses A and H, and parvoviruses with potential zoonotic risk were characterized in more detail. Most interestingly, in a ground stool sample of a Vespertilio murinus colony an almost complete genome of a Middle East respiratory syndrome-related coronavirus (MERS-CoV) was detected by Next generation sequencing and confirmed by PCR. In conclusion, bats in Switzerland naturally harbour many different viruses. Metagenomic analyses of non-invasive samples like ground stool may support effective surveillance and early detection of viral zoonoses.
47
Li, Linlin, Joseph G. Victoria, Chunlin Wang, Morris Jones, Gary M. Fellers, Thomas H. Kunz, and Eric Delwart. "Bat Guano Virome: Predominance of Dietary Viruses from Insects and Plants plus Novel Mammalian Viruses." Journal of Virology 84, no. 14 (May 12, 2010): 6955–65. http://dx.doi.org/10.1128/jvi.00501-10.
Full textAbstract:
ABSTRACT Bats are hosts to a variety of viruses capable of zoonotic transmissions. Because of increased contact between bats, humans, and other animal species, the possibility exists for further cross-species transmissions and ensuing disease outbreaks. We describe here full and partial viral genomes identified using metagenomics in the guano of bats from California and Texas. A total of 34% and 58% of 390,000 sequence reads from bat guano in California and Texas, respectively, were related to eukaryotic viruses, and the largest proportion of those infect insects, reflecting the diet of these insectivorous bats, including members of the viral families Dicistroviridae, Iflaviridae, Tetraviridae, and Nodaviridae and the subfamily Densovirinae. The second largest proportion of virus-related sequences infects plants and fungi, likely reflecting the diet of ingested insects, including members of the viral families Luteoviridae, Secoviridae, Tymoviridae, and Partitiviridae and the genus Sobemovirus. Bat guano viruses related to those infecting mammals comprised the third largest group, including members of the viral families Parvoviridae, Circoviridae, Picornaviridae, Adenoviridae, Poxviridae, Astroviridae, and Coronaviridae. No close relative of known human viral pathogens was identified in these bat populations. Phylogenetic analysis was used to clarify the relationship to known viral taxa of novel sequences detected in bat guano samples, showing that some guano viral sequences fall outside existing taxonomic groups. This initial characterization of the bat guano virome, the first metagenomic analysis of viruses in wild mammals using second-generation sequencing, therefore showed the presence of previously unidentified viral species, genera, and possibly families. Viral metagenomics is a useful tool for genetically characterizing viruses present in animals with the known capability of direct or indirect viral zoonosis to humans.
48
Kinoti, Wycliff M., Narelle Nancarrow, Alison Dann, Brendan C. Rodoni, and Fiona E. Constable. "Updating the Quarantine Status of Prunus Infecting Viruses in Australia." Viruses 12, no. 2 (February 23, 2020): 246. http://dx.doi.org/10.3390/v12020246.
Full textAbstract:
One hundred Prunus trees, including almond (P. dulcis), apricot (P. armeniaca), nectarine (P. persica var. nucipersica), peach (P. persica), plum (P. domestica), purple leaf plum (P. cerasifera) and sweet cherry (P. avium), were selected from growing regions Australia-wide and tested for the presence of 34 viruses and three viroids using species-specific reverse transcription-polymerase chain reaction (RT-PCR) or polymerase chain reaction (PCR) tests. In addition, the samples were tested using some virus family or genus-based RT-PCR tests. The following viruses were detected: Apple chlorotic leaf spot virus (ACLSV) (13/100), Apple mosaic virus (ApMV) (1/100), Cherry green ring mottle virus (CGRMV) (4/100), Cherry necrotic rusty mottle virus (CNRMV) (2/100), Cherry virus A (CVA) (14/100), Little cherry virus 2 (LChV2) (3/100), Plum bark necrosis stem pitting associated virus (PBNSPaV) (4/100), Prune dwarf virus (PDV) (3/100), Prunus necrotic ringspot virus (PNRSV) (52/100), Hop stunt viroid (HSVd) (9/100) and Peach latent mosaic viroid (PLMVd) (6/100). The results showed that PNRSV is widespread in Prunus trees in Australia. Metagenomic high-throughput sequencing (HTS) and bioinformatics analysis were used to characterise the genomes of some viruses that were detected by RT-PCR tests and Apricot latent virus (ApLV), Apricot vein clearing associated virus (AVCaV), Asian Prunus Virus 2 (APV2) and Nectarine stem pitting-associated virus (NSPaV) were also detected. This is the first report of ApLV, APV2, CGRMV, CNRNV, LChV1, LChV2, NSPaV and PBNSPaV occurring in Australia. It is also the first report of ASGV infecting Prunus species in Australia, although it is known to infect other plant species including pome fruit and citrus.
