Journal articles on the topic 'Victoria River Region (N.T.)'

Abstract Nitrogen Use Efficiency (NUE) is one of the established metrics for benchmarking management of Nitrogen (N) in various systems. Numerous approaches to calculate NUE exist, making it difficult to compare the performances of systems depending on the methodology used. This study adopted the conceptualized framework by European Union Nitrogen Expert Panel (EUNEP) to calculate NUE values for cereal crops to determine future trends for the first time in the Lake Victoria region. Data were collected through in-person interviews among maize and rice smallholder farmers within the Lake Victoria region. A total of 293 observations were recorded. Collected data on yield and N fertilizer were used to make projections on the changes of NUE based on scientific and policy recommendations for Sub-Saharan Africa for 2020 (base year), 2025, 2030, and 2050. Significant differences in maize grain yield for both fertilized and unfertilized farms were observed with very low yields of 2.4 t ha−1 (fertilized) and 1.4 t ha−1 (unfertilized). The graphical representation of NUE of both maize and rice showed that most farmers were in the zone of soil N mining. Projected results showed that most maize farmers within Lake Victoria region will continue to experience NUE values >90%, low N inputs <50 kg N ha−1) and less than 5 t ha−1 maize crop yield over the years. For rice farmers, Nyando and Nzoia catchments had surpassed the set target of both yield (6 t ha−1) and N input (50 kg N ha−1). However, NUE values remain higher than the optimal ranges of 50%–90% (127.14%−267.57%), indicating risks of depleting soil N status. The unbalanced N fertilization also showed a trend below the linear neutrality option and the average N output for good N management for both crops. Therefore, farmers need to explore various crop management options that could increase N use efficiencies. This should be coupled with policies that promote farmers to access more N input and advocate for optimal management of N and improved quality of the cereals.

Five new species of the genus Trechus Clairville, 1806 are described from the eastern part of the Tien Shan mountains (China, Xinjiang-Uygur Autonomous Region): T. tsanmensis sp. n. from the Narat Mountain Range, left bank of the Zanma River; T. torgaut sp. n. from the upper course of the Kunges River and Narat Mountain Range (both species belong to the uygur species group, which is defined here); T. aghiazicus sp. n. from the Aghiaz River and Koeksu Basin, T. cratocephalus sp. n. from the Narat Mountain Range (both belong to the micrangulus species group); and T. saluki sp. n. from the mountains S of the Kunges River (belonging to the kashensis species group, also defined in the present paper). Some new data on the distribution of T.uygur Deuve, 1993 and T. kashensis Belousov & Kabak, 2001 are given. The distribution of all known species of the uygur and kashensis groups is mapped. An identification key is provided to known species of the uygur group.

Seasonal production profiles are fundamental to the effective utilisation of herbage crops. In the Peace River region of north-western Canada, the seasonal productivity and nutritive value of the primary growth of nine grasses was assessed under conditions of potentially non-limiting N fertiliser (150 kg N ha-1). Yield, digestibility and N concentration of dry matter (DM) were determined for herbage harvested at six dates during primary growth (late-May to mid-August at 2-wk intervals), and regressed on time in the growing season. Herbage DM yield increased exponentially throughout primary growth for each grass although the nature of the relationship differed among the grasses, both with respect to the maximum yield and the amount of early-season production; maximum yields ranged from 3.61 t ha-1 for reed canary to 6.31 t ha-1 for intermediate wheat. The early-season productivity of meadow foxtail and crested wheat was particularly evident, with DM yields in excess of 1 t ha-1 by 24 May compared to less than 0.32 t ha-1 for the other seven grasses. Reed canary and meadow foxtail had high N concentrations, meadow brome and three wheatgrasses had low N concentrations, and smooth brome, timothy and creeping red fescue had intermediate N concentrations. Herbage digestibility during the primary growth could be characterised by a single response curve for the nine grasses; digestibility decreased exponentially during the vegetative to head-emergence stage of growth at an average rate of 4.1 g kg-1 DM d-1, from 830 g kg-1 DM in late-May to 616 g kg-1 DM in mid-July. Herbage N concentration and digestibility were related linearly for each of the nine grasses. Key words: Grasses, herbage, yield, nutritive value, primary growth

A series of simulations was made with a fallow{wheat crop simulation model to examine the effects of stubble retention and tillage on yield for 2 semi-arid environments in north-western Victoria over a 100-200-year period. The fallow treatments comprised 4 combinations of stubble management and tillage in 18-month-long fallows of a fallow{wheat rotation. The 2 sites are representative of the major soil types of the region: a chromic vertisol at Dooen and a calcic xerosol at Walpeup. Stubble retention had the greatest effect on yield, providing a median increase of 0·8 and 0·6 t/ha at Dooen and Walpeup, respectively. Zero tillage had an importantbut small advantage in the presence of stubble at Dooen (0·2 t/ha) and no significant advantage under any system at Walpeup. Yield response was primarily caused through increased fallow-stored water of approximately 89 and 25 mm at Dooen and Walpeup, respectively. The accumulation of soil mineral nitrogen (SMN) at sowing in fallows did not show the same treatment differences as with water or yield. There was a significant interaction between soil type and fallow method. At Dooen, stubble depressed SMN by about 24 kg N/ha (163{185 kg N/ha) below those without stubble (188-207 kg N/ha). Tillage reduced SMN with or without stubble by about 20 kg N/ha. At Walpeup, on the other hand, the highest SMN was associated with tillage and was enhanced by stubble, but the differences were small (<10 kg N/ha). Nitrogen fertiliser produced a small increase in yield (median 0·2 t/ha) at Dooen, increasing to about 0·4 t/ha in wetter years when stubble was retained and fallows were maintained with zero tillage. Over a 100-year period, nitrogen fertiliser reduced the rate of yield decline. The use of nitrogen fertiliser with stubble retention and zero tillage offers an opportunity for arresting declining yield and quality in intensive cropping systems in the Wimmera region of Victoria.

Objective: To describe the clinical and pathological presentation as well as treatment options of parotid swelling inchildren. D e s i g n : Descriptive case series study. S e t t i n g : Department of Paediatric Surgery Bahawal Victoria Hospital Bahawalpur. Period:From Nov2005 to Jul2007. Material a n d m e t h o d : All patients of either sex below the age of 13 years presenting with parotid swelling wereincluded in the study. Clinical presentations, preoperative investigations, operative procedures, histopathology reports, postoperativecomplications and further management (radiotherapy &chemotherapy) were recorded. Results: Twelve patients presented with parotidswelling. Commonest presentation was a lump over the parotid region (100%) & pain (25%). Majority of tumours were benign (50%).Vascular lesions outnumbered solid tumours. 4 patients (33.33%) had haemangioma 1 patient (8.33%) had cystic hygroma, one patienteach of pleomorphic adenoma, mucoepidermoid carcinoma and Adenocarcinoma. C o n c l u s i o n : Salivary gland lesions are most likelyinflammatory in origin. Vascular tumours are common benign tumours than epithelial tumours in children. Superficial parotidectomy is theoperation for benign tumours and total conservative parotidectomy for malignant tumours.

Abstract The Riva River is a water basin located within the borders of Istanbul in the Marmara Region (Turkey) in the south-north direction. Water samples were taken for the 35 km drainage area of the Riva River Basin before the river flows into the Black Sea at 4 stations on the Riva River every month and analyses were carried out. Changes were observed in the quality of water from upstream to downstream. For this purpose, the spatial and temporal variations of water quality were investigated using 13 water quality variables with the ANOVA test. It was observed that COD, DO, S and BOD were important in determining the spatial variation. On the other hand, it was found out that all the variables were effective in determining the temporal variation. Moreover, the correlation analysis which was carried out in order to assess the relations between water quality variables showed that the variables of BOD-COD, BOD-EC, COD-EC, BOD-T and COD-T were correlated and the regression analysis showed that COD, TKN and NH4-N explained BOD and BOD, NH4-N, T and TSS explained COD by approximately 80 %. Consequently, the Artificial Neural Network (ANN), Decision Tree and Logistic Regression models were developed using the data of training set in order to predict the water quality classes of the variables of COD, BOD and NH4-N. Quality classes were predicted for the variables by inputting the data of testing set into the developed models. According to these results, it was seen that the ANN was the best prediction model for COD, the Decision Tree for BOD and the ANN and Decision Tree for NH4-N.

Three crayfishes of the genus Procambarus, subgenus Ortmannicus, are described from Texas, including (1) Procambarus (Ortmannicus) parvus n. sp. from the Victoria-El Campo region of the Coastal Plain; (2) P. (O.) albaughi n. sp. from the Coastal Plain in the vicinity of Houston; and (3) P. (O.) fayettei n. sp. from the eastern versant of the Colorado River drainage south of Giddings. The three new species, P. (O.) acutus, P. (O.) texanus, and P. (O.) zonangulus form a closely allied group. They are distinguished from each other primarily by characters of the first pleopod. The subspecies P. (O.) acutus acutus and P. (O.) a. cuevachicae are elevated to full species. Species accounts are provided for all Texas subgenus members and may include diagnoses, color notes, size data, locality data, life history notes, listings of associates, and information on variation and relationships. A key to the species of Ortmannicus in Texas is also presented.

Basic and molecular cytogenetic techniques were carried out in 3 Neotropical region populations of catfishes, two of <i>Trachelyopterus galeatus</i> (one from the marshlands of Paraguay River basin and another from Lago Catalão, Amazon River basin) and one of <i>Trachelyopterus porosus</i>, a sympatric population to <i>T. galeatus</i> from the Amazon River basin. This study aimed to describe and understand the structure and evolution of <i>Trachelyopterus</i> B chromosomes, mainly through physical mapping of repetitive elements. A diploid number of 58 chromosomes was found for all individuals, as well as the presence of B chromosomes. For <i>T. porosus</i> this is the first report of a supernumerary. The sympatric species of <i>T. galeatus</i> and <i>T. porosus</i> from Amazon River had 1–3 B chromosomes and <i>T. galeatus</i> from Paraguay River had 1–2 B chromosomes, all of them showed intra- and interindividual numerical variation. Two females of <i>T. porosus</i> exhibited a new variant B chromosome (B2), previously not seen in Auchenipteridae, which might have originated from B1 chromosomes. All B chromosomes were entirely heterochromatic. In contrast to all complement A and B2 chromosomes, in which the telomeric sequences were found in the telomeric regions, B1 chromosomes of all populations were totally marked by (TTAGGG)_n probes. (GATA)_n sequence sites were found through all complement A chromosomes, but B1 and B2 chromosomes exhibited only a clustered block in one of the chromosome arms. The most frequent B chromosomes (B1) in all populations/species, including those previously studied in Auchenipteridae catfishes, share the following characteristics: totally heterochromatic, small, metacentric, with accumulation of repetitive (TTAGGG)_n sequences, and a low number of (GATA)_n copies, which might suggest a common ancient origin in <i>Trachelyopterus</i> species/populations.

An overview of regional seismicity registered by the Arkhangelsk seismic network is presented. In 2013 the Arkhangelsk seismic network included 9 digital seismic stations (ARH, KRR, PRG, TMC, PRO, LASH, SLV, AMD, and ZFI/ZFI2). A large number of technogenic events were recorded by the Arkhangelsk network in the north of the East European Platform (Arkhangelsk Region). Only 2 earthquakes were registered during the entire observation period: on October 22, 2005, at 17h46m with ML=2.9, and on March 28, 2013, at 07h02m with ML=3.4. The parameters of the hypocenter of the March 28, 2013 earthquake were evaluated using all currently available source data and bulletins of Russian and foreign seismic stations. The evaluation was done using the method of Generalized beamforming, in an improved form, implemented in the program NAS (New Association System). This earthquake is reprocessed using the same initial data (26 arrivals of seismic P- and S-phases from 13 seismic stations) by the NAS program. The epicentral distances ranged from 85 to 1800 km. The final parameters of the epicenter are as follows: 28.03.2013, t0=07:02:16.2, φ=63.95°N, λ=41.57°E. The epicenter is located 80 km south of Arkhangelsk in a sparsely populated area slightly west of the Severnaya Dvina River. The probable source depths lie in the interval from 2 to 33 km and the depth with the maximal value of the rating function is 19 km. A map of earthquakes in the Arctic region is provided. Earthquakes were registered by stations of the Arkhangelsk seismic network and processed together with the waveforms from other networks. The distribution of earthquakes correlates with the seismic zones of the Arctic – the Knipovich and Gakkel ridges, Spitsbergen. There are weak earthquakes on the shelf of the Barents Sea near the Frantz Josef land archipelago, as in 2012. They relate to the trench of Franz Victoria, the border of the continental slope, and the island of Bely. The coordinates of the epicenters of 290 earthquakes were determined in 2013. The representative level of the Euro-Arctic region's magnitude for 2013 according to the Arkhangelsk network was 2.9.

This study evaluated environmental factors affecting on sediment and nutrient loads in Lam Takong River basin, Northeastern region of Thailand, using the results of SWAT (Soil and Water Assessment Tool) model. The simulation from 2007-2009 showed that mean annual sediment, NO3-N and TP at the outlet were 8.134 t/ha, 0.879 kg/ha and 1.213 kg/ha, respectively. Seven factors were significantly related to soil erosion including slope, elevation, agriculture, wetland, deciduous forest, evergreen forest and orchard. In addition, two factors were significantly related to NO3-N including surface runoff and urban area. Finally, four factors were significantly related to TP including surface runoff, elevation, deciduous forest and orchard. Modification of these factors can reduce sediment and nutrient loads in this basin.

Trechodes laophilus Deuve, 2002 is firstly recorded from Thailand (Chiang Mai province, Mae lai river). This species is probably closely related to T. leclerci Deuve, 1987 and T. satoi Uéno, 1991, both from Thailand too. An identification key including the morphology of the aedeagus, to all Trechodes species recorded from the Oriental region, as well as a distribution map of the species known so far from Thailand, are provided.Moreover, the following new synonymy is proposed: Blennidus magellanicus Allegro & Giachino, 2017 = Trirammatus unistriatus nocticolor Straneo, 1955 syn. n.

The Qinghai-Tibetan Plateau (QTP) is generally considered to be the water source region for its surrounding lowlands. However, there have only been a few studies that have focused on quantifying alpine meadow evapotranspiration (ET) and its partitioning, which are important components of water balance. This paper used the Shuttleworth–Wallace (S–W) model to quantify soil evaporation (E) and plant transpiration (T) in a degraded alpine meadow (34°24′ N, 100°24′ E, 3963 m a.s.l) located at the QTP from September 2006 to December 2008. The results showed that the annual ET estimated by the S–W model (ETSW) was 511.5 mm (2007) and 499.8 mm (2008), while E estimated by the model (ESW) was 306.0 mm and 281.7 mm for 2007 and 2008, respectively, which was 49% and 29% higher than plant transpiration (TSW). Model analysis showed that ET, E, and T were mainly dominated by net radiation (Rn), while leaf area index (LAI) and soil water content at a 5 cm depth (SWC5cm) were the most important factors influencing ET partitioning. The study results suggest that meadow degradation may increase water loss through increasing E, and reduce the water conservation capability of the alpine meadow ecosystem.

The majority of rain used by winter grain crops in the Mallee region of Victoria, Australia, falls during the cooler months of the year (April–October). However, rain falling during the summer fallow period (November–March) and stored as soil moisture contributes to grain yield. Strategies to better capture and store summer fallow rain include (i) retention of crop residues on the soil surface to improve water infiltration and evaporation; and (ii) chemical or mechanical control of summer fallow weeds to reduce transpiration. Despite the widespread adoption of no-till farming systems in the region, few published studies have considered the benefits of residue management during the summer fallow relative to weed control, and none quantify the impacts or identify the mechanisms by which summer fallow weeds influence subsequent crop yield. Over 3 years (2009–11), identical experiments on adjacent sand and clay soil types at Hopetoun in the southern Mallee were conducted to quantify the effect of residue management (standing, removed, or slashed) and summer fallow weed control (± chemical control) compared with cultivation on soil water and nitrogen (N) accumulation and subsequent crop yield. The presence of residue (2.4–5.8 t/ha) had no effect on soil water accumulation and a small negative effect on grain yield on the clay soil in 2011. Controlling summer weeds (Heliotropium europaeum and volunteer crop species) increased soil water accumulation (mean 45 mm) and mineral N (mean 45 kg/ha) before sowing on both soil types in 2 years of the experiment with significant amounts of summer fallow rain (2010 and 2011). Control of summer weeds increased grain yield of canola by 0.6 t/ha in 2010 and wheat by 1.4 t/ha in 2011. Using the data from these experiments to parameterise the APSIM model, simulation of selected treatments using historical climate data (1958–2011) showed that an extra 40 mm of stored soil water resulted in an average additional 0.4 t/ha yield, most of which was achieved in dry growing seasons. An additional 40 kg/ha N increased yield only in wetter growing seasons (mean 0.4 t/ha on both soil types). The combination of extra water and N that was found experimentally to result from control of summer fallow weeds increased subsequent crop yield in all season types (mean 0.7 t/ha on sand, 0.9 t/ha on clay). The co-limitation of yield by water and N in the Mallee environment means that yield increases due to summer weed control (and thus returns on investment) are very reliable.

We used an array of fixed acoustic receivers (N = 42) to track the summer marine movements of 121 anadromous Arctic char (Salvelinus alpinus) equipped with acoustic transmitters at three locations in the Cambridge Bay region, where commercial and subsistence fisheries target the species. The timing of transitions between salt and fresh water was influenced by the putative river of origin of tagged individuals, but not by their size or sex. Females, however, were more likely to remain proximate to rivers where they were tagged throughout the summer. A majority of fish migrated west from their rivers of origin, primarily moving between estuarine environments. Individuals occupied estuaries for several days between bouts of marine movement, and these periods of residency coincided with spring tides in some estuaries. We also recorded increased numbers of detections on receivers located less than 1.5 km from the coast, indicating a preference for nearshore habitats. Finally, we report evidence of extensive stock mixing throughout the summer, including at known fishing locations and periods, a finding with implications for fisheries management.

Urbanization and ever increasing socioeconomic activities have degraded natural resources globally. This study monitored water quality (WQI) based on physicochemical and microbial qualities of river water in an industrial region northwest coast of Borneo. Microbiological parameters tested included total viable count (TVC), coliform count (TC), faecal coliform count (FC), and Escherichia coli confirmation. Physicochemical constituents evaluated included water temperatures (T), pH, total dissolved solids (TDS), salinity, electrical conductivity (EC), dissolved oxygen (DO), biochemical oxygen demand (BOD), ammoniacal nitrogen (NH3-N), chemical oxygen demand (COD) and total suspended solids (TSS). The mean microbial counts of samples were: TVC (3.9 × 102–3.0 × 104 cfu mL−1), TC and FC (23–>1600 MPN 100 mL−1) (MPN: the most probable number) and Escherichia coli growth was confirmed. The mean values of pH, TDS, salinity, EC and BOD are significantly different (p < 0.05) between the rivers ranged: pH (5.05 ± 0.03–6.10 ± 0.10), TDS (0.0 ± 0.0–38,600 ± 50 mg L−1), salinity (0.01 ± 0.0–3.07 ± 0.07%), EC (650 ± 25–19,566.67 ± 251.66 µS cm−1), and BOD (0.23 ± 0.10–3.12 ± 0.02 mgO2 L−1). The tested parameters of samples exceeded international limits with the exception of COD and TSS. The WQI of river water tested ranged from 65–73 under class III. Most of the river water was slightly polluted and a potential threat to public health.

In the recent decades, the issue of water-resource security of the Daqing River Basin, which is one of the five major rivers in the Haihe River Basin, has become increasingly serious affected by climate change and human activities. In this paper, a dynamic simulation and early warning model of water quantity and quality in this basin based on the SWAT model was constructed to promote the implementation of water environment quality and safety bottom line in the Beijing-Tianjin-Hebei region. The results of the study are as follows: (1) When encountering a once-in-a-century rainstorm, the flood pressure of Zijingguan in the flood season is the highest, with the highest water level reaching 521.23 m, and the overall maximum runoff follows the order of Zijingguan > Fuping > Zhangfang. (2) When the NH3-N emissions are reduced by 37.64~85.10% in each month (based on the level in 2017), the water quality at the outlet of the basin can reach the standard, and the upper limit of NH3-N emissions is 504.5 t/m. (3) The regulation and control scheme seeking to “ensure the base flow with standard water quality” and “optimize NH3-N annual emission” is proposed in this paper. The NH3-N concentration at the outlet of all watersheds can reach the standard when the basic runoff of each sub-basin reaches 0.01 to 10.32 m3/s. In addition, concentrating the emission in July, August, and September and reducing the emission intensity of NH3-N in proportion can significantly reduce the monthly average NH3-N concentration (<1.99 mg/L) at the outlet section of the basin.

Long-term studies of suspended particulate matter (SPM) and organic compounds (OCs)—Corg, lipids, hydrocarbons (aliphatic—AHCs and polycyclic aromatic—PAHs), and chlorophyll a in the snow cover of the Arctic (Franz Victoria Trough, Mendeleev Rise, White Sea) and Antarctica (in the coastal waters on fast ice and on the mainland near Russian stations) were generalized. It was shown that in the Arctic, the influence of continental air masses leads to an increase in OCs in snow. Therefore, despite the fact that the Franz Victoria Trough and the Mendeleev Rise are at the same latitude (82° N), the OCs content in the snow in the region of the Mendeleev Rise was lower for aliphatic hydrocarbons 5 and 14–18 μg/L. In the White Sea, the AHC content in the snow and the upper layers of the ice in the mouth of the Severnaya Dvina River and in the Kandalaksha Bay was higher than that in the lower layers of the ice and sharply decreased with distance from the emission sources. As a result, the snow was supplied mainly by pyrogenic PAHs. In the Antarctica, the lowest OCs levels in atmosphere were found in areas where coastal hills are covered with snow. The maximum SPM and AHCs concentration was found in the sludge (SPM—to 4.37 mg/L, AHC—to 33 μg/L). An increase in the concentration of OCs and SPM in snow sampled on the continent took place in the areas of stations and oases (St. Novolazarevskaya) where the predominance of mineral particles in the SPM was registered. In the area of the operating stations, mainly low molecular weight PAHs with the dominance of petroleum PAHs were found in the SPM of snow and in mosses.

The distribution and morphometric features of the common toad (Bufo bufo) in the North-East of European Russia are discussed. The northern boundary of the species' range in the region has a complex configuration. In the west and central part of the region, the toad is found up to latitude 65º42'N and 63º01'N, respectively, the eastern border of its habitat moves northwards up to 64º13' and then drops to the south along the Ural Mountain Ridge. The formation of the modern range of the species in the region was influenced by an extensive network of watercourses and global climate changes. For the last 70 years, toads have distributed along the Pechora River at a distance of more than 600 km. The morphometric variability of the common toad was estimated by 13 linear criteria and 7 indices on the example of four localities in the Komi Republic (Pechora, Beloye Lake, Lokchim Lake, and Sysola Lake). Significant sexual differences were found by most criteria: their values in females are higher than in males. Toads of both sexes inhabiting the eastern and northern localities (Pechora, Lake Beloye) are smaller in size than animals from the southwestern parts of the region (Lokchim Lake, Sysola Lake). Discriminant analysis showed that maximal differences between samples were registered on the body length L., femur length F., tibia length T., head length L.c., and head latitude Lt.c.

There is an increased use of no-tillage (NT) methods in soils of the Peace River region of Alberta–British Columbia where a good proportion of acid soils exist. There is little information, however, on how crops, soils, and weeds respond to liming under different tillage intensities. A Hythe clay loam (Gray Luvisol; initial pH in CaCl2 ≈ 5) was limed (7.5 t ha−1) in May 1991. Field pea (Pisum sativum L.) yield, soil properties, and weed populations under conventional tillage (CT) and NT were monitored during three growing seasons (1993–1995). The pH of limed soil in the 0–10 cm layer ranged from 6.0 to 6.3. Liming slightly increased NO3-N, P and bulk density of soil, lowered exchangeable Al concentration and wet aggregate stability, and had no effect on NH4-N and penetration resistance. Liming increased the grain yield by 0.50 (22%) t ha−1 yr−1 in CT and by 0.55 (18%) t ha−1 yr−1 in NT. Aboveground dry matter (DM) increase of 1.37 (27%) t ha−1 yr−1 in CT and 1.72 (25%) t ha−1 yr−1 in NT was obtained due to liming. Populations of annual broadleaf, annual grass and perennial weeds were not affected by either liming or tillage. Reduced soil acidity and exchangeable Al in conjunction with increased NO3-N and P contributed to increased crop yield by liming under both CT and NT. Higher soil moisture in the NT contributed to increased yield in comparison to CT system, as other soil properties and weed population were not significantly affected by tillage. Key words: No tillage, Pisum sativum L., exchangeable aluminium, wet aggregate stability

Willow flycatchers (Empidonax traillii; WIFL) nest along the Owens River and Horton Creek in the Owens Valley. Migrating WIFL visit these sites as well as many other tributaries to both the Owens River and Mono Lake. We estimate there are approximately 35 WIFL territories in the Owens valley, or 5% of territories in California. Nesting WIFL in the Owens Valley are likely the federally endangered southwestern subspecies (E. t. extimus; SWIFL). The Chalk Bluff nesting site is particularly important as large nesting areas tend to be both rare and important for SWIFL and it contains more than half (63%) of all known WIFL territories in the region, which also represents 12% of all nesting SWIFL in California. Between 2014 and 2016, WIFL territory numbers declined from 37 to 27 across the three largest breeding sites. Territory numbers may have been influenced by drought conditions or brown-headed cowbird (Molothrus ater; BHCO) nest parasitism. In 2015 and 2016, comprehensive nest monitoring found nest parasitism rates were >40%, and nest success was lower in parasitized nests (16%; N = 5/31) compared with non-parasitized nests (60%; N = 31/52). BHCO management could potentially improve nest success for WIFL as well as many other open-cup nesting riparian birds in the Owens Valley.

Only few publications on the classification of vegetation of Koelerio–Corynephoretea canescentis Klika in Klika et Novák1941 class, that unites pioneer communities on sandy soils, dunes or an exposed sands, is known for Bryansk region of Russia (Bulokhov, 2001; Bulokhov, Kharin, 2008). This region is located in the western part of the East European plain, on the watershed of two large river (Dnieper and Volga) systems, occupying the central part of the Desna river pool and the woody watershed between Desna and Oka. The territory (34.9 thousand кm2) is extended from the west to the east on 270 km (between 31°10′ and 35°20′ E) and from the north to the south — on 190 km (between 54°05′ and 52°10′ N). The main item of this paper is to submit the results of the classification carried out upon thebasis of 57 releves made in 2003–2016 in Bryansk region and to characterize the composition, distribution and syntaxonomical position of thepioneer vege­tation of sandy and shallow soils communities within it. Three new associations are described according to Braun-Blanquet floristic classification. The syntaxon nomenclature of the higher ranks follows Mucina et al. (2016) The ass. Thymo serpylli–Koelerietum glaucae ass. nov. hoc loco, with synecological optimum on dry poor sandy soils, is diagnosed by character species Artemisia campestris, Koeleria glauca, Thymus serpyl­lum. Its communities occur on fringes of the lichen pine forests, sandy river terraces and outwash plains. Two subassociations are distinguished within the association: T. s.–K. g. typicum (with var. typica and Corynephorus canescens) and agrostietosum vinealis subass. nov. hoc loco (with var. typica and Calluna vulgaris) with Agrostis vinealis, Dianthus arenarius, Cladonia arbuscula as differential species. The ass. Koelerio glaucae–Plantaginetum arena­riae ass. nov. hoc loco, with synecological optimum on dry poor sandy soils or exposed sands, is diagnosed by Plantago arenaria and Koeleria glauca. Its communities occuron the exposed sands, fringes of lichen pine forests and not flooded sandy river crests. The ass. Diantho borbasii–Festucetum polesicae ass. nov. hoc loco with synecological optimum on dry, weekly acidic, poor of mineral nitrogen, sandy soils or the exposed sands, is diagnosed by Festuca pole­sica, Astragalus arenarius, Jurinea cyanoides, Otites parviflora. Communities occur on the exposed sands, fringes of lichen pine forests. Two variants are distinguished within association: Sempervivum ruthenicum (on dunes with dry, poor, weekly developed soils) and typica. These three associations are the early stages of the progressive succession of oligotrophic lichen pine fo­rests on the river terraces or of the heath meadows in flood river plains.

Abstract. Analysis of dissolved organic and inorganic carbon (DOC and DIC, respectively), pH, Na, K, Ca, Mg, Cl, SO4 and Si in ~ 100 large and small rivers (< 100 to ≤ 150 000 km2) of western Siberia sampled in winter, spring, summer and autumn over a more than 1500 km latitudinal gradient allowed for establishing the main environmental factors controlling the transport of dissolved river components in this environmentally important region, comprising continuous, discontinuous, sporadic and permafrost-free zones. There was significant latitudinal trend consisting in general decrease of DOC, DIC, SO4, and major cation (Ca, Mg, Na, K) concentrations northward, reflecting the interplay between groundwater feeding (detectable mostly in the permafrost-free zone, south of 60° N) and surface flux (in the permafrost-bearing zone). The trend of inorganic components was mostly pronounced in winter and less visible in spring, whereas for DOC, the trend of concentration decrease with latitude was absent in winter, and less pronounced in the spring flood than in the summer baseflow. The latitudinal trends persisted over all river watershed sizes, from < 100 to > 10 000 km2. This suggested that in addition to groundwater feeding of the river, there was a significant role of surface and shallow subsurface flow linked to plant litter degradation and peat leaching. Environmental factors are ranked by their increasing effect on DOC, DIC, δ13CDIC, and major elements in western Siberian rivers as the following: watershed area < season < latitude. Seasonal fluxes of dissolved components did not significantly depend on the river size and as such could be calculated as a~function of watershed latitude. Unexpectedly, the DOC flux remained stable around 3 t km−2 yr−1 until 61° N, decreased two-fold in the discontinuous permafrost zone (62–66° N), and increased again to 3 t km−2 yr−1 in the continuous permafrost zone (67° N). The DIC, Mg, K and Ca followed this pattern. The total dissolved cation flux (TDS_c) ranged from 1.5 to 5.5 t km−2 yr−1, similar to that in central Siberian rivers of the continuous permafrost region. While Si concentration was almost unaffected by the latitude over all seasons, the Si flux systematically increased northward, suggesting a decreasing role of secondary mineral formation in soil and of vegetation uptake. The dominating effect of latitude cannot however be interpreted solely in terms of permafrost abundance and water flow path (deep vs. surface) but has to be considered in the context of different climate, plant biomass productivity, unfrozen peat thickness and peat chemical composition. It can be anticipated that, under climate warming in western Siberia, the maximal change will occur in small (< 1000 km2 watershed) rivers DOC, DIC and ionic composition, and this change will be mostly pronounced in summer and autumn. The wintertime concentrations and spring flood fluxes and concentrations are unlikely to be appreciably affected by the change of the active layer depth and terrestrial biomass productivity. Assuming a conservative precipitation scenario and rising temperature over next few centuries, the annual fluxes of DOC and K in the discontinuous permafrost zone may see a maximum increase by a factor of 2, whereas for DIC and Mg, this increase may achieve a factor of 3. The fluxes of Ca and TDS_c may increase by a factor of 5. At the same time, Si fluxes will either remain constant or decrease two-fold in the permafrost-bearing zone relative to the permafrost-free zone of western Siberia.

Settlements with a similar material culture dominated in the West Siberian taiga zone in the 6th and 5th millennia BC. They are characterized by pottery with rounded bottoms, thin walls and incised ornamentation. In the upper and middle Konda River area and in the basin of the Severnaya Sosva River such pottery is identified as belonging to the Umyt’insky and Chestyjyagsky cultural type, respectively, in the mid-Ob region it relates to the Bystrinsky archaeological culture. The Chilimka V settlement is situated in the lower section of the Konda River basin, on the border of the Bystrinsky and Umyt’insky areas. It was investigated by I. G. Glushkov in 1988. The Chilimka V complex characterized by pottery with rounded bottoms, thin walls and incised ornamentation was defined as a “Chilimkinsky ceramic type”. The genesis of this type, according to I. G. Glushkov and T. N. Sobolnikova, is connected with migrations of Kelterminar population to the taiga zone in the 3rd millennium BC. The fundamental question of the definition of the “Chilimkinsky ceramic type”, which arose during the development of the modern cultural and chronological scheme of the Neolithic, required to re-examine the materials of the excavations. We have established that the site is multi-layered. The Neolithic dwelling was penetrated by several late Neolithic burials. In addition, some shards of the Bronze Age were discovered. The analysis of Neolithic ceramics demonstrates its objective similarity to both Umyt’insky type and Bystrinsky culture. Based on this, it is suggested to combine the settlements of these types into one cultural-chronological horizon of the taiga Neolithic of the north of Western Siberia.

AbstractEquine piroplasmosis (EP) is a tick-borne disease caused by Babesia caballi and Theileria equi that is potentially emerging in non-endemic countries. We conducted a descriptive study to investigate EP prevalence and spatial distribution in an endemic region: the Camargue and the Plain of La Crau in France. In spring 2015 and 2016, we carried out sampling at stables (total n = 46) with a history of horses presenting chronic fever or weight loss. Overall, we collected blood from 632 horses, which were also inspected for ticks; these horses had been housed in the target stables for at least 1 year. We obtained 585 ticks from these horses and described land use around the stables. Real-time PCR was employed to assess T. equi and B. caballi prevalence in the horses and in the ticks found on the horses. For the horses, T. equi and B. caballi prevalence was 68.6% and 6.3%, respectively. For the ticks found on the horses, prevalence was 28.8% for T. equi and 0.85% for B. caballi. The most common tick species were, in order of frequency, Rhipicephalus bursa, R. sanguineus sl., Hyalomma marginatum, Haemaphysalis punctata, and Dermacentor sp. Horses bearing Rhipicephalus ticks occurred in wetter zones, closer to agricultural areas, permanent crops, and ditches, as well as in drier zones, in the more northern countryside. Compared to horses bearing R. bursa, horses bearing R. sanguineus sl. more frequently occurred near the Rhone River. Prevalence of T. equi in the ticks was as follows: Hyalomma marginatum (43%), Dermacentor sp. (40%), R. bursa (33%), R. sanguineus sl. (19%), and Haemaphysalis punctata (17%). In contrast, B. caballi only occurred in Dermacentor sp. (20%) and R. bursa (1%).

Trials were undertaken at two sites with contrasting soil types in the Wimmera region of Victoria: a well-structured grey cracking clay soil (Vertosol) at Traynors Lagoon and a poorly structured sodic clay soil (Sodosol) at Gre Gre. The effect of a once-off application of three different types of bedding litter (wheat straw and two types of rice hulls) applied at three rates (20, 30 and 40 t/ha) was compared with that of a control (no amelioration), nitrogen fertiliser (46 kg N/ha) applied to each crop, or nitrogen plus a once-off application of gypsum (2.5 t/ha). The growth of three subsequent crops and soil water was examined. Pig bedding litter (rice hulls 1, rice hulls 2 or wheat straw) produced marked improvements in the dry matter production and grain yield of the first crop (wheat) in 1997 and a following canola crop in 1998. In 1999, bedding litter significantly improved the growth of an oats crop at Gre Gre, but had no effect on a crop of field peas at Traynors Lagoon. The beneficial effects of bedding litter on grain yields, however, were matched by small but significant reductions in grain quality resulting from soil water limitations for the yield potential. Although crop growth was improved by the addition of nitrogen fertiliser each year or both nitrogen plus gypsum, the effect was usually small compared with that of adding litter and provided minimal residual value in the following year. There was a general trend for gravimetric soil water to be higher at sowing where bedding litter had been applied, especially at Gre Gre. In contrast, soil water tended to be lower at grain maturity at Traynors Lagoon, where bedding litter or nitrogen fertiliser had been applied, reflecting the enhanced crop growth in these treatments compared with the control. There was no consistent effect of treatments on soil water at maturity in either 1998 or 1999 at Gre Gre.

Phytophthora decline of riparian alder (Alnus spp.) has been reported in several European countries (2). Death of common alder (Alnus glutinosa) due to Phytophthora alni has also been reported in Spain (4). During several surveys of alder trees in September 2012, typical dieback symptoms, including sparse small yellowish foliage and the presence of rusty exudates on the bark at the collar and lower stem were observed in A. glutinosa growing on the banks of the river Tera (Langa de Duero, Soria, 41°36′34″ N, 3°25′10″ W, elevation 851 m) and the river Tormes (La Maya, Salamanca, 40°41′42″ N, 5°35′36″ W, elevation 833 m). Bark samples plus cambium were taken from the active lesions at collar region, cut into small pieces, dried on filter paper, and plated on V8-PARPH agar (2). The samples were incubated for 4 days at 20°C in the dark before obtaining the Phytophthora isolates. Colonies developed on V8 juice agar (V8A) had limited aerial mycelium at the center and displayed radiate and slightly chrysanthemum-like growth pattern. Mycelial growth was optimal at 25°C (radial growth rate, 8.2 mm d–1), whereas no growth was observed at 32°C. Isolates were homothallic with paragynous antheridia, smooth-walled spherical (very rarely elongated) oogonia (22.8 to 30.6 μm diam.) and both plerotic and aplerotic golden brown oospores (21.3 to 28.5 μm diam.). In non-sterile soil extracts, the isolates produced abundant sporangia (31.5 to 57.2 × 21.3 to 38.4 μm; length:breadth ratio 1.2 to 1.6) borne terminally on unbranched or sympodial sporagiophores, occasionally attached laterally to the sporangiophores. Sporagia were non-caducous, semipapillate, mainly ovoid and obpyriform, obovoid to limoniform but sometimes distorted with two apices. On the basis of the morpho-physiological features, the isolates resembled P. plurivora (formerly identified as P. citricola) (3). To confirm this, genomic DNA was extracted and subjected to PCR. The internal transcribed spacer (ITS) region of the rDNA was amplified using the ITS-6 (5′ GAAGGTGAAGTCGTAACAAGG 3′) and ITS-4 (5′ TCCTCCGCTTATTGATATGC 3′) primers before sequencing (Secugen, Madrid, Spain). The sequences were deposited in the EMBL/GenBank database (Accession Nos. KF413074 and KF413075). In order to perform the pathogenicity test, 10 A. glutinosa seedlings (2 years old) per isolate were inoculated by using the under-bark inoculation technique (1) and 10 control seedlings were inoculated with V8A. Seedlings were incubated in a growth chamber at 22.5°C with a 14-h photoperiod. Three months after inoculation, all inoculated plants wilted and died, whereas the control plants showed no disease symptoms. To fulfill Koch's postulates, the pathogen was re-isolated from the necrotic lesions developed around inoculation points, thus confirming its pathogenicity. P. plurivora has been found to be present in rhizosphere soil beneath Alnus spp. and to cause aerial canker and collar rot on alder trees in Austria, Germany, and Romania (2,3). Further studies and surveys are essential to determine the distribution, extent of damage, and potential interactions with other alder pathogens (e.g., P. alni). To our knowledge, this is the first record of P. plurivora affecting A. glutinosa in Spain. References: (1) T. Jung et al. Eur. J. For. Pathol. 26:253, 1996. (2) T. Jung and M. Blaschke. Plant Pathol. 53:197, 2004. (3) T. Jung and T. I. Burgess. Persoonia 22:95, 2009. (4) A. Solla et al. Plant Pathol. 59:798, 2010.

The old village of Ulvivok, located above the Bug River in Sokal district, Lviv region, is extremely rich with archaeological sites. Relief, favourable for living, fertile soils, large river have contributed to appearing of human settlements on this area since ancient times. This fact is witnessed by finds of numerous archaeological artifacts near Ulvivok and discovery of significant archaeological sites – cemeteries and settlements, which have an interesting history of research since the late XIX century and till nowadays, associated with many famous Lviv scientists. An important role in the preservation and study of local archaeological finds was played by Dzieduszycki Museum. The first references to finds from Ulvivok and the surrounding villages – Horodylovychi, Stargorod, Skomorokhy and Telyazh – are found at the works of local historian B. Sokalski and geologist A. Lomnitcki, published in 1899. J. Nykorovych – the owner of the village and amateur archaeologist contributed noticeably preservation and research of sites during XIX – beginning of XX century. The first extensive exploration in Ulvivok in 1923 was conducted by archaeologist and local historian, guardian of the prehistoric monuments of Lviv district B. Janusz, who discovered a tomb of Globular Amphorae culture and part of the burials of the most famous archaeological sites near Ulvivok – inhumation cemetery from the end of Bronze Age of “Ulvivok-Rovantsi type”. The same cemetery was investigated in 1931 by archaeologist T. Sulimirski, who published the results of excavations. Local archaeological finds were studied by famous Ukrainian archaeologist J. Pasternak, J. Bryk, K. Żurowski, J. Dąmbrowski, I. Sveshnikov, L. Krushelnytska. Nowadays, the exploration work was conducted by N. Wojceschuk, surveys in Ulvivok, Horodylovychi, Stargorod and excavation of Early Iron Age site were carried out by D. Pavliv. At least 14 archaeological sites (8 settlements and 6 cemeteries) and about 100 individual finds have been found on the territory of the village and surrounding area. This territory on the western part of Ukraine is extremely rich with archaeological sites of almost all epochs. It is witnessed by the great historical importance of this region and requires continuation of professional archaeological examinations and protective actions for the preservation of archaeological heritage. Key words: Ulvivok, archaeological site, Lviv scientists, Globular Amphorae culture, burial complex of Ulvivok-Rovantsi type.

ESTIMATIVA DA EVAPOTRANSPIRAÇÃO REAL E MAPEAMENTO DE ÁREAS CULTIVADAS EM UMA BACIA DO PROJETO DE INTEGRAÇÃO DO SÃO FRANCISCO (PISF), SEMIÁRIDO PERNAMBUCANO LIZANDRA DE BARROS DE SOUSA1; ABELARDO ANTÔNIO DE ASSUNÇÃO MONTENEGRO1; THIERES GEORGE FREIRE DA SILVA2; AILTON ALVES DE CARVALHO1 E MOISÉS ALVES DA SILVA NETO3 1 Departamento de Engenharia Agrícola (DEAGRI). Programa de Pós-Graduação em Engenharia Agrícola (PGEA). Universidade Federal Rural de Pernambuco (UFRPE). Rua Dom Manuel de Medeiros, S/N, Dois Irmãos, CEP: 52171-900, Recife/PE, Brasil. E-mail: lizandradebarros@gmail.com; montenegro.ufrpe@gmail.com; Ailtonalvesst@gmail.com. 2 Unidade Acadêmica de Serra Talhada (UAST). Universidade Federal Rural de Pernambuco (UFRPE). Avenida Gregório Ferraz Nogueira, S/N, José Tomé de Souza Ramos, CEP: 56909-535, Serra Talhada/PE, Brasil. E-mail: thigeoprofissional@hotmail.com. 3 Departamento de Engenharia Agrícola (DEAGRI). Universidade Federal Rural de Pernambuco (UFRPE). Rua Dom Manuel de Medeiros, S/N, Dois Irmãos, CEP: 52171-900, Recife/PE, Brasil. E-mail: moisesneto179@gmail.com. 1 RESUMO A região semiárida brasileira apresenta limitada disponibilidade de recursos hídricos, além disso, profundas alterações no uso e ocupação do solo estão previstas para ocorrer nas bacias hidrográficas de Pernambuco. Objetivou-se avaliar a evapotranspiração real e mapear áreas cultivadas por meio de sensoriamento remoto, utilizando, respectivamente, os modelos SAFER (Simple Algorithm for Evapotranspiration Retrieving) e SUREAL (Surface Resistance Algorithm), na Bacia do rio Terra Nova, em trecho perenizado. Imagens do satélite Landsat-8, de 2015 a 2020, foram selecionadas. Calculou-se: Índice de Vegetação da Diferença Normalizada (NDVI), albedo, temperatura de superfície, evapotranspiração de referência e evapotranspiração real. As imagens foram processadas no Google Earth Engine (GEE) e no software QGIS 3.16. Notou-se aumento no índice de cobertura vegetal. Regiões com maiores valores de evapotranspiração real estão ligadas àquelas com temperaturas mais baixas. Observou-se uma menor quantidade de áreas cultivadas no trecho do Rio Terra Nova nas imagens de 2015. Verificou-se o aumento da agricultura na região às margens desse rio, em seu trecho perenizado, de 29,5; 15,2; 7,7; 7,6; e 12,9 km² em 18/07/2016, 22/06/2018, 28/10/2018, 13/11/2018, e 20/12/2020, respectivamente. Além da intensidade de precipitação, a liberação das águas do PISF pode ter contribuído para o aumento de áreas irrigadas na região. Palavras-chave: sensoriamento remoto, agricultura irrigada, SAFER, SUREAL. SOUSA, L. B.; MONTENEGRO, A. A. A.; SILVA, T. G. F.; CARVALHO, A. A.; SILVA NETO, M. A. ESTIMATION OF ACTUAL EVAPOTRANSPIRATION AND MAPPING OF CULTIVATED AREAS IN A BASIN OF THE SÃO FRANCISCO INTEGRATION PROJECT (PISF), SEMIARID OF PERNAMBUCO STATE 2 ABSTRACT The Brazilian semi-arid region has limited availability of water resources, in addition, profound changes in land use and occupation are expected to occur in the river basins of Pernambuco. The objective was to evaluate the actual evapotranspiration and to map cultivated areas through remote sensing, using, respectively, the SAFER (Simple Algorithm for Evapotranspiration Retrieving) and SUREAL (Surface Resistance Algorithm) models, in the Terra Nova River Basin, in a perennial stretch. Landsat-8 satellite images from 2015 to 2020 were selected. The Normalized Difference Vegetation Index (NDVI), albedo, surface temperature, reference evapotranspiration, and actual evapotranspiration were calculated. Images were processed using the Google Earth Engine (GEE) platform and QGIS 3.16 software. There was an increase in the vegetation cover index. Regions with higher actual evapotranspiration values ​​are linked to those with lower temperatures. It was observed a smaller number of cultivated areas in the Terra Nova River stretch in the 2015 images. Also, it was verified an increase in agriculture in the riverside region along this, in its perennial stretch, of 29.5; 15.2; 7.7; 7.6; and 12.9 km² on 07/18/2016, 06/22/2018, 10/28/2018, 11/13/2018, and 12/20/2020, respectively. In addition to the intensity of precipitation, the release of PISF waters may have contributed to the increase in irrigated areas in the region. Keywords: remote sensing, irrigated agriculture, SAFER, SUREAL.

In the Republic of Altai, there are about 7 thousand lakes with a total area of more than 600 km2 and most of them are practically unexplored. Despite the fact that botanical research has been carried out on the territory of the Republic of Altai for a rather long period and generalizing works have been published, the aquatic flora of the region has not been fully studied. This work presents a processed part of the data on floristic findings obtained during hydrobotanical research in lakes of the Altai Mountains. We completed the fieldwork in the first half of July 2018. 12 lakes located in UstKanskii, Ongudayskii, Ulaganskii and Kosh-Agachskii districts, as well as several small roadside water bodies were surveyed by the route method using an inflatable boat. In the course of the work, we used hydrobotanical cat-rakes, a portable Garmin eTrex Vista navigator (with a GPS receiver), and a Pentax waterproof camera. Mineralization measurements were carried out in the surface layer of water using a Hanna HI 98130 portable conductometer-thermometer-pH meter. To determine the plants, we used an Altami PS0745-T stereoscopic microscope with a camera. Herbarium specimens were transferred to the NSK Herbarium of the Central Siberian Botanical Garden of the Siberian Branch, Russian Academy of Sciences. During our hydrobotanical reseach on a number of water bodies of the Altai Republic, we discovered five species that had not been previously indicated for this region. Utricularia macrorhiza Le Conte. Localities: 1) Ust-Kanskii district, environs of Ust-Kan village, the Kan river floodplain, 50°56'50.64''N. 84°48'25.49''E, 04 VII 2018, forms communities (see Fig. 1); 2) in the same place, 7 km east of the village of Ust-Kan, lake Yaboganskoye. 50°55'33.67''N 84°52'47.85''E, mineralization 0.34 g/dm3 , 05 VII 2018, forms communities; 3) in the same place, 2 km north-west of Oro village, Bolshaya Shiverta river, 50°55'33.95''N 84°58'35.64''E, mineralization 0.31 g/dm3 , 05 VII 2018, forms communities, NSK0084776; 4) Ongudayskii district, Tenginskoye lake, 50°55'59.39''N 85 ° 33'44.32''E, mineralization 0.19 g/dm3 , 06 VII 2018, forms communities; 5) Kosh-Agachskii district, lake Bolshoye, 49°59'27.10''N 88°35'23.10''E, 12 VI 2018. Ranunculus subrigidus W.B. Drew. Localities: 1) Ulaganskii district, pond of the unfinished Chuya hydroelectric power station, 50°15'11.80''N 87°39'42.63''E, mineralization 0.08 g/dm3 , 10 VII 2018; 2) Kosh-Agachskii district, Kosh-Agach village, in a lake without a name, 50°15'10.6''N 87°39'47.5''E, 13 VII 2018; 3) in the same place, lake Presnoe, depth 20 cm, forms a community, 49°59'2.75''N 88°34'53.30''E, mineralization 0.14 g/dm3 , 11 VII 2018, NSK0084774; 4) in the same place, lake Bolshoye, 12 VII 2018. Lemna turionifera Landolt. Localities: 1) Ust-Kanskii district, lake Bukalu, 50°57'54.04''N 84°46’46.75''E, mineralization 0.45 g/dm3 , 05 VII 2018; 2) KoshAgachskii district, lake Presnoe, 49°59'6.49''N 88°34'53.19''E, mineralization 0.14 g/ dm3 , 11.VII 2018, NSK0084775; 3) in the same place, lake Bolshoye, 49°59'27.10''N 88°35'23.10''E, 12 VII 2018. Zannichellia repens Boenn. Localities: 1) Ust-Kanskii district, quarry near the road, depth 40 cm, in Chara vulgaris L. community, 50°56'33.26''N 85°01'14.55''E, mineralization 0.43 g/dm3 , 06 VII 2018; 2) Ongudayskii district, ditch by the road, 50°47'22.34''N 85°21'33.05''E, forms a community, depth 20 cm, viscous clay, mineralization 0.88 g/dm3 , 06 VII 2018, NSK0084778. Stuckenia chakassiensis (Kasсhina) Klinkova. Localities: 1) Kosh-Agachskii district, an unnamed lake by the road, 49°57’14.33''N 88°43’49.41''E, mineralization 2.7 g/dm3 , 12 VII 2018, NSK0084777; 2) in the same place, lake Solyenoye, 49°58’58.07''N 88°34’18.85''E, mineralization 0.75 g/dm3 , 11 VII 2018. Thus, the list of flora of the Republic of Altai was replenished with five more species Utricularia macrorhiza, Ranunculus subrigidus, Lemna turionifera, Zannichellia repens and Stuckenia chakassiensis. We found the first three species in fresh waters, and Z. repens and S. chakassiensis in brackish waters. All these findings supplement information on the distribution of these species in Siberia. Utricularia macrorhiza, Ranunculus subrigidus and Lemna turionifera are predominantly American-Asian species, Stuckenia chakassiensis is, mainly, an Asian one.

Abstract. The accelerated decline in Arctic sea ice combined with an ongoing trend toward a more dynamic atmosphere is modifying carbon cycling in the Arctic Ocean. A critical issue is to understand how net community production (NCP; the balance between gross primary production and community respiration) responds to changes and modulates air–sea CO2 fluxes. Using data collected as part of the ArcticNet-Malina 2009 expedition in southeastern Beaufort Sea (Arctic Ocean), we synthesize information on sea ice, wind, river, water column properties, metabolism of the planktonic food web, organic carbon fluxes and pools, as well as air–sea CO2 exchange, with the aim of identifying indices of ecosystem response to environmental changes. Data were analyzed to develop a non-steady-state carbon budget and an assessment of NCP against air–sea CO2 fluxes. The mean atmospheric forcing was a mild upwelling-favorable wind (~5 km h−1) blowing from the N-E and a decaying ice cover (<80% concentration) was observed beyond the shelf, the latter being fully exposed to the atmosphere. We detected some areas where the surface mixed layer was net autotrophic owing to high rates of primary production (PP), but the ecosystem was overall net heterotrophic. The region acted nonetheless as a sink for atmospheric CO2 with a mean uptake rate of −2.0 ± 3.3 mmol C m−2d−1. We attribute this discrepancy to: (1) elevated PP rates (>600 mg C m−2d−1) over the shelf prior to our survey, (2) freshwater dilution by river runoff and ice melt, and (3) the presence of cold surface waters offshore. Only the Mackenzie River delta and localized shelf areas directly affected by upwelling were identified as substantial sources of CO2 to the atmosphere (>10mmol C m−2d−1). Although generally <100 mg C m−2d−1, daily PP rates cumulated to a total PP of ~437.6 × 103 t C, which was roughly twice higher than the organic carbon delivery by river inputs (~241.2 × 103 t C). Subsurface PP represented 37.4% of total PP for the whole area and as much as ~72.0% seaward of the shelf break. In the upper 100 m, bacteria dominated (54%) total community respiration (~250 mg C m−2d−1), whereas protozoans, metazoans, and benthos, contributed to 24%, 10%, and 12%, respectively. The range of production-to-biomass ratios of bacteria was wide (1–27% d−1), while we estimated a narrower range for protozoans (6–11% d−1) and metazoans (1–3 % d−1). Over the shelf, benthic biomass was twice higher (~5.9 g C m−2) than the biomass of pelagic heterotrophs (~2.4 g C m−2), in accord with high vertical carbon fluxes on the shelf (956 ± 129 mg C m−2d−1). Threshold PP (PP at which NCP becomes positive) in the surface layer oscillated from 20–152 mg C m−2d−1, with a pattern from low-to-high values as the distance from the Mackenzie River decreased. We conclude that: (1) climate change is exacerbating the already extreme biological gradient across the Arctic shelf-basin system; (2) the Mackenzie Shelf acts as a weak sink for atmospheric CO2, implying that PP exceeds the respiration of terrigenous and marine organic matter in the surface layer; and (3) shelf break upwelling can transfer CO2 to the atmosphere, but massive outgassing can be attenuated if nutrients brought also by upwelling support diatom production. Our study underscores that cross-shelf exchange of waters, nutrients and particles is a key mechanism that needs to be properly monitored as the Arctic transits to a new state.

APLICABILIDADE DO MODELO HIDROLÓGICO SWAT NA BACIA HIDROGRÁFICA DO RIO PARAIBUNA, SP - BRASIL CAIO VINICIUS FERREIRA MARMONTEL¹; TERESA CRISTINA TARLÉ PISSARRA²; MAURÍCIO RANZINI³ E VALDEMIR ANTONIO RODRIGUES4 ¹Departamento de Ciência Florestal, Faculdade de Ciências Agronômicas, Universidade Estadual Paulista “Júlio de Mesquita Filho”, Avenida Universitária, nº 3780, Altos do Paraíso, CEP 18610-034,Botucatu-SP, Brasil, caioomarmontel@gmail.com ²Departamento de Engenharia Rural, Faculdade de Ciências Agrárias e Veterinárias, Universidade Estadual Paulista “Júlio de Mesquita Filho”, Via de Acesso Profº. Paulo Donato Castellane s/n, Altos do Paraíso, CEP 18610-034, Jaboticabal-SP, Brasil, teresap1204@gmail.com ³Seção de Engenharia Florestal, Divisão de Dasonomia, Instituto Florestal do Estado de São Paulo, Rua do Horto, 931, Altos do Paraíso, CEP 18610-034, São Paulo-SP, Brasil, ranzini@gmail.com 4Departamento de Ciência Florestal, Faculdade de Ciências Agronômicas, Universidade Estadual Paulista “Júlio de Mesquita Filho”, Avenida Universitária, nº 3780, Altos do Paraíso, CEP 18610-034, Botucatu-SP, Brasil, valdemirrodrigues@fca.unesp.br 1 RESUMO A água disponível para o consumo humano vem se tornando cada vez mais escassa. Diante desse problema, uma possibilidade de melhorar a compreensão do comportamento hidrológico, é a utilização de tecnologias, em especial a integração do SIG com a modelagem hidrológica. O presente estudo teve como objetivo testar a aplicabilidade do modelo hidrológico SWAT para estimação de vazões em um trecho da bacia hidrográfica do rio Paraibuna - Vale do Paraíba, região da Mata Atlântica, um dos formadores do rio Paraíba do Sul. Os dados climáticos e fluviométricos foram coletados com uma série histórica de 22 anos. Na calibração e validação verificou-se boa aderência entre os dados simulados e observados, ou seja, os valores simulados reconheceram os picos e recessões dos valores observados. Os índices estatísticos (NS, PBIAS, RSR e R²) calculados foram qualificados como “muito bom” para a estimação das vazões. Os resultados confirmaram a aplicabilidade do modelo, dessa forma, pode servir como ferramenta para planejamento e gestão de políticas públicas dos recursos hídricos em bacias hidrográficas, na região da Mata Atlântica. O modelo hidrológico SWAT mostrou-se muito bom e apto para estimação de vazões e do balanço hídrico na área de estudo. Palavras-chave: água, calibração, mata atlântica, validação, vazão MARMONTEL, C. V. F.; PISSARRA, T. C. T.; RANZINI, M. E RODRIGUES, V. A. APPLICABILITY OF THE SWAT HYDROLOGICAL MODEL IN PARAIBUNA RIVER BASIN, SP – BRAZIL 2 ABSTRACT The water available for human consumption is becoming increasingly scarce. Faced with this problem, one possibility to improve the understanding of water behavior, is the use of technologies, particularly the integration of GIS with hydrological modeling. The present study is intended to test the applicability of SWAT hydrological model for flow estimation in the stretch of Paraibuna river basin - Paraiba Valley, in the Atlantic Forest region, in the state of São Paulo, one of the tributaries of Paraíba do Sul river. Climatic and fluviometric data were collected with a historical series of 22 years. In the calibration and validation, good adherence was observed across simulated and observed data, that is, the simulated values recognized the peaks and recessions of the observed values. The statistical indices (NS, PBIAS, RSR and R²) calculated were qualified as "very good" for the estimation of flows. The results confirmed the applicability of the model, so it can serve as a tool for planning and management of water resources public policies in watersheds, in the Atlantic Forest region. The SWAT hydrological model was very good and suitable for estimation of flow and water balance in the stretch of the Paraibuna river basin. Keywords: water, calibration, forest hydrology, atlantic forest, validation, discharge

Tilia genus in Siberia is a relict element of flora which grows as isolated plots. Some authors consider Siberian lime as Tilia sibirica Bayer. Two small lime populations near Krasnoyarsk have been described as a separate species Tilia nasczokinii Stepanov. Both T. sibirica and T. nasczokinii retain the ambiguous status in the modern international nomenclature of plants. The facts concerning the presence of a number of relict nemoral species among T. nasczokinii satellites indicate the relict origin of its populations. Recent investigations have ascertained that T. nasczokinii species is essentially genetically removed both from T. cordata and T. sibirica. This confirms the relict origin of the populations. The aim of our investigation is to determine the number of lime plants and their sizes, to find out the ontogenetic structure and reproduction character of relict T. nasczokinii populations and to estimate the vitality of the plants. T. nasczokinii populations are located on different banks of the Yenisei River. The fist population is on the left bank (from 55°57'34''N, 92°28'07''E to 55°57'51''N, 92°30'10''E) and the second one is on the right bank (55°57'26''N, 92°46'41''E) (See Fig. 1). We made a general geobotanical description of phytocenosis. The ontogenetic status was determined for each T. nasczokinii plant. The sizes (height and diameter at 1.3 m) and the vital status were established for virginile and generative plants. In order to assess the contribution of vegetative and seed reproduction, we calculated the index of genotypic richness R (Dorken, Eckert, 2001) and clonal heterogeneity D* (Arnaud-Haond et al., 2007) using the GenClone v2.0 program (Arnaud-Haond and Belkhir, 2007) on the basis of genotype analysis of 11 polymorphic nuclear microsatellite loci (Ekart et al., 2021). Also, we determined the number of unique multy-locus genotypes (MLG) in every population. As a result of our research, 305 T. nasczokinii plants were found in the left bank population (39 of them are large trees, others belong to the undergrowth) and 196 plants (30 from them are rather large) on the right bank. T. nasczokinii is a part of pine and pine-birch forests with Carex macroura Meinsh. and other grasses which have the average closeness of crowns (0.55-0.65). On the right bank, all the lime trees grow on the area of 1.5 ha. On the left bank, they are located on the area of 370 ha as individual trees or as groups up to 7 big trees and 5-96 small plants. The distance between the groups is rather long: from 500 to 1000 m. It is demonstrated that both investigated populations have a similar ontogenetic structure (See Fig. 2). Juvenile and immature plants occupy the biggest part (84% on the left bank and 77% on the right). Not many current year sprouts were found both on the left (2%) and on the right bank (8%). As it is typical for the lime, senile plants were practically absent (only one plant was found on the left bank). The calculated indexes R and D* were rather high (0.731 and 0.987 in general for both populations). We showed that most of the analyzed plants are not the parts of clones but there are some clones with a few ramets. In the left bank population, from 77 analyzed individuals we recognized 61 unique MLG and 10 (16.4%) of them have 2-5 ramets. On the right bank, 32 individuals were analyzed and among 19 MLG there were 3 (15.8%) clones with 2, 5 and 9 ramets. The genotypic diversity of T. nasczokinii is higher than that of T. sibirica in Kemerovo region (R=0.661) but slightly lower than that of T. cordata (R=0.938). The high genotypic diversity demonstrates the significant role of seeds in the self-reproduction of T. nasczokinii populations. The contribution of vegetative reproduction is also considerable (33.8% on the left and 50% on the right banks). It turns out that the sizes of virginile trees in both populations are very close (See Table), the differences in the average values are insignificant at p=0.05. The generative trees in the left bank population are higher than in the right bank population, and they are rather close in diameter. In general, for both populations the virginile trees have the average height of 6.0±0.31 m and trunk diameter of 5.1±0.32 cm, with the generative trees being 13.7±0.71 m and 12.2±0.56 cm, accordingly. Individuals of these groups have the habitus of single-stemmed (56.4% on the left and 73.3% on the right bank) and bush-like trees (See Fig. 3). T. nasczokinii is much smaller than both T. sibirica and T. cordata. The large part (58% on the left bank and 77% on the right) of T. nasczokinii trees has the vitality status “healthy” (See Fig. 4). Thus, both T. nasczokinii populations are characterized by the normal ontogenetic structure with the complete left-handed spectrum. They are able to reproduce both by seeds and by vegetative organs. The existence of unique T. nasczokinii populations is possible only if the natural phytocenosis with its participation is preserved.

This work comprehensively investigated the constituents, sources, and associated health risks of ambient volatile organic compounds (VOCs) sampled during the autumn of 2020 in urban Nanjing, a megacity in the densely populated Yangtze River Delta region in China. The total VOC (TVOC, sum of 108 species) concentration was determined to be 29.04 ± 14.89 ppb, and it was consisted of alkanes (36.9%), oxygenated VOCs (19.9%), halogens (19.1%), aromatics (9.9%), alkenes (8.9%), alkynes (4.9%), and others (0.4%). The mean TVOC/NOx (ppbC/ppbv) ratio was only 3.32, indicating the ozone control is overall VOC-limited. In terms of the ozone formation potential (OFP), however, the largest contributor became aromatics (41.9%), followed by alkenes (27.6%), and alkanes (16.9%); aromatics were also the dominant species in secondary organic aerosol (SOA) formation, indicative of the critical importance of aromatics reduction to the coordinated control of ozone and fine particulate matter (PM2.5). Mass ratios of ethylbenzene/xylene (E/X), isopentane/n-−pentane (I/N), and toluene/benzene (T/B) ratios all pointed to the significant influence of traffic on VOCs. Positive matrix factorization (PMF) revealed five sources showing that traffic was the largest contributor (29.2%), particularly in the morning. A biogenic source, however, became the most important source in the afternoon (31.3%). The calculated noncarcinogenic risk (NCR) and lifetime carcinogenic risk (LCR) of the VOCs were low, but four species, acrolein, benzene, 1,2-dichloroethane, and 1,2-dibromoethane, were found to possess risks exceeding the thresholds. Furthermore, we conducted a multilinear regression to apportion the health risks to the PMF-resolved sources. Results show that the biogenic source instead of traffic became the most prominent contributor to the TVOC NCR and its contribution in the afternoon even outpaced the sum of all other sources. In summary, our analysis reveals the priority of controls of aromatics and traffic/industrial emissions to the efficient coreduction of O3 and PM2.5; our analysis also underscores that biogenic emissions should be paid special attention if considering the direct health risks of VOCs.

Bermudagrass (Cynodon dactylon) is an important warm-season perennial turf and forage grass that is typically grown in warm, tropical and subtropical climates. Smutted inflorescences of bermudagrass were observed and collected in Benton County, Washington, United States, in October of 2012 in an unmanaged, naturalized area located near the banks of the Columbia River and adjacent to large expanses of managed turf containing bermudagrass. The climate in this area is favorable to bermudagrass due to the relatively mild winters and hot, dry summers that usually occur in this region. The infected plants occurred in patches alongside healthy plants and several disease foci were observed along a 100-m transect of non-contiguous bermudagrass. The disease was severe wherever it occurred. Diseased inflorescences were covered with black-brown teliospores, distorted, and frequently failed to fully emerge and develop. Teliospores (n = 80) were irregularly globose to subglobose, 5.3 to 7.0 × 4.5 to 6.2 μm (mean 6.4 × 5.9 μm) and 6.2 to 8.8 × 5.3 to 7.0 μm (mean 7.0 × 6.5 μm), with a smooth wall approximately 1 μm thick, and were consistent with previous descriptions of Ustilago cynodontis teliospores (1,3). Teliospores germinated within 24 h when plated on 0.2% malt agar at 16°C and produced 4-celled basidia in a 3+1 arrangement, also consistent with U. cynodontis (3). Basidia gave rise to lateral and terminal, ovoid to long ellipsoidal basidiospores. Basidiospores budded or germinated by hyphae from which lateral or terminal aerial sporidia developed as previously described (3,4). DNA was extracted from sporidia of three single-spored isolates grown in malt extract broth. Complete nucleotide sequences of the 5.8S ribosomal RNA coding region and partial sequences of the internal transcribed spacer (ITS) regions 1 and 2 were obtained from the three isolates using ITS1 and ITS4 primers. The corresponding regions of the three aligned sequences (GenBank Accession Nos. KC920742 to KC920744) were identical and exhibited 99 to 100% identity with U. cynodontis strains previously deposited in GenBank (HM143013, AY740168, AF038825, and AY345000). Representative specimens were deposited in the WSU Mycological Herbarium as WSP 72345 to WSP 72348. This is the first report of U. cynodontis causing smut on bermudagrass in Washington State and represents the northernmost record of this fungus in North America (2). The occurrence of U. cynodontis in Washington State suggests that the pathogen may exist in other hot and dry areas of northwestern North America where bermudagrass is found associated with turf in recreational, landscape, or natural settings. References: (1) S. D. Brook. Trans. R. Soc. N. Z. 84:643, 1957. (2) D. F. Farr and A. Y. Rossman. Fungal Databases, Systematic Mycology and Microbiology Laboratory, ARS, USDA. Online. Retrieved from http://nt.ars-grin.gov/fungaldatabases , April 18, 2013. (3) C. T. Ingold. Trans. Br. Mycol. Soc. 83:251, 1984. (4) C. T. Ingold. Trans. Br. Mycol. Soc. 89:471, 1987.

The article considers the influence of atmospheric precipitation in the form of dust and dry residue with rain and snow in the formation of technogenic situations in the soils of the Belarusian Polesye. Anthropogenic impact on the soil is formed as a result of entering into the soil of technogenesis product, is made up of atmospheric precipitation in the form of dust and rain, as well as key components of chemical reclamation (Ca, Mg, K, N, P) of soil. Based on field research and data of the Hydrometeorological Service of Belarus there was generalized the information and disclosed the regularities of dust deposition and mineral residue precipitation in Belarusian Polesye. Mapping the anthropogenic impact on the soil was performed using software packages ESRI ArcView and ESRI ArcGIS. It is set a noticeable spatial heterogeneity in the level of anthropogenic impact on the soil of the Belarusian Polesye, ranging from 6,3 t/ha per year in the district of Gantsevichi to 17,6 t/ha in Malorita district, Brest region. There is a general tendency of increasing of the given parameter in the direction from north-east to south-west of Polesye. The level of anthropogenic impact is largely dependent on natural (soil properties and structure of the soil) and economic (level of development and specialization of industry and agriculture) factors. The lowest value of the anthropogenic impact (less than 7,5 t/ha per year) is characteristic for areas with underdeveloped industry and a high proportion of drained peat soils: Gantsevichi, Oktyabrsky, Narovlya and Zhitkovichi. For the western part of the Belarusian Polesye (Malorita, Stolin, Ivanovo, Berezovsky, Drogichin areas) other than large areas of sandy soils, characterized by increased loads on agropochvy (12,1 or more t/ha per year), the largest contribution falls on the organic fertilizers. Technogenic situation in the soils was estimated based on the amount of annual agrotechnogenic load on the soil, air emissions from stationary sources and the level of radioactive contamination, formed as a result of the Chernobyl accident. As a result, we allocated favorable, satisfactory, conflict, tension, and critical situation. Favorable technogenic situation is typical for soils under forests and within specially protected areas (national parks and nature reserves) with anthropogenic load of less than 1 t/ha, not contaminated and distant from industrial centers. Such conditions correspond to 15 % of the Belarusian Polesye near major rivers and their tributaries in the region (the area between the Dnieper and the Sozh, the middle flow for the Pripyat and its tributaries Sluch, Yaselda, Ubort). A satisfactory situation has developed for 28,5 % of the territory, mainly within the northern part of the Pripyat Polesye due to a moderate level of anthropogenic pressure, in part – in the border of forest and wetland areas due to contamination with radionuclides. The conflict situation is typical for the northern part of Brest and Mozyr Polesye, on the right bank of the Dnieper and Berezina rivers, as well as in the area between Pina and Goryn rivers (27,7 %). In the southern part of the Brest Polesye, as well as in the countryside and along the Goryn river valley there is a tense situation (22,2 %), due to high anthropogenic pressure and intensive agricultural activities, in the latter case – also complicated by radioactive contamination. Critical man-made situation (7 %), which is observed in the south-east of Polesye, is due to high levels of radioactive contamination within the Polesye State Radiation Ecological Reserve and adjacent areas, despite the relatively low levels of air and agrotechnogenic pollution.

Can Gio mangrove forest (CGM) is located downstream of Ho Chi Minh City (HCMC), situated between an estuarine system of Dong Nai - Sai Gon river and a part of Vam Co river. The CGM is the largest restored mangrove forest in Vietnam and the UNESCO’s Mangrove Biosphere Reserve. The CGM has been gradually facing to numeric challenges of global climate change, environmental degradation and socio-economic development for the last decades. To evaluate sediment quality in the CGM, we collected 13 cores to analyze for sediment grain size, organic matter content, and trace element concentration of Cd, Cr, Cu, Ni, Pb, Zn. Results showed that trace element concentrations ranged from uncontaminated (Cd, Cu, and Zn) to very minor contaminated (Cr, Ni, and Pb). The concentrations were gradually influenced by suspended particle size and the mangrove plants.ReferencesAnh M.T., Chi D.H., Vinh N.N., Loan T.T., Triet L.M., Slootenb K.B.-V., Tarradellas J., 2003. Micropollutants in the sediment of Sai Gon – Dong Nai rivers: Situation and ecological risks. Chimia International Journal for Chemistry, 57, 09(0009–4293), 537–541.Baruddin N.A., Shazili N.A., Pradit S., 2017. Sequential extraction analysis of heavy metals in relation to bioaccumulation in mangroves, Rhizophora mucronata from Kelantan delta, Malaysia. AACL Bioflux, 10(2), 172-181. Retrieved from www.bioflux.com/aacl.Bravard J.-P., Goichot M., Tronchere H., 2014. An assessment of sediment transport processes in the lower Mekong river based on deposit grain size, the CM technique and flow energy data. Geomorphology, 207, 174-189.Cang L.T., Thanh N.C. 2008. Importing and exporting sediment to and from mangrove forest at Dong Trang estuary, Can Gio district, Ho Chi Minh city. Science & Technology Development, 11(04), 12-18.Carignan J., Hild P., Mevelle G., Morel J., Yeghicheyan D., 2001. Routine analyses of trace elements in geological samples using flow injection and low-pressure on-line liquid chromatography coupled to ICP-MS: A study of geochemical reference materials BR, DR-N, UB-N, AN-G and GH. The Journal of Geo standard and Geoanalysis, 187-198.Carlson P.R., Yarbro L.A., Zimmermann C.F., Montgomery J.R., 1983. Pore water chemistry of an overwash mangrove island. Academy Symposium: Future of the Indian River System, 46(3/4), 239-249. https://www.jstor.org/stable/24320336.Chatterjee M., Canário J., Sarkar S.K., Branco V., Godhantaraman N., Bhattacharya B.D., Bhattacharya A., 2012. Biogeochemistry of mercury and methylmercury in sediment cores from Sundarban mangrove wetland, India—a UNESCO World Heritage Site. Environ Monit Assess, 184, 5239–5254.Claudia R., Huy N.V., 2004. Water allocation policies for the Dong Nai river basin in Viet Nam: An integrated perspective. EPTD Discussion Paper, 127, 01-52.Folk R.L., Ward W.C., 1957. Brazos River bar: A study in the significance of grain size parameters. Journal of Sedimentary Petrology, 27(1), 3-26.Furukawaa K., Wolanski E., Mueller H., 1997. Currents and sediment transport in mangrove forests. Estuarine, Coastal and Shelf Science, 44, 301-310.Hai H.Q., Tuyen N.N., 2011. Coastal Erosion of Can Gio district Ho Chi Minh City due to the global climate change. The journal of development of technology and science, 14, 17-28.HCM SO S.O., 2015. Annual statistic data in 2015 for HCM city. Ho Chi Minh city: Statistic office of HCM city.HCMC, 2017. Decision No. 3901 on approving the areas of forest and land in HCM city in 2016. Ho Chi Minh: The people's committee of HCM city.Herut B., Sandler A., 2006. Normalization methods for pollutants in marine sediments: review and recommendations for the Mediterranean. Haifa 31080: Israel Oceanographic & Limnological Research: IOLR Report H18/2006.Hong P.N., San H.T., 1993. Mangroves of Vietnam: Chapter VI Human impacts on the mangrove ecosystem. Bangkok 10501: IUCN - The International Union for Conservation of Nature, ISBN: 2-8317-0166-x.Hubner R., Astin K.B., Herbert R.J., 2009. Comparison of sediment quality guidelines (SQGs) for the assessment of metal contamination in marine and estuarine environments. Journal of Environmental Monitoring, 11, 713–722.IAEA, 2003. Collection and preparation of bottom sediment samples for analysis of radionuclides and trace elements. Vienna, Austria: International Atomic Energy Agency, IAEA-TECDOC-1360, ISBN 92–0–109003–X.Jingchun L., Chongling Y., Ruifeng Z., Haoliang L., Guangqiu Q., 2008. Speciation changes of Cd in mangrove (Kandelia Candel L.) rhizosphere sediments. Bull Environ Contam Toxicol, 231-236. Doi:10.1007/s00128-007-9351-z.Kalaivanan R., Jayaprakash M., Nethaji S., Arya V., Giridharan L., 2017. Geochemistry of Core Sediments from Tropical Mangrove Region of Tamil Nadu: Implications on Trace Metals. Journal of Earth Science & Climatic Change, ISSN: 2157-7617., 8(1.1000385), 1-10. Doi:10.4172/2157-7617.1000385.Kathiresan K., Saravanakumar K., Mullai P., 2014. Bioaccumulation of trace elements by Avicennia marina. Journal of Coastal Life Medicine, 2(11), 888-894.Kitazawa T., Nakagawa T., Hashimoto T., Tateishi M., 2006. Stratigraphy and optically stimulated luminescence (OSL) dating of a Quaternary sequence along the Dong Nai River, southern Vietnam. Journal of Asian Earth Sciences, 27, 788–804.Lacerda L.D., 1998. Trace metals of biogeochemistry and diffuse pollution in mangrove (M. Vannucci, Ed.) Mangrove ecosystem occassional papers (ISSN: 0919-1348), 2, 1-72.Laura H., Probsta A., Probsta J.L., Ulrich E., 2003. Heavy metal distribution in some French forest soils: evidence for atmospheric contamination. The Science of Total Environment, 195-210.Li R., Li R., Chai M., Shen X., Xu H., Qiu G., 2015. Heavy metal contamination and ecological risk in Futian mangrove forest sediment in Shenzhen Bay, South China. Marine Pollution Bulletin, 101, 448–456.Long E., Morgan L.G., 1990. The potential for biological effects of sediment-sorted contaminants tested in the national status and trends program. Seattle, Washington: NOAA Technical Memorandum NOS OMA 52.Long E.R., Field L.J., MacDonald D.D., 1998. Predicting toxicity in marine sediments with numerical sediment quality guidelines. Environmental Toxicology and Chemistry, 17, 714–727. http://onlinelibrary.wiley.com/doi/10.1002/etc.5620170428/abstract;jsessionid=C5264A1AD0.7ACCA9B4EF9A088BE2EDE9.f04t04Long E.R., MacDonald D.D., Smith S.L., Calder F.D., 1995. Incidence of adverse biological effects within ranges of chemical concentration in marine and estuarine sediments. Environmental management, 19, 81-97.Maiti S.K., Chowdhury A., 2013. Effects of Anthropogenic Pollution on Mangrove Biodiversity: A Review. Journal of Environmental Protection, 4, 1428-1434.Marchand C., Allenbach M., Lallier-Verges E., 2011. Relation between heavy metal distribution and organic matter cycling in mangrove sediments (Conception Bay, New Caledonia). Geoderma, Elsevier, 160 (3-4), 444-456.Mohd F.N., Nor R.H., 2010. Heavy metal concentrations in an important mangrove species, Sonneratia caseolaris, in Peninsular Malaysia. Environment Asia, 3, 50-53.Muller G., 1979. Schwermetalle in den Sedimenten des Rheins - Veränderungen seit 1971. Umschau, 778-783.Nam V.N., 2007. Restoration of Can Gio mangrove forest: Its structure and function in comparison between the ecosytems of plantion and nature mangrove forest. Workshop on the thesis between Germany and Vietnam.Nickerson N.H., Thibodeau F.R., 1985. Association between pore water sulfide concentrations and the distribution of mangroves. Biogeochemistry, 1, 183-192.Ong Che R.G., 1999. Concentration of 7 Heavy Metals in Sediments and Mangrove Root Samples from Mai Po, Hong Kong. Marine Pollution Bulletin, 39, 269-279.Passega R., 1957. Texture as characteristics of clastic deposition. Publisher: American Association of Petroleum Geologists.Passega R., 1964. Grain size representation by CM patterns as a geological tool. J Sediment Petrol, 34, 830–847.Phuoc V.L., An D.T., Cang L.T., Chung B.N., Tien N.V., 2010. Study the sediment dynamics in Can Gio mangrove forest (Nang Hai site, Ho Chi Minh city). Ho Chi Minh city: The final report of National University Ho Chi Minh city, No. B2009-18-36.Pumijumnong N., Danpradit S., 2016. Heavy metal accumulation in sediments and mangrove forest stems from Surat Thani province, Thailand. The Malaysian forester, 79(1&2), 212-228.QCVN43:2012/BTNMT, 2012. QCVN43:2012/BTNMT: National technical regulation on the sediment quality, Ha Noi: Ministry of natural resources and environment of Vietnam.Qiao S., Shi X., Fang X., Liu S., Kornkanitnan N., Gao J., Yu Y., 2015. Heavy metal and clay mineral analyses in the sediments of Upper Gulf of Thailand and their implications on sedimentary provenance and dispersion pattern. Journal of Asian Earth Sciences, 114, 488–496.Rollinson H. R., 1993. Using geochemical data for evaluation, presentation and interpretation. UK: Longman Group UK Limited ISBN-0-582-06701-4.Spalding M., Blasco F., Field C., 2010. World atlas of mangrove. Cambridge: Earthscan in UK and US, ISBN: 978-1-84407-657-4.Strady E., Dang V.B., Némery J., Guédron S., Dinh Q.T., Denis H., Nguyen P.D., 2016. Baseline seasonal investigation of nutrients and trace metals in surface waters and sediments along the Saigon River basin impacted by the megacity of HCM, Viet Nam. Environ Sci Pollut Res, 1-18. doi:10.1007/s11356-016-7660-7.Tam N.F., Wong Y.S., 1996. Retention and distribution of heavy metals in mangrove soils receiving wastewater. Environment pollution, 94(5), 283-291.Thomas N., Lucas R., Bunting P., Hardy A., Rosenqvist A., Simard M., 2017. Distribution and drivers of global mangrove forest change, 1996– 2010. PLoS ONE, 12(6): e0179302, 1-14. Doi:10.1371/journal.pone.0179302.Thuy H.T., Loan T.T., Vy N.N., 2007. Study on environmental geochemistry of heavy metals in urban canal sediments of Ho Chi Minh city. Science and Technology Development, 10(01), 1-9.Toan T.T., Bay N.T., 2006. A study on the tendency of accretion and erosion in Can Gio coastal zone. Vietnam-Japan estuary workshop, 184-194.Tri N.H., Hong P.N., Cuc L.T., 2000. Can Gio Mangrove Biosphere Reserve Ho Chi Minh city, Ha Noi, Viet Nam. Ha Noi: Hanoi University Publisher.Truong T.V., 2007. Planning for water source of Dong Nai river basin. Retrieved from Water Resources Planning: http://siwrp.org.vn/tin-tuc/quy-hoach-tai-nguyen-nuoc-luu-vuc-song-dong-nai_143.html.Tuan L.D., Oanh T.T., Thanh C.V., Quy N.D., 2002. Can Gio mangrove biosphere reserve. HCM city, Vietnam: Agriculture Publisher.Tue N.T., Quy T.D., Amono A., 2012. Historical profiles of trace element concentrations in Mangrove sediments from the Ba Lat estuary, Red river, Vietnam. Water, Air & Soil Pollution, ISSN 0049-6979, 223(3), 1315-1330.Twilley R., Chen R., Hargis T., 1992. Carbon sinks in mangroves and their implications to carbon budget of tropical coastal ecosystems. Water, Air & Soil pollution, Netherland, 64, 265-288.UN Environment Program, 2006. Methods for sediment sampling and analysis. Palermo (Sicily), Italy: United Nation Environment Program.UNESCO, 2000. List of Biosphere reserves approved by MAB committee belonging to UNESCO. Retrieved from United Nations, Educational, Scientific, Cultural Organization (UNESCO): http://www.unesco.org/new/en/natural-sciences/environment/ecological-sciences/biosphere-reserves/asia-and-the-pacific.Vandenberghe N., 1975. An evaluation of CM patterns for grain size studies of fine grained sediments. Sedimentology, 22, 615-622.Vinh B.T., Ichiro D., 2012. Erosion mechanism of cohesive river bank and bed of Soai Rap river (Ho Chi Minh city). J. Sci. of the Earth, 34(2), 153-161.Wang J., Du H., Xu Y., Chen K., Liang J., Ke H., Cai M., 2016. Environmental and Ecological Risk Assessment of Trace Metal Contamination in Mangrove Ecosystems. BioMed Research International, Article ID 2167053, 1-14. Doi:10.1155/2016/2167053.Wedepohl K.H., 1995. The composition of the continental crust. Geochimica et Cosmochimica Acta, 59(7), 1217-1232.Woodroffe C., Rogers K., McKee K., Lovelock C., Mendelssohn I., Saintilan N., 2016. Mangrove sedimentation and response to relative sea level rise. The Annual Review of Marine Science, 8, 243-266.Zhang J., Liu C.L., 2002. Riverine Composition and Estuarine Geochemistry of Particulate Metals in China-Weathering Features, Anthropogenic Impact and Chemical Fluxes. Estuarine, Coastal and Shelf Science, 54(6), 1051-1070.Zhang W., Feng H., Chang J., Qu J., Xie H., Yu L., 2009. Heavy metal contamination in surface sediments of Yangtze River intertidal zone: An assessment from different indexes. Environmental Pollution, 157, 1533-1543.Zheng W.-j., Xiao-yong C., Peng L., 1997. Accumulation and biological cycling of heavy metal elements in Rhizophora stylosa mangroves in Yingluo Bay, China. Marine ecology progress series, 159, 293-301.

Purpose. The archeological study of Siberia started in the 18th century by the employees of the scientific expeditions initiated by the senior state bodies. I. G. Gmelin belonged to the Second Kamchatka Expedition and drew up a description of the Uenskoe Fortress in the Novosibirsk Ob River region. Until now, A. P. Umansky, T. N. Troitskaya and A. P. Borodovskiy were engaged in determining the location of this archaeological site. They made several hypotheses that turned out to be incorrect. The article determines the reasons for the failures of these researchers: a fragmentary translation of the source text, inaccuracies in the translation and ignoring data on the Abakhanskoe Zimovie (small russian settlement) ground. This paper is devoted to the results of the research within the framework of which the location of the Uenskoe Fortress was determined and the fortress itself was identified with one of the archeological sites discovered earlier. Within the framework of fulfillment of this task, one localized the Abakhanskoe Zimovie as this item of the 18th century is very important for localizing the Uenskoe Fortress. Results. J. G. Gmelin’s itineraries were published in Germany in 1751 and 1752 (in Göttingen) and have not been republished and translated into Russia since then, so the article contains an abstract of the book translated into Russia that is related to the performed study. At the first stage one managed to localize the Abakhanskoe Zimovie that was located in the western part of the modern suburban settlement of Starodubrovino, Moshkovo district, Novosibirsk region. Then according to the reference points provided by J. G. Gmelin and associated with the Abakhanskoe Zimovie, one determined the location of the Uenskoe Fortress in the western part of Cherny Mys to the north from the Zimovie. Afterwards, one compared the description of the fortress compiled by J. G. Gmelin and those fortresses discovered in this area earlier. It was determined that the author of the itinerary described the archeological object of Dubrovinsky Borok-6 dating back to 500–400 BC. Conclusion. The experience in analyzing J. G. Gmelin’sitinerary in terms of localization of the Abakhanskoe Zimovie and the Uenskoe Fortress showed that the quantitative data as well as information related to the cardinal directions are rather approximate. Based on such data, it would be impossible to achieve the research objectives. Here one also discovered a mount on which the already studied archeological sites were located.

The alkali volcanics and intrusive rocks, dated at around 35-33Ma, are cut by mineralised northeast and east trending faults showing predominant evidence for strike-slip. Mineralisation includes haematite-Au-Cu and is accompanied by iron-rich alteration of the volcanic rocks. Detailed assessment of the geometry of the fault system at Pu Sam Cap suggests that the faults formed as a Riedel shear system during left-lateral slip within the Song Hong-Song Chay shear zone and the numerous contemporaneous northwest trending faults to the south; the northeast trending faults are interpreted as dextral “book-end’’ faults between major northwest trending faults enclosing the Pu Sam Cap massif. As mineralisation is hosted within these faults and is also associated with lamprohyric dykes it confirms a thermal event younger than the alkaline volcanics and syenitic intrusives at Pu Sam Cap, suggesting a hidden, young porphyry system. The age of faulting, and thus the maximum age for this young intrusive event, is attributed to the 23-21Ma period of late-stage left-lateral strike-slip motion across northwest Vietnam.ReferencesAnczkiewicz R., Viola G., Muntener O., Thrirlwall M., Quong N.Q., 2007. Structure and shearing conditions in the Day Nui Con Voi massif: implications for the evolution of the Red River Fault. Tectonics 26: TC2002.Cao Shunyun, Liu Junlai, Leis B., Zhao Chunquiang 2010. New zircon U/Pb geochronology of the post-kinematic granitic plutons in Diancang Shan Massif along the Ailao-Shan-Red River Shear Zone and its geological implications. Acta Geologica Sinica (English Edition), 84, 1474-1487.Chung S.-L., Lee T., Lo C., et al., 1997. Intraplate extension prior to continental extrusion along the Ailao Shan-Red River shear zone.Geology, 25, 311-314.Cloos H., 1928. Experimentezurinnern Tektonik. Zentralblatt fur Mineralogie und Palaeontologie, 1928, 609-621.Findlay R.H., Phan Trong Trinh 1997. The structural setting of the Song Ma region, Vietnam, and the Indochina-South China plate boundary problem. Gondwana Research, 1, 11-33.Jolivet L., Beysasac O., Goffe B., Avigad D., Leprevrier C., Maluski H., Ta Trong Thang, 2001. Oligo-Miocene midcrustal subhorizontal shear in Indochina. Tectonics, 20, 46-57.Khuong The Hung 2010. The complex tectonic events and their influence on formation of mineral deposits in northwest Vietnam. Unpublished PhD Thesis, University of Science and Technology, Cracow, 167p.Leloup P.H., N. Arnau, R. Lacassin, J.R. Kienast, T.M. Harrison, P.T. Trinh, A. Replumaz and P. Tapponnier, 2001. New constraints on the structure, thermochronology and timing of the Ailao Shan - Red river shear zone, SE Asia, J. G. R., 106, 6657-6671.Leloup PH.., R. Lacassin, P. Tapponnier, U. Scharer, Zhong Dalai, Liu Xaohan, Zhangshan, Ji Shaocheng and PT.Trinh, 1995. The Ailao Shan - Red river shear zone (Yunnan, China), Tertiary transform boundary of Indochina, Tectonophysics, 251, 3-84. Leprevier C., Maluski H., Nguyen Van Vuong, Roques D., Axente V., Rangin C., 1996. Indosinian NW-trending shear zones within the Truong Son belt, Vietnam: 40Ar-39Ar Triassic ages and Cretaceous to Cenozoic overprints. Tectonophysics, 283, 105-107.Lien-Sheng Zhang, Scharer U. 1999. Age and origin of magmatism along the Cenozoic Red River shear belt, China. Contributions to Mineralogy and Petrology, 134, 67-85.Nagy E.A., Scharer U., Minh N.T., 2000. Oligo-Miocene granitic magmatismin central Vietnam and implications for continental deformation in Indochina. Terra Nova, 12, 67-76.Nguyen Thi Bich Thuy, 2016. Isotop dating U-Pb Zircon of Syenit Formation, Pu Sam Cap. Journal of Geology, A Serie, 356, 30-36. (In Vietnamese).Pei-Long Wang, Ching-Hua Lo, Tung-Yi Lee, Sun-ling Chun, Ching-Yan Lan, Nguyen Trong Yem 1998. Thermochronological evidence for the movement of the Ailo Shan-Red River shear zone, a perspective from Vietnam. Geology, 26, 887-890.Phan Trong Trinh, Nguyen Trong Yem, Herve L.P., Tapponnier P., 1994. Late Cenozoic stress fields in North Vietnam from microtectonic measurements. Proceedings of the International Workshop on Seismotectonics and Seismic Hazard in Southeast Asia. Geological Survey of SR Vietnam, Hanoi, 182-186.Riedel W., 1929. Zur Mechanikgreologischer Brucherscheinungen. Zentralblatt fur Mineralogie und Palaeontologie, Abhandlung B, 354-368.Scharer U., Tapponnier P., Lacassin R., Leloup P.H., Dalai Z., Shaosheng J., 1990. Intraplate tectonics in Asia: a precise age for large-scale Miocene movement along the Ailao Shan-Red River shear zone, China. Earth and Planetary Science Letters, 97, 65-77.Scharer U., Zhang L.S., Tapponnier P., 1994. Duration of strike-slip movements in large shear zones: the Red River belt, China. Earth and Planetary Science Letters, 126, 379-397.Searle M.P., 2006. Role of the Red River Shear zone, Yunnan and Vietnam, in the continental extrusion of SE Asia. Journal of the Geological Society, London, 163, 1025-1036.Searle M.P., Meng-Wan Yeh, Te-Hsien Lin, Sun-Lin Chung, 2010. Structural constraints on the timing of left-lateral shear along the Red River shear zone in the Ailao Shan and Diancang Shan Ranges, Yunnan, SW China. Geosphere, 6, 316-338.Tapponnier P., Lacassin R., Leloup H., Scharer U., Zhong Dalai, Wu Hawei, Liu Ziaohan, Ji Shaocheng, Zhang Lianshang, Zong Jiayou, 1990. The Ailao Shan/ Red River metamorphic belt: Tertiary left-lateral shear between Indochina and south China. Nature, 342, 431-437.Tchalenko J.S., 1970. Similarities between shear zones of different magnitudes. Bulletin of the Geological Society of America, 81, 1625-1640.Viola G., Anczkiewicz R. 2009. Exhumation history of the Red River shear zone in northern Vietnam: new insights from zircon and apatite fission-track analysis. Journal of Asian Earth Sciences, 33, 78-90.Yang Yiseng, Hong Qun, Hu Huan-ting, Hieu Pham Trung, Nguyen Thi Bich Thuy, Chen Fu-kun, 2013. Geochemical characteristics and genesis of the Cenozoic porphyry in the Laizhou area, northwestern Vietnam. Acta Petrologica Sinica, 29(3), 899-911. (In Chinese with English abstract, full English version through Google Translate).

Symphyotrichum novi-belgii (L.) G.L. Nesom (synonym Aster novi-belgii L.) is an autumn flowering perennial used in gardens and as a cut flower. During the last 20 years, it has been developed as a potted plant, thereby increasing its economic importance. In Denmark, 7 to 8 million S. novi-belgii plants are produced annually, making it one of the 10 most popular potted plant crops ( http://floradania.dk/index.php?id=165 ). In general, S. novi-belgii is a healthy plant, but it can be severely attacked by powdery mildew both in greenhouse production and outdoors, and diseased plants have been observed in most parts of the country. Infected plants show typical symptoms: leaf surfaces become covered with white mycelium and as the disease progresses infected leaves turn yellow and die. Powdery mildew is regarded the main disease problem in S. novi-belgii and it causes problems year round in greenhouse production. Normally, the disease is controlled by fungicides, but once out of the production system, symptom development in the retail trade will reduce the plant's appeal to customers to a degree that prevents sales. The powdery mildew identified in this study was collected in a small research field at Aarslev, Denmark in September 2004. Since collection, the pathogen has been maintained in a greenhouse on S. novi-belgii and it has been used for disease resistance screening. However, lack of proper identification of the causal agent has hindered the development of powdery mildew resistant cultivars. To identify the pathogen, the internal transcribed spacer region (ITS) of the rDNA was amplified using primers ITS1 and ITS4 (2) and sequenced. The resulting sequence was deposited in GenBank (Accession No. HM769725). BLASTn analysis of the 598-bp fragment showed 99% identity to Golovinomyces cichoracearum (DC.) V.P. Heluta from Rudbeckia laciniata L. (Accession No. AB077622). The powdery mildew colonies were slightly pink with barrel-shaped, hyaline conidia borne in chains of three to four. The length of the conidia was 30 ± 4 μm and the width was 13 ± 1 μm (n = 105). Foot cells of the conidiophores were 101 ± 16 μm long and 12 ± 5 μm wide (n = 50) with a slight constriction at the base. Chasmothecia were not observed. These morphological characteristics confirmed the identification as G. cichoracearum (1). To fulfill Koch's postulates, 10 healthy S. novi-belgii ‘Victoria Fanny’ plants were inoculated in an inoculation tower by shaking infected S. novi-belgii plants over the tower, resulting in a spore density of 47 spores/mm2 on the leaf surface. The infected plants were placed in a growth chamber with 16 h of light (200 μmol·m–2·s–1) and day and night temperatures of 20 and 15°C, respectively. Symptoms developed on all plants after 11 days. Colony morphology on the leaves and the morphological characteristics were as described above. Conidia were washed off the leaves, DNA extracted, and the ITS was amplified by PCR. The resulting PCR product was sequenced and was identical to HM769725. To our knowledge, this is the first report of G. cichoracearum on S. novi-belgii in Denmark. References: (1) U. Braun. The Powdery Mildews (Erysiphales) of Europe. Gustav Fischer Verlag, Jena Germany, 1995. (2) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. M. A. Innis et al., eds. Academic Press, New York, 1990.

Ключові слова: скіфи, курган, Красногірка, катакомба, поховальний обряд, кінська вузда. Анотація Стаття присвячена аналізу матеріалів з розкопок кургану біля с. Красногірка на Кіровоградщині. Пам’ятка була розкопана у 1983 р. археологічною експедицією Кіровоградського державного педагогічного інституту (тепер Центральноукраїнський державний педагогічний університет імені Володимира Винниченка) під керівництвом Н.М. Бокій. У статті здійснена спроба розглянути матеріали пам’ятки у контексті інших старожитностей скіфського часу. Під насипом знаходилось поховання, здійснене у катакомбі степового типу. Вона належить до катакомб, у яких довгі стінки камери та вхідної ями були розташовані на одній осі. Подібні споруди використовувались у Північному Причорномор’ї протягом IV ст. до н. е. Встановлено, що поховання було майже вщент пограбоване у давнину. Кістяк похованого також був повністю поруйнований грабіжниками. В могилі знайдені лише рештки кісток та фрагмент бронзового наконечника від стріли. На сходах, що вели до катакомби розчищені рештки дерев’яного підносу із жертовною їжею та залізний підток від списа. У насипу виявлені елементи кінської вузди та стінки античних амфор. Віднайдені автором публікації аналогії дозволили датувати пам’ятку IV ст. до н. е. Курган біля Красногірки належить до групи пам’яток басейну Синюхи. Тривалий час дослідники пов’язують цей регіон з північним кордоном розселення скіфів на Правобережжі. Аналіз предметів матеріальної культури та поховального обряду вказує, що курган біля Красногірки був споруджений над похованням кочовика. Тип поховальної споруди, залишки озброєння та жертвоприношень дозволяють припустити, що власник гробниці належав до представників військової аристократії. Посилання Alekseev i dr., 1991. – Alekseev A.Yu., Murzin V.Yu., Rolle R. Chertomlyk (Skifskij czarskij kurgan IV v. do n. e.). [Russian: Chertomlyk (Scythian royal barrow of the 4th century BC)] K., 1991. 416 s. [in Russian]. Bobrinskoj, 1901. – Bobrinskoj A.A. Kurgany i sluchajnye naxodki bliz mestechka Smely. [Russian: Barrows and accidental finds near the town of Smela] SPb, 1901. T ІІІ. 171 s. [in Russian]. Bokij, 1974. – Bokij N.M. Skifskij kurgan u sela Mederovo // Sovetskaya arxeologiya. [Russian: Scythian barrow near Mederovo // Soviet archeology]. 1974. № 4. S. 264–271. [in Russian]. Bokii, 2001. – Bokii N.M. Davni problemy istorii skifiv Dniprovskoho Pravoberezhzhia // Naukovi zapysky z istorii Ukrainy. Vypusk 8. [Ukraine: Ancient problems of the history of the Scythians of the Dnieper Right Bank // Scientific notes on the history of Ukraine]. K., 2001. S. 3–9. [in Ukrainian]. Bokii, 1994. – Bokii N.M. Skifski pam’iatky baseinu r. Syniukhy // Naukovi zapysky z istorii Ukrainy. [Ukraine: Scythian sites of the Sinyukha river basin // Scientific notes on the history of Ukraine]. Kirovohrad, 1994. S. 107-114. [in Ukrainian]. Bokii, 1983. – Bokii N. Strila zi skifskoho kurhana // Kirovohradska pravda. [Ukraine: Arrow from Scythian barrow // Kirovograd truth]. № 250 (zo zhovtnia 1983 r.). S. 3. [in Ukrainian]. Bokii ta in., 2013. – Вokii N.M., Mohylov O.D., Panchenko K.I. Kolektyvne pokhovannia skifskoho chasu v Lisostepovomu Pravoberezhnomu Podniprov’I // Arkheolohiia ta fortyfikatsiia Serednoho Podnistrov’ia. Zbirnyk materialiv III Vseukrainskoi naukovo-praktychnoi konferentsii [Ukraine: Collective burial of Scythian time in the Forest-Steppe Right-Bank Dnieper // Archeology and fortification of Middle Transnistria. Proceedings of the III All-Ukrainian scientific-practical conference]. Kamianets-Podilskyi, 2013. S. 17–24 [in Ukrainian]. Galanina, 1977. – Galanina L.K. Skifskie drevnosti Podneprovya (Ermitazhnaya kollekcziya N.E. Brandenburga). Svod arheologicheskix istochnikov. Vyp. D 1-33. [Russian: Scythian antiquities of the Dnieper region (Hermitage collection of N.E. Brandenburg) // A set of archaeological sources.] M, 1977. 68 s. [in Russian]. Ilinskaya, 1968. – Ilinskaya V.A. Skify Dneprovskogo Lesostepnogo Levoberezhya. [Russian: Scythians of the Dnieper Forest-Steppe Left Bank] K., 1968. 267 s. [in Russian]. Ilinskaya, 1973. – Ilinskaya V.A. Skifskaya uzda IV v. do n. e. // Skifskie drevnosti. [Russian: Scythian bridle IV centures BC // Scythian antiquities] K., 1973. S. 42–63. [in Russian]. Ilinskaya, Terenozhkin, 1983. – Ilinskaya V.A., Terenozhkin A.I. Skifiya VII–IV vv. do n. e. [Russian: Scythia VII–IV centuries BC] K., 1983. 380 s. [in Russian]. Kovpanenko i dr., 1989. – Kovpanenko G.T., Bessonova S.S., Skoryj S.A. Pamyatniki skifskoj epoxi Dneprovskogo Lesostepnogo Pravoberezhya (Kievo-Cherkasskij region). [Russian: The sites of the Scythian period of the Dnipro Right Bank Forest-Steppe (Kyiv-Cherkasy region)] K., 1989. 333 s. [in Russian]. Kozyr ta in., 2019. – Kozyr I.A., Chornyy O.V., Panchenko K.I. Vasyns’kyy kurhan seredn’oskifs’koho chasu // Arkheolohiya i davnya istoriya Ukrayiny [Ukraine: Vasynskiy barrow of the Middle Scythian time // Archeology and ancient history of Ukraine]. Vyp. 2. K., 2019. S. 300–314 [in Ukrainian]. Kubishev i dr., 2009. – Kubishev A.I., Bessonova S.S., Kovalov S.S. Bratolyubovskij kurgan. [Russian: Bratolyubovsky barrow] K., 2009. 192 s. [in Russian]. Liberov, 1965. – Liberov P.D. Pamyatniki skifskogo vremeni na Srednem Donu. Svod arxeologicheskix istochnikov. D 1-31. [Russian: antiquities of the Scythian time in the Middle Don // A set of archaeological sources] M, 1965. 112 s. [in Russian]. Melyukova, 1964. – Melyukova A.I. Vooruzhenie skifov. Svod arheologicheskih istochnikov. D 1-4. [Russian: Armament of the Scythians // A set of archaeological sources]. M, 1964. 91 s. [in Russian]. Mohylov, Didenko, 2009. – Mohylov O.D., Didenko S.V. Skifskyi kurhan 448 bilia s. Zhuravka – pam’iatka perekhidnoho chasu v Potiasmynni // Arkheolohiia. [Ukraine: Scythian barrow 448 near Zhuravka – a site of transition time in Potyasminna // Archeology] 2009. № 3. S. 45-55. [in Ukrainian]. Mohylov, 2008. – Mohylov O.D. Sporiadzhennia konia skifskoi doby u Lisostepu Skhidnoi Yevropy. [Ukraine: Equipment of a Scythian horse in the Forest-Steppe of Eastern Europe]. Kyiv, Kam’ianets-Podilskyi, 2008. 439 s. [in Ukrainian]. Mozolevskyi, 1979. – Mozolevskyi B.M. Tovsta mohyla. [Ukraine: Tovsta barrow]. K., 1979. 252 s. [in Ukrainian]. Olhovskij, 1991. – Olhovskij V.S. Pogrebal’no-pominal’naya obryadnost’ naseleniya stepnoj Skifii (VII–III vv. do n. e.). [Russian: Funeral and memorial rites of the population of steppe Scythia (VII–III centuries BC)] M., 1991. 253 s. [in Russian]. Panchenko, 2015. – Panchenko K.I. Skifskyi kurhan bilia s. Krasnohirka na Kirovohradshchyni // Naukovi zapysky. Seriia: Istorychni nauky. Vyp. 22. [Ukraine: Scythian barrow Krasnohirka in the Kirovograd region // Scientific notes. Series: Historical Sciences. Issue 22]. Kirovohrad, 2015. S. 8–12. [in Ukrainian]. Petrenko, 1961. – Petrenko V.G. Kul’tura plemen pravoberezhnego srednego Pridneprov’ya v IV–III vv. do n. e. Materialy po arxeologii SSSR. [Russian: The culture of the tribes of the right-bank middle Dnieper region in the IV–III centuries. BC // Materials on archeology of the USSR] M., 1961. № 96. S. 51–102. [in Russian]. Petrenko, 1967. – Petrenko V.G. Pravoberezh’e Srednego Pridneprov’ya v V-III vv. do n. e. Svod arheologicheskih istochnikov. Vyp. D 1-4. [Russian: The Right bank of the Middle Dnieper region in the V–III centuries BC // A set of archaeological sources] M, 1967. 180 s. [in Russian]. Skoryj, 2003. – Skoryj S.A. Skify v Dneprovskoj Pravoberezhnoj Lesostepi. [Russian: Scythians in the Dnieper Right-Bank Forest-Steppe] K., 2003. 161 s. [in Russian]. Terenozhkin, Mozolevskij, 1988. – Terenozhkin A.I., Mozolevskij B.N. Melitopol’skij kurgan. [Russian: Melitopol barrow] K., 1988. 264 s. [in Russian]. Fialko, 1994. – Fialko E.E. Pamyatniki skifskoj epohi Pridneprovskoj terassovoj Lesostepi. [Russian: Monuments of the Scythian era of the Dnieper terrace forest-steppe.] K., 1994. 53 s. [in Russian].

This paper presents some results of rainfall forecast in the monsoon onset period in South Vietnam, with the use of ensemble Kalman filter to assimilate observation data into the initial field of the model. The study of rainfall forecasts are experimented at the time of Southern monsoon outbreaks for 3 years (2005, 2008 and 2009), corresponding to 18 cases. In each case, there are five trials, including satellite wind data assimilation, upper-air sounding data assimilation, mixed data (satellite wind+upper-air sounding data) assimilation and two controlled trials (one single predictive test and one multi-physical ensemble prediction), which is equivalent to 85 forecasts for one trial. Based on the statistical evaluation of 36 samples (18 meteorological stations and 18 trials), the results show that Kalman filter assimilates satellite wind data to forecast well rainfall at 48 hours and 72 hours ranges. With 24 hour forecasting period, upper-air sounding data assimilation and mixed data assimilation experiments predicted better rainfall than non-assimilation tests. The results of the assessment based on the phase prediction indicators also show that the ensemble Kalman filter assimilating satellite wind data and mixed data sets improve the rain forecasting capability of the model at 48 hours and 72 hour ranges, while the upper-air sounding data assimilation test produces satisfactory results at the 72 hour forecast range, and the multi-physical ensemble test predicted good rainfall at 24 hour and 48 hour forecasts. The results of this research initially lead to a new research approach, Kalman Filter Application that assimilates the existing observation data into input data of the model that can improve the quality of rainfall forecast in Southern Vietnam and overall country in general.References Bui Minh Tuan, Nguyen Minh Truong, 2013. Determining the onset indexes for the summer monsoon over southern Vietnam using numerical model with reanalysis data. VNU Journal of Science, 29(1S), 187-195.Charney J.G., 1955. The use of the primitive equations of motion in numerical prediction, Tellus, 7, 22.Cong Thanh, Tran Tan Tien, Nguyen Tien Toan, 2015. Assessing prediction of rainfall over Quang Ngai area of Vietnam from 1 to 2 day terms. VNU Journal of Science, 31(3S), 231-237.Courtier P., Talagrand O., 1987. Variational assimilation of meteorological observations with the adjoint vorticity equations, Part II, Numerical results. Quart. J. Roy. Meteor. Soc., 113, 1329.Daley R., 1991. Atmospheric data analysis. Cambridge University Press, Cambridge.Elementi M., Marsigli C., Paccagnella T., 2005. High resolution forecast of heavy precipitation with Lokal Modell: analysis of two case studies in the Alpine area. Natural Hazards and Earth System Sciences, 5, 593-602.Fasullo J. and Webster P.J., 2003. A hydrological definition of India monsoon onset and withdrawal. J. Climate, 16, 3200-3211.Haltiner G.J., Williams R.T., 1982. Numerical prediction and dynamic meteorology, John Wiley and Sons, New York.Hamill T.M., Whitaker J.S., Snyder C., 2001. Distance-dependent filtering of background error covariance estimates in an ensemble Kalman filter. Mon. Wea. Rev., 129, 2776.He J., Yu J., Shen X., and Gao H., 2004. Research on mechanism and variability of East Asia monsoon. J. Trop. Meteo, 20(5), 449-459.Hoang Duc Cuong, 2008. Experimental study on heavy rain forecast in Vietnam using MM5 model. A report on the Ministerial-level research projects on science and technology, 105p.Houtekamer P.L., Mitchell H.L., Pellerin G., Buehner M., Charron M., Spacek L., Hansen B., 2005. Atmospheric data assimilation with an ensemble Kalman filter: Results with real observations. Mon. Wea. Rev., 133, 604.Houtekamer P.L., Mitchell H.L., 2005. Ensemble Kalman filtering, Quart. J. Roy. Meteor. Soc., 131C, 3269-3289.Hunt B.R., Kostelich E., Szunyogh I., 2007. Efficient data assimilation for spatiotemporal chaos: a local ensemble transform Kalman filter. Physica D., 230, 112-126.Kalnay E., 2003. Atmospheric modeling, data assimilation and predictability. Cambridge University Press, 181.Kalnay et al., 2008. A local ensemble transform Kalman filter data assimilation system for the NCEP global model. Tellus A, 60(1), 113-130.Kato T., Aranami K., 2009. Formation Factors of 2004 Niigata-Fukushima and Fukui Heavy Rainfalls and Problems in the Predictions using a Cloud-Resolving Model. SOLA. 10, doi:10.2151/sola.Kieu C.Q., 2010. Estimation of Model Error in the Kalman Filter by Perturbed Forcing. VNU Journal of Science, Natural Sciences and Technology, 26(3S), 310-316.Kieu C.Q., 2011. Overview of the Ensemble Kalman Filter and Its Application to the Weather Research and Forecasting (WRF) model. VNU Journal of Science, Natural Sciences and Technology, 27(1S), 17-28.Kieu C.Q., Truong N.M., Mai H.T., and Ngo Duc T., 2012. Sensitivity of the Track and Intensity Forecasts of Typhoon Megi (2010) to Satellite-Derived Atmosphere Motion Vectors with the Ensenble Kalman filter. J. Atmos. Oceanic Technol., 29, 1794-1810.Kieu Thi Xin, 2005. Study on large-scale rainfall forecast by modern technology for flood prevention in Vietnam. State-level independent scientific and technological briefing report, 121-151.Kieu Thi Xin, Vu Thanh Hang, Le Duc, Nguyen Manh Linh, 2013. Climate simulation in Vietnam using regional climate nonhydrostatic NHRCM and hydrostatic RegCM models. Vietnam National University, Hanoi. Journal of Natural sciences and technology, 29(2S), 243-25.Krishnamurti T.N., Bounoa L., 1996. An introduction to numerical weather prediction techniques. CRC Press, Boca Raton, FA.Lau K.M., Yang S., 1997. Climatology and interannual variability of the Southeast Asian summer monsoon. Adv. Atmos. Sci., 14,141-162.Li C., Qu X., 1999. Characteristics of Atmospheric Circulation Associated with Summer monsoon onset in the South China Sea. Onset and Evolution of the South China Sea Monsoon and Its Interaction with the Ocean. Ding Yihui, and Li Chongyin, Eds, Chinese Meteorological Press, Beijing, 200-209.Lin N., Smith J.A., Villarini G., Marchok T.P., Baeck M.L., 2010. Modeling Extreme Rainfall, Winds,and Surge from Hurricane Isabel, 25. Doi: 10.1175/2010WAF2222349.Lu J., Zhang Q., Tao S., and Ju J., 2006. The onset and advance of the Asian summer monsoon. Chinese Science Bulletin, 51(1), 80-88.Matsumoto J., 1997. Seasonal transition of summer rainy season over Indochina and adjacent monsoon region. Adv. Atmos. Sci., 14, 231-245.Miyoshi T., and Kunii M., 2012. The Local Ensenble Transform Kalman Filter with the Weather Rearch and Forecasting Model: Experiments with Real Observation. Pure Appl. Geophysic, 169(3), 321-333. Miyoshi T., Yamane S., 2007. Local ensemble transform Kalman filtering with an AGCM at a T159/L48 resolution. Mon. Wea. Rev., 135, 3841-3861.Nguyen Khanh Van, Tong Phuc Tuan, Vuong Van Vu, Nguyen Manh Ha, 2013. The heavy rain differences based on topo-geographical analyse at Coastal Central Region, from Thanh Hoa to Khanh Hoa. J. Sciences of the Earth, 35, 301-309.Nguyen Minh Truong, Bui Minh Tuan, 2013. A case study on summer monsoon onset prediction for southern Vietnam in 2012 using the RAMS model. VNU Journal of Science, 29(1S), 179-186.Phillips N.A., 1960b. Numerical weather prediction. Adv. Computers, 1, 43-91, Kalnay 2004.Phillips N., 1960a. On the problem of the initial data for the primitive equations, Tellus, 12, 121126.Phuong Nguyen Duc, 2013. Experiment on combinatorial Kalman filtering method for WRF model to forecast heavy rain in central region in Vietnam. The Third International MAHASRI/HyARC Workshop on Asian Monsoon and Water Cycle, 28-30 August 2013, Da Nang, Viet Nam, 217-224.Richardson L.F., 1922. Weather prediction by numerical process. Cambridge University Press, Cambridge. Reprinted by Dover (1965, New York).Routray, Mohanty U.C., Niyogi D., Rizvi S.R., Osuri K.K., 2008. First application of 3DVAR-WRF data assimilation for mesoscale simulation of heavy rainfall events over Indian Monsoon region. Journal of the Royal Meteorological Society, 1555.Schumacher, R. S., C. A. Davis, 2010. Ensemble-based Forecast Uncertainty Analysis of Diverse Heavy Rainfall Events, 25. Doi: 10.1175/2010WAF2222378.Snyder C., Zhang F., 2003. Assimilation of simulated Doppler radar observations with an Ensemble Kalman filter. Mon. Wea. Rev., 131, 1663.Szunyogh I., Kostelich E.J., Gyarmati G., Kalnay E., Hunt B.R., Ott E., Satterfield E., Yorke J.A., 2008. A local ensemble transform Kalman filter data assimilation system for the NCEP global model. Tellus A., 60, 113-130.Tanaka M., 1992. Intraseasonal oscillation and the onset and retreat dates of the summer monsoon east, southeast Asia and the western Pacific region using GMS high cloud amount data. J. Meteorol. Soc. Japan, 70, 613-628.Tan Tien Tran, Nguyen Thi Thanh, 2011. The MODIS satellite data assimilation in the WRF model to forecast rainfall in the central region. VNU Journal of Science, Natural Sciences and Technology, 27(3S), 90-95.Tao S., Chen L., 1987. A review of recent research on East summer monsoon in China, Monsoon Meteorology. C. P. Changand T. N. Krishramurti, Eds, Oxford University Press, Oxford, 60-92.Tippett M.K., Anderson J.L., Bishop C.H., Hamill T.M., Whitaker J.S., 2003. Ensemble square root filters. Mon. Wea. Rev., 131, 1485.Thuy Kieu Thi, Giam Nguyen Minh, Dung Dang Van, 2013. Using WRF model to forecast heavy rainfall events on September 2012 in Dong Nai River Basin. The Third International MAHASRI/HyARC Workshop on Asian Monsoon and Water Cycle, 28-30 August 2013, Da Nang, Viet Nam, 185-200.Xavier, Chandrasekar, Singh R. and Simon B., 2006. The impact of assimilation of MODIS data for the prediction of a tropical low-pressure system over India using a mesoscale model. International Journal of Remote Sensing 27(20), 4655-4676. https://doi.org/10.1080/01431160500207302. Wang B., 2003. Atmosphere-warm ocean interaction and its impacts on Asian-Australian monsoon variation. J. Climate, 16(8), 1195-1211.Wang B. and Wu R., 1997. Peculiar temporal structure of the South China Sea summer monsoon. J. Climate., 15, 386-396.Wang L., He J., and Guan Z., 2004. Characteristic of convective activities over Asian Australian ”landbridge” areas and its possible factors. Act a Meteorologic a Sinica, 18, 441-454.Wang, B., and Z. Fan, 1999. Choice of South Asian Summer Monsoon Indices. Bull. Amer. Meteor. Sci., 80, 629-638.Webster P.J., Magana V.O., Palmer T.N., Shukla J., Tomas R.A., Yanai M., Yasunari T., 1998. Monsoons: Processes, predictability, and teprospects for prediction, J. Geophys. Res., 103, 14451-14510.Wilks Daniel S., 1997. Statistical Methods in the Atmospheric Sciences. Ithaca New York., 59, 255.Whitaker J.S., Hamill T.M., 2002. Ensemble data assimilation without perturbed observations. Mon. Wea. Rev., 130, 1913.Wu G., Zhang Y., 1998. Tibetan plateau forcing and the timing of the monsoon onset over South Asia and the South China Sea. Mon.Wea.Rev., 126, 913-927.Zhang Z., Chan J.C.L., and Ding Y., 2004. Characteristics, evolution and mechanisms of the summer monsoon onset over Southeast Asia. J.Climatology, 24, 1461-1482.http://weather.uwyo.edu/upperair/sounding.html and http://tropic.ssec.wisc.edu/archive/

The existence of several early childhood education institutions in Indonesia, such as in the Riau Province region, often faces the risk of catastrophic floods overflowing the Kampar River resulting in casualties. The results of preliminary research found that children lacked insight into flood disaster mitigation, and schools did not have appropriate mitigation programs or media. This study aims to develop a product in the form of an E-Comic to introduce flood disaster mitigation in a practical and effective early childhood education. Research and development procedures in this study using the ADDIE model. The data collection techniques for this study were the results of expert validation, practicality tests, and media effectiveness tests on children aged 5-6 years using the mitigation understanding instrument and descriptive statistical analysis of Aiken's V validation. Flood disaster is very suitable for use in early childhood learning, with the average Aiken's V result by material experts is 89% and media expert is 96%. E-Comic practicality with an average percentage of 85.5% and effectiveness test results with an average value of 90%. It can be concluded that the E-Comic introduction of flood disaster mitigation in Kindergarten children is suitable for use as a learning medium and has a practical and effective quality. Keywords: E-Comic, Flood Disaster Mitigation References: Apriyani, R., Sumarni, S., & Rukiyah, R. (2018). Pengembangan Media Pembelajaran Komik Tema Alam Semesta untuk Anak. Cakrawala Dini: Jurnal Pendidikan Anak Usia Dini, 9(2), 110–124. https://doi.org/10.17509/cd.v9i2.11004 Azizah, N., & Khanafiyah, S. (2014). Pengaruh Komik Sains dalam Pembelajaran IPA terhadap Pengembangan Karakter Siswa di Kecamatan Semarang Tengah. 3(3), 34–42. https://doi.org/10.15294/upej.v3i3.4329 Bolton-Gary, C. (2012). Connecting Through Comics: Expanding Opportunities for Teaching and Learning. 7. Branch, R. M. (2009). Instructional Design: The ADDIE Approach. Springer US. https://doi.org/10.1007/978-0-387-09506-6 Courtis, A. (2012). Tech Module: Using Comic Life in the Classroom. 61. S. Syarah, E. Yetti, L. Fridani, Yufiarti, Hapidin, B. Pupala. (2019). Electronic Comics in Elementary School Science Learning for Marine Conservation. Jurnal Pendidikan IPA Indonesia, 8(4). https://doi.org/10.15294/jpii.v8i4.19377 Ersoy, Ş., & Koçak, A. (2016). Disasters and earthquake preparedness of children and schools in Istanbul, Turkey. Geomatics, Natural Hazards and Risk, 7(4), 1307–1336. https://doi.org/10.1080/19475705.2015.1060637 Haynes, K., & Tanner, T. M. (2015). Empowering young people and strengthening resilience: Youth-centred participatory video as a tool for climate change adaptation and disaster risk reduction. Children’s Geographies, 13(3), 357–371. https://doi.org/10.1080/14733285.2013.848599 Permendikbud no 137, Pub. L. No. no 137 (2014). Kousky, C. (2016). Impacts of Natural Disasters on Children. The Future of Children, 26(1), 73–92. https://doi.org/10.1353/foc.2016.0004 Lopez, Y., Hayden, J., Cologon, K., & Hadley, F. (2012). Child participation and disaster risk reduction. International Journal of Early Years Education, 20(3), 300–308. https://doi.org/10.1080/09669760.2012.716712 Martin, M.-L. (2010). Child Participation in Disaster Risk Reduction: The case of flood-affected children in Bangladesh. Third World Quarterly, 31(8), 1357–1375. https://doi.org/10.1080/01436597.2010.541086 Melliou, K., Moutafidou, A., & Bratitsis, T. (2014). Digital Comics Use to Develop Thinking Dispositions in Early Childhood Education. 2014 IEEE 14th International Conference on Advanced Learning Technologies, 502–504. https://doi.org/10.1109/ICALT.2014.148 Mitchell, T., Tanner, T., & Haynes, K. (2009). Children as agents of change for Disaster Risk Reduction: Lessons from El Salvador and the Philippines. 48. Peek, L. (2008). Children and Disasters: Understanding Vulnerability, Developing Capacities, and Promoting Resilience—An Introduction. Understanding Vulnerability, 30. Pfefferbaum, B., Pfefferbaum, R. L., & Van Horn, R. L. (2018). Involving children in disaster risk reduction: The importance of participation. European Journal of Psychotraumatology, 9(sup2), 1425577. https://doi.org/10.1080/20008198.2018.1425577 Save the Children UK. (2006). Child Protection During Floods in Bangladesh. The Save the Children Fund. Schipper, L., & Pelling, M. (2006). Disaster risk, climate change and international development: Scope for, and challenges to, integration: Disaster Risk, Climate Change and International Development. Disasters, 30(1), 19–38. https://doi.org/10.1111/j.1467-9523.2006.00304.x Syarah, E. S., Yetti, E., & Fridani, Lara. (2018). Pengembangan Media Komik Elektronik untuk Meningkatkan Pemahaman Konservasi Kelautan Anak Usia Dini. 12, 10. Tanner, T. (2010). Shifting the Narrative: Child-led Responses to Climate Change and Disasters in El Salvador and the Philippines: Child-led Responses to Climate Change and Disasters. Children & Society, 24(4), 339–351. https://doi.org/10.1111/j.1099-0860.2010.00316.x Tuladhar, G., Yatabe, R., Dahal, R. K., & Bhandary, N. P. (2014). Knowledge of disaster risk reduction among school students in Nepal. Geomatics, Natural Hazards and Risk, 5(3), 190–207. https://doi.org/10.1080/19475705.2013.809556 Versaci, R. (2001). How Comic Books Can Change the Way Our Students See Literature: One Teacher’s Perspective. The English Journal, 91(2), 61. https://doi.org/10.2307/822347 Wasliyah, S. (2018). Komik Bencana Meningkatkan Sikap Kesiapsiagaan Bencana pada Anak Sekolah Dasar Negeri Bulakan Kecamatan Gunung Kencana Banten Selatan Tahun 2017. Jurnal Medikes (Media Informasi Kesehatan), 5(1), 30–39. https://doi.org/10.36743/medikes.v5i1.39

Rapid urbanization rates impact significantly on the nature of Land Cover patterns of the environment, which has been evident in the depletion of vegetal reserves and in general modifying the human climatic systems (Henderson, et al., 2017; Kumar, Masago, Mishra, & Fukushi, 2018; Luo and Lau, 2017). This study explores remote sensing classification technique and other auxiliary data to determine LULCC for a period of 50 years (1967-2016). The LULCC types identified were quantitatively evaluated using the change detection approach from results of maximum likelihood classification algorithm in GIS. Accuracy assessment results were evaluated and found to be between 56 to 98 percent of the LULC classification. The change detection analysis revealed change in the LULC types in Minna from 1976 to 2016. Built-up area increases from 74.82ha in 1976 to 116.58ha in 2016. Farmlands increased from 2.23 ha to 46.45ha and bared surface increases from 120.00ha to 161.31ha between 1976 to 2016 resulting to decline in vegetation, water body, and wetlands. The Decade of rapid urbanization was found to coincide with the period of increased Public Private Partnership Agreement (PPPA). Increase in farmlands was due to the adoption of urban agriculture which has influence on food security and the environmental sustainability. The observed increase in built up areas, farmlands and bare surfaces has substantially led to reduction in vegetation and water bodies. The oscillatory nature of water bodies LULCC which was not particularly consistent with the rates of urbanization also suggests that beyond the urbanization process, other factors may influence the LULCC of water bodies in urban settlements. Keywords: Minna, Niger State, Remote Sensing, Land Surface Characteristics References Akinrinmade, A., Ibrahim, K., & Abdurrahman, A. (2012). Geological Investigation of Tagwai Dams using Remote Sensing Technique, Minna Niger State, Nigeria. Journal of Environment, 1(01), pp. 26-32. Amadi, A., & Olasehinde, P. (2010). Application of remote sensing techniques in hydrogeological mapping of parts of Bosso Area, Minna, North-Central Nigeria. International Journal of Physical Sciences, 5(9), pp. 1465-1474. Aplin, P., & Smith, G. (2008). Advances in object-based image classification. The International Archives of the Photogrammetry, Remote Sensing and Spatial Information Sciences, 37(B7), pp. 725-728. Ayele, G. T., Tebeje, A. K., Demissie, S. S., Belete, M. A., Jemberrie, M. A., Teshome, W. M., . . . Teshale, E. Z. (2018). Time Series Land Cover Mapping and Change Detection Analysis Using Geographic Information System and Remote Sensing, Northern Ethiopia. Air, Soil and Water Research, 11, p 1178622117751603. Azevedo, J. A., Chapman, L., & Muller, C. L. (2016). Quantifying the daytime and night-time urban heat island in Birmingham, UK: a comparison of satellite derived land surface temperature and high resolution air temperature observations. Remote Sensing, 8(2), p 153. Blaschke, T., Hay, G. J., Kelly, M., Lang, S., Hofmann, P., Addink, E., . . . van Coillie, F. (2014). Geographic object-based image analysis–towards a new paradigm. ISPRS Journal of Photogrammetry and Remote Sensing, 87, pp. 180-191. Bukata, R. P., Jerome, J. H., Kondratyev, A. S., & Pozdnyakov, D. V. (2018). Optical properties and remote sensing of inland and coastal waters: CRC press. Camps-Valls, G., Tuia, D., Bruzzone, L., & Benediktsson, J. A. (2014). Advances in hyperspectral image classification: Earth monitoring with statistical learning methods. IEEE signal processing magazine, 31(1), pp. 45-54. Chen, J., Chen, J., Liao, A., Cao, X., Chen, L., Chen, X., . . . Lu, M. (2015). Global land cover mapping at 30 m resolution: A POK-based operational approach. ISPRS Journal of Photogrammetry and Remote Sensing, 103, pp. 7-27. Chen, M., Mao, S., & Liu, Y. (2014). Big data: A survey. Mobile networks and applications, 19(2), pp. 171-209. Cheng, G., Han, J., Guo, L., Liu, Z., Bu, S., & Ren, J. (2015). Effective and efficient midlevel visual elements-oriented land-use classification using VHR remote sensing images. IEEE transactions on geoscience and remote sensing, 53(8), pp. 4238-4249. Cheng, G., Han, J., Zhou, P., & Guo, L. (2014). Multi-class geospatial object detection and geographic image classification based on collection of part detectors. ISPRS Journal of Photogrammetry and Remote Sensing, 98, pp. 119-132. Coale, A. J., & Hoover, E. M. (2015). Population growth and economic development: Princeton University Press. Congalton, R. G., & Green, K. (2008). Assessing the accuracy of remotely sensed data: principles and practices: CRC press. Corner, R. J., Dewan, A. M., & Chakma, S. (2014). Monitoring and prediction of land-use and land-cover (LULC) change Dhaka megacity (pp. 75-97): Springer. Coutts, A. M., Harris, R. J., Phan, T., Livesley, S. J., Williams, N. S., & Tapper, N. J. (2016). Thermal infrared remote sensing of urban heat: Hotspots, vegetation, and an assessment of techniques for use in urban planning. Remote Sensing of Environment, 186, pp. 637-651. Debnath, A., Debnath, J., Ahmed, I., & Pan, N. D. (2017). Change detection in Land use/cover of a hilly area by Remote Sensing and GIS technique: A study on Tropical forest hill range, Baramura, Tripura, Northeast India. International journal of geomatics and geosciences, 7(3), pp. 293-309. Desheng, L., & Xia, F. (2010). Assessing object-based classification: advantages and limitations. Remote Sensing Letters, 1(4), pp. 187-194. Dewan, A. M., & Yamaguchi, Y. (2009). Land use and land cover change in Greater Dhaka, Bangladesh: Using remote sensing to promote sustainable urbanization. Applied Geography, 29(3), pp. 390-401. Dronova, I., Gong, P., Wang, L., & Zhong, L. (2015). Mapping dynamic cover types in a large seasonally flooded wetland using extended principal component analysis and object-based classification. Remote Sensing of Environment, 158, pp. 193-206. Duro, D. C., Franklin, S. E., & Dubé, M. G. (2012). A comparison of pixel-based and object-based image analysis with selected machine learning algorithms for the classification of agricultural landscapes using SPOT-5 HRG imagery. Remote Sensing of Environment, 118, pp. 259-272. Elmhagen, B., Destouni, G., Angerbjörn, A., Borgström, S., Boyd, E., Cousins, S., . . . Hambäck, P. (2015). Interacting effects of change in climate, human population, land use, and water use on biodiversity and ecosystem services. Ecology and Society, 20(1) Farhani, S., & Ozturk, I. (2015). Causal relationship between CO 2 emissions, real GDP, energy consumption, financial development, trade openness, and urbanization in Tunisia. Environmental Science and Pollution Research, 22(20), pp. 15663-15676. Feng, L., Chen, B., Hayat, T., Alsaedi, A., & Ahmad, B. (2017). The driving force of water footprint under the rapid urbanization process: a structural decomposition analysis for Zhangye city in China. Journal of Cleaner Production, 163, pp. S322-S328. Fensham, R., & Fairfax, R. (2002). Aerial photography for assessing vegetation change: a review of applications and the relevance of findings for Australian vegetation history. Australian Journal of Botany, 50(4), pp. 415-429. Ferreira, N., Lage, M., Doraiswamy, H., Vo, H., Wilson, L., Werner, H., . . . Silva, C. (2015). Urbane: A 3d framework to support data driven decision making in urban development. Visual Analytics Science and Technology (VAST), 2015 IEEE Conference on. Garschagen, M., & Romero-Lankao, P. (2015). Exploring the relationships between urbanization trends and climate change vulnerability. Climatic Change, 133(1), pp. 37-52. Gokturk, S. B., Sumengen, B., Vu, D., Dalal, N., Yang, D., Lin, X., . . . Torresani, L. (2015). System and method for search portions of objects in images and features thereof: Google Patents. Government, N. S. (2007). Niger state (The Power State). Retrieved from http://nigerstate.blogspot.com.ng/ Green, K., Kempka, D., & Lackey, L. (1994). Using remote sensing to detect and monitor land-cover and land-use change. Photogrammetric engineering and remote sensing, 60(3), pp. 331-337. Gu, W., Lv, Z., & Hao, M. (2017). Change detection method for remote sensing images based on an improved Markov random field. Multimedia Tools and Applications, 76(17), pp. 17719-17734. Guo, Y., & Shen, Y. (2015). Quantifying water and energy budgets and the impacts of climatic and human factors in the Haihe River Basin, China: 2. Trends and implications to water resources. Journal of Hydrology, 527, pp. 251-261. Hadi, F., Thapa, R. B., Helmi, M., Hazarika, M. K., Madawalagama, S., Deshapriya, L. N., & Center, G. (2016). Urban growth and land use/land cover modeling in Semarang, Central Java, Indonesia: Colombo-Srilanka, ACRS2016. Hagolle, O., Huc, M., Villa Pascual, D., & Dedieu, G. (2015). A multi-temporal and multi-spectral method to estimate aerosol optical thickness over land, for the atmospheric correction of FormoSat-2, LandSat, VENμS and Sentinel-2 images. Remote Sensing, 7(3), pp. 2668-2691. Hegazy, I. R., & Kaloop, M. R. (2015). Monitoring urban growth and land use change detection with GIS and remote sensing techniques in Daqahlia governorate Egypt. International Journal of Sustainable Built Environment, 4(1), pp. 117-124. Henderson, J. V., Storeygard, A., & Deichmann, U. (2017). Has climate change driven urbanization in Africa? Journal of development economics, 124, pp. 60-82. Hu, L., & Brunsell, N. A. (2015). A new perspective to assess the urban heat island through remotely sensed atmospheric profiles. Remote Sensing of Environment, 158, pp. 393-406. Hughes, S. J., Cabral, J. A., Bastos, R., Cortes, R., Vicente, J., Eitelberg, D., . . . Santos, M. (2016). A stochastic dynamic model to assess land use change scenarios on the ecological status of fluvial water bodies under the Water Framework Directive. Science of the Total Environment, 565, pp. 427-439. Hussain, M., Chen, D., Cheng, A., Wei, H., & Stanley, D. (2013). Change detection from remotely sensed images: From pixel-based to object-based approaches. ISPRS Journal of Photogrammetry and Remote Sensing, 80, pp. 91-106. Hyyppä, J., Hyyppä, H., Inkinen, M., Engdahl, M., Linko, S., & Zhu, Y.-H. (2000). Accuracy comparison of various remote sensing data sources in the retrieval of forest stand attributes. Forest Ecology and Management, 128(1-2), pp. 109-120. Jiang, L., Wu, F., Liu, Y., & Deng, X. (2014). Modeling the impacts of urbanization and industrial transformation on water resources in China: an integrated hydro-economic CGE analysis. Sustainability, 6(11), pp. 7586-7600. Jin, S., Yang, L., Zhu, Z., & Homer, C. (2017). A land cover change detection and classification protocol for updating Alaska NLCD 2001 to 2011. Remote Sensing of Environment, 195, pp. 44-55. Joshi, N., Baumann, M., Ehammer, A., Fensholt, R., Grogan, K., Hostert, P., . . . Mitchard, E. T. (2016). A review of the application of optical and radar remote sensing data fusion to land use mapping and monitoring. Remote Sensing, 8(1), p 70. Kaliraj, S., Chandrasekar, N., & Magesh, N. (2015). Evaluation of multiple environmental factors for site-specific groundwater recharge structures in the Vaigai River upper basin, Tamil Nadu, India, using GIS-based weighted overlay analysis. Environmental earth sciences, 74(5), pp. 4355-4380. Koop, S. H., & van Leeuwen, C. J. (2015). Assessment of the sustainability of water resources management: A critical review of the City Blueprint approach. Water Resources Management, 29(15), pp. 5649-5670. Kumar, P., Masago, Y., Mishra, B. K., & Fukushi, K. (2018). Evaluating future stress due to combined effect of climate change and rapid urbanization for Pasig-Marikina River, Manila. Groundwater for Sustainable Development, 6, pp. 227-234. Lang, S. (2008). Object-based image analysis for remote sensing applications: modeling reality–dealing with complexity Object-based image analysis (pp. 3-27): Springer. Li, M., Zang, S., Zhang, B., Li, S., & Wu, C. (2014). A review of remote sensing image classification techniques: The role of spatio-contextual information. European Journal of Remote Sensing, 47(1), pp. 389-411. Liddle, B. (2014). Impact of population, age structure, and urbanization on carbon emissions/energy consumption: evidence from macro-level, cross-country analyses. Population and Environment, 35(3), pp. 286-304. Lillesand, T., Kiefer, R. W., & Chipman, J. (2014). Remote sensing and image interpretation: John Wiley & Sons. Liu, Y., Wang, Y., Peng, J., Du, Y., Liu, X., Li, S., & Zhang, D. (2015). Correlations between urbanization and vegetation degradation across the world’s metropolises using DMSP/OLS nighttime light data. Remote Sensing, 7(2), pp. 2067-2088. López, E., Bocco, G., Mendoza, M., & Duhau, E. (2001). Predicting land-cover and land-use change in the urban fringe: a case in Morelia city, Mexico. Landscape and urban planning, 55(4), pp. 271-285. Luo, M., & Lau, N.-C. (2017). Heat waves in southern China: Synoptic behavior, long-term change, and urbanization effects. Journal of Climate, 30(2), pp. 703-720. Mahboob, M. A., Atif, I., & Iqbal, J. (2015). Remote sensing and GIS applications for assessment of urban sprawl in Karachi, Pakistan. Science, Technology and Development, 34(3), pp. 179-188. Mallinis, G., Koutsias, N., Tsakiri-Strati, M., & Karteris, M. (2008). Object-based classification using Quickbird imagery for delineating forest vegetation polygons in a Mediterranean test site. ISPRS Journal of Photogrammetry and Remote Sensing, 63(2), pp. 237-250. Mas, J.-F., Velázquez, A., Díaz-Gallegos, J. R., Mayorga-Saucedo, R., Alcántara, C., Bocco, G., . . . Pérez-Vega, A. (2004). Assessing land use/cover changes: a nationwide multidate spatial database for Mexico. International Journal of Applied Earth Observation and Geoinformation, 5(4), pp. 249-261. Mathew, A., Chaudhary, R., Gupta, N., Khandelwal, S., & Kaul, N. (2015). Study of Urban Heat Island Effect on Ahmedabad City and Its Relationship with Urbanization and Vegetation Parameters. International Journal of Computer & Mathematical Science, 4, pp. 2347-2357. Megahed, Y., Cabral, P., Silva, J., & Caetano, M. (2015). Land cover mapping analysis and urban growth modelling using remote sensing techniques in greater Cairo region—Egypt. ISPRS International Journal of Geo-Information, 4(3), pp. 1750-1769. Metternicht, G. (2001). Assessing temporal and spatial changes of salinity using fuzzy logic, remote sensing and GIS. Foundations of an expert system. Ecological modelling, 144(2-3), pp. 163-179. Miller, R. B., & Small, C. (2003). Cities from space: potential applications of remote sensing in urban environmental research and policy. Environmental Science & Policy, 6(2), pp. 129-137. Mirzaei, P. A. (2015). Recent challenges in modeling of urban heat island. Sustainable Cities and Society, 19, pp. 200-206. Mohammed, I., Aboh, H., & Emenike, E. (2007). A regional geoelectric investigation for groundwater exploration in Minna area, north west Nigeria. Science World Journal, 2(4) Morenikeji, G., Umaru, E., Liman, S., & Ajagbe, M. (2015). Application of Remote Sensing and Geographic Information System in Monitoring the Dynamics of Landuse in Minna, Nigeria. International Journal of Academic Research in Business and Social Sciences, 5(6), pp. 320-337. Mukherjee, A. B., Krishna, A. P., & Patel, N. (2018). Application of Remote Sensing Technology, GIS and AHP-TOPSIS Model to Quantify Urban Landscape Vulnerability to Land Use Transformation Information and Communication Technology for Sustainable Development (pp. 31-40): Springer. Myint, S. W., Gober, P., Brazel, A., Grossman-Clarke, S., & Weng, Q. (2011). Per-pixel vs. object-based classification of urban land cover extraction using high spatial resolution imagery. Remote Sensing of Environment, 115(5), pp. 1145-1161. Nemmour, H., & Chibani, Y. (2006). Multiple support vector machines for land cover change detection: An application for mapping urban extensions. ISPRS Journal of Photogrammetry and Remote Sensing, 61(2), pp. 125-133. Niu, X., & Ban, Y. (2013). Multi-temporal RADARSAT-2 polarimetric SAR data for urban land-cover classification using an object-based support vector machine and a rule-based approach. International journal of remote sensing, 34(1), pp. 1-26. Nogueira, K., Penatti, O. A., & dos Santos, J. A. (2017). Towards better exploiting convolutional neural networks for remote sensing scene classification. Pattern Recognition, 61, pp. 539-556. Oguz, H., & Zengin, M. (2011). Analyzing land use/land cover change using remote sensing data and landscape structure metrics: a case study of Erzurum, Turkey. Fresenius Environmental Bulletin, 20(12), pp. 3258-3269. Pohl, C., & Van Genderen, J. L. (1998). Review article multisensor image fusion in remote sensing: concepts, methods and applications. International journal of remote sensing, 19(5), pp. 823-854. Price, O., & Bradstock, R. (2014). Countervailing effects of urbanization and vegetation extent on fire frequency on the Wildland Urban Interface: Disentangling fuel and ignition effects. Landscape and urban planning, 130, pp. 81-88. Prosdocimi, I., Kjeldsen, T., & Miller, J. (2015). Detection and attribution of urbanization effect on flood extremes using nonstationary flood‐frequency models. Water resources research, 51(6), pp. 4244-4262. Rawat, J., & Kumar, M. (2015). Monitoring land use/cover change using remote sensing and GIS techniques: A case study of Hawalbagh block, district Almora, Uttarakhand, India. The Egyptian Journal of Remote Sensing and Space Science, 18(1), pp. 77-84. Rokni, K., Ahmad, A., Solaimani, K., & Hazini, S. (2015). A new approach for surface water change detection: Integration of pixel level image fusion and image classification techniques. International Journal of Applied Earth Observation and Geoinformation, 34, pp. 226-234. Sakieh, Y., Amiri, B. J., Danekar, A., Feghhi, J., & Dezhkam, S. (2015). Simulating urban expansion and scenario prediction using a cellular automata urban growth model, SLEUTH, through a case study of Karaj City, Iran. Journal of Housing and the Built Environment, 30(4), pp. 591-611. Santra, A. (2016). Land Surface Temperature Estimation and Urban Heat Island Detection: A Remote Sensing Perspective. Remote Sensing Techniques and GIS Applications in Earth and Environmental Studies, p 16. Shrivastava, L., & Nag, S. (2017). MONITORING OF LAND USE/LAND COVER CHANGE USING GIS AND REMOTE SENSING TECHNIQUES: A CASE STUDY OF SAGAR RIVER WATERSHED, TRIBUTARY OF WAINGANGA RIVER OF MADHYA PRADESH, INDIA. Shuaibu, M., & Sulaiman, I. (2012). Application of remote sensing and GIS in land cover change detection in Mubi, Adamawa State, Nigeria. J Technol Educ Res, 5, pp. 43-55. Song, B., Li, J., Dalla Mura, M., Li, P., Plaza, A., Bioucas-Dias, J. M., . . . Chanussot, J. (2014). Remotely sensed image classification using sparse representations of morphological attribute profiles. IEEE transactions on geoscience and remote sensing, 52(8), pp. 5122-5136. Song, X.-P., Sexton, J. O., Huang, C., Channan, S., & Townshend, J. R. (2016). Characterizing the magnitude, timing and duration of urban growth from time series of Landsat-based estimates of impervious cover. Remote Sensing of Environment, 175, pp. 1-13. Tayyebi, A., Shafizadeh-Moghadam, H., & Tayyebi, A. H. (2018). Analyzing long-term spatio-temporal patterns of land surface temperature in response to rapid urbanization in the mega-city of Tehran. Land Use Policy, 71, pp. 459-469. Teodoro, A. C., Gutierres, F., Gomes, P., & Rocha, J. (2018). Remote Sensing Data and Image Classification Algorithms in the Identification of Beach Patterns Beach Management Tools-Concepts, Methodologies and Case Studies (pp. 579-587): Springer. Toth, C., & Jóźków, G. (2016). Remote sensing platforms and sensors: A survey. ISPRS Journal of Photogrammetry and Remote Sensing, 115, pp. 22-36. Tuholske, C., Tane, Z., López-Carr, D., Roberts, D., & Cassels, S. (2017). Thirty years of land use/cover change in the Caribbean: Assessing the relationship between urbanization and mangrove loss in Roatán, Honduras. Applied Geography, 88, pp. 84-93. Tuia, D., Flamary, R., & Courty, N. (2015). Multiclass feature learning for hyperspectral image classification: Sparse and hierarchical solutions. ISPRS Journal of Photogrammetry and Remote Sensing, 105, pp. 272-285. Tzotsos, A., & Argialas, D. (2008). Support vector machine classification for object-based image analysis Object-Based Image Analysis (pp. 663-677): Springer. Wang, L., Sousa, W., & Gong, P. (2004). Integration of object-based and pixel-based classification for mapping mangroves with IKONOS imagery. International journal of remote sensing, 25(24), pp. 5655-5668. Wang, Q., Zeng, Y.-e., & Wu, B.-w. (2016). Exploring the relationship between urbanization, energy consumption, and CO2 emissions in different provinces of China. Renewable and Sustainable Energy Reviews, 54, pp. 1563-1579. Wang, S., Ma, H., & Zhao, Y. (2014). Exploring the relationship between urbanization and the eco-environment—A case study of Beijing–Tianjin–Hebei region. Ecological Indicators, 45, pp. 171-183. Weitkamp, C. (2006). Lidar: range-resolved optical remote sensing of the atmosphere: Springer Science & Business. Wellmann, T., Haase, D., Knapp, S., Salbach, C., Selsam, P., & Lausch, A. (2018). Urban land use intensity assessment: The potential of spatio-temporal spectral traits with remote sensing. Ecological Indicators, 85, pp. 190-203. Whiteside, T. G., Boggs, G. S., & Maier, S. W. (2011). Comparing object-based and pixel-based classifications for mapping savannas. International Journal of Applied Earth Observation and Geoinformation, 13(6), pp. 884-893. Willhauck, G., Schneider, T., De Kok, R., & Ammer, U. (2000). Comparison of object oriented classification techniques and standard image analysis for the use of change detection between SPOT multispectral satellite images and aerial photos. Proceedings of XIX ISPRS congress. Winker, D. M., Vaughan, M. A., Omar, A., Hu, Y., Powell, K. A., Liu, Z., . . . Young, S. A. (2009). Overview of the CALIPSO mission and CALIOP data processing algorithms. Journal of Atmospheric and Oceanic Technology, 26(11), pp. 2310-2323. Yengoh, G. T., Dent, D., Olsson, L., Tengberg, A. E., & Tucker III, C. J. (2015). Use of the Normalized Difference Vegetation Index (NDVI) to Assess Land Degradation at Multiple Scales: Current Status, Future Trends, and Practical Considerations: Springer. Yu, Q., Gong, P., Clinton, N., Biging, G., Kelly, M., & Schirokauer, D. (2006). Object-based detailed vegetation classification with airborne high spatial resolution remote sensing imagery. Photogrammetric Engineering & Remote Sensing, 72(7), pp. 799-811. Zhou, D., Zhao, S., Zhang, L., & Liu, S. (2016). Remotely sensed assessment of urbanization effects on vegetation phenology in China's 32 major cities. Remote Sensing of Environment, 176, pp. 272-281. Zhu, Z., Fu, Y., Woodcock, C. E., Olofsson, P., Vogelmann, J. E., Holden, C., . . . Yu, Y. (2016). Including land cover change in analysis of greenness trends using all available Landsat 5, 7, and 8 images: A case study from Guangzhou, China (2000–2014). Remote Sensing of Environment, 185, pp. 243-257.

Study of petrological and geochemical characteristics of mantle peridotite xenoliths in Pliocene alkaline basalt in Nghia Dan (West Nghe An) was carried out. Rock-forming clinopyroxenes, the major trace element containers, were separated from the xenoliths to analyze for major, trace element and Sr-Nd isotopic compositions. The data were interpreted for source geochemical characteristics and geodynamic processes of the lithospheric mantle beneath the region. The peridotite xenoliths being mostly spinel-lherzolites in composition, are residual entities having been produced following partial melting events of ultramafic rocks in the asthenosphere. They are depleted in trace element abundance and Sr-Nd isotopic composition. Some are even more depleted as compared to mid-ocean ridge mantle xenoliths. Modelled calculation based on trace element abundances and their corresponding solid/liquid distribution coefficients showed that the Nghia Dan mantle xenoliths may be produced of melting degrees from 8 to 12%. Applying various methods for two-pyroxene temperature- pressure estimates, the Nghia Dan mantle xenoliths show ranges of crystallization temperature and pressure, respectively, of 1010-1044°C and 13-14.2 kbar, roughly about 43km. A geotherm constructed for the mantle xenoliths showed a higher geothermal gradient as compared to that of in the western Highlands (Vietnam) and a conductive model, implying a thermal perturbation under the region. The calculated Sm-Nd model ages for the clinopyroxenes yielded 127 and 122 Ma. If the age is meaningful it suggests that there was a major geodynamic process occurred beneath Western Nghe An in the middle- Early Cretaceous that was large enough to cause perturbation in the evolutional trend of the Sm-Nd isotopic system.ReferencesAn A-R., Choi S.H., Yu Y-g., Lee D-C., 2017. Petrogenesis of Late Cenozoic basaltic rocks from southern Vietnam. Lithos, 272-273 (2017), 192-204.Anders E., Grevesse N., 1989. Abundances of the elements: meteorite and solar. Geochimica et Cosmochimica Acta, 53, 197-214.Anderson D.L, 1994. The subcontinental mantle as the source of continental flood basalts; the case against the continental lithosphere mantle and plume hear reservoirs. Earth and Planetary Science Letter, 123, 269-280.Arai S., 1994. Characterization of spinel peridotites by olivine-spinel compositional relationships: review and interpretation. Chemical Geology, 113, 191-204.Ballhaus C., Berry R.G., Green D.H., 1991. High pressure experimental calibration of the olivine orthopyroxene-spinel oxygen geobarometer: implications for the oxidation state of the upper mantle. Contributions to Mineralogy and Petrology, 107, 27-40.Barr S.M. and MacDonald A.S., 1981. Geochemistry and geochronology of late Cenozoic basalts of southeast Asia: summary. Geological Society of America Bulletin, 92, 508-512.Brey G.P., Köhler T., 1990. Geothermobarometry in four-phase lherzolite II. New thermobarometers, and practical assessment of existing thermobarometers. Journal of Petrology, 31, 1353-1378.Briais A., Patriat P., Tapponnier P., 1993. Updated interpretation of magnetic anomalies and seafloor spreading stages in the South China Sea, implications for the Tertiary tectonics of SE Asia. Journal of Geophysical Research, 98, 6299-6328.Carlson R.W., Irving A.J., 1994. Depletion and enrichment history of subcontinental lithospheric mantle: an Os, Sr, Nd and Pb isotopic study of ultramafic xenoliths from the northwestern Wyoming Craton. Earth and Planetary Science Letters, 126, 457-472.Carlson R.W., Lugmair G.W., 1979. Sm-Nd constraints on early lunar differentiation and the evolution of KREEP. Earth and Planetary Science Letters, 45, 123-132.Carlson R.W., Lugmair G.W., 1981. Sm-Nd age of lherzolite 67667: implications for the processes involved in lunar crustal formation. Earth and Planetary Science Letters, 56, 1-8.Choi H.S., Mukasa S.B., Zhou X-H., Xian X-G.H., Andronikov A.V., 2008. Mantle dynamics beneath East Asia constrained by Sr, Nd, Pb and Hf isotopic systematics of ultramafic xenoliths and their host basalts from Hannuoba, North China. Chemical Geology, 248, 40-61.Choi S.H., Jwa Y.-J., Lee H.Y., 2001. Geothermal gradient of the upper mantle beneath Jeju Island, Korea: evidence from mantle xenoliths. Island Arc, 10, 175-193.Choi S.H., Kwon S-T., Mukasa S.B., Sagon H., 2005. Sr-Nd-Pb isotope and trace element systematics of mantle xenoliths from Late Cenozoic alkaline lavas, South Korea. Chemical Geology, 22, 40-64.Cox K.G., Bell J.D., Pankhurst R.J., 1979. The Interpretation of Igneous Rocks. George Allen & Unwin.Cung Thuong Chi, Dorobek S.L., Richter C., Flower M., Kikawa E., Nguyen Y.T., McCabe R., 1998. Paleomagnetism of Late Neogene basalts in Vietnam and Thailand: Implications for the Post-Miocene tectonic history of Indochina. In: Flower M.F.J., Chung, S.L., Lo, C.H., (Eds.). Mantle Dynamics and Plate Interactions in East Asia. Geodynamics Ser, American Geophysical Union, 27, 289-299.De Hoog J.C.M., Gall L., Cornell D.H., 2010. Trace-element geochemistry of mantle olivine and application to mantle petrogenesis and geothermobarometry. Chemical Geology, 270, 196-215.DePaolo D. J., 1981. Neodymium isotopes in the Colorado Front Range and crust - mantle evolution in the Proterozoic. Nature, 291, 193-197.DePaolo D.J., Wasserburg G.J., 1976. Nd isotopic variations and petrogenetic models. Geophysical Research Letters, 3(5), 249-252. Doi: https://doi.org/10.2113/gselements.13.1.11.Embey-Isztin A., Dobosi G., Meyer H.-P., 2001. Thermal evolution of the lithosphere beneath the western Pannonian Basin: evidence from deep-seat xenoliths. Tectonophysics, 331, 285-306.Fedorov P.I., Koloskov A.V., 2005. Cenozoic volcanism of Southeast Asia. Petrologiya, 13(4), 289-420.Frey F.A., Prinz M., 1978. Ultramafic inclusions from San Carlos, Arizona: Petrologic and geochemical data bearing on their Petrogenesis. Earth and Planetary Science Letters, 38, 129-176.Garnier V., Ohmenstetter D., Giuliani G., Fallick A.E., Phan T.T., Hoang Q.V., Pham V.L., Schawarz D., 2005. Basalt petrology, zircon ages and sapphire genesis from Dak Nong, southern Vietnam. Mineralogical Magazine, 69(1), 21-38.Gast P.W., 1968. Trace element fractionation and the origin of tholeiitic and alkaline magma types. Geochimica et Cosmochimica Acta, 32, 1057-1086.Gorshkov A.P, Ivanenko A.N., Rashidov V.A., 1984. Hydro-magnetic investigations of submarine volcanic zones in the marginal seas of Pacific Ocean (Novovineisky and Bien Dong seas). Pacific Ocean Geology, 1, 13-20.Gorshkov A.P., 1981. Investigation of submarine volcanoes during the 10th course of scientific research vessel ‘Volcanolog’. Volcanology and Seismology, 6, 39-45 (in Russian).Hart S.R., 1988. Heterogeneous mantle domains: signatures, genesis and mixing chronologies. Earth and Planetary Science Letters, 90, 273-296.Hirose K., Kushiro I., 1993. Partial melting of dry peridotites at high pressures: determination of composition of melts segregated from peridotite using aggregate of diamond. Earth Planet Science Letters, 114, 477-489.Hoang-Thi H.A., Choi S.H., Yongjae Yu Y-g., Pham T.H., Nguyen K.H., Ryu J-S., 2018. Geochemical constraints on the spatial distribution of recycled oceanic crust in the mantle source of late Cenozoic basalts, Vietnam. Lithos, 296-299 (2018), 382-395.Izokh A.E., Smirnov S.Z., Egorova V.V., Tran T.A., Kovyazin S.V., Ngo T.P., Kalinina V.V., 2010. The conditions of formation of sapphire and zircon in the areas of alkali-basaltoid volcanism in Central Vietnam. Russian Geology and Geophysics, 51(7), 719-733.Johnson K.T., Dick H.J.B. and Shimizu N., 1990. Melting in the oceanic upper mantle: An ion microprobe study of diopsides in abyssal peridotites. Journal of Geophysical Research (solid earth), 95, 2661-2678.Kölher T.P., Brey G.P., 1990. Calcium exchange between olivine and clinopyroxene calibrated as a geothermobarometer for natural peridotites from 2 to 60 kb with applications. Geochimica et Cosmochimica Acta, 54(9), 2375-2388.Kushiro I., 1996. Partial melting of a fertile mantle peridotite at high pressure: An experimental study using aggregates of diamond. In: A. Basu and S.R. Hart (Eds.), Earth Processes: Reading the Isotopic Code. AGU Monograph, 95, 109-122.Kushiro I., 1998. Compositions of partial melts formed in mantle peridotites at high pressures and their relation to those of primitive MORB. Physics of Earth and Planetary Interiors, 107, 103-110.Latin D., White N., 1990. Generating melt during lithospheric extension: Pure shear vs. simple shear. Geology, 18, 327-331.Lee T.-y. and Lawver L., 1995. Cenozoic plate reconstruction of Southeast Asia. In: M.F.J. Flower, R.J. McCabe and T.W.C. Hilde (Editors), Southeast Asia Structure, Tectonics, and Magmatism. Tectonophysics, 85-138.Li C-F., et al., 2015. Seismic stratigraphy of the central South China Sea basin and implications for neotectonics. Journal of Geophysical Research (solid earth), 120, 1377-1399. Doi:10.1002/2014JB011686.Li C.-F., et al., 2014. Ages and magnetic structures of the South China Sea constrained by deep tow magnetic surveys and IODP Expedition 349 Geochemistry, Geophysics, Geosystems, 14, 4958-4983.Malinovsky A.I., Rashidov V.A., 2015. Compositional characteristics of sedimentary and volcano-sedimentary rocks of Phu Quy-Catwick island group in the continental shelf of Vietnam. Bulletin of Kamchatka Regional Association of ‘Educational - Scientific’ Center, Earth Sciences, 27(3), 12-34 (in Russian with English summary).McCulloch M.T., Wasserburg G.J., 1978. Sm-Nd and Rb-Sr chronology of continental crust formation. Science, 200(4345), 1003-1011.Menzies M.A., Arculus R.L., Best M.G., et al., 1987. A record of subduction process and within-plate volcanism in lithospheric xenoliths of the southwestern USA. In P.H. Nixon (Editor), Mantle Xenoliths, John Wiley & Sons, Chichester, 59-74.Nguyen Hoang, Ogasawara M., Tran Thi Huong, Phan Van Hung, Nguyen Thi Thu, Cu Sy Thang, Pham Thanh Dang, Pham Tich Xuan, 2014. Geochemistry of Neogene Basalts in the Nghia Dan district, western Nghe An. J. Sci. of the Earth, 36, 403 -412.Nguyen Kinh Quoc, Nguyen Thu Giao, 1980. Cenozoic volcanic activity in Viet Nam. Geology and Mineral Resources, 2, 137-151 (in Vietnamese with English abstract).Nixon P.H., 1987 (Editor). Mantle xenoliths. John Wiley and Sons, 844p.Norman M.D. and Garcia M.O., 1999. Primitive magmas and source characteristics of the Hawaiian plume: petrology and geochemistry of shield picrites. Earth and Planetary Science Letters, 168, 27-44.Pollack H.N., Chapman D.S., 1977. On the regional variation of heat flow, geotherms and lithospheric thickness. Tectonophysics, 38, 279-296.Putirka K., 2008. Thermometers and Barometers for Volcanic Systems. In: Putirka, K., Tepley, F. (Eds.), Minerals, Inclusions and Volcanic Processes, Reviews in Mineralogy and Geochemistry, Mineralogical Soc. Am., 69, 61-120. Putirka K.D., 2017. Down the craters: where magmas stored and why they erupt. Methods and Further Reading. Supplement to February 2017 issue of Elements, 3(1), 11-16.Putirka K.D., Johnson M., Kinzler R., Longhi J., Walker D., 1996. Thermobarometry of mafic igneous rocks based on clinopyroxene-liquid equilibria, 0-30 kbar. Contributions to Mineralogy and Petrology, 123, 92-108. Putirka K.D., Mikaelian H., Ryerson F., Shaw H., 2003. New clinopyroxene-liquid thermobarometers for mafic, evolved, and volatile-bearing lava compositions, with applications to lavas from Tibet and the Snake River Plain, Idaho. American Mineralogist, 88, 1542-1554. Qi Q., Taylor L.A., Zhou X., 1995. Petrology and geochemistry of mantle peridotite xenoliths from SE China. Journal of Petrology, 36, 55-79.Sachtleben T.H., Seck H.A., 1981. Chemical control on the Al-solubility in orthopyroxene and its implications on pyroxene geothermometry. Contributions to Mineralogy and Petrology, 78, 157-65.Shaw D.M., 1970. Trace element fractionation during anataxis. Geochimica et Cosmochimica Acta, 34, 237-243.Sun S-S, McDonough W.F., 1989. Chemical and isotopic systematics of oceanic basalts: implications for mantle composition and processes. In Saunders A.D. and Norry, M.J. (eds) Magmatism in the Ocean Basins. Geological Society Special Publication, 42, 313-345.Takahashi E., 1986. Melting of a dry peridotite KLB-1 up to 14 Gpa: implications on the origin of peridotite upper mantle. J. Geophysical Research, 91, 9367-9382.Takahashi E., Kushiro I., 1983. Melting of a dry peridotite at high pressure and basalt magma genesis. American Mineralogist, 68, 859-879.Tamaki K., 1995. Upper mantle extrusion tectonics of southeast Asia and formation of western Pacific backarc basins. In: International Workshop: Cenozoic Evolution of the Indochina Peninsula, Hanoi/Do Son, April, p.89 (Abstract with Programs).Tapponnier P., Lacassin R., Leloup P.H., Shärer U., Dalai Z., Haiwei W., Xiaohan L., Shaocheng J., Lianshang Z., Jiayou Z., 1990. The Ailao Shan/Red River metamorphic belt: Tertiary left-lateral shear between Indochina and South China. Nature, 343(6257), 431-437.Tapponnier P., Peltzer G., La Dain A.Y., Armijo R., Cobbold P., 1982. Propagating extrusion tectonics in Asia: New insights from simple experiments with plasticine. Geology, 7, 611-616.Tatsumoto M., Basu A.R., Huang W., Wang J., Xie G., 1992. Sr, Nd, and Pb isotopes of ultramafic xenoliths in volcanic rocks of eastern China: enriched components EMI and EMII in subcontinental lithosphere. Earth Planet Sci. Letters, 113, 107-128.Taylor S.R., McLennan S.M., 1981. The composition and evolution of the continental crust: rare earth element evidence from sedimentary rocks. Philosophical Transactions of the Royal Society of London, 301, 381-399.Tu K., Flower M.F.J., Carlson R.W., Xie G-H., 1991. Sr, Nd, and Pb isotopic compositions of Hainan basalt (south China): Implications for a subcontinental lithosphere Dupal source. Geology, 19, 567-569.Tu K., Flower M.F.J., Carlson R.W., Xie G-H., Zhang M., 1992. Magmatism in the South China Basin 1. Isotopic and trace-element evidence for an endogenous Dupal component. Chemical Geology, 97, 47-63.Warren J.M., 2016. Global variations in abyssal peridotite compositions. Lithos, 248-251, 193-219.Webb S.A., Wood B.J., 1986. Spinel pyroxene- garnet relationships and their dependence on Cr/Al ratio. Contributions to Mineralogy and Petrology, 92, 471-480.Wells P.R.A., 1977. Pyroxene thermometry in simple and complex systems. Contributions to Mineralogy and Petrology, 62, 129-139.Whitford-Stark J.L., 1987. A survey of Cenozoic olcanism on mainland Asia, special paper, 213. Geological Society of America, 74p.Workman R.K., Hart S.R., 2005. Major and trace element composition of the depleted MORB mantle (DMM). Earth and Planetary Science Letters, 231, 53-72.Zhou P., Mukasa S., 1997. Nd-Sr-Pb isotopic, and major- and trace-element geochemistry of Cenozoic lavas from the Khorat Plateau, Thailand, sources and petrogenesis. Chemical Geology, 137, 175-193.Zindler A., Hart S.R., 1986. Chemical geodynamics. Annual Review of Earth and Planetary Sciences, 14, 493-571.

Climate change induced sea-level rise (SLR) is on its increase globally. Regionally the lowlands of China, Vietnam, Bangladesh, and islands of the Malaysian, Indonesian and Philippine archipelagos are among the world’s most threatened regions. Sea-level rise has major impacts on the ecosystems and society. It threatens coastal populations, economic activities, and fragile ecosystems as mangroves, coastal salt-marches and wetlands. This paper provides a summary of the current state of knowledge of sea level-rise and its effects on both human and natural ecosystems. The focus is on coastal urban areas and low lying deltas in South-East Asia and Vietnam, as one of the most threatened areas in the world. About 3 mm per year reflects the growing consensus on the average SLR worldwide. The trend speeds up during recent decades. The figures are subject to local, temporal and methodological variation. In Vietnam the average values of 3.3 mm per year during the 1993-2014 period are above the worldwide average. Although a basic conceptual understanding exists that the increasing global frequency of the strongest tropical cyclones is related with the increasing temperature and SLR, this relationship is insufficiently understood. Moreover the precise, complex environmental, economic, social, and health impacts are currently unclear. SLR, storms and changing precipitation patterns increase flood risks, in particular in urban areas. Part of the current scientific debate is on how urban agglomeration can be made more resilient to flood risks. Where originally mainly technical interventions dominated this discussion, it becomes increasingly clear that proactive special planning, flood defense, flood risk mitigation, flood preparation, and flood recovery are important, but costly instruments. Next to the main focus on SLR and its effects on resilience, the paper reviews main SLR associated impacts: Floods and inundation, salinization, shoreline change, and effects on mangroves and wetlands. The hazards of SLR related floods increase fastest in urban areas. This is related with both the increasing surface major cities are expected to occupy during the decades to come and the increasing coastal population. In particular Asia and its megacities in the southern part of the continent are increasingly at risk. The discussion points to complexity, inter-disciplinarity, and the related uncertainty, as core characteristics. An integrated combination of mitigation, adaptation and resilience measures is currently considered as the most indicated way to resist SLR today and in the near future.References Aerts J.C.J.H., Hassan A., Savenije H.H.G., Khan M.F., 2000. Using GIS tools and rapid assessment techniques for determining salt intrusion: Stream a river basin management instrument. Physics and Chemistry of the Earth, Part B: Hydrology, Oceans and Atmosphere, 25, 265-273. Doi: 10.1016/S1464-1909(00)00014-9. Alongi D.M., 2002. Present state and future of the world’s mangrove forests. Environmental Conservation, 29, 331-349. Doi: 10.1017/S0376892902000231 Alongi D.M., 2015. The impact of climate change on mangrove forests. Curr. Clim. Change Rep., 1, 30-39. Doi: 10.1007/s404641-015-0002-x. Anderson F., Al-Thani N., 2016. Effect of sea level rise and groundwater withdrawal on seawater intrusion in the Gulf Coast aquifer: Implications for agriculture. Journal of Geoscience and Environment Protection, 4, 116-124. Doi: 10.4236/gep.2016.44015. Anguelovski I., Chu E., Carmin J., 2014. Variations in approaches to urban climate adaptation: Experiences and experimentation from the global South. Global Environmental Change, 27, 156-167. Doi: 10.1016/j.gloenvcha.2014.05.010. Arustienè J., Kriukaitè J., Satkunas J., Gregorauskas M., 2013. Climate change and groundwater - From modelling to some adaptation means in example of Klaipèda region, Lithuania. In: Climate change adaptation in practice. P. Schmidt-Thomé, J. Klein Eds. John Wiley and Sons Ltd., Chichester, UK., 157-169. Bamber J.L., Aspinall W.P., Cooke R.M., 2016. A commentary on “how to interpret expert judgement assessments of twenty-first century sea-level rise” by Hylke de Vries and Roderik S.W. Van de Wal. Climatic Change, 137, 321-328. Doi: 10.1007/s10584-016-1672-7. Barnes C., 2014. Coastal population vulnerability to sea level rise and tropical cyclone intensification under global warming. BSc-thesis. Department of Geography, University of Lethbridge, Alberta Canada. Be T.T., Sinh B.T., Miller F., 2007. Challenges to sustainable development in the Mekong Delta: Regional and national policy issues and research needs. The Sustainable Mekong Research Network, Bangkok, Thailand, 1-210. Bellard C., Leclerc C., Courchamp F., 2014. Impact of sea level rise on 10 insular biodiversity hotspots. Global Ecology and Biogeography, 23, 203-212. Doi: 10.1111/geb.12093. Berg H., Söderholm A.E., Sönderström A.S., Nguyen Thanh Tam, 2017. Recognizing wetland ecosystem services for sustainable rice farming in the Mekong delta, Vietnam. Sustainability Science, 12, 137-154. Doi: 10.1007/s11625-016-0409-x. Bilskie M.V., Hagen S.C., Medeiros S.C., Passeri D.L., 2014. Dynamics of sea level rise and coastal flooding on a changing landscape. Geophysical Research Letters, 41, 927-934. Doi: 10.1002/2013GL058759. Binh T.N.K.D., Vromant N., Hung N.T., Hens L., Boon E.K., 2005. Land cover changes between 1968 and 2003 in Cai Nuoc, Ca Mau penisula, Vietnam. Environment, Development and Sustainability, 7, 519-536. Doi: 10.1007/s10668-004-6001-z. Blankespoor B., Dasgupta S., Laplante B., 2014. Sea-level rise and coastal wetlands. Ambio, 43, 996- 005.Doi: 10.1007/s13280-014-0500-4. Brockway R., Bowers D., Hoguane A., Dove V., Vassele V., 2006. A note on salt intrusion in funnel shaped estuaries: Application to the Incomati estuary, Mozambique.Estuarine, Coastal and Shelf Science, 66, 1-5. Doi: 10.1016/j.ecss.2005.07.014. Cannaby H., Palmer M.D., Howard T., Bricheno L., Calvert D., Krijnen J., Wood R., Tinker J., Bunney C., Harle J., Saulter A., O’Neill C., Bellingham C., Lowe J., 2015. Projected sea level rise and changes in extreme storm surge and wave events during the 21st century in the region of Singapore. Ocean Sci. Discuss, 12, 2955-3001. Doi: 10.5194/osd-12-2955-2015. Carraro C., Favero A., Massetti E., 2012. Investment in public finance in a green, low carbon economy. Energy Economics, 34, S15-S18. Castan-Broto V., Bulkeley H., 2013. A survey ofurban climate change experiments in 100 cities. Global Environmental Change, 23, 92-102. Doi: 10.1016/j.gloenvcha.2012.07.005. Cazenave A., Le Cozannet G., 2014. Sea level rise and its coastal impacts. GeoHealth, 2, 15-34. Doi: 10.1002/2013EF000188. Chu M.L., Guzman J.A., Munoz-Carpena R., Kiker G.A., Linkov I., 2014. A simplified approach for simulating changes in beach habitat due to the combined effects of long-term sea level rise, storm erosion and nourishment. Environmental modelling and software, 52, 111-120. Doi.org/10.1016/j.envcsoft.2013.10.020. Church J.A. et al., 2013. Sea level change. In: Climate change 2013: The physical science basis. Contribution of working group I to the fifth assessment report of Intergovernmental Panel on Climate Change. Eds: Stocker T.F., Qin D., Plattner G.-K., Tignor M., Allen S.K., Boschung J., Nauels A., Xia Y., Bex V., Midgley P.M., Cambridge University Press, Cambridge, UK. Connell J., 2016. Last days of the Carteret Islands? Climate change, livelihoods and migration on coral atolls. Asia Pacific Viewpoint, 57, 3-15. Doi: 10.1111/apv.12118. Dasgupta S., Laplante B., Meisner C., Wheeler, Yan J., 2009. The impact of sea level rise on developing countries: A comparative analysis. Climatic Change, 93, 379-388. Doi: 10.1007/s 10584-008-9499-5. Delbeke J., Vis P., 2015. EU climate policy explained, 136p. Routledge, Oxon, UK. DiGeorgio M., 2015. Bargaining with disaster: Flooding, climate change, and urban growth ambitions in QuyNhon, Vietnam. Public Affairs, 88, 577-597. Doi: 10.5509/2015883577. Do Minh Duc, Yasuhara K., Nguyen Manh Hieu, 2015. Enhancement of coastal protection under the context of climate change: A case study of Hai Hau coast, Vietnam. Proceedings of the 10th Asian Regional Conference of IAEG, 1-8. Do Minh Duc, Yasuhara K., Nguyen Manh Hieu, Lan Nguyen Chau, 2017. Climate change impacts on a large-scale erosion coast of Hai Hau district, Vietnam and the adaptation. Journal of Coastal Conservation, 21, 47-62. Donner S.D., Webber S., 2014. Obstacles to climate change adaptation decisions: A case study of sea level rise; and coastal protection measures in Kiribati. Sustainability Science, 9, 331-345. Doi: 10.1007/s11625-014-0242-z. Driessen P.P.J., Hegger D.L.T., Bakker M.H.N., Van Renswick H.F.M.W., Kundzewicz Z.W., 2016. Toward more resilient flood risk governance. Ecology and Society, 21, 53-61. Doi: 10.5751/ES-08921-210453. Duangyiwa C., Yu D., Wilby R., Aobpaet A., 2015. Coastal flood risks in the Bangkok Metropolitan region, Thailand: Combined impacts on land subsidence, sea level rise and storm surge. American Geophysical Union, Fall meeting 2015, abstract#NH33C-1927. Duarte C.M., Losada I.J., Hendriks I.E., Mazarrasa I., Marba N., 2013. The role of coastal plant communities for climate change mitigation and adaptation. Nature Climate Change, 3, 961-968. Doi: 10.1038/nclimate1970. Erban L.E., Gorelick S.M., Zebker H.A., 2014. Groundwater extraction, land subsidence, and sea-level rise in the Mekong Delta, Vietnam. Environmental Research Letters, 9, 1-20. Doi: 10.1088/1748-9326/9/8/084010. FAO - Food and Agriculture Organisation, 2007.The world’s mangroves 1980-2005. FAO Forestry Paper, 153, Rome, Italy. Farbotko C., 2010. Wishful sinking: Disappearing islands, climate refugees and cosmopolitan experimentation. Asia Pacific Viewpoint, 51, 47-60. Doi: 10.1111/j.1467-8373.2010.001413.x. Goltermann D., Ujeyl G., Pasche E., 2008. Making coastal cities flood resilient in the era of climate change. Proceedings of the 4th International Symposium on flood defense: Managing flood risk, reliability and vulnerability, 148-1-148-11. Toronto, Canada. Gong W., Shen J., 2011. The response of salt intrusion to changes in river discharge and tidal mixing during the dry season in the Modaomen Estuary, China.Continental Shelf Research, 31, 769-788. Doi: 10.1016/j.csr.2011.01.011. Gosian L., 2014. Protect the world’s deltas. Nature, 516, 31-34. Graham S., Barnett J., Fincher R., Mortreux C., Hurlimann A., 2015. Towards fair outcomes in adaptation to sea-level rise. Climatic Change, 130, 411-424. Doi: 10.1007/s10584-014-1171-7. COASTRES-D-12-00175.1. Güneralp B., Güneralp I., Liu Y., 2015. Changing global patterns of urban expoàsure to flood and drought hazards. Global Environmental Change, 31, 217-225. Doi: 10.1016/j.gloenvcha.2015.01.002. Hallegatte S., Green C., Nicholls R.J., Corfee-Morlot J., 2013. Future flood losses in major coastal cities. Nature Climate Change, 3, 802-806. Doi: 10.1038/nclimate1979. Hamlington B.D., Strassburg M.W., Leben R.R., Han W., Nerem R.S., Kim K.-Y., 2014. Uncovering an anthropogenic sea-level rise signal in the Pacific Ocean. Nature Climate Change, 4, 782-785. Doi: 10.1038/nclimate2307. Hashimoto T.R., 2001. Environmental issues and recent infrastructure development in the Mekong Delta: Review, analysis and recommendations with particular reference to large-scale water control projects and the development of coastal areas. Working paper series (Working paper No. 4). Australian Mekong Resource Centre, University of Sydney, Australia, 1-70. Hibbert F.D., Rohling E.J., Dutton A., Williams F.H., Chutcharavan P.M., Zhao C., Tamisiea M.E., 2016. Coral indicators of past sea-level change: A global repository of U-series dated benchmarks. Quaternary Science Reviews, 145, 1-56. Doi: 10.1016/j.quascirev.2016.04.019. Hinkel J., Lincke D., Vafeidis A., Perrette M., Nicholls R.J., Tol R.S.J., Mazeion B., Fettweis X., Ionescu C., Levermann A., 2014. Coastal flood damage and adaptation costs under 21st century sea-level rise. Proceedings of the National Academy of Sciences, 111, 3292-3297. Doi: 10.1073/pnas.1222469111. Hinkel J., Nicholls R.J., Tol R.S.J., Wang Z.B., Hamilton J.M., Boot G., Vafeidis A.T., McFadden L., Ganapolski A., Klei R.J.Y., 2013. A global analysis of erosion of sandy beaches and sea level rise: An application of DIVA. Global and Planetary Change, 111, 150-158. Doi: 10.1016/j.gloplacha.2013.09.002. Huong H.T.L., Pathirana A., 2013. Urbanization and climate change impacts on future urban flooding in Can Tho city, Vietnam. Hydrol. Earth Syst. Sci., 17, 379-394. Doi: 10.5194/hess-17-379-2013. Hurlimann A., Barnett J., Fincher R., Osbaldiston N., Montreux C., Graham S., 2014. Urban planning and sustainable adaptation to sea-level rise. Landscape and Urban Planning, 126, 84-93. Doi: 10.1016/j.landurbplan.2013.12.013. IMHEN-Vietnam Institute of Meteorology, Hydrology and Environment, 2011. Climate change vulnerability and risk assessment study for Ca Mau and KienGiang provinces, Vietnam. Hanoi, Vietnam Institute of Meteorology, Hydrology and Environment (IMHEN), 250p. IMHEN-Vietnam Institute of Meteorology, Hydrology and Environment, Ca Mau PPC, 2011. Climate change impact and adaptation study in The Mekong Delta - Part A: Ca Mau Atlas. Hanoi, Vietnam: Institute of Meteorology, Hydrology and Environment (IMHEN), 48p. IPCC-Intergovernmental Panel on Climate Change, 2014. Fifth assessment report. Cambridge University Press, Cambridge, UK. Jevrejeva S., Jackson L.P., Riva R.E.M., Grinsted A., Moore J.C., 2016. Coastal sea level rise with warming above 2°C. Proceedings of the National Academy of Sciences, 113, 13342-13347. Doi: 10.1073/pnas.1605312113. Junk W.J., AN S., Finlayson C.M., Gopal B., Kvet J., Mitchell S.A., Mitsch W.J., Robarts R.D., 2013. Current state of knowledge regarding the world’s wetlands and their future under global climate change: A synthesis. Aquatic Science, 75, 151-167. Doi: 10.1007/s00027-012-0278-z. Jordan A., Rayner T., Schroeder H., Adger N., Anderson K., Bows A., Le Quéré C., Joshi M., Mander S., Vaughan N., Whitmarsh L., 2013. Going beyond two degrees? The risks and opportunities of alternative options. Climate Policy, 13, 751-769. Doi: 10.1080/14693062.2013.835705. Kelly P.M., Adger W.N., 2000. Theory and practice in assessing vulnerability to climate change and facilitating adaptation. Climatic Change, 47, 325-352. Doi: 10.1023/A:1005627828199. Kirwan M.L., Megonigal J.P., 2013. Tidal wetland stability in the face of human impacts and sea-level rice. Nature, 504, 53-60. Doi: 10.1038/nature12856. Koerth J., Vafeidis A.T., Hinkel J., Sterr H., 2013. What motivates coastal households to adapt pro actively to sea-level rise and increased flood risk? Regional Environmental Change, 13, 879-909. Doi: 10.1007/s10113-12-399-x. Kontgis K., Schneider A., Fox J;,Saksena S., Spencer J.H., Castrence M., 2014. Monitoring peri urbanization in the greater Ho Chi Minh City metropolitan area. Applied Geography, 53, 377-388. Doi: 10.1016/j.apgeogr.2014.06.029. Kopp R.E., Horton R.M., Little C.M., Mitrovica J.X., Oppenheimer M., Rasmussen D.J., Strauss B.H., Tebaldi C., 2014. Probabilistic 21st and 22nd century sea-level projections at a global network of tide-gauge sites. Earth’s Future, 2, 383-406. Doi: 10.1002/2014EF000239. Kuenzer C., Bluemel A., Gebhardt S., Quoc T., Dech S., 2011. Remote sensing of mangrove ecosystems: A review.Remote Sensing, 3, 878-928. Doi: 10.3390/rs3050878. Lacerda G.B.M., Silva C., Pimenteira C.A.P., Kopp Jr. R.V., Grumback R., Rosa L.P., de Freitas M.A.V., 2013. Guidelines for the strategic management of flood risks in industrial plant oil in the Brazilian coast: Adaptive measures to the impacts of sea level rise. Mitigation and Adaptation Strategies for Global Change, 19, 104-1062. Doi: 10.1007/s11027-013-09459-x. Lam Dao Nguyen, Pham Van Bach, Nguyen Thanh Minh, Pham Thi Mai Thy, Hoang Phi Hung, 2011. Change detection of land use and river bank in Mekong Delta, Vietnam using time series remotely sensed data. Journal of Resources and Ecology, 2, 370-374. Doi: 10.3969/j.issn.1674-764x.2011.04.011. Lang N.T., Ky B.X., Kobayashi H., Buu B.C., 2004. Development of salt tolerant varieties in the Mekong delta. JIRCAS Project, Can Tho University, Can Tho, Vietnam, 152. Le Cozannet G., Rohmer J., Cazenave A., Idier D., Van de Wal R., de Winter R., Pedreros R., Balouin Y., Vinchon C., Oliveros C., 2015. Evaluating uncertainties of future marine flooding occurrence as sea-level rises. Environmental Modelling and Software, 73, 44-56. Doi: 10.1016/j.envsoft.2015.07.021. Le Cozannet G., Manceau J.-C., Rohmer J., 2017. Bounding probabilistic sea-level projections with the framework of the possible theory. Environmental Letters Research, 12, 12-14. Doi.org/10.1088/1748-9326/aa5528.Chikamoto Y., 2014. Recent Walker circulation strengthening and Pacific cooling amplified by Atlantic warming. Nature Climate Change, 4, 888-892. Doi: 10.1038/nclimate2330. Lovelock C.E., Cahoon D.R., Friess D.A., Gutenspergen G.R., Krauss K.W., Reef R., Rogers K., Saunders M.L., Sidik F., Swales A., Saintilan N., Le Xuan Tuyen, Tran Triet, 2015. The vulnerability of Indo-Pacific mangrove forests to sea-level rise. Nature, 526, 559-563. Doi: 10.1038/nature15538. MA Millennium Ecosystem Assessment, 2005. Ecosystems and human well-being: Current state and trends. Island Press, Washington DC, 266p. Masterson J.P., Fienen M.N., Thieler E.R., Gesch D.B., Gutierrez B.T., Plant N.G., 2014. Effects of sea level rise on barrier island groundwater system dynamics - ecohydrological implications. Ecohydrology, 7, 1064-1071. Doi: 10.1002/eco.1442. McGanahan G., Balk D., Anderson B., 2007. The rising tide: Assessing the risks of climate changes and human settlements in low elevation coastal zones.Environment and urbanization, 19, 17-37. Doi: 10.1177/095624780707960. McIvor A., Möller I., Spencer T., Spalding M., 2012. Reduction of wind and swell waves by mangroves. The Nature Conservancy and Wetlands International, 1-27. Merryn T., Pidgeon N., Whitmarsh L., Ballenger R., 2016. Expert judgements of sea-level rise at the local scale. Journal of Risk Research, 19, 664-685. Doi.org/10.1080/13669877.2015.1043568. Monioudi I.N., Velegrakis A.F., Chatzipavlis A.E., Rigos A., Karambas T., Vousdoukas M.I., Hasiotis T., Koukourouvli N., Peduzzi P., Manoutsoglou E., Poulos S.E., Collins M.B., 2017. Assessment of island beach erosion due to sea level rise: The case of the Aegean archipelago (Eastern Mediterranean). Nat. Hazards Earth Syst. Sci., 17, 449-466. Doi: 10.5194/nhess-17-449-2017. MONRE - Ministry of Natural Resources and Environment, 2016. Scenarios of climate change and sea level rise for Vietnam. Publishing House of Environmental Resources and Maps Vietnam, Hanoi, 188p. Montz B.E., Tobin G.A., Hagelman III R.R., 2017. Natural hazards. Explanation and integration. The Guilford Press, NY, 445p. Morgan L.K., Werner A.D., 2014. Water intrusion vulnerability for freshwater lenses near islands. Journal of Hydrology, 508, 322-327. Doi: 10.1016/j.jhydrol.2013.11.002. Muis S., Güneralp B., Jongman B., Aerts J.C.H.J., Ward P.J., 2015. Science of the Total Environment, 538, 445-457. Doi: 10.1016/j.scitotenv.2015.08.068. Murray N.J., Clemens R.S., Phinn S.R., Possingham H.P., Fuller R.A., 2014. Tracking the rapid loss of tidal wetlands in the Yellow Sea. Frontiers in Ecology and Environment, 12, 267-272. Doi: 10.1890/130260. Neumann B., Vafeidis A.T., Zimmermann J., Nicholls R.J., 2015a. Future coastal population growth and exposure to sea-level rise and coastal flooding. A global assessment. Plos One, 10, 1-22. Doi: 10.1371/journal.pone.0118571. Nguyen A. Duoc, Savenije H. H., 2006. Salt intrusion in multi-channel estuaries: a case study in the Mekong Delta, Vietnam. Hydrology and Earth System Sciences Discussions, European Geosciences Union, 10, 743-754. Doi: 10.5194/hess-10-743-2006. Nguyen An Thinh, Nguyen Ngoc Thanh, Luong Thi Tuyen, Luc Hens, 2017. Tourism and beach erosion: Valuing the damage of beach erosion for tourism in the Hoi An, World Heritage site. Journal of Environment, Development and Sustainability. Nguyen An Thinh, Luc Hens (Eds.), 2018. Human ecology of climate change associated disasters in Vietnam: Risks for nature and humans in lowland and upland areas. Springer Verlag, Berlin.Nguyen An Thinh, Vu Anh Dung, Vu Van Phai, Nguyen Ngoc Thanh, Pham Minh Tam, Nguyen Thi Thuy Hang, Le Trinh Hai, Nguyen Viet Thanh, Hoang Khac Lich, Vu Duc Thanh, Nguyen Song Tung, Luong Thi Tuyen, Trinh Phuong Ngoc, Luc Hens, 2017. Human ecological effects of tropical storms in the coastal area of Ky Anh (Ha Tinh, Vietnam). Environ Dev Sustain, 19, 745-767. Doi: 10.1007/s/10668-016-9761-3. Nguyen Van Hoang, 2017. Potential for desalinization of brackish groundwater aquifer under a background of rising sea level via salt-intrusion prevention river gates in the coastal area of the Red River delta, Vietnam. Environment, Development and Sustainability. Nguyen Tho, Vromant N., Nguyen Thanh Hung, Hens L., 2008. Soil salinity and sodicity in a shrimp farming coastal area of the Mekong Delta, Vietnam. Environmental Geology, 54, 1739-1746. Doi: 10.1007/s00254-007-0951-z. Nguyen Thang T.X., Woodroffe C.D., 2016. Assessing relative vulnerability to sea-level rise in the western part of the Mekong River delta. Sustainability Science, 11, 645-659. Doi: 10.1007/s11625-015-0336-2. Nicholls N.N., Hoozemans F.M.J., Marchand M., Analyzing flood risk and wetland losses due to the global sea-level rise: Regional and global analyses.Global Environmental Change, 9, S69-S87. Doi: 10.1016/s0959-3780(99)00019-9. Phan Minh Thu, 2006. Application of remote sensing and GIS tools for recognizing changes of mangrove forests in Ca Mau province. In Proceedings of the International Symposium on Geoinformatics for Spatial Infrastructure Development in Earth and Allied Sciences, Ho Chi Minh City, Vietnam, 9-11 November, 1-17. Reise K., 2017. Facing the third dimension in coastal flatlands.Global sea level rise and the need for coastal transformations. Gaia, 26, 89-93. Renaud F.G., Le Thi Thu Huong, Lindener C., Vo Thi Guong, Sebesvari Z., 2015. Resilience and shifts in agro-ecosystems facing increasing sea-level rise and salinity intrusion in Ben Tre province, Mekong Delta. Climatic Change, 133, 69-84. Doi: 10.1007/s10584-014-1113-4. Serra P., Pons X., Sauri D., 2008. Land cover and land use in a Mediterranean landscape. Applied Geography, 28, 189-209. Shearman P., Bryan J., Walsh J.P., 2013.Trends in deltaic change over three decades in the Asia-Pacific Region. Journal of Coastal Research, 29, 1169-1183. Doi: 10.2112/JCOASTRES-D-12-00120.1. SIWRR-Southern Institute of Water Resources Research, 2016. Annual Report. Ministry of Agriculture and Rural Development, Ho Chi Minh City, 1-19. Slangen A.B.A., Katsman C.A., Van de Wal R.S.W., Vermeersen L.L.A., Riva R.E.M., 2012. Towards regional projections of twenty-first century sea-level change based on IPCC RES scenarios. Climate Dynamics, 38, 1191-1209. Doi: 10.1007/s00382-011-1057-6. Spencer T., Schuerch M., Nicholls R.J., Hinkel J., Lincke D., Vafeidis A.T., Reef R., McFadden L., Brown S., 2016. Global coastal wetland change under sea-level rise and related stresses: The DIVA wetland change model. Global and Planetary Change, 139, 15-30. Doi:10.1016/j.gloplacha.2015.12.018. Stammer D., Cazenave A., Ponte R.M., Tamisiea M.E., 2013. Causes of contemporary regional sea level changes. Annual Review of Marine Science, 5, 21-46. Doi: 10.1146/annurev-marine-121211-172406. Tett P., Mee L., 2015. Scenarios explored with Delphi. In: Coastal zones ecosystems services. Eds., Springer, Berlin, Germany, 127-144. Tran Hong Hanh, 2017. Land use dynamics, its drivers and consequences in the Ca Mau province, Mekong delta, Vietnam. PhD dissertation, 191p. VUBPRESS Brussels University Press, ISBN 9789057186226, Brussels, Belgium. Tran Thuc, Nguyen Van Thang, Huynh Thi Lan Huong, Mai Van Khiem, Nguyen Xuan Hien, Doan Ha Phong, 2016. Climate change and sea level rise scenarios for Vietnam. Ministry of Natural resources and Environment. Hanoi, Vietnam. Tran Hong Hanh, Tran Thuc, Kervyn M., 2015. Dynamics of land cover/land use changes in the Mekong Delta, 1973-2011: A remote sensing analysis of the Tran Van Thoi District, Ca Mau province, Vietnam. Remote Sensing, 7, 2899-2925. Doi: 10.1007/s00254-007-0951-z Van Lavieren H., Spalding M., Alongi D., Kainuma M., Clüsener-Godt M., Adeel Z., 2012. Securing the future of Mangroves. The United Nations University, Okinawa, Japan, 53, 1-56. Water Resources Directorate. Ministry of Agriculture and Rural Development, 2016. Available online: http://www.tongcucthuyloi.gov.vn/Tin-tuc-Su-kien/Tin-tuc-su-kien-tong-hop/catid/12/item/2670/xam-nhap-man-vung-dong-bang-song-cuu-long--2015---2016---han-han-o-mien-trung--tay-nguyen-va-giai-phap-khac-phuc. Last accessed on: 30/9/2016. Webster P.J., Holland G.J., Curry J.A., Chang H.-R., 2005. Changes in tropical cyclone number, duration, and intensity in a warming environment. Science, 309, 1844-1846. Doi: 10.1126/science.1116448. Were K.O., Dick O.B., Singh B.R., 2013. Remotely sensing the spatial and temporal land cover changes in Eastern Mau forest reserve and Lake Nakuru drainage Basin, Kenya. Applied Geography, 41, 75-86. Williams G.A., Helmuth B., Russel B.D., Dong W.-Y., Thiyagarajan V., Seuront L., 2016. Meeting the climate change challenge: Pressing issues in southern China an SE Asian coastal ecosystems. Regional Studies in Marine Science, 8, 373-381. Doi: 10.1016/j.rsma.2016.07.002. Woodroffe C.D., Rogers K., McKee K.L., Lovdelock C.E., Mendelssohn I.A., Saintilan N., 2016. Mangrove sedimentation and response to relative sea-level rise. Annual Review of Marine Science, 8, 243-266. Doi: 10.1146/annurev-marine-122414-034025.

The Tobol and the Irtysh watershed occupy the western part of West-Siberian plain. Area studied covers latitudinal band between 55° and 57° n. l. It includes the southern part of subtaiga subzone and northern part of forest-steppe zone. This territory has been used for agriculture since XVIIth century. In the middle of XXth century the local landscapes were represented by endless arable lands alternated with tiny patches of forests on the watersheds and swamps and solonchaks prevailing at lowlands. In the end of XXth century the large areas of arable lands, especially in northern part of mentioned area, were abandoned. Nowadays this area is covered by fallow meadows on different stages of demutation. Vegetation studies of the region have started in the end of XIXth century. One of the best scientific works on local grasslands was written by B. N. Gorodkov (1915). The spectrum of natural plant communities demonstrates some changes fr om south to north. These changes enclose both zonal and intrazonal vegetation. The southern part of the area studied belongs to forest-steppe zone. Its zonal vegetation is represented by small-leaved forests, grasslands (steppe meadows) and meadow steppes. Zonal vegetation of northern part — subtaiga subzone — includes only small-leaved forests. The watershed grasslands replace the cut-off forests. Intrazonal vegetation of southern part consists of various grasslands on salty soils and swamps predominated in the northern part. The border of forest-steppe and subtaiga represents a combination of zonal and intrazonal communities disturbed by man. The goal of this article is to reveal the diversity of grasslands on drained soils of mentioned area. The analysis of 151 geobotanical relevйs obtained fr om subtaiga and northern forest-steppe of Omskaya and Tyumenskaya administrative districts has been carried out. The syntaxonomy of the Tobol-and-the Irtysh watershed grasslands is represented by 6 associations, 4 subassociations and 2 communities of 4 alliances, 4 order and 2 classes. Subtaiga and northern forest steppe are charac­terized by different spectra of grasslands. This can be explained by a presence of wide range of saline soils in forest-steppe and their absence in subtaiga. The floristic composition of grasslands of forest-steppes zone includes the plants tolerant to soil salinity such as Artemisia pontica, Galatella biflora, Plantago maxi­ma, Eryngium planum, Saussurea amara, Limonium gmelinii. The listed species are rare in subtaiga grasslands while Festuca pratensis, Phleum pratense, Agrostis gigantea of alliance Festucion pratensis are dominated in subtaiga grassland meadows. Steppe meadows of this territory are represented by two classes. Northern forest-steppe subzone demonstrates the northern lim it of Festuco-Brometea (alliance Galatellion biflorae of order Festucetalia valesiacae). The associations Galatello biflorae–Calamagrostietum epigeii and Galio borealis–Artemisietum ponticae occupy the zonal positions. Their communities are characterize by high activity of meadow-steppe mesoxerophytes that are the diagnostic of the class Festuco-Brometea. The meadow mesophytes dominate in subtaiga steppe meadows absolutely; meadow-steppe species are rare. They are marked with a lack of diagnostic species of alliance Galatellion biflorae. They are ascribed to the class Molinio–Arrhenatheretea, order Galietalia veri and alliance Trifolion montani as the communities Filipendula stepposa–Cenolophium denudatum and Astragalus danicus–Potentilla anserinа. Forest steppe meadows of alliance Aconito barbati–Vicion unijugae (order Carici macrou­rae–Crepidetalia sibiricae, class Molinio-Arrhena­theretea) are usual for northern, subtaiga subzone of the Tobol and the Irtysh watershed. Diagnostic species list of the communities belonging to the order Carici macrourae–Crepidetalia sibiricae on West-Siberian plain is impoverished in comparison with the uplands and the mountains of South Siberia wh ere this order was described by Ermakov et al. (1999). We have revealed 2 new associations of alliance Aconito barbati–Vicion unijugae: Aegopodio podagrariae–Brachypodietum pinnati and Dracocephalo ruyschiani–Heracleetum sibiricae. In subtaiga subzone communities of these associations occupy the small well drained habitats between mesophytic forests and arable lands. The first association unites the xerophytic forest meadows with Aegopodium podagraria dominance, occurring only on right bank of the Ishim River. The second one includes forest meadows of subtaiga widely spread on the Tobol and the Irtysh watershed. Association Dracocephalo ruyschiani–Heracleetum sibiricae comprises two subassociations: D. r.–H. s. typicum and D. r.–H. s.molinietosum caeruleae. One of diagnostic species of the last mentioned subassociation is Molinia caerulea that is a common species of boreal wet meadows of Europe. The eastern border of this species distribution is on the left riverside of the Ishim River. Meadows of alliance Festucion pratensis of order Arrhenatheretalia are characteristic only for subtaiga, they belong to two associations. Meadows of subassociation Cirsio setosi–Phleetum pratensis pastinacetosum sylvestris are widespread. They are wide spread over the abandoned arable lands and rather monotonous by their floristic composition. The floristic peculiarity of plant communities is abundance of diagnostic species of classes Artemisietea и Chenopodietea. Meadows of Agrostio tenuis–Festucetum pratensis Yamalov 2005 occur on sandy soils; they present one of the first stages of pine forest demutation. Some of species are not characteristic for typical subassociation described by S. M. Yamalov (2005), therefore the meadows of this association on the Tobol and the Irtysh watershed are referred to a new subassociation A. t.–F. p. senecionetosum jacobaea.

The impact of agricultural intensification on soil degradation now is occurring in tropical countries. The objective of this study was to determine the effect of long-term tillage and N fertilization on soil properties and crop yields in corn-soybean rotation. This long-term study which initiated since 1987 was carried out on a Typic Fragiudult soil at Politeknik Negeri Lampung, Sumatra (105o13’45.5"-105o13’48.0"E, 05o21’19.6"-05o21’19.7"S) in 2010 and 2011. A factorial experiment was arranged in a randomized block design with four replications. The first factor was tillage system namely intensive tillage (IT) and conservation tillage (CT) which consist of minimum tillage (MT) and no-tillage (NT); while the second factor was N fertilization with rates of 0, 100 and 200 kg N ha-1 applied for corn, and 0, 25, and 50 kg N ha-1 for soybean. The results showed that bulk density and soil strength at upper layer after 24 years of cropping were similar among treatments, but the soil strength under IT at 50-60 cm depth was 28.2% higher (p<0.05) than NT. Soil moisture and temperature under CT at 0-5 cm depth were respectively 38.1% and 4.5% higher (p<0.05) than IT. High N rate decreased soil pH at 0-20 cm depth as much as 10%, but increased total soil N at 0-5 cm depth as much as 19% (p<0.05). At 0-10 cm depth, MT with no N had highest exchangeable K, while IT with medium N rate had the lowest (p<0.05). At 0-5 cm depth, MT with no N had highest exchangeable Ca, but it had the lowest (p<0.05) if combined with higher N rate. Microbial biomass C throughout the growing season for NT was consistently highest and it was 14.4% higher (p<0.05) than IT. Compared to IT, Ap horizon of CT after 24 years of cropping was deeper, with larger soil structure and more abundance macro pores. Soybean and corn yields for long-term CT were 64.3% and 31.8% higher (p<0.05) than IT, respectively. Corn yield for long-term N with rate of 100 kg N ha-1 was 36.4% higher (p<0.05) than with no N.Keywords: Conservation tillage, crop yields, N fertilization, soil properties[How to Cite: Utomo M, IS Banuwa, H Buchari, Y Anggraini and Berthiria. 2013.Long-term Tillage and Nitrogen Fertilization Effects on Soil Properties and Crop Yields. J Trop Soils 18 (2): 131-139. Doi: 10.5400/jts.2013.18.2.131][Permalink/DOI: www.dx.doi.org/10.5400/jts.2013.18.2.131] REFERENCESAl-Kaisi and X Yin. 2005. Tillage and crop residue effects on soil carbon dioxide emission in corn- soybean rotation. J Environ Qual 34: 437-445. Pub Med. Barak P, BO Jobe, AR Krueger, LA Peterson and DA Laird. 1997. Effects of long-term soilacidification due to nitrogen inputs in Wisconsin. Plant Soil 197: 61-69.Blake GR and KH Hartge. 1986. Bulk density. In: A Klute (ed). Methods of Soil Analysis. ASA and SSSA. Madison, Wisconsin, USA, pp. 363-375.Blanco-Canqui H and R Lal. 2008. No-till and soil-profile carbon sequestration: an on farm assessment. Soil Sci Soc Am J 72: 693-701. Blanco-Canqui H, LR Stone and PW Stahlman. 2010. Soil response to long-term cropping systems on an Argiustoll in the Central Great Plains. Soil Sci Soc Am J 74: 602-611.Blevins RL, MS Smith, GW Thomas and WW Frye. 1983. Influence of conservation tillage on soil properties. J Soil Water Conserv 38: 301-305.Blevins RL, GW Thomas and PL Cornelius. 1977 Influence of no-tillage and nitrogen fertilization on certain soil properties after 5 years of continuous corn. Agron J 69: 383-386.Blevins, RL and WF Frye, 1993. Conservation tillage: an ecological approach to soil management. Adv Agron 51: 34-77.Brady NC and RR Weil. 2008. The nature and properties of soils. Pearson Prentice Hall. Fourteenth Edition. New Jersey, 965 p.Brito-Vega, H, D Espinosa-Victoria, C Fragoso, D Mendoza, N De la Cruz Landaro and A Aldares-Chavez. 2009. Soil organic particle and presence of earthworm under different tillage systems. J Biol Sci 9: 180-183.Derpch, R 1998. Historical review of no-tilage cultivation of crops. JIRCAS Working Rep. JAPAN Int Res Ctr for Agric Sciences, Ibaraki, Japan 13: 1-18. Diaz-Zorita, M., JH Grove, L Murdock, J Herbeck and E Perfect. 2004. Soil structural disturbance effects on crop yields and soil properties in a no-till production system. Agron J 96: 1651-1659.Dickey EC, PJ Jasa and RD Grisso. 1994. Long-term tillage effect on grain yield and soil properties in a soybean/grain sorghum Rotation. J Prod Agric 7: 465 - 470.Edwards WM, LD, Norton, CE, Redmond. 1988. Characterizing macro pores that affect infiltration into non tilled soil. Soil Sci Soc Am J 52: 483-487.Fernandez RO, PG Fernandez, JVG Cervera and FP Torres. 2007 Soil properties and crop yields after 21 years of direct drilling trials in southern Spain. Soil Till Res 94: 47-54.Fengyun Z, W Pute, Z Xining and C Xuefeng. 2011. The effects of no-tillage practice on soil physical properties. Afr J Biotech 10: 17645-17650. Havlin, JL, JD Beaton, SM Tisdale and WL Nelson. 2005. Soil Fertility and Fertilizer: an Introduction to Nutrient Management. Pearson Prantice Hall. Sevent Edition. Upper Saddle River, New Jersey, 515 p.Karlen DL, NC Wollenhaupt, DC Erbach, EC Berry, JB Swan, NS Eash and JL Jordahl. 1994. Crop residue effects on soil quality following 10-years of no-till corn. Soil Till Res 31: 149-167.Kumar A and DS Yadav. 2005. Effect of zero and minimum tillage in conjunction with nitrogen management in wheat (Triticum aestivum ) after rice (Oryza sativa.). Indian J Agron 50 (1): 54-57.Lal R. 1989. Conservation tillage for sustainable agriculture: tropics versus temper­ate environment. Adv Agron 42: 85-197.Lal R. 1997. Residue management, conservation tillage and soil restoration for mitigating greenhouse effect by CO2 enrichment. Soil Till Res 43: 81-107.Lal R. 2007. Soil science in a changing climate. CSA New 52: 1-9.Mallory J J, RH Mohtar, GC Heathman, DG Schulze and E Braudeau. 2011. Evaluating the effect of tillage on soil structural properties using the pedostructure concept. Geoderma 163: 141-149. doi:10.1016/ j.geoderma. 2011.01.018. 9p.Paustian K, HP Collins and EA Paul. 1997. Management control on soil carbon. In: EA Paul, ET Elliot, K Paustian and CV Cole (eds). Soil Organic Matter in Temperate Agro-ecosystems: Long-term Experiment in North America. CRC Press, pp. 15-50.Rasmussen, KJ. 1999. Impact of ploughless soil tillage on yield and soil quality: A Scandinavian review. Soil Till Res 53: 3-14.Quintero M. 2009. Effects of conservation tillage in soil carbon sequestration and net revenues of potato-based rotations in the Colombian Andes. [Thesis], University of Florida, USA. SAS [Statistical Analysis System] Institute. 2003. The SAS system for windows. Release 9.1. SASInst Inc, Cary, NC.Singh A and J Kaur. 2012. Impact of conservation tillage on soil properties in rice-wheat cropping system. Agric Sci Res J 2: 30-41.Six, J, SD Frey, RK Thiet and KM Batten. 2006. Bacterial and fungal contributions to carbon sequestration in agroecosystems. Soil Sci Soc Am J 70: 555-569.Smith JL and HP Collins. 2007. Management of organisms and their processes in soils. In: EA Paul (ed). Soil Microbiology, Ecology and Biochemistry. Third Edition. Academic Press, Burlington, USA, 532 p.Stockfisch N, T Forstreuter, W Ehlers. 1999. Ploughing effects on soil organic matter after twenty years of conservation tillage in Lower Saxony, Germany. Soil Till Res 52: 91-101.Tarkalson, DD, GW Hergertb and KG Cassmanc. 2006. Long-term effects of tillage on soil chemical properties and grain yields of a dryland winter wheat-sorghum/corn-fallow rotation in the great plains. Agron J 26: 26-33. Thomas GA, RC Dalal, J Standley. 2007. No-till effect on organic matter, pH, cation exchange capacity and nutrient distribution in a Luvisol in the semi-arid subtropics. Soil Till Res 94: 295-304.Utomo M, H Suprapto and Sunyoto. 1989. Influence of tillage and nitrogen fertilization on soil nitrogen, decomposition of alang-alang (Imperata cylindrica) and corn production of alang-alang land. In: J van der Heide (ed.). Nutrient management for food crop production in tropical farming systems. Institute for Soil Fertility (IB), pp. 367-373.Utomo M. 2004. Olah tanah konservasi untuk budidaya jagung berkelanjutan. Prosiding Seminar Nasional IX Budidaya Pertanian Olah Tanah Konservasi. Gorontalo, 6-7 Oktober, 2004, pp. 18-35 (in Indonesian).Utomo M, A Niswati, Dermiyati, M R Wati, AF Raguan and S Syarif. 2010. Earthworm and soil carbon sequestration after twenty one years of continuous no-tillage corn-legume rotation in Indonesia. JIFS 7: 51-58.Utomo M, H Buchari, IS Banuwa, LK Fernando and R Saleh. 2012. Carbon storage and carbon dioxide emission as influenced by long-term conservation tillage and nitrogen fertilization in corn-soybean rotation. J Trop Soil 17: 75-84.Wang W, RC Dalal and PW Moody. 2001. Evaluation of the microwave irradiation method for measuring soil microbial biomass. Soil Sci Soc Am J 65: 1696-1703.Wright AL and FM Hons. 2004. Soil aggregation and carbon and nitrogen storage under soybean cropping sequences. Soil Sci Soc Am J 68: 507-513. Zibilske LM, JM Bradford and JR Smart. 2002. Conservation tillage induced change in organic carbon, total nitrogen and available phosphorus in a semi-arid alkaline subtropical soil. Soil Till Res 66: 153-163.

While the first two chapters of Doucas's historical work present a meagre outline of world history - a sketch which becomes a little more detailed from 1261 on, when the narration reaches the history of the Turks and their conquests in Asia Minor - the third chapter deals with the well-known battle of Kosovo, which took place in 1389. From that point on, the Byzantine historian gives much important information on Serbia, as well as on the Ottoman advances in the Balkans, and thus embarks upon his central theme - the rise of the Turks and the decline of Byzantium. Doucas considers the battle of Kosovo a key event in the subjugation of the Balkan peoples by the Turks, and he shows that after the battle of Kosovo the Serbs were the first to suffer that fate. At the beginning, Doucas says that after the death of Orhan, the ruler (o archgos) of the Turks, his son and successor Murad conquered the Thracian towns, Adrianople and the whole Thessaly, so that he mastered almost all the lands of the Byzantines, and finally reached the Triballi (Triballous). He devastated many of their towns and villages sending the enslaved population beyond Chersonesus, until Lazar, son of King Stefan of Serbia (Serbias), who ruled (kraley?n) in Serbia at that time decided to oppose him with all the might he could muster. The Serbs were often called Triballi by Byzantine authors. For the fourteenth century writers Pachymeres, Gregoras, Metochites and Kantakouzenos the Serbs were Triballi. However, Pachymeres and Gregoras refer to the rulers of the Triballi as the rulers of Serbia. Fifteenth century writers, primarily Chalcondyles and Critobulos, use only that name. It seems, nevertheless, that Doucas makes a distinction between the Triballi and the Serbs. As it is known, the conquest of the Serbian lands by the Turks began after the battle on the river Marica in 1371. By 1387. the Turks had mastered Serres(1388) Bitola and Stip (1385), Sofia (1385), Nis (1386) and several other towns. Thus parts of Macedonia, Bulgaria and even of Serbia proper were reduced by the Turks by 1387. For Doucas, however, this is the territory inhabited by the Triballi. After the exposition of the events on Kosovo, Doucas inserts an account of the dispute of John Kantakouzenos and the regency on behalf of John V, which had taken place, as it is known, long before 1389. At the beginning of his description of the civil war, Doucas says that by dividing the empire Kantakouzenos made it possible for the Turks to devastate not only all the lands under Roman rule, but also the territories of the Triballi Moesians and Albanians and other western peoples. The author goes on to narrate that Kantakouzenos established friendly relations with the king Stefan Du{an, and reached an agreement with him concerning the fortresses towns and provinces of the unlucky Empire of the Romaioi, so that, instead of giving them over to the Roman lords, he surrendered them to barbarians, the Triballi and the Serbs (Triballoys te kai Serbous). When he speaks later how the Tatars treated the captives after the battle of Angora in 1402, Doucas points out that the Divine Law, honored from times immemorial not only among the Romaioi, but also among the Persians, the Triballi and the Scythians (as he calls Timur's Tatars), permitted only plunder, not the taking of captives or any executions outside the battlefield when the enemy belonged to the same faith. Finally, when he speaks of the conflict between Murad II and Juneid in Asia Minor, Doucas mentions a certain Kelpaxis, a man belonging to the people of the Triballi, who took over from Juneid the rule over Ephesus and Ionia. It seems, therefore, that Doucas, when he speaks of the land of the Triballi he has in mind a broad ethnical territory in the Balkans, which was obviously not settled by the Serbs only or even by the Slavs only. According to him Kelpaxis (Kelpaz?sis) also belonged to the Triballi, although the name can hardly be of Slavonic, i.e. Serbian origin. On the other hand, he is definitely aware of Serbia, a state which had left substantial traces in the works of Byzantine authors, particularly from the time when it usurped (according to the Byzantine view) the Empire. Writing a whole century after Dusan's coronation as emperor, Doucas is not willing, as we shall see later to recognize this usurpation. Although he ascribes to Serbia, in conformity with the Byzantine conception of tazis, a different rank, he considers Serbia and the Serbs, as they are generally called in his work (particularly when he describes the events after the Battle of Kosovo) an important factor in the struggle against the Turks. Therefore he makes a fairly accurate distinction between the Serbs and the other Triballi. In his case, the term may in fact serve as a geographical designation for the territory settled by many peoples, including the Serbs. When he uses specific titles and when he speaks of the degrees of authority conveyed by them in individual territories Doucas is anxious to prove himself a worthy scion of the Romaioi, who considered that they had the exclusive right to the primacy in the Christian hierarchy with the Roman emperor at its top. He makes distinctions of rank between individual rulers. The Emperor in Constantinople is for him the only emperor of the Romans (basileys t?n R?mai?n). King Sigismund of Hungary is also styled emperor, but as basileys t?n R?man?n, meaning Latin Christians. The last Byzantine emperor Constantine XI Dragas Palaleologus is not recognized as an emperor, and the author calls his rule a despotic rule (despoteia). He has a similar view of the Serbs. Thus he says, erroneously that Lazar was the son of King Stefan of Serbia (yios Stefanoy toy kral? Serbias) and that he ruled Serbia at that time (o tote t?n Serbian kraley?n). Elsewhere, Doucas explains his attitude and says that o t?n Serb?n archgos etolm?sen anadusasthai kratos kai kral?s onomazesthai. Toyto gar to barbaron onoma exell?nizomenon basileys erm?neyetai. Lazar exercises royal power (kraley?n) in Serbia, which is appropriate, for the author thinks erroneously that Lazar was the son and successor of King Stefan Du{an. It is significant that he derives the werb kraley? from the Serbian title 'kralj', i.e. from the title which never existed in the Byzantine Empire. Moreover, there is no mention of this werb in any other Byzantine text. When he narrates how Serbia fell under the Turkish rule in 1439, Doucas says that Despot Djuradj Brankovic seeing his ravaged despotate (despoteian), went to the King of Hungary hoping to get aid from him. There can be no doubt that the term despoteia here refers to the territory ruled by Despot Djuradj Brankovic. Doucas correctly styles the Serbian rulers after 1402 as despots. The space he devotes to Serbia in his work, as well as the manner in which he speaks of it, seems to indicate, however, that he regarded it, together with Hungary as a obstacle of the further Turkish conquests in the Balkans. Doucas's text indicates that Serbia, though incomparably weaker than in the time of Dusan's mighty empire, was in fact the only remaining more or less integral state in the Peninsula. The riches of Serbia and, consequently, of its despots, is stressed in a number of passages. Almost at the very beginning Doucas says that Bayezid seized 'a sufficient quantity of silver talents from the mines of Serbia' after the Battle of Kosovo. When Murad II conducted negotiations with Despot Djuradj for his marriage with the Despot's daughter Mara, Doucas writes, no one could guess how many 'gold and silver talents' he took. Doucas also says that the Despot began to build the Smederevo fortress with Murad's permission. The building of a fortress has never been an easy undertaking and if we bear in mind that Despot Djuradj built the part of the Smederevo fortress called 'Mali Grad' (Small fortress) in two years only, we realize that his economic power was really considerable. When Fadulah, the counselor of Murad II, sought to persuade his lord to occupy Serbia, he stressed the good position of the country, particularly of Smederevo, and the country's abundant sources of silver and gold, which would enable Murad not only to conquer Hungary, but also to advance as far as Italy. After Mehmed II captured Constantinople, the Serbs undertook to pay an annual tribute of 12.000 gold coins, more than the despots of Mistra, the lords of Chios Mitylene or the Emperor of Trebizond. Already in 1454 the Despot's men brought the tribute to Mehmed II and also ransomed their captives. Critobulos's superb description of Serbia is the best testimony that this was not only Doucas's impression: 'Its greatest advantage, in which it surpasses the other countries, is that it produces gold and silver? They are mined everywhere in that region, which has rich veins of both gold and silver, more abundant than those of India. The country of the Triballi was indeed fortunate in this respect from the very beginning and it was proud of its riches and its might. It was a kingdom with numerous flourishing towns and strong and impregnable fortresses. It was also rich in soldiers and armies as well as in good equipment. It had citizens of the noblest rank and it brought up many youths who had the strength of adult men. It was admired and famous, but it was also envied, so that is was not only loved of many, but also disliked by many people who sought to harm It'. It is no wonder that George Sphrantzes once complains that Christians failed to send aid to Constantinople and that he singles out for particular blame that 'miserable despot, who did not realize that once the head is removed, the limbs, too disappear'. It may be said, therefore, that Doucas regarded Serbia as one of the few remaining allies of at least some ability to stem the Turkish advances, and that this opinion was primarily based on its economic resources. Serbia was clearly distinguished as a state structure, as opposed to most of the remaining parts of the Peninsula, inhabited by peoples which Doucas does not seem to differentiate precisely. According to him, the authority over a particular territory issued from the ruler's title, the title of despot, which was first in importance after the imperial title, also determined the rank of Serbia in the Byzantine theory of hierarchy of states. Doucas's testimony also shows that this theory not only endured until the collapse of the Empire, but that it also persisted even in the consciousness of the people who survived its fall.

ABSTRACT: Asia is the second region after Africa to have the tallest prevalence of stunting in the world. Indonesia is one of the countries in Southeast Asia with the fifth highest prevalence of stunting in the world at 37%, or nearly 9 million children who experience stunting. This study aims to examine the factors that influence and risk the occurrence of stunting in children in Indonesia. The research method uses a type of qualitative research with a traditional literature review. This study found that stunting is influenced by several complex factors not only at the individual level but also at the family and community levels. A comprehensive synthesis of the available evidence on the determinants of stunting in children in Indonesia outlines who is most vulnerable to stunting, which interventions are successful, and what new research is needed to fill knowledge gaps. Keywords: Indonesian toddlers, stunting factors References: Adair, L. S., & Guilkey, D. K. (1997). Age-specific Determinants of Stunting in Filipino Children. The Journal of Nutrition, 127(2), 314–320. https://doi.org/10.1093/jn/127.2.314 Akombi, B. J., Agho, K. E., Hall, J. J., Merom, D., Astell-Burt, T., & Renzaho, A. M. N. (2017). Stunting and Severe Stunting Among Children Under-5 Years in Nigeria: A Multilevel Analysis. BMC Pediatrics, 17(1), 1–16. https://doi.org/10.1186/s12887-016-0770-z Asfaw, M., Wondaferash, M., Taha, M., & Dube, L. (2015). Prevalence of Undernutrition and Associated Factors Among Children Aged Between Six to Fifty Nine Months in Bule Hora District, South Ethiopia. BMC Public Health,15(1), 41. https://doi.org/10.1186/s12889-015-1370-9 Badan Penelitian dan Pengembangan Kesehatan. (2018). Hasil Utama RISKESDAS 2018. Bardosono, S., Sastroamidjojo, S., & Lukito, W. (2007). Determinants of Child Malnutrition During the 1999 Economic Crisis in Selected Poor Areas of Indonesia. Asia Pacific Journal of Clinical Nutrition, 16(3), 512–526. Best, C. M., Sun, K., De Pee, S., Sari, M., Bloem, M. W., & Semba, R. D. (2008). Paternal Smoking and Increased Risk of Child Malnutrition Among Families in Rural Indonesia. Tobacco Control, 17(1), 38–45. https://doi.org/10.1136/tc.2007.020875 Biadgilign, S., Shumetie, A., & Yesigat, H. (2016). Does Economic Growth Reduce Childhood Undernutrition in Ethiopia? PLoS ONE, 11(8), 1–14. https://doi.org/10.1371/journal.pone.0160050 Black, R. E., Victoria, C. G., Walker, S. P., Bhutta, Z. A., Christian, P., Onis, M. de, Ezzati, M., McGregor, S. G., Katz, J., Martorell, R., Uauy, R., & The Maternal and Child Nutrition Study Group. (2013). Maternal and Child Undernutrition and Overweight in Low-income and Middle-income Countries. The Lancet, 382, 396. Budge, S., Parker, A. H., Hutchings, P. T., & Garbutt, C. (2019). Environmental Enteric Dysfunction and Child Stunting. Nutrition Reviews, 77(4), 240–253. https://doi.org/10.1093/nutrit/nuy068 Burchi, F. (2010). Child Nutrition in Mozambique in 2003: The Role of Mother’s Schooling and Nutrition Knowledge. Economics and Human Biology, 8(3), 331–345. https://doi.org/10.1016/j.ehb.2010.05.010 Casale, D., Espi, G., & Norris, S. A. (2018). Estimating the pathways through which maternal education affects stunting: Evidence from an urban cohort in South Africa. 21(10), 1810–1818. https://doi.org/10.1017/S1368980018000125 Casanovas, M. del C., Lutter, C. K., Mangasaryan, N., Mwadime, R., Hajeebhoy, N., Aguilar, A. M., Kopp, C., Rico, L., Ibiett, G., Andia, D., & Onyango, A. W. (2013). Multi-sectoral Intervensions for Healthy Growth. Matern Child Nutrition, 2, 46–57. https://doi.org/10.1111/mcn.12082 Chirande, L., Charwe, D., Mbwana, H., Victor, R., Kimboka, S., Issaka, A. I., Baines, S. K., Dibley, M. J., & Agho, K. E. (2015). Determinants of Stunting and Severe Stunting Among Under-Fives in Tanzania: Evidence from The 2010 Cross-sectional Household Survey. BMC Pediatrics, 15(1), 1–13. https://doi.org/10.1186/s12887-015-0482-9 Creswell, J. W. (2014). A Concise Introduction to Mixed Methods Research. SAGE Publications Inc. Dao, D., Thang, V. Van, & Hoa, D. T. (2010). Malnutrition Status and Related Factors Within Ethnic Minority Children Under 5 Years Old in North Tra My District, Quang Nam Province in 2010. Journal of Science, 61. Fantay Gebru, K., Mekonnen Haileselassie, W., Haftom Temesgen, A., Oumer Seid, A., & Afework Mulugeta, B. (2019). Determinants of Stunting Among Under-Five Children in Ethiopia: A Multilevel Mixed-Effects Analysis of 2016 Ethiopian Demographic and Health Survey Data. BMC Pediatrics, 19(1), 1–13. https://doi.org/10.1186/s12887-019-1545-0 Fitri, L. (2018). Hubungan BBLR dan ASI Eksklusif Dengan Kejadian Stunting di Puskesmas Lima Puluh Pekanbaru. Jurnal Endurance, 3(1), 131–137. Goldstein, H. (2010). Multilevel Statistical Models, 4th Edition. Wiley. Handayani, F., Siagian, A., & Aritonang, E. (2017). Mother’s Education as A Determinant of Stunting among Children of Age 24 to 59 Months in North Sumatera Province of Indonesia. IOSR Journal of Humanities and Social Science, 22, 58–64. https://doi.org/10.9790/0837-2206095864 Hendraswari, C. A., Purnamaningrum, Y. E., Maryani, T., Widyastuti, Y., & Harith, S. (2021). The Determinants of Stunting for Children Aged 24-59 Months in Kulon Progo District 2019. Kesmas: Jurnal Kesehatan Masyarakat Nasional, 16(2), 71–77. https://doi.org/10.21109/kesmas.v16i2.3305 Hoddinott, J., Alderman, H., Behrman, J. R., Haddad, L., & Horton, S. (2013). The Economic Rationale For Investing In Stunting Reduction. Maternal & Child Nutrition, 9, 69–82. https://doi.org/10.1111/mcn.12080 Horrell, S., Humphries, J., & Voth, H.-J. (2001). Destined for Deprivation: Human Capital Formation and Intergenerational Poverty in Nineteenth-Century England. Explorations in Economic History, 38(3), 339–365. https://doi.org/10.1006/exeh.2000.0765 International Food Policy Research Institute. (2016). Global Nutrition Report 2016: From Premise to Impact: Ending Malnutrition by 2030. Kementerian Kesehatan Republik Indonesia. (2016). InfoDATIN: Situasi Balita Pendek. Kementerian Kesehatan Republik Indonesia. (2018). Warta KESMAS: Cegah Stunting itu Penting. Kimani-Murage, E. W., Muthuri, S. K., Oti, S. O., Mutua, M. K., Van De Vijver, S., & Kyobutungi, C. (2015). Evidence of A Double Burden of Malnutrition in Urban Poor Settings in Nairobi, Kenya. PLoS ONE, 10(6), 1–17. https://doi.org/10.1371/journal.pone.0129943 Kusumawati, E., Rahardjo, S., & Sari, H. P. (2015). Model Pengendalian Faktor Risiko Stunting pada Anak Usia di Bawah Tiga Tahun Model of Stunting Risk Factor Control among Children under Three Years. Kesmas: Jurnal Kesehatan Masyarakat Nasional, 9, 249–256. Madan, E. M., Haas, J. D., Menon, Purnima., & Gillespie, Stuart. (2018). Seasonal