To see the other types of publications on this topic, follow the link: VIH (virus) – Reproduction (biologie).
Journal articles on the topic 'VIH (virus) – Reproduction (biologie)'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 44 journal articles for your research on the topic 'VIH (virus) – Reproduction (biologie).'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
Lamoril, J., and M. Bogard. "La quantification en biologie moléculaire: application à l'étude de la charge virale du virus VIH-1." Immuno-analyse & Biologie Spécialisée 11, no. 5 (January 1996): 325–32. http://dx.doi.org/10.1016/0923-2532(96)88207-x.
Full text
2
Kim, Keun Il, Ming Yan, Oxana Malakhova, Jiann-Kae Luo, Mei-Feng Shen, Weiguo Zou, Juan Carlos de la Torre, and Dong-Er Zhang. "Ube1L and Protein ISGylation Are Not Essential for Alpha/Beta Interferon Signaling." Molecular and Cellular Biology 26, no. 2 (January 15, 2006): 472–79. http://dx.doi.org/10.1128/mcb.26.2.472-479.2006.
Full textAbstract:
ABSTRACT The expression of ubiquitin-like modifier ISG15 and its conjugation to target proteins are highly induced by interferon (IFN) stimulation and during viral and bacterial infections. However, the biological significance of this modification has not been clearly understood. To investigate the function of protein modification by ISG15, we generated a mouse model deficient in UBE1L, an ISG15-activating enzyme. Ube1L−/− mice did not produce ISG15 conjugates but expressed free ISG15 normally. ISGylation has been implicated in the reproduction and innate immunity. However, Ube1L−/− mice were fertile and exhibited normal antiviral responses against vesicular stomatitis virus and lymphocytic choriomeningitis virus infection. Our results indicate that UBE1L and protein ISGylation are not critical for IFN-α/β signaling via JAK/STAT activation. Moreover, using Ube1L/Ubp43 double-deficient mice, we showed that lack of UBP43, but not the increase of protein ISGylation, is related to the increased IFN signaling in Ubp43-deficient mice.
3
Oludoun, Olajumoke, Olukayode Adebimpe, James Ndako, Michael Adeniyi, Oluwakemi Abiodun, and Babatunde Gbadamosi. "The impact of testing and treatment on the dynamics of Hepatitis B virus." F1000Research 10 (September 17, 2021): 936. http://dx.doi.org/10.12688/f1000research.72865.1.
Full textAbstract:
Despite the intervention of WHO on vaccination for reducing the spread of Hepatitis B Virus (HBV), there are records of the high prevalence of HBV in some regions. In this paper, a mathematical model was formulated to analyze the acquisition and transmission process of the virus with the view of identifying the possible way of reducing the menace and mitigating the risk of the virus. The models' positivity and boundedness were demonstrated using well-known theorems. Equating the differential equations to zero demonstrates the equilibria of the solutions i.e., the disease-free and endemic equilibrium. The next Generation Matrix method was used to compute the basic reproduction number for the models. Local and global stabilities of the models were shown via linearization and Lyapunov function methods respectively. The importance of testing and treatment on the dynamics of HBV were fully discussed in this paper. It was discovered that testing at the acute stage of the virus and chronic unaware state helps in better management of the virus.
4
Barker, Colin T., and Naveen K. Vaidya. "Modeling HIV-1 infection in the brain." PLOS Computational Biology 16, no. 11 (November 19, 2020): e1008305. http://dx.doi.org/10.1371/journal.pcbi.1008305.
Full textAbstract:
While highly active antiretroviral therapy (HAART) is successful in controlling the replication of Human Immunodeficiency Virus (HIV-1) in many patients, currently there is no cure for HIV-1, presumably due to the presence of reservoirs of the virus. One of the least studied viral reservoirs is the brain, which the virus enters by crossing the blood-brain barrier (BBB) via macrophages, which are considered as conduits between the blood and the brain. The presence of HIV-1 in the brain often leads to HIV associated neurocognitive disorders (HAND), such as encephalitis and early-onset dementia. In this study we develop a novel mathematical model that describes HIV-1 infection in the brain and in the plasma coupled via the BBB. The model predictions are consistent with data from macaques infected with a mixture of simian immunodeficiency virus (SIV) and simian-human immunodeficiency virus (SHIV). Using our model, we estimate the rate of virus transport across the BBB as well as viral replication inside the brain, and we compute the basic reproduction number. We also carry out thorough sensitivity analysis to define the robustness of the model predictions on virus dynamics inside the brain. Our model provides useful insight into virus replication within the brain and suggests that the brain can be an important reservoir causing long-term viral persistence.
5
Diao, Feifei, Chenlong Jiang, Yangyang Sun, Yanni Gao, Juan Bai, Hans Nauwynck, Xianwei Wang, Yuanqi Yang, Ping Jiang, and Xing Liu. "Porcine reproductive and respiratory syndrome virus infection triggers autophagy via ER stress-induced calcium signaling to facilitate virus replication." PLOS Pathogens 19, no. 3 (March 27, 2023): e1011295. http://dx.doi.org/10.1371/journal.ppat.1011295.
Full textAbstract:
Calcium (Ca2+), a ubiquitous second messenger, plays a crucial role in many cellular functions. Viruses often hijack Ca2+ signaling to facilitate viral processes such as entry, replication, assembly, and egress. Here, we report that infection by the swine arterivirus, porcine reproductive and respiratory syndrome virus (PRRSV), induces dysregulated Ca2+ homeostasis, subsequently activating calmodulin-dependent protein kinase-II (CaMKII) mediated autophagy, and thus fueling viral replication. Mechanically, PRRSV infection induces endoplasmic reticulum (ER) stress and forms a closed ER–plasma membrane (PM) contacts, resulting the opening of store operated calcium entry (SOCE) channel and causing the ER to take up extracellular Ca2+, which is then released into the cytoplasm by inositol trisphosphate receptor (IP3R) channel. Importantly, pharmacological inhibition of ER stress or CaMKII mediated autophagy blocks PRRSV replication. Notably, we show that PRRSV protein Nsp2 plays a dominant role in the PRRSV induced ER stress and autophagy, interacting with stromal interaction molecule 1 (STIM1) and the 78 kDa glucose-regulated protein 78 (GRP78). The interplay between PRRSV and cellular calcium signaling provides a novel potential approach to develop antivirals and therapeutics for the disease outbreaks.
6
Veit, Michael, Mohamed Rasheed Gadalla, and Minze Zhang. "Using Alphafold2 to Predict the Structure of the Gp5/M Dimer of Porcine Respiratory and Reproductive Syndrome Virus." International Journal of Molecular Sciences 23, no. 21 (October 30, 2022): 13209. http://dx.doi.org/10.3390/ijms232113209.
Full textAbstract:
Porcine reproductive and respiratory syndrome virus is a positive-stranded RNA virus of the family Arteriviridae. The Gp5/M dimer, the major component of the viral envelope, is required for virus budding and is an antibody target. We used alphafold2, an artificial-intelligence-based system, to predict a credible structure of Gp5/M. The short disulfide-linked ectodomains lie flat on the membrane, with the exception of the erected N-terminal helix of Gp5, which contains the antibody epitopes and a hypervariable region with a changing number of carbohydrates. The core of the dimer consists of six curved and tilted transmembrane helices, and three are from each protein. The third transmembrane regions extend into the cytoplasm as amphiphilic helices containing the acylation sites. The endodomains of Gp5 and M are composed of seven β-strands from each protein, which interact via β-strand seven. The area under the membrane forms an open cavity with a positive surface charge. The M and Orf3a proteins of coronaviruses have a similar structure, suggesting that all four proteins are derived from the same ancestral gene. Orf3a, like Gp5/M, is acylated at membrane-proximal cysteines. The role of Gp5/M during virus replication is discussed, in particular the mechanisms of virus budding and models of antibody-dependent virus neutralization.
7
Chadsuthi, Sudarat, and Surapa Wichapeng. "The Modelling of Hand, Foot, and Mouth Disease in Contaminated Environments in Bangkok, Thailand." Computational and Mathematical Methods in Medicine 2018 (June 3, 2018): 1–8. http://dx.doi.org/10.1155/2018/5168931.
Full textAbstract:
Hand, foot, and mouth disease (HFMD) has spread widely in a continuing endemic in Thailand. There are no specific vaccines or antiviral treatments available that specifically target HFMD. Indirect transmission via free-living viruses from the environment may influence HFMD infections because the virus can survive for long periods in the environment. In this study, a new mathematical model is proposed to investigate the effect of indirect transmission from contaminated environments and the impact of asymptomatic individuals. By fitting our model to reported data on hospitalized individuals of HFMD endemic in Bangkok, Thailand, 2016, the basic reproduction number was estimated as 1.441, which suggests that the disease will remain under current conditions. Numerical simulations show that the direct transmission from asymptomatic individuals and indirect transmission via free-living viruses are important factors which contribute to new HFMD infections. Sensitivity analysis indicates that the basic reproduction number is sensitive to the transmission rate of asymptomatic and symptomatic subgroups and indirect transmission. Our findings suggest that cleaning the environment frequently and healthcare precautions which include the reduction of direct transmission rates should be promoted as effective control strategies for preventing the HFMD spread.
8
Castelo Branco, Anna Cláudia, Luanda Mara da Silva Oliveira, Fábio Seiti Yamada Yoshikawa, Anna Julia Pietrobom, Amaro Nunes Duarte Neto, and Maria Notomi Sato. "Evaluation of human placental villi inflammation via TLR4 activation during Zika virus infection." Placenta 83 (August 2019): e92. http://dx.doi.org/10.1016/j.placenta.2019.06.292.
Full text
9
Zhang, Lin, Lu Zhang, Yu Pan, Junxin Gao, Yunfei Xu, Xi Li, Zhijun Tian, Hongyan Chen, and Yue Wang. "Downregulation of miR-218 by porcine reproductive and respiratory syndrome virus facilitates viral replication via inhibition of type I interferon responses." Journal of Biological Chemistry 296 (January 2021): 100683. http://dx.doi.org/10.1016/j.jbc.2021.100683.
Full text
10
Ling, Xiaoya, Zhigang Cao, Panpan Sun, Hua Zhang, Yaogui Sun, Jia Zhong, Wei Yin, et al. "Target Discovery of Matrine against PRRSV in Marc-145 Cells via Activity-Based Protein Profiling." International Journal of Molecular Sciences 24, no. 14 (July 16, 2023): 11526. http://dx.doi.org/10.3390/ijms241411526.
Full textAbstract:
Porcine reproductive and respiratory syndrome (PRRS) seriously endangers the sustainable development of the pig industry. Our previous studies have shown that matrine can resist porcine reproductive and respiratory syndrome virus (PRRSV) infection. This study aimed to explore the anti-PRRSV targets of matrine in Marc-145 cells. Biotin-labeled matrine 1 and 2 were used as probes. MTT assay was used to determine the maximum non-cytotoxic concentration (MNTC) of each probe in Marc-145 cells. The anti-PRRSV activity of each probe was evaluated via MTT, qPCR and Western blot, and its anti-inflammatory activity was evaluated via qPCR and Western blot. The targets of matrine in Marc-145 cells were searched using activity-based protein profiling (ABPP), and compared with the targets predicted via network pharmacology for screening the potential targets of matrine against PRRSV. The protein–protein interaction networks (PPI) of potential targets were constructed using a network database and GO/KEGG enrichment analysis was performed. ACAT1, ALB, HMOX1, HSPA8, HSP90AB1, PARP1 and STAT1 were identified as potential targets of matrine, and their functions were related to antiviral capacity and immunity. Matrine may play an anti-PRRSV role by directly acting on ACAT1, ALB, HMOX1, HSPA8, HSP90AB1, PARP1 and STAT1.
11
Gard, J. A., M. D. Givens, P. K. Galik, K. P. Riddell, M. S. D. Marley, D. A. Stringfellow, M. A. Edmondson, and B. K. Whitlock. "154 THE QUANTITY OF BOVINE VIRAL DIARRHEA VIRUS ASSOCIATED WITH SINGLE ZONA PELLUCIDA-INTACT IN VITRO-PRODUCED BOVINE EMBRYOS FOLLOWING ARTIFICIAL EXPOSURE." Reproduction, Fertility and Development 20, no. 1 (2008): 157. http://dx.doi.org/10.1071/rdv20n1ab154.
Full textAbstract:
The primary objective of this study was to determine the percentage of individual, preimplantation, in vitro-produced bovine embryos which maintained association with virus despite washing following artificial exposure to a high affinity strain of bovine viral diarrhea virus (BVDV). Another objective of this study was to determine the quantity of virus associated with these embryos. A total of eighty-seven zona pellucida-intact, Day 7, in vitro-produced bovine embryos were exposed for 1 h to 2 � 106 cell culture infected doses per mL to the 50 percent endpoint (CCID50 mL–1) of a type 1 noncytopathic strain of BVDV (SD-1). Following exposure, the embryos were washed according to International Embryo Transfer Society standards for in vitro-produced bovine embryos; they then underwent sonication, RNA extraction, and freezing at –80�C until assayed for virus. A real-time quantitative polymerase chain reaction (QPCR) was run in duplicate on each of the 87 embryos. Forty-two percent (39/87) of the embryos assayed were determined to be positive for virus. The quantity of virus associated with the embryos averaged 0.55 viral copies per 5 µL (SD = 0.89 copies/5 µL, SEM = 0.14 copies/5 µL). Assessment of data using tolerance intervals (P = 0.05) indicates that 90% of contaminated embryos were associated with ≤2.40 viral copies per 5 µL while 99% of contaminated embryos were associated with ≤3.44 viral copies per 5 µL. These findings show that there is a low level of virus associated with in vitro-produced embryos but virus is associated with a significant number of exposed embryos. In conclusion, this study indicates that the potential for transmission of BVDV via embryo transfer of in vitro-produced embryos is small given the amount of virus that was found to associate with individual embryos.
12
Gard, J. A., M. D. Givens, P. K. Galik, D. A. Stringfellow, K. P. Riddell, S. E. Marley, and B. K. Whitlock. "234 QUANTITATION OF BOVINE VIRAL DIARRHEA VIRUS ASSOCIATED WITH SINGLE ZONA PELLUCIDA-INTACT IN VIVO-DERIVED BOVINE EMBRYOS." Reproduction, Fertility and Development 19, no. 1 (2007): 233. http://dx.doi.org/10.1071/rdv19n1ab234.
Full textAbstract:
Quantitation of bovine viral diarrhea virus (BVDV) associated with individual transferable embryos is prerequisite to a thorough assessment of the risk for transmission of BVDV via embryo transfer. One objective of this study was to determine the proportion of in vivo-derived bovine embryos that remained virus-positive after artificial exposure to a high-affinity strain of BVDV and thorough washing. A second objective was to determine the quantity of virus associated with these individual embryos. A total of 87 zona pellucida-intact, Day 7, in vivo-derived bovine embryos were exposed to a type 1 noncytopathic strain of BVDV (SD-1) and washed according to International Embryo Transfer Society recommendations. Subsequently, individual embryos were sonicated, and the RNA was extracted from the sonicate fluids and stored at -80�C until assayed using a real-time quantitative polymerase chain reaction (QPCR). Twenty-six percent (23/87) of the embryos contained virus. The average quantity of virus associated with individual embryos after viral exposure and washing was 1.12 viral copies per 5 �L (SD = 1.57 copies 5 per �L-1; SEM = 0.33 copies 5 per �L-1). Assessment of data using tolerance intervals (P = 0.05) indicates that 90% of contaminated embryos will be associated with ≤4.64 viral copies per 5 �L, whereas 99% of contaminated embryos will be associated with ≤6.62 copies per 5 �L. Obviously, only extremely small quantities of virus were associated with less than one-third of the embryos tested. Based on previous research, it is presumed that this virus is associated with the outer layers of the zona pellucida. A logical next step in the risk assessment would be to determine if these quantities of zona-associated virus are sufficient to infect na�ve recipients and/or embryonic cells after embryos are transferred. Further, similar efforts should be made to estimate the quantity of virus associated with in vitro-derived, zona pellucida-intact, bovine embryos after exposure to the same high-affinity strain of virus and washing.
13
Gard, J. A., M. D. Givens, P. K. Galik, M. S. D. Marley, K. P. Riddell, and M. A. Edmondson. "140 INTRAUTERINE INOCULATION OF CATTLE WITH BOVINE VIRAL DIARRHEA VIRUS SIMULTANEOUS TO TRANSFER OF IN VIVO-DERIVED BOVINE EMBRYOS." Reproduction, Fertility and Development 21, no. 1 (2009): 169. http://dx.doi.org/10.1071/rdv21n1ab140.
Full textAbstract:
Bovine viral diarrhea virus (BVDV) has been shown to be associated with single transferable in vivo-derived and in vitro-produced bovine embryos despite washing. Hence, the primary objective of this study was to evaluate the potential of BVDV to be transmitted via the intrauterine route at the time of embryo transfer. A total of 10 in vivo-derived Day 7 bovine embryos were nonsurgically collected from a BVDV negative and seronegative donor cow. After collection, embryos were washed in accordance with the International Embryo Transfer Society (IETS) standards. Following washing, embryos were placed into transfer media containing BVDV (SD-1; type 1a). The embryos were immediately aspirated into 0.25-mL straws and transferred into seronegative recipients (Day 0). The total quantity of virus transferred into the uterus of each recipient was 900 to 1000 cell culture infective dose 50 (CCID50)/straw. This amount of virus was previously shown to be consistent with the average amount of BVDV associated with in vivo-derived and in vitro-produced embryos following standard IETS washing procedures after in vitro exposure to virus. The positive control heifer received 1.5 × 106 CCID50/straw of BVDV without an embryo. The negative control heifer received 1.5 × 106 CCID50/straw of heat-inactivated BVDV without an embryo. Serum and buffy coat samples were drawn from all heifers on Days 0, 3, 4, 6, 7, 8, 9, 10, 12, 15, and 30 after inoculation and analyzed for serum neutralizing antibodies and virus, respectively. The positive control heifer and all recipients of virus-exposed embryos exhibited viremia by Day 6 and seroconverted by Day 15. The negative control heifer did not exhibit viremia or seroconvert. All recipients receiving embryos were assessed for pregnancy using transrectal ultrasonography on Day 30 and 6 of 10 heifers were pregnant. On Day 60 the pregnant heifers were again assessed for pregnancy using transrectal ultrasonography. At this time only 1 of the 6 heifers was still pregnant. However, the fetus was determined to be nonviable and was removed via colpotomy. The fetus, fetal fluids and membranes were determined to be positive for BVDV via immunohistochemistry and PCR. Additionally, 213 base pairs of the 5′ nontranslated region of this PCR product were sequenced and found to be consistent with the inoculated strain. Results demonstrate that the average quantity of BVDV associated with bovine embryos after in vitro exposure and washing can result in viremia and seroconversion of seronegative recipients following transfer into the uterus during diestrus.
14
Quang, Trinh Duy, Kazuhide Takada, Chika Takano, Shihoko Komine-Aizawa, and Satoshi Hayakawa. "TGF-β1 enhances Zika Virus Infection in Immortalized Human First-Trimester Trophoblasts via the Smad Pathway." Placenta 141 (September 2023): 94. http://dx.doi.org/10.1016/j.placenta.2023.08.056.
Full text
15
Ramisetty-Mikler, Suhasini, and LeAnn Boyce. "Communicating the risk of contracting Zika virus to low income underserved pregnant Latinas: A clinic-based study." PLOS ONE 15, no. 11 (November 20, 2020): e0241675. http://dx.doi.org/10.1371/journal.pone.0241675.
Full textAbstract:
Objective Frequent travel between the Southern border states in the USA, Mexico, and Latin American countries increases the risk of the Zika virus (ZIKV) spread. Patient education on virus transmission is fundamental in decreasing the number of imported cases, particularly among pregnant women. Methods The study used cross-sectional methodology to investigate information sources and knowledge concerning the ZIKV virus among 300 under-served pregnant Latinas recruited from prenatal care clinics in the North Texas region. Bivariate and multiple logistic regression models were used to investigate associations between the primary outcomes and patient characteristics. Results Physicians, nurses, and families are the major sources for pregnancy information, while media/internet (65%) and physician/nurse (33%) are the main sources for ZIKV information. Less than one-half of the mothers reported that their physician/nurse did not discuss safe sexual practices or inquired about their sexual practices. A considerable proportion of women from the community clinic were neither warned nor queried about travel to ZIKV risk countries. There is an overall understanding of Zika virus transmission, symptoms, complications, and recommended guidelines. Younger age and single mother status are risk factors for lack of ZIKV knowledge. Foreign-born mothers are 2.5–3.0 times more likely to have knowledge on disease transmission, symptoms, and microcephaly condition. While, younger mothers (18–24) are less likely to have knowledge of ZIKV infection symptoms (fever, rash and pink eye) and transmission of infection via unprotected sexual (vaginal, anal, or oral) behavior, compared to older mothers. Conclusions Interventions are needed to heighten the knowledge of ZIKV, particularly among women of reproductive age and their male partners in the community health care setting. Our study underscores the need for health care providers to be trained in delivering messages to enhance risk perception during health emergencies to vulnerable and underserved families (lower economic background, language ability, and culture). During health emergencies, clinics must disseminate crucial information via multi modalities to ensure messages reach the targeted patients.
16
Shehu-Xhilaga, M., J. Dale, M. O'Bryan, M. Hedger, S. Kent, and D. De Kretser. "308. Characterization of SIV infection in the male genital tract of juvenile macaques." Reproduction, Fertility and Development 17, no. 9 (2005): 131. http://dx.doi.org/10.1071/srb05abs308.
Full textAbstract:
Reproductive organs contribute infected cells and free viral particles to semen in human immunodeficiency type-1 (HIV-1) infected individuals, increasing the risk of infection from the HIV-1 positive male to the mother and ultimately to the offspring. The majority of information gathered with respect to the HIV-1 burden in the male reproductive tract (MGT) have been conducted in tissues obtained on autopsies of testis, prostate and epididymis of individuals that die from AIDS. Therefore, little is known about the progression and pathogenesis of the infection within these organs. Investigating the mechanism of the spread of HIV-1 in the cells and tissues of the MGT, particularly during the asymptomatic stage, remains a critical task. Infection of macaques with simian immunodeficiency virus (SIV) is a useful animal model for studies of mucosal transmission and viral transmission via breastfeeding. In this study eight juvenile macaques (2.5 yo) were infected with SIVmac for a period of 3–6 months and testis and epididymis tissue were collected in two intervals, 3 and 6 months post-infection. To determine SIV progression and pathogenesis in the MGT we have used EM, immunohistochemistry, confocal microscopy and immunoblotting. Our preliminary EM obtained via analysis of testis and epididymis tissue of SIV infected macaques show the presence of elongated spermatids in the epididymis. Scattered viral like SIV particles were observed in the testis and epididymal lumen, principally associated with aberrant germ cells. Necrosis of epididymal tissue was also observed, potentially due to the SIV burden in this organ. The data indicate that SIV infected juvenile macaques are a potential model for studying HIV-1 pathogenesis and its effect in spermatogenesis as well as the immune response of testis in a species that is closely related to humans.
17
Waldrop, J., M. Givens, K. Riddell, P. Galik, and D. Stringfellow. "214 USE OF VIRUS ISOLATION AND QUANTITATIVE POLYMERASE CHAIN-REACTION TECHNIQUES TO DETECT BOVINE VIRAL DIARRHEA VIRUS (BVDV) IN SINGLE OR SMALL GROUPS OF PRE-IMPLANTATION BOVINE EMBRYOS." Reproduction, Fertility and Development 18, no. 2 (2006): 214. http://dx.doi.org/10.1071/rdv18n2ab214.
Full textAbstract:
Because of its broad distribution among populations of cattle and its association with materials of animal origin used in embryo production, bovine viral diarrhea virus (BVDV) is a potential problem in applications of embryo technologies. While some isolates of BVDV are known to associate with both in vivo-derived and in vitro-produced bovine embryos, it has yet to be determined if the quantity of virus associated with exposed zona pellucida-intact embryos is sufficient to infect susceptible recipient cows via the intrauterine route. Techniques to detect and quantify BVDV associated with single transferable embryos are important to determine the risk of transmitting BVDV via embryo transfer. The objectives of this study were to define reproducible techniques to detect and quantify BVDV associated with single or small groups of bovine embryos contained in small aliquots of medium using virus isolation (VI) or real time quantitative polymerase chain reaction (Q-PCR) assays. In vivo-derived and in vitro-produced embryos were exposed for 2 h to approximately 106-cell culture infective doses (50% endpoint) per mililiter of a high affinity strain of BVDV, SD-1, and then washed according to IETS guidelines. Embryos were assayed in groups of five or two embryos, or single. There were 5 replicates of the group of five embryos, 4 of the group of two embryos, and 3 of the single embryos for the in vivo-derived embryos undergoing VI; 5, 4, and 2 replicates, respectively, undergoing Q-PCR, and 2, 5, and 2 replicates, respectively, for the in vitro-produced embryo groups undergoing VI and Q-PCR. Those to be assayed by VI were sonicated and the sonicate fluids were layered onto Madin Darby Bovine Kidney (MDBK) cells and passaged to allow for viral replication; an immunoperoxidase monolayer assay was then used for viral detection. A Roche� RNA/DNA extraction kit (Roche Diagnostic Systems, Inc., Somerville, NJ, USA) was used to extract RNA from virally exposed embryos, and extracted samples were assayed in duplicate Q-PCR reactions consisting of 100 �L. The primers used were L1 and U3 which are specific for conserved areas of the 5 prime nontranslated regions of the viral genome of BVDV. The PCR product was detected using hybridization probes s1 and s2 as in Struder et al. 2002 Biologicals 40, 289-296. In vivo-derived groups of five or two embryos, or single embryos, were positive for BVDV 100, 50, and 30% of the time, respectively, when VI was used and 100, 75 and 100%, respectively, when Q-PCR was used. The virus was detected in all of the in vitro-produced embryo groups of five, or two embryos, or single embryos, 100% of the time using VI, and in 100, 80, and 100% respectively, using Q-PCR. The virus isolation technique is highly sensitive but the need to destroy embryos by sonication to identify any embryo-associated virus precludes its use for embryos intended for transfer. Techniques for Q-PCR were sufficiently sensitive to detect and quantify 10 copies of RNA in a sample and to detect BVDV associated with single embryos.
18
GeraghtyE, R. J., J. M. Morrell, L. Spencer, and P. V. Holmes. "195REMOVAL OF EQUINE ARTERITIS VIRUS FROM STALLION SEMEN." Reproduction, Fertility and Development 16, no. 2 (2004): 219. http://dx.doi.org/10.1071/rdv16n1ab195.
Full textAbstract:
Infection of breeding horses with equine arteritis virus (EAV) can result in abortion in up to 50% of mares (Del Piero F 2000 Vet. Pathol. 37, 287–296). Viral transmission occurs in body fluids, including semen (Golnik W et al. 1986 Zentralblatt für Veterinarmedizin 33, 413–417), with infected males potentially shedding virus indefinitely. Previously, the only means of preventing EAV transmission via semen was to remove identified shedders from the breeding pool. Recent medical studies have shown that viral infectivity can be removed from the semen of HIV or hepatitis C patients by a sequential method of sperm preparation: i.e. centrifugation on a discontinuous density gradient, followed by swim-up, (e.g. Bujan et al. 2002 Fertil. Steril. 78, 1321–1323; Levy et al. 2002 Hum. Rep. 17, 2650–2653). Human sperm prepared by this method have been used in over 1000 assisted reproduction attempts without sero-conversion of mothers or children (Lyerly A et al. 2001 Fertil. Steril. 75, 843–858). The current study investigates whether a sequential preparation technique of centrifugation on an EquiPure density gradient followed by a swim-up into a sperm maintenance medium can remove EAV from stallion ejaculates. Aliquots (1mL) of stallion semen, extended in Kenny’s medium, were spiked with known quantities of EAV at three levels corresponding to 1.0, 10 and 100 TCID50/mL−1. The latter was considered to be representative of levels seen in natural infection (Timoney PJ et al. 1987 J. Reprod. Fertil. (Suppl. 35), 95–102). Aliquots of spiked semen were prepared by centrifugation on EquiPure gradients. After centrifuging the resulting sperm pellets in EquiSperm Wash, the sperm were subjected to a swim-up treatment (all sperm preparation material from NidaCon, Gothenburg, Sweden). Aliquots of the sperm preparations, the unspiked extended semen, and spiked extended semen were stored at −70°C for viral assay by nested PCR (Belak S et al. 1994 Proc. 7th Int. Conf. Equine Inf. Dis. pp 33–38). The sensitivity of this assay is less than 1 PFU mL−1 of virus in seminal plasma, as validated by Belak et al. Using the PCR technique, a region from the nucleocapsid gene of EAV is amplified, resulting in a 170-base-pair product. Details of the primer sequences used are as follows: first TCGATGGCGTCAAGACGATCAC and GGTTCCTGGGTGGCTAATAACTACTTCAAC; second CGCAACCCACTCAGGCTATTATTG and GGTAGGAACCCAACTGACGGTG. The untreated spiked samples were all positive for EAV, whereas the sperm preparations from the spiked semen, after density gradient and swim-up, were negative for EAV. A negative control (water) and the unspiked extended ejaculate were also negative. These preliminary results indicate that the sequential technique of centrifugation on an EquiPure density gradient followed by a swim-up is potentially a useful and simple tool for the removal of EAV from the semen of shedding stallions. Further experiments will investigate whether the virus can be removed from naturally infected ejaculates. We are grateful to Prof. Twink Allen and Miss Clare Tiplady of the Equine Fertility Unit, Newmarket, UK, for providing samples of stallion semen. This study is partially funded by Eureka (E-2967).
19
Song, Hongqin, Dan Xiong, Jing Wang, Xianyue Zhai, and Guangcheng Liang. "A Porcine Reproductive and Respiratory Syndrome Virus Vaccine Candidate Based on PRRSV Glycoprotein 5 and the Toll-Like Receptor 5 Agonist Salmonella typhimurium Flagellin." Journal of Molecular Microbiology and Biotechnology 25, no. 1 (2015): 56–59. http://dx.doi.org/10.1159/000375496.
Full textAbstract:
Glycoprotein 5 (GP5) from porcine reproductive and respiratory syndrome virus (PRRSV) is a key inducer of neutralizing antibodies. A truncated GP5 gene lacking the signal peptide and transmembrane sequences was amplified via an overlap PCR method and inserted into prokaryotic expression vectors, pET32a or pGEX-6p-1, to add an His or GST tag, respectively. His-tagged GP5 was induced with IPTG, verified by SDS-PAGE and Western blotting, and purified to serve as an immunogen accompanied with the <i>Salmonella typhimurium</i> flagellin (FliC), a Toll-like receptor 5 (TLR5) agonist. Levels of TLR5 and cytokine mRNAs in spleens of mice following injection with FliC were detected by qRT-PCR to verify the activation of innate immunity. FliC was used as an adjuvant and administered with the GP5 to C57BL/6 mice via intraperitoneal injection. Coadministration of GP5 with FliC induced a significantly enhanced GP5-specific IgG and IFN-γ response compared with administration of GP5 alone, and the GP5-specific titer in the GP5 + FliC coadministration group was elevated almost twofold after the third immunization. These results indicate that FliC is an effective adjuvant, increasing the induction of antibodies against GP5 with the induction of both humoral and cellular immune responses.
20
Gad, Sameh A., Masaya Sugiyama, Masataka Tsuge, Kosho Wakae, Kento Fukano, Mizuki Oshima, Camille Sureau, et al. "The kinesin KIF4 mediates HBV/HDV entry through the regulation of surface NTCP localization and can be targeted by RXR agonists in vitro." PLOS Pathogens 18, no. 3 (March 21, 2022): e1009983. http://dx.doi.org/10.1371/journal.ppat.1009983.
Full textAbstract:
Intracellular transport via microtubule-based dynein and kinesin family motors plays a key role in viral reproduction and transmission. We show here that Kinesin Family Member 4 (KIF4) plays an important role in HBV/HDV infection. We intended to explore host factors impacting the HBV life cycle that can be therapeutically addressed using siRNA library transfection and HBV/NLuc (HBV/NL) reporter virus infection in HepG2-hNTCP cells. KIF4 silencing resulted in a 3-fold reduction in luciferase activity following HBV/NL infection. KIF4 knockdown suppressed both HBV and HDV infection. Transient KIF4 depletion reduced surface and raised intracellular NTCP (HBV/HDV entry receptor) levels, according to both cellular fractionation and immunofluorescence analysis (IF). Overexpression of wild-type KIF4 but not ATPase-null KIF4 mutant regained the surface localization of NTCP and significantly restored HBV permissiveness in these cells. IF revealed KIF4 and NTCP colocalization across microtubule filaments, and a co-immunoprecipitation study revealed that KIF4 interacts with NTCP. KIF4 expression is regulated by FOXM1. Interestingly, we discovered that RXR agonists (Bexarotene, and Alitretinoin) down-regulated KIF4 expression via FOXM1-mediated suppression, resulting in a substantial decrease in HBV-Pre-S1 protein attachment to HepG2-hNTCP cell surface and subsequent HBV infection in both HepG2-hNTCP and primary human hepatocyte (PXB) (Bexarotene, IC50 1.89 ± 0.98 μM) cultures. Overall, our findings show that human KIF4 is a critical regulator of NTCP surface transport and localization, which is required for NTCP to function as a receptor for HBV/HDV entry. Furthermore, small molecules that suppress or alleviate KIF4 expression would be potential antiviral candidates targeting HBV and HDV entry.
21
Morfeld, K. A., B. White, G. Mills, R. Krisher, M. A. Mellencamp, and N. M. Loskutoff. "186 A NOVEL METHOD FOR ELIMINATING PORCINE REPRODUCTIVE AND RESPIRATORY SYNDROME VIRUS FROM BOAR SEMEN AND ITS EFFECTS ON EMBRYO DEVELOPMENT." Reproduction, Fertility and Development 17, no. 2 (2005): 243. http://dx.doi.org/10.1071/rdv17n2ab186.
Full textAbstract:
Porcine reproductive and respiratory syndrome virus (PRRSv) is known to cause venereal transmission of the disease via natural or artificial breeding and this constitutes a significant risk to AI programs in modern swine production. The objectives of this study were to determine the effectiveness of a novel density gradient centrifugation method incorporating trypsin to eliminate PRRSv from infected semen and to evaluate its effects on sperm viability and embryo development. Exp. 1: To assess the efficacy of the procedure on eliminating PRRSv, semen was collected from 21 infected boars. Concentrated sperm (1 mL) was layered on three Percoll (Sigma, St. Louis, MO, USA) density gradient columns, top to bottom: 1 mL 30%, 2 mL 45% with or without 0.25% trypsin (trypsin-treated and control, respectively), and 2 mL 90% with or without 10 μg/mL soy-based trypsin inhibitor (Sigma), and centrifuged (700g for 30 min). Trypsin-treated and control sperm were submitted for RT-PCR analysis pre- and post-treatment. Exp.2: To evaluate the effect on sperm quality, semen samples (n = 10) were collected from non-infected boars and processed as described in Exp. 1. Sperm motility, viability, and acrosomal integrity were evaluated at 0 and 2 h post-treatment. Exp. 3.1: To assess the in vitro fertilizing capability of trypsin-treated sperm, in vitro-matured porcine oocytes (n = 64) were inseminated, and cleavage (48 h post-insemination (PI)) and blastulation (144 h PI) rates were compared to those of oocytes (n = 63) inseminated with control sperm. Exp. 3.2: Trypsin-treated or control sperm (3 × 109/dose) were used to AI sows (n = 10). In vivo-generated embryos were surgically recovered 4–6 d post-AI, and embryo number, stage, and morphological quality were recorded. Data were analyzed using ANOVA and differences were considered significant at P < 0.05. Sperm quality parameters are expressed as means ± SEM. Results showed that the procedure (with and without trypsin) was effective for eliminating PRRSv from infected boar semen. There were no differences at 0 or 2 h post-treatment between the control and the trypsin-treated boar sperm in motility (76 ± 4.9 and 56 ± 8.7 vs. 75 ± 4.4 and 48 ± 8.3%, respectively), viability (87 ± 2.6 and 75 ± 6.2 vs. 81 ± 3.2 and 80 ± 3.7%, respectively), and acrosomal integrity (96 ± 2.7 and 98.8 ± 0.8 vs. 98 ± 1.3 and 99 ± 0.4%, respectively). There was no difference between the control and trypsin-treated sperm used for IVF on cleavage (82 vs. 89%, respectively) and blastulation (20 vs. 32%, respectively) rates. There were significantly more transferable-quality embryos recovered from sows inseminated with trypsin-treated as compared to control sperm: 54/63 (85.7%) vs. 35/72 (48.6%), respectively. In conclusion, the novel trypsin gradient treatment was effective in eliminating PRRSv without detrimentally affecting sperm quality and has the potential to increase the numbers of transferable-quality embryos produced.
22
Givens, M. D., D. A. Stringfellow, K. P. Riddell, P. K. Galik, E. Sullivan, J. Robl, P. Kasinathan, C. C. Dykstra, and D. W. Boykin. "196PREVENTION AND TREATMENT OF BOVINE VIRAL DIARRHEA VIRUS INFECTIONS IN FETAL FIBROBLAST CELLS." Reproduction, Fertility and Development 16, no. 2 (2004): 219. http://dx.doi.org/10.1071/rdv16n1ab196.
Full textAbstract:
Unnoticed infections with bovine viral diarrhea virus (BVDV) can occur in cultured cells used for somatic cell nuclear transfer. Aromatic cationic molecules have exhibited inhibitory activity against in vitro replication of BVDV. The purpose of this research was to evaluate the ability of aromatic cationic compounds to prevent or treat noncytopathic BVDV infections of fetal fibroblast cells. Aromatic compounds tested were 2-(4-[2-imidazolinyl]phenyl)-5-(4-methoxyphenyl)furan (DB606); 2-(2-benzimidazolyl)-5-[4-(2-imidazolino) phenyl]furan dihydrochloride (DB772); and 2-(1-methyl-2-benzimidazolyl)-5-[4’-(2-imidazolino)-2’-methylphenyl]furan dihydrochloride (DB824). To evaluate prevention of BVDV infections, 10 cell lines in the absence or presence of 7 dilutions of each of the 3 compounds were inoculated with BVDV. The concentrations of BVDV in medium and cell lysates were determined by serial dilution and virus isolation. Samples were obtained 72 hours post-inoculation. Bovine viral diarrhea virus in cell culture medium and cell lysate samples was evaluated by comparison to equivalent samples from control cultures in which no compound was added (percent of control=cell culture infective doses (50%; CCID50) of BVDV in compound sample/CCID50 of BVDV in control sample lacking compound). The viral inhibitory concentrations (99%) of compounds were calculated with JMP software by least-squares regression techniques. Cumulatively, the 99% endpoints for inhibition of viral replication in fetal fibroblast cell lines for the 3 compounds were 0.1μM, 0.007μM and 0.028μM, respectively. To evaluate therapeutic treatment of established BVDV infections, the concentration of BVDV in medium and cell lysates of 2 fetal fibroblast cell lines were evaluated. The cell lines were previously determined to be infected with a genotype 1a strain of BVDV. Samples were obtained during 4 sequential passages in the absence or presence of 0.04μM and 4μM concentrations of DB772 or DB824. Presence of BVDV was determined by reverse transcription nested polymerase chain reaction and virus isolation. While BVDV persisted in cultures supplemented with no aromatic compound or 0.04μM, both DB772 and DB824 effectively cured BVDV infections after 1 passage in 4μM, and cells remained viable. Results indicate that BVDV infections can be effectively prevented or treated in fetal fibroblast cultures. Further research is needed to determine if exposed cells are competent for production of normal embryos via nuclear transfer.
23
Yang, Guanghui, Jiufeng Wang, Shenghua Wang, and Yaohong Zhu. "Forsythiaside A Improves the Inhibitory Efficiency of Recombinant Protein Vaccines against Bovine Viral Diarrhea Virus Infection." International Journal of Molecular Sciences 23, no. 16 (August 20, 2022): 9390. http://dx.doi.org/10.3390/ijms23169390.
Full textAbstract:
Bovine viral diarrhea virus (BVDV) is a critical animal pathogen that leads to cattle production losses associated with acute disease, immune dysregulation, reproductive failure, and respiratory disease. Due to the monotonous control technique and neglect of BVDV, increasing prevalence of BVDV has caused significant economic losses in the cattle industry worldwide. Therefore, novel anti-BVDV drugs are essential to prevent and control BVDV. Our previous studies have found that Forsythoside A (FTA) could inhibit the replication of BVDV via TRAF2-dependent CD28-4-1BB signaling in bovine peripheral blood mononuclear cells (PBMCs), but whether they can directly inhibit the BVDV remains unclear. Here, we further investigated the effects of FTA on BVDV and its underlying mechanisms of action. We found that FTA significantly inhibited the replication of BVDV in the MDBK cell directly. The results demonstrated that FTA could reduce the functional activation of Caspase-1 to inhibit the inflammatory response caused by BVDV infection and increase the expression of type I interferon (IFN-I) to clear the virus in vitro. The animal experiment was performed to evaluate the antiviral effect of FTA in vivo. Notably, after challenged with BVDV, mice with FTA + Erns-E2 protein displayed alleviated pathological damage and decreased the viral load in the spleen compared with mice inoculated with Erns-E2 protein. Furthermore, treatment with FTA enhanced body defense and delayed infection by the BVDV. Our results reveal that FTA suppresses BVDV replication both in vitro and in vivo and therefore shows promise as an anti-BVDV agent.
24
Patel, Ankoor, Emmely E. Treffers, Markus Meier, Trushar R. Patel, Jörg Stetefeld, Eric J. Snijder, and Brian L. Mark. "Molecular characterization of the RNA-protein complex directing −2/−1 programmed ribosomal frameshifting during arterivirus replicase expression." Journal of Biological Chemistry 295, no. 52 (October 30, 2020): 17904–21. http://dx.doi.org/10.1074/jbc.ra120.016105.
Full textAbstract:
Programmed ribosomal frameshifting (PRF) is a mechanism used by arteriviruses like porcine reproductive and respiratory syndrome virus (PRRSV) to generate multiple proteins from overlapping reading frames within its RNA genome. PRRSV employs −1 PRF directed by RNA secondary and tertiary structures within its viral genome (canonical PRF), as well as a noncanonical −1 and −2 PRF that are stimulated by the interactions of PRRSV nonstructural protein 1β (nsp1β) and host protein poly(C)-binding protein (PCBP) 1 or 2 with the viral genome. Together, nsp1β and one of the PCBPs act as transactivators that bind a C-rich motif near the shift site to stimulate −1 and −2 PRF, thereby enabling the ribosome to generate two frameshift products that are implicated in viral immune evasion. How nsp1β and PCBP associate with the viral RNA genome remains unclear. Here, we describe the purification of the nsp1β:PCBP2:viral RNA complex on a scale sufficient for structural analysis using small-angle X-ray scattering and stochiometric analysis by analytical ultracentrifugation. The proteins associate with the RNA C-rich motif as a 1:1:1 complex. The monomeric form of nsp1β within the complex differs from previously reported homodimer identified by X-ray crystallography. Functional analysis of the complex via mutational analysis combined with RNA-binding assays and cell-based frameshifting reporter assays reveal a number of key residues within nsp1β and PCBP2 that are involved in complex formation and function. Our results suggest that nsp1β and PCBP2 both interact directly with viral RNA during formation of the complex to coordinate this unusual PRF mechanism.
25
Tang, Tian, Chuan Wang, Qikang Pu, Jinmei Peng, Sijing Liu, Chenyan Ren, Mingjuan Jiang, and Zhijun Tian. "Vaccination of Mice with Listeria ivanovii Expressing the Truncated M Protein of Porcine Reproductive and Respiratory Syndrome Virus Induces both Antigen-Specific CD4+ and CD8+ T Cell-Mediated Immunity." Journal of Molecular Microbiology and Biotechnology 29, no. 1-6 (2019): 74–82. http://dx.doi.org/10.1159/000506686.
Full textAbstract:
Porcine reproductive and respiratory syndrome (PRRS), a serious disease of swine caused by the PRRS virus (PRRSV), had a severe economic impact worldwide. As commonly used PRRS vaccines, the attenuated or inactivated vaccines, provide unsatisfactory immune protection, a new PRRS vaccine is urgently needed. In this study, a part of the PRRSV <i>ORF6</i> gene (from 253 to 519 bp) encoding the hydrophilic domain of PRRSV M protein was integrated into two <i>Listeria</i> strains via homologous recombination to generate two PRRS vaccine candidates, namely LI-M’ and LM-Δ<i>actAplcB</i>-M’. Both candidate vaccines showed similar growth rate as their parent strains in culture media, but presented different bacterial loads in target organs. As the integrated heterogenous gene was not expressed, LM-Δ<i>actAplcB</i>-M’ was excluded from the immunological test. In a mouse model, LI-M’ provoked both CD4+ and CD8+ T cell-mediated immunity. In addition, LI-M’ boosting dramatically enhanced CD8+ T cell-mediated immunity without affecting the response intensity of CD4+ T cell-mediated immunity. All of these data suggest that LI-M’ is a promising PRRS vaccine candidate.
26
Stringfellow, David A., M. Daniel Givens, and Julie G. Waldrop. "Biosecurity issues associated with current and emerging embryo technologies." Reproduction, Fertility and Development 16, no. 2 (2004): 93. http://dx.doi.org/10.1071/rd03082.
Full textAbstract:
A variety of procedures associated with in vivo and in vitro embryo production, as well as cloning and transgenics, are in current use by both researchers and practitioners. Biohazards associated with these procedures could influence clinical proficiency and the outcome of basic research or result in unusual distribution of pathogens in populations of animals. By their nature, embryo technologies are vulnerable to contamination from numerous sources. Although pathogens can originate in the physical environments in which embryo technologies are applied, they are more likely to be introduced via animals or materials of animal origin. However, it is important to note that both the occurrence and consequences of contamination are heavily influenced by environmental circumstances. This paper represents a philosophical description of biohazards associated with three generations of embryo technologies using the cow as a model species. Emphasis is placed on sources of contamination, current or suggested preventive actions and the issue of environmental changes as they relate to the emergence of biohazards and the implementation of biosecurity measures. Some specific pathogens are discussed for illustration. In addition, details of the risks associated with introducing bovine viral diarrhoea virus in each of three generations of embryo technologies are described.
27
Gregg, K., S. Chen, S. Sadeghieh, T. Guerra, T. Xiang, J. Meredith, and I. Polejaeva. "149 RISK ASSESSMENT OF INFECTIOUS DISEASE TRANSMISSION VIA IN VITRO EMBRYO PRODUCTION USING SOMATIC CELL NUCLEAR TRANSFER." Reproduction, Fertility and Development 21, no. 1 (2009): 174. http://dx.doi.org/10.1071/rdv21n1ab149.
Full textAbstract:
Somatic cell nuclear transfer (SCNT) technology is a powerful tool for preservation and propagation of superior genetics of livestock animals. Bovine oocytes derived from abattoirs are usually used in SCNT embryo production. The puncture of the zona pellucida during the nuclear transfer process has raised additional concerns about the risk of disease transmission through application of this new technology. The objective of this study was to use bovine viral diarrhea virus (BVDV) as a model to perform a comprehensive risk assessment on infectious disease transmission in the SCNT system. Thirteen batches of cumulus–oocyte complexes (COC; n = 550) were collected from several abattoirs over 6 months. Two hundred were tested for BVDV before cumulus cell removal. Cumulus cells were removed from the other 350 COC by gentle vortexing in 0.1% hyaluronidase in HEPES-M199 with Hanks’ salts. The cumulus-cell-free oocytes (CFO) were then washed 3 times with FBS-free HEPES-M199 with Hanks’ salts containing penicillin-streptomycin solution (5 μg mL–1). Both COC and CFO were pooled in groups (5/group) and tested for presence of BVDV using sensitive real-time PCR method. Only 2.5% of the COC were BVDV positive and all of the CFO were BVDV negative. Additionally, 293 embryos were produced from 14 different cell lines using the previously described SCNT procedure (Zhou et al. 2008 Mol Reprod Dev. 75, 1281–1289). These embryos were generated using in vitro-matured oocytes collected as 23 different batches over 7 months. The embryos were cultured in vitro to blastocyst stage and then tested for BVDV. All of the 293 SCNT embryos (100%) were BVDV negative. In conclusion, under these SCNT embryo production conditions, a small portion of COC were BVDV positive. However, all CFO and SCNT embryos were BVDV negative. Therefore, the risk of disease transmission using abattoir oocytes and SCNT procedure is relatively low and can be eliminated by using a combination of cumulus cell removal and adequate oocyte washing procedures. F. Arenivas, B. Findeisen, V. Farrar, E. Hwang helped with the SCNT embryo production for this study.
28
Kwon, Jeongwoo, Shuha Park, Min-Jung Seong, Inchul Choi, and Nam-Hyung Kim. "Corrigendum to: Cytoplasmic polyadenylation element binding protein 2 (CPEB2) is required for tight-junction assembly for establishment of porcine trophectoderm epithelium." Reproduction, Fertility and Development 31, no. 3 (2019): 632. http://dx.doi.org/10.1071/rd18098_co.
Full textAbstract:
Cytoplasmic polyadenylation element binding protein (CPEB) is an RNA-binding protein that promotes elongation of poly(A) tails and regulates mRNA translation. CPEB depletion in mammary epithelium is known to disrupt tight-junction (TJ) assembly via mislocalisation of tight junction protein 1 (TJP1), but the role of CPEB in the biological functions associated with TJs has not yet been studied. The objective of this study was to investigate the roles of CPEB2 during porcine parthenote development. CPEB2 was detected in both the nuclei and apical cytoplasm at the 4- and 8-cell stages and was localised to cell–cell contact after the initiation of the morula stage. Its depletion led to retarded blastocyst formation caused by impaired TJ assembly. Moreover, transcription of TJ-associated genes, including TJP1, Coxsackie virus and adenovirus receptor (CXADR) and occludin (OCLN), was not affected, but the corresponding proteins were not properly localised at the apical cell membrane in morulae, suggesting that CPEB2 confers mRNA stability or determines subcellular localisation for translation. Remarkably reduced relative levels of TJP1 transcripts bearing the 3′-untranslated region were noted, indicating that CPEB2 mediates TJP1 mRNA stability. In conclusion, our findings demonstrate that because of its regulation of TJP1, CPEB2 is required for TJ assembly during porcine blastocyst development.
29
Hooley, R. P., M. Paterson, P. Brown, K. Kerr, and P. T. K. Saunders. "Intra-testicular injection of adenoviral constructs results in Sertoli cell-specific gene expression and disruption of the seminiferous epithelium." REPRODUCTION 137, no. 2 (February 2009): 361–70. http://dx.doi.org/10.1530/rep-08-0247.
Full textAbstract:
Spermatogenesis is a complex process that cannot be modelledin vitro. The somatic Sertoli cells (SCs) within the seminiferous tubules perform a key role in supporting maturation of germ cells (GCs). Progress has been made in determining what aspects of SC function are critical to maintenance of fertility by developing rodent models based on the Cre/LoxP system; however, this is time-consuming and is only applicable to mice. The aim of the present study was to establish methods for direct injection of adenoviral vectors containing shRNA constructs into the testis as a way of inducing target-selective knock-downin vivo. We describe here a series of experiments using adenovirus expressing a green fluorescent protein (GFP) transgene. Injection via the efferent ductules resulted in SC-specific expression of GFP; expression levels paralleled the amount of infective viral particles injected. At the highest doses of virus seminiferous tubule architecture were grossly disturbed and immune cell invasion noted. At lower concentrations, the expression of GFP was variable/negligible, the seminiferous tubule lumen was maintained but stage-dependent GC loss and development of numerous basal vacuoles was observed. These resembled intercellular dilations of SC junctional complexes previously described in rats and may be a consequence of disturbances in SC function due to interaction of the viral particles with the coxsackie/adenovirus receptor that is a component of the junctional complexes within the blood testis barrier. In conclusion, intra-testicular injection of adenoviral vectors disturbs SC functionin vivoand future work will therefore focus on the use of lentiviral delivery systems.
30
Lueders, Imke, Barbara Drews, Cheryl Niemuller, Charlie Gray, Peter Rich, Jörns Fickel, Gudrun Wibbelt, Frank Göritz, and Thomas B. Hildebrandt. "Ultrasonographically documented early pregnancy loss in an Asian elephant (Elephas maximus)." Reproduction, Fertility and Development 22, no. 7 (2010): 1159. http://dx.doi.org/10.1071/rd09305.
Full textAbstract:
Early embryonic resorption or fetal loss is known to occur occasionally in captive elephants; however, this has mostly been reported anecdotally. The present study documents the case of a 24-year-old, multiparous Asian elephant cow that suffered embryonic death and resorption at around 18 weeks of gestation. From ovulation onwards, this female was sonographically examined 58 times. Blood was collected twice weekly for progestagen determination via enzyme immunoassay. On Day 42 after ovulation, a small quantity of fluid was detected in the uterine horn, which typically indicates the presence of a developing conceptus. Repeated inspections followed what appeared to be a normal pregnancy until Day 116. However, on Day 124, signs of embryonic life were absent. Progestagen concentrations started declining two weeks later, reaching baseline levels one month after embryonic death. Retrospectively, ultrasound examination revealed several abnormalities in the uterine horn. Besides an existing leiomyoma, multiple small cystic structures had formed in the endometrium at the implantation site and later in the placenta. These pathological findings were considered as possible contributors to the early pregnancy failure. PCR for endotheliotropic elephant herpes virus (EEHV) (which had occurred previously in the herd) as well as serology for other infectious organisms known to cause abortion in domestic animals did not yield any positive results. Although no definitive reason was found for this pregnancy to abort, this ultrasonographically and endocrinologically documented study of an early pregnancy loss provides important insights into the resorption process in Asian elephants.
31
Long, Charles R., Kimberly J. Tessanne, and Michael C. Golding. "Applications of RNA interference-based gene silencing in animal agriculture." Reproduction, Fertility and Development 22, no. 1 (2010): 47. http://dx.doi.org/10.1071/rd09211.
Full textAbstract:
Classical genetic selection, recently aided by genomic selection tools, has been successful in achieving remarkable progress in livestock improvement. However, genetic selection has led to decreased genetic diversity and, in some cases, acquisition of undesirable traits. In order to meet the increased demands of our expanding population, new technologies and practices must be developed that contend with zoonotic and animal disease, environmental impacts of large farming operations and the increased food and fibre production needed to feed and clothe our society. Future increases in productivity may be dependent upon the acquisition of genetic traits not currently encoded by the genomes of animals used in standard agricultural practice, thus making classical genetic selection impossible. Genetic engineering of livestock is commonly used to produce pharmaceuticals or to impart enhanced production characteristics to animals, but has also demonstrated its usefulness in producing animals with disease resistance. However, significant challenges remain because it has been more difficult to produce animals in which specific genes have been removed. It is now possible to modify livestock genomes to block expression of endogenous and exogenous genes (such as those expressed following virus infection). In the present review, we discuss mechanisms of silencing gene expression via the biology of RNA interference (RNAi), the technology of activating the RNAi pathway and the application of this technology to enhance livestock production through increased production efficiency and prevention of disease. An increased demand for sustainable food production is at the forefront of scientific challenges and RNAi technology will undoubtedly play a key role.
32
Mahabir, E., A. Mayer, S. Marschall, M. Hrabe de Angelis, and J. Schmidt. "179IMPORTANCE OF EMBRYO TRANSFERS IN TRANSGENIC MOUSE FACILITIES." Reproduction, Fertility and Development 16, no. 2 (2004): 211. http://dx.doi.org/10.1071/rdv16n1ab179.
Full textAbstract:
With the increasing demand for and production of transgenic and mutant mice for biomedical research, embryo transfer plays a paramount role. The purpose of performing embryo transfer in this species is to generate transgenic mice via blastocyst injection of embryonic stem cells or pronuclear injection of DNA constructs, to revitalize cryopreserved sperm and embryos, and to generate mouse lines that meet specific pathogen-free health standards for breeding in barrier areas (rederivation). We present results from two years of carrying out embryo transfers for rederivation purposes in the large mouse breeding facility of the GSF—National Research Center for Environment and Health, Neuherberg, Germany. Pathogens to be eradicated from inbred transgenic (C57BL/6 background) and mutant (C3H background) mouse lines included mouse hepatitis virus, mouse minute virus, and mouse parvovirus. In vitro- and in vivo-produced two-cell embryos were washed 3 times in M2 medium. A total of 20 embryos each were transferred to the oviduct of 8- to 12-week-old specific pathogen-free pseudopregnant (Day 0.5) Swiss recipients under aseptic conditions. Mice were then kept singly in individually ventilated cages and manipulated in a Class II laminar flow hood. From each transfer to one to five recipients with embryos originating from the same mouse line, one recipient was tested for the presence of microorganisms 6 to 12 weeks after embryo transfer, i.e. at 0 to 6 weeks after weaning, according to the FELASA (Federation of European Laboratory Animal Science Associations) Guidelines. A total of 290 embryo transfers were performed for revitalization of cryopreserved sperm from 52 mouse lines, cryopreserved two-cell embryos from 18 mouse lines and rederivation of 12 mouse lines using freshly collected two-cell embryos. From these 290 embryo transfers, 59 mouse lines were re-established (40 from cryopreserved sperm, 7 from cryopreserved embryos and 12 from in vivo-produced embryos). Health monitoring of 54 recipients showed that all mouse lines generated were free of all pathogens stated in the FELASA list. The results presented here show that all 12 (100%) mouse lines were re-established after transfer of freshly collected two-cell embryos whereas 77% and 39% success rates were observed for revitalization of cryopreserved sperm and embryos, respectively. The success of embryo transfer in eradicating pathogens depends on the inability of these pathogens to transverse the zona pellucida and enter and/or infect embryonic cells. In our mouse facility, embryo transfer provided an efficient method to successfully revitalize cells of the mouse germ line as well as to eradicate prevalent murine pathogens. Furthermore, the results demonstrate the efficiency of transferring embryos of different origins and thereby obtaining and maintaining specific pathogen-free health standards in our mouse colonies.
33
Borg, N., B. Hardman, L. Salamonsen, and G. Nie. "212. Specific targeting of uterine proprotein convertase 6 (PC6) facilitates the development of dual function contraception." Reproduction, Fertility and Development 20, no. 9 (2008): 12. http://dx.doi.org/10.1071/srb08abs212.
Full textAbstract:
Proprotein convertase 6 (PC6), is a key player during embryo implantation in humans and mice. We have previously shown that PC6 is essential for decidualisation in the mouse and knockdown of endometrial PC6 leads to implantation failure. The PC family of proteases, including PC6, are necessary for transmission of human immunodeficiency virus (HIV). It has been postulated that inhibition of PC activity could prevent HIV infection. We hypothesise that PC6 is a prospective target for the development of a dual role contraceptive for women to avoid pregnancy and protect from HIV infection. The aim of this study is to evaluate if a PC6 inhibitor that is capable of preventing HIV transmission can block implantation in mice. We used a generic PC peptide substrate to assess the potency of the inhibitor to block PC6 activity in vitro. The substrate releases a fluorochrome when cleaved by PC6; no fluorescent signals were observed in samples when inhibitor concentrations were 10μM or higher. We then gauged inhibitor uptake by the uterus over 24 h in mice by two delivery routes; intrauterine injection (IU) and vaginal delivery (VD) with a neutral gel. Uptake was tracked with a FITC-conjugated inhibitor at 50μM (IU) and 500μM (VD). Strong fluorescent signals were seen at 2, 4, 6 and 24 h at sites of endometrial PC6 activity in the IU and VD groups. Administration of a 50μM dosage (20μl) to the uterine lumen (IU) caused a significant reduction (P = 0.002) in the number of implantation sites compared with controls (saline only) when treated between 2000–2100 on E3.75. The inhibitor's ability to block uterine PC6 activity and implantation via VD was assessed and to date outcomes have suggested that correct timing is crucial to prevent implantation and decidualisation. These outcomes show the potential of the inhibitor to block implantation in mice.
34
Zhang, Yile, Beining Yin, Sichen Li, Yueyue Cui, and Jianrong Liu. "Friend leukemia integration 1 overexpression decreases endometrial receptivity and induces embryo implantation failure by promoting PART1 transcription in the endometrial epithelial cells." PeerJ 11 (September 26, 2023): e16105. http://dx.doi.org/10.7717/peerj.16105.
Full textAbstract:
Background In vitro fertilization-embryo transfer (IVF-ET) is a crucial assisted reproductive technology for treating infertility. However, recurrent implantation failure (RIF), a significant challenge in IVF-ET success, remains unresolved. This study aimed to explore the role and mechanism of FLI1 in endometrial receptivity and RIF. Methods Differential endometrial cell proportions between patients with RIF and control subjects were assessed using single-cell RNA sequencing (scRNA-seq) analysis. The chromatin accessibility of FLI1 in the luteal endometrial tissue of patients with RIF and control subjects was examined using the single-cell assay for transposase-accessible chromatin sequencing (scATAC-seq). FLI1 mRNA and protein levels were gauged by quantitative real-time polymerase chain reaction (qRT-PCR) and western blotting. Cell viability and migration were examined via cell counting kit (CCK)-8 and scratch healing assays. Epithelial-mesenchymal transition markers were analyzed using western blotting. Mechanisms underlying FLI1’s regulation of PART1 transcription and expression in endometrial epithelial cells were explored using chromatin immunoprecipitation and dual-luciferase reporter assays. Adeno-associated virus (AAV) carrying epithelial cell-specific FLI1/PART1 overexpression sequences was uterinely injected in mice to assess FLI1/PART1 effects. Results scRNA-seq revealed diminished endometrial epithelial cell proportions in RIF patients. Meanwhile, scATAC-seq indicated enhanced chromatin accessibility of FLI1 in these cells. FLI1 exhibited specific expression in RIF patients’ endometrial epithelial cells. Specific FLI1 overexpression inhibited embryo implantation, while knockdown enhanced it. Pregnant mice injected with AAV encoding FLI1 overexpression had significantly lower implantation than AAV-negative controls. FLI1 binding to PART1 promoter heightened PART1 transcription and expression in endometrial epithelial cells. Rescue experiments illustrated FLI1’s role in embryo implantation by boosting PART1 expression. PART1 was notably elevated in RIF patients’ luteal endometrial tissue and non-receptive endometrial epithelial cells (HEC-1-A). Specific PART1 overexpression dampened embryo implantation, whereas knockdown promoted it. Pregnant mice injected with AAV encoding PART1 had lower implantation than negative controls. PART1 knockdown mitigated FLI1’s inhibitory impact on HEC-1-A cell viability and migration. Conclusions FLI1 overexpression in the endometrial epithelial cells of patients with RIF inhibited embryo implantation by binding to the PART1 promoter region to promote PART1 expression. These findings can aid in the development of novel therapeutic targets for RIF.
35
Tyo, Kevin M., Amanda B. Lasnik, Longyun Zhang, Alfred B. Jenson, Joshua L. Fuqua, Kenneth E. Palmer, and Jill M. Steinbach-Rankins. "Rapid-Release Griffithsin Fibers for Dual Prevention of HSV-2 and HIV-1 Infections." Antimicrobial Agents and Chemotherapy 64, no. 6 (March 30, 2020). http://dx.doi.org/10.1128/aac.02139-19.
Full textAbstract:
ABSTRACT The biologic griffithsin (GRFT) has recently emerged as a candidate to safely prevent sexually transmitted infections (STIs), including human immunodeficiency virus type 1 (HIV-1) and herpes simplex virus 2 (HSV-2). However, to date, there are few delivery platforms that are available to effectively deliver biologics to the female reproductive tract (FRT). The goal of this work was to evaluate rapid-release polyethylene oxide (PEO), polyvinyl alcohol (PVA), and polyvinylpyrrolidone (PVP) fibers that incorporate GRFT in in vitro (HIV-1 and HSV-2) and in vivo (HSV-2) infection models. GRFT loading was determined via enzyme-linked immunosorbent assay (ELISA), and the bioactivity of GRFT fibers was assessed using in vitro HIV-1 pseudovirus and HSV-2 plaque assays. Afterwards, the efficacy of GRFT fibers was assessed in a murine model of lethal HSV-2 infection. Finally, murine reproductive tracts and vaginal lavage samples were evaluated for histology and cytokine expression, 24 and 72 h after fiber administration, to determine safety. All rapid-release formulations achieved high levels of GRFT incorporation and were completely efficacious against in vitro HIV-1 and HSV-2 infections. Importantly, all rapid-release GRFT fibers provided potent protection in a murine model of HSV-2 infection. Moreover, histology and cytokine levels, evaluated from collected murine reproductive tissues and vaginal lavage samples treated with blank fibers, showed no increased cytokine production or histological aberrations, demonstrating the preliminary safety of rapid-release GRFT fibers in vaginal tissue.
36
Chen, Dan, Chuqing Wu, Simin Wei, Yican Guo, Meng Wu, Su Zhou, Fangfang Fu, et al. "Semaphorin 4C regulates ovarian steroidogenesis through RHOA/ROCK1-mediated actin cytoskeleton rearrangement." Molecular Human Reproduction, March 9, 2023. http://dx.doi.org/10.1093/molehr/gaad010.
Full textAbstract:
Abstract Semaphorins are a family of evolutionarily conserved morphogenetic molecules that were initially found to be associated with axonal guidance. Semaphorin 4C (Sema4C), a member of the fourth subfamily of semaphorins, has been demonstrated to play multifaceted and important roles in organ development, immune regulation, tumour growth and metastasis. However, it is completely unknown whether Sema4C is involved in the regulation of ovarian function. We found that Sema4C was widely expressed in the stroma, follicles and corpus luteum of mouse ovaries, and its expression was decreased at distinct foci in ovaries of mice of mid-to-advanced reproductive age. Inhibition of Sema4C by the ovarian intrabursal administration of recombinant adeno-associated virus (AAV)-shRNA significantly reduced oestradiol, progesterone and testosterone levels in vivo. Transcriptome sequencing analysis showed changes in pathways related to ovarian steroidogenesis and the actin cytoskeleton. Similarly, knockdown of Sema4C by siRNA interference in mouse primary ovarian granulosa cells (GCs) or thecal interstitial cells (TICs) significantly suppressed ovarian steroidogenesis and led to actin cytoskeleton disorganization. Importantly, the cytoskeleton-related pathway RHOA/ROCK1 was simultaneously inhibited after downregulation of Sema4C. Furthermore, treatment with a ROCK1 agonist after siRNA interference stabilized the actin cytoskeleton and reversed the inhibitory effect on steroid hormones described above. In conclusion, Sema4C may play an important role in ovarian steroidogenesis through regulation of the actin cytoskeleton via the RHOA/ROCK1 signalling pathway. These findings shed new light on the identification of dominant factors involved in the endocrine physiology of female reproduction.
37
Silva, Agnaldo Plácido da, Eloá Jessica Mendes dos Santos Plácido, and Walber Breno de Souza Moraes. "Les impacts du moustique transgénique sur l’homme et l’environnement." Revista Científica Multidisciplinar Núcleo do Conhecimento, November 15, 2020, 158–76. http://dx.doi.org/10.32749/nucleodoconhecimento.com.br/biologie/moustique-transgenique.
Full textAbstract:
L’un des plus grands défis actuellement pour la santé publique au Brésil et dans le monde sont les maladies à transmission vectorielle, et les mesures de lutte actuelles sont inefficaces. Les moustiques sont parmi les vecteurs de diverses maladies, parce qu’ils sont hématophagous, les femelles ont besoin de sang dans la période d’ovulation pour la reproduction et une fois contaminés, le moustique peut contenir des bactéries, protozoaires et virus qui sont alloués dans leurs glandes salivaires, infectant ainsi l’individu directement dans la circulation sanguine. Aedes aegypti est responsable de ces maladies : dengue, zika, chikungunya et fièvre jaune. Les formes de lutte contre les moustiques vecteurs jusqu’à présent sont inefficaces, et avec cela plusieurs technologies ont été développées comme alternatives dans la lutte et la lutte contre le moustique Aedes aegypti. Avec les approbations récentes pour la libération d’insectes génétiquement modifiés, il est nécessaire d’avoir des études plus détaillées pour évaluer leur potentiel écologique et leurs effets évolutifs. Ces effets peuvent se produire en deux phases : une phase transitoire lorsque la population focale change de densité, et une phase d’état stable lorsqu’elle atteint une densité nouvelle et constante. Avec les innovations dans la lutte antivectorielle par le biais d’insectes génétiquement modifiés nous donner une nouvelle perspective par rapport à la manipulation génétique. Cette étude vise à évaluer les effets potentiels d’un changement rapide de la densité du moustique Aedes aegypti lié à la lutte biologique par le moustique génétiquement modifié. Nous nous demandons donc si la biotechnologie peut être une solution aux problèmes de santé publique dans le cas du moustique Aedes aegypti ou un problème? Puisque la transformation ou les modifications de ces êtres vivants dans les laboratoires sont de nouvelles techniques qu’il est impossible jusqu’à présent de savoir quelles seront les conséquences à long terme.
38
Koonin, Eugene V., Valerian V. Dolja, Mart Krupovic, Arvind Varsani, Yuri I. Wolf, Natalya Yutin, F. Murilo Zerbini, and Jens H. Kuhn. "Global Organization and Proposed Megataxonomy of the Virus World." Microbiology and Molecular Biology Reviews 84, no. 2 (March 4, 2020). http://dx.doi.org/10.1128/mmbr.00061-19.
Full textAbstract:
SUMMARY Viruses and mobile genetic elements are molecular parasites or symbionts that coevolve with nearly all forms of cellular life. The route of virus replication and protein expression is determined by the viral genome type. Comparison of these routes led to the classification of viruses into seven “Baltimore classes” (BCs) that define the major features of virus reproduction. However, recent phylogenomic studies identified multiple evolutionary connections among viruses within each of the BCs as well as between different classes. Due to the modular organization of virus genomes, these relationships defy simple representation as lines of descent but rather form complex networks. Phylogenetic analyses of virus hallmark genes combined with analyses of gene-sharing networks show that replication modules of five BCs (three classes of RNA viruses and two classes of reverse-transcribing viruses) evolved from a common ancestor that encoded an RNA-directed RNA polymerase or a reverse transcriptase. Bona fide viruses evolved from this ancestor on multiple, independent occasions via the recruitment of distinct cellular proteins as capsid subunits and other structural components of virions. The single-stranded DNA (ssDNA) viruses are a polyphyletic class, with different groups evolving by recombination between rolling-circle-replicating plasmids, which contributed the replication protein, and positive-sense RNA viruses, which contributed the capsid protein. The double-stranded DNA (dsDNA) viruses are distributed among several large monophyletic groups and arose via the combination of distinct structural modules with equally diverse replication modules. Phylogenomic analyses reveal the finer structure of evolutionary connections among RNA viruses and reverse-transcribing viruses, ssDNA viruses, and large subsets of dsDNA viruses. Taken together, these analyses allow us to outline the global organization of the virus world. Here, we describe the key aspects of this organization and propose a comprehensive hierarchical taxonomy of viruses.
39
Wan, Jiajia, Qifu Liang, Ruonan Zhang, Yu Cheng, Xin Wang, Hui Wang, Jieting Zhang, et al. "Arboviruses and symbiotic viruses cooperatively hijack insect sperm-specific proteins for paternal transmission." Nature Communications 14, no. 1 (March 9, 2023). http://dx.doi.org/10.1038/s41467-023-36993-0.
Full textAbstract:
AbstractArboviruses and symbiotic viruses can be paternally transmitted by male insects to their offspring for long-term viral persistence in nature, but the mechanism remains largely unknown. Here, we identify the sperm-specific serpin protein HongrES1 of leafhopper Recilia dorsalis as a mediator of paternal transmission of the reovirus Rice gall dwarf virus (RGDV) and a previously undescribed symbiotic virus of the Virgaviridae family, Recilia dorsalis filamentous virus (RdFV). We show that HongrES1 mediates the direct binding of virions to leafhopper sperm surfaces and subsequent paternal transmission via interaction with both viral capsid proteins. Direct interaction of viral capsid proteins mediates simultaneously invasion of two viruses into male reproductive organs. Moreover, arbovirus activates HongrES1 expression to suppress the conversion of prophenoloxidase to active phenoloxidase, potentially producing a mild antiviral melanization defense. Paternal virus transmission scarcely affects offspring fitness. These findings provide insights into how different viruses cooperatively hijack insect sperm-specific proteins for paternal transmission without disturbing sperm functions.
40
Li, Jia, Yanrong Zhou, Wenkai Zhao, Jiao Liu, Rizwan Ullah, Puxian Fang, Liurong Fang, and Shaobo Xiao. "Porcine reproductive and respiratory syndrome virus degrades DDX10 via SQSTM1/p62-dependent selective autophagy to antagonize its antiviral activity." Autophagy, February 13, 2023. http://dx.doi.org/10.1080/15548627.2023.2179844.
Full text
41
Wang, Hsin-Wei, Hsing-Han Li, Shih-Cheng Wu, Cheng-Kang Tang, Hui-Ying Yu, Ya-Chen Chang, Pei-Shan Sung, et al. "CLEC5A mediates Zika virus-induced testicular damage." Journal of Biomedical Science 30, no. 1 (February 17, 2023). http://dx.doi.org/10.1186/s12929-023-00906-6.
Full textAbstract:
Abstract Background Zika virus (ZIKV) infection is clinically known to induce testicular swelling, termed orchitis, and potentially impact male sterility, but the underlying mechanisms remain unclear. Previous reports suggested that C-type lectins play important roles in mediating virus-induced inflammatory reactions and pathogenesis. We thus investigated whether C-type lectins modulate ZIKV-induced testicular damage. Methods C-type lectin domain family 5 member A (CLEC5A) knockout mice were generated in a STAT1-deficient immunocompromised background (denoted clec5a−/−stat1−/−) to enable testing of the role played by CLEC5A after ZIKV infection in a mosquito-to-mouse disease model. Following ZIKV infection, mice were subjected to an array of analyses to evaluate testicular damage, including ZIKV infectivity and neutrophil infiltration estimation via quantitative RT-PCR or histology and immunohistochemistry, inflammatory cytokine and testosterone detection, and spermatozoon counting. Furthermore, DNAX-activating proteins for 12 kDa (DAP12) knockout mice (dap12−/−stat1−/−) were generated and used to evaluate ZIKV infectivity, inflammation, and spermatozoa function in order to investigate the potential mechanisms engaged by CLEC5A. Results Compared to experiments conducted in ZIKV-infected stat1−/− mice, infected clec5a−/−stat1−/− mice showed reductions in testicular ZIKV titer, local inflammation and apoptosis in testis and epididymis, neutrophil invasion, and sperm count and motility. CLEC5A, a myeloid pattern recognition receptor, therefore appears involved in the pathogenesis of ZIKV-induced orchitis and oligospermia. Furthermore, DAP12 expression was found to be decreased in the testis and epididymis tissues of clec5a−/−stat1−/− mice. As for CLEC5A deficient mice, ZIKV-infected DAP12-deficient mice also showed reductions in testicular ZIKV titer and local inflammation, as well as improved spermatozoa function, as compared to controls. CLEC5A-associated DAP12 signaling appears to in part regulate ZIKV-induced testicular damage. Conclusions Our analyses reveal a critical role for CLEC5A in ZIKV-induced proinflammatory responses, as CLEC5A enables leukocytes to infiltrate past the blood-testis barrier and induce testicular and epididymal tissue damage. CLEC5A is thus a potential therapeutic target for the prevention of injuries to male reproductive organs in ZIKV patients.
42
Masud, M. A., Md Hamidul Islam, and Byul Nim Kim. "Understanding the Role of Environmental Transmission on COVID-19 Herd Immunity and Invasion Potential." Bulletin of Mathematical Biology 84, no. 10 (September 10, 2022). http://dx.doi.org/10.1007/s11538-022-01070-y.
Full textAbstract:
AbstractCOVID-19 is caused by the SARS-CoV-2 virus, which is mainly transmitted directly between humans. However, it is observed that this disease can also be transmitted through an indirect route via environmental fomites. The development of appropriate and effective vaccines has allowed us to target and anticipate herd immunity. Understanding of the transmission dynamics and the persistence of the virus on environmental fomites and their resistive role on indirect transmission of the virus is an important scientific and public health challenge because it is essential to consider all possible transmission routes and route specific transmission strength to accurately quantify the herd immunity threshold. In this paper, we present a mathematical model that considers both direct and indirect transmission modes. Our analysis focuses on establishing the disease invasion threshold, investigating its sensitivity to both transmission routes and isolate route-specific transmission rate. Using the tau-leap algorithm, we perform a stochastic model simulation to address the invasion potential of both transmission routes. Our analysis shows that direct transmission has a higher invasion potential than that of the indirect transmission. As a proof of this concept, we fitted our model with early epidemic data from several countries to uniquely estimate the reproduction numbers associated with direct and indirect transmission upon confirming the identifiability of the parameters. As the indirect transmission possess lower invasion potential than direct transmission, proper estimation and necessary steps toward mitigating it would help reduce vaccination requirement.
43
Gleicher, Norbert. "The COVID-19 pandemic through eyes of a NYC fertility center: a unique learning experience with often unexpected results." Reproductive Biology and Endocrinology 18, no. 1 (November 4, 2020). http://dx.doi.org/10.1186/s12958-020-00663-3.
Full textAbstract:
Abstract Affecting basic tenets of human existence such as health, economic as well as personal security and, of course, reproduction, the COVID-19 pandemic transcended medical specialties and professional disciplines. Yet, six months into the pandemic, there still exists no consensus on how to combat the virus in absence of a vaccine. Facing unprecedented circumstances, and in absence of real evidence on how to proceed, our organization early in the pandemic decided to act independently from often seemingly irrational guidance and, instead, to carefully follow a quickly evolving COVID-19 literature. Here described is the, likely, unique journey of a fertility center that maintained services during peaks of COVID-19 and political unrest that followed. Closely following publicly available data, we recognized relatively early that New York City and other East Coast regions, which during the initial COVID-19 wave between March and May represented the hardest-hit areas in the country, during the second wave, beginning in June and still in progress, remained almost completely unaffected. In contrast, south western regions, almost completely unaffected by the initial wave, were severely affected in the second wave. These two distinctively different infectious phenotypes suggested two likely explanations: The country was witnessing infections with two different SARS-CoV-2 viruses and NYC (along with the East Coast) acquired during the first wave much better immunity to the virus than south western regions. Both hypotheses since have been confirmed: East and West Coasts, indeed, were initially infected by two distinctively different lineages of the virus, with the East Coast lineage being 10-times more infectious. In addition, immunologists discovered an up to this point unknown long-term anti-viral innate (cellular) immune response which offers additional and much broader anti-viral immunity than the classical adaptive immunity via immobilizing antibodies that has been known for decades. Consequently, we predict that in the U.S., even in absence of an available vaccine, COVID-19, by September–October, will be at similarly low levels as are currently seen in NYC and other East Coast regions (generally < 1% test-positivity). We, furthermore, predict that, if current mitigation measures are maintained and no newly aggressive mutation of the virus enters the country, a significant fall-wave of COVID-19, in combination with the usual fall wave of influenza, appears unlikely. To continue serving patients uninterrupted throughout the pandemic, turned for all of our center’s staff into a highly rewarding experience, garnered respect and appreciation from patients, and turned into an absolutely unique learning experience.
44
Rabie, Amgad M., and Wafa A. Eltayb. "Potent Dual Polymerase/Exonuclease Inhibitory Activities of Antioxidant Aminothiadiazoles Against the COVID-19 Omicron Virus: A Promising In Silico/In Vitro Repositioning Research Study." Molecular Biotechnology, January 24, 2023. http://dx.doi.org/10.1007/s12033-022-00551-8.
Full textAbstract:
AbstractRecently, natural and synthetic nitrogenous heterocyclic antivirals topped the scene as first choices for the treatment of the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infections and their accompanying disease, the coronavirus disease 2019 (COVID-19). Meanwhile, the mysterious evolution of a new strain of SARS-CoV-2, the Omicron variant and its sublineages, caused a new defiance in the continual COVID-19 battle. Hitting the two principal coronaviral-2 multiplication enzymes RNA-dependent RNA polymerase (RdRp) and 3′-to-5′ exoribonuclease (ExoN) synchronously using the same ligand is a highly effective novel dual pathway to hinder SARS-CoV-2 reproduction and stop COVID-19 progression irrespective of the SARS-CoV-2 variant type since RdRps and ExoNs are widely conserved among all SARS-CoV-2 strains. Herein, the present computational/biological study screened our previous small libraries of nitrogenous heterocyclic compounds, searching for the most ideal drug candidates predictably able to efficiently act through this double approach. Theoretical filtration gave rise to three promising antioxidant nitrogenous heterocyclic compounds of the 1,3,4-thiadiazole type, which are CoViTris2022, Taroxaz-26, and ChloViD2022. Further experimental evaluation proved for the first time, utilizing the in vitro anti-RdRp/ExoN and anti-SARS-CoV-2 bioassays, that ChloViD2022, CoViTris2022, and Taroxaz-26 could effectively inhibit the replication of the new virulent strains of SARS-CoV-2 with extremely minute in vitro anti-RdRp and anti-SARS-CoV-2 EC50 values of 0.17 and 0.41 μM for ChloViD2022, 0.21 and 0.69 μM for CoViTris2022, and 0.23 and 0.73 μM for Taroxaz-26, respectively, transcending the anti-COVID-19 drug molnupiravir. The preliminary in silico outcomes greatly supported these biochemical results, proposing that the three molecules potently strike the key catalytic pockets of the SARS-CoV-2 (Omicron variant) RdRp’s and ExoN’s vital active sites. Moreover, the idealistic pharmacophoric hallmarks of CoViTris2022, Taroxaz-26, and ChloViD2022 molecules relatively make them typical dual-action inhibitors of SARS-CoV-2 replication and proofreading, with their highly flexible structures open for various kinds of chemical derivatization. To cut it short, the present pivotal findings of this comprehensive work disclosed the promising repositioning potentials of the three 2-aminothiadiazoles, CoViTris2022, Taroxaz-26, and ChloViD2022, to successfully interfere with the crucial biological interactions of the coronaviral-2 polymerase/exoribonuclease with the four principal RNA nucleotides, and, as a result, cure COVID-19 infection, encouraging us to rapidly start the three drugs’ broad preclinical/clinical anti-COVID-19 evaluations. Graphical Abstract Dual SARS-CoV-2 polymerase (RdRp) and exoribonuclease (ExoN) inhibition via nucleoside mimicry is a very effective novel approach for COVID-19 infection therapy. Hydroxylated nitrogenous heterocyclic compounds are currently considered first choices in COVID-19 therapy. Extensive computational investigations disclosed three synthetic 5-substituted-2-amino-1,3,4-thiadiazoles, CoViTris2022, Taroxaz-26, and ChloViD2022, with ideal anti-RdRp/ExoN features. ChloViD2022 was ranked the top among the three NAs, with biochemical anti-RdRp EC50 value of 0.17 μM. ChloViD2022 accordingly displayed excellent anti-SARS-CoV-2 EC50 value of 0.41 μM against the Omicron variant.