49
Birnberg, Lotty, Francisco M. Codoñer, Raúl Escosa, Carles Aranda, Ana Isabel Núñez, Sandra Talavera, and Núria Busquets. "Small RNAs Virome Characterization Reveals Arthropod-Associated Viruses in Anopheles atroparvus from the Ebro Delta, Spain." Proceedings 50, no. 1 (June 24, 2020): 103. http://dx.doi.org/10.3390/proceedings2020050103.
Full textAbstract:
Even though malaria was eradicated from Europe after the mid-20th century, in 2017, more than 8000 imported cases were reported in the continent. Due to travel routes to endemic areas, climate change, and the presence of native vector mosquitoes (genus Anopheles), the re-establishment of autochthonous malaria transmission is a current concern. Anopheles atroparvus (Van Thiel, 1972) is one of the 11 sibling species within the Palearctic Anopheles maculipennis complex, which formerly were considered the main vectors of the disease in the European continent. The microbiota (bacteria and viruses) of vector species has been demonstrated to play a significant role in the biology of these organisms, including their infection susceptibility and their capacity to transmit disease-causing agents. Recently, with the improvement of metagenomics techniques, several viruses that naturally infect vector mosquitoes have been identified. The purpose of the present study was to characterize, for the first time, the virome present in An. atroparvus from the Ebro Delta and assess its evolution after ten generations in the laboratory. Small RNA sequencing was used to characterize the virome from wild-caught An. atroparvus females and from the tenth generation produced under controlled laboratory conditions. Through this approach, we were able to identify viral linages previously reported in other invertebrates, such as Chaq virus and several Partiti-like viruses. A reduction in the viral composition was observed during the colonization process. The present study contributes to the understanding of the viral diversity of a medically relevant vector species in its natural setting and under confinement, and sets a baseline for further studies to assess the potential implications of these viruses in the transmission of pathogens.
50
Fear, Warwick R., Alison M. Kesson, Hassan Naif, Garry W. Lynch, and Anthony L. Cunningham. "Differential Tropism and Chemokine Receptor Expression of Human Immunodeficiency Virus Type 1 in Neonatal Monocytes, Monocyte-Derived Macrophages, and Placental Macrophages." Journal of Virology 72, no. 2 (February 1, 1998): 1334–44. http://dx.doi.org/10.1128/jvi.72.2.1334-1344.1998.
Full textAbstract:
ABSTRACT Laboratory-adapted (LA) macrophage-tropic (M-tropic) human immunodeficiency virus type 1 (HIV-1) isolates (e.g., HIV-1Ba-L) and low-passage primary (PR) isolates differed markedly in tropism for syngeneic neonatal monocytes, monocyte-derived macrophages (MDMs), and placental macrophages (PMs). Newly adherent neonatal monocytes and cultured PMs were highly refractory to infection with PR HIV-1 isolates yet were permissive for LA M-tropic isolates. Day 4 MDMs were also permissive for LA M-tropic isolates and additionally, were permissive for over half the PR isolates tested. Qualitative differences in PR HIV-1 infection of monocytes/MDMs could not be correlated with CD4 levels alone, and in all three cell types the block to PR HIV-1 strain replication preceded reverse transcription. Neonatal monocyte susceptibility to PR HIV-1 strains correlated with increasing CCR-5 expression during maturation. CCR-5 could not be detected on newly adherent (day 1) neonatal monocytes, in contrast to adult monocytes (H. Naif et al., J. Virol. 72:830–836, 1998), but was readily detectable after 4 to 7 days of culture. However, moderate CCR-5 mRNA levels were present in day 1 neonatal monocytes and remained constant during monocyte maturation. CCR-5 was not detectable on the surface of PMs, yet the receptor was present within permeabilized cells. Notably, two brain-derived PR HIV-1 isolates from a single patient, differing in their V3 loops, were discordant in their abilities to infect neonatal monocytes/MDMs and PMs, yet both isolates could infect newly adherent adult monocytes. Together these data strongly suggest that LA HIV-1 isolates are able to infect neonatal monocytes at earlier stages of maturation and lower-level expression of CCR-5 than PR isolates. The differences between neonatal and adult monocytes in susceptibility to PR isolates may also be related to the level of CCR-5 expression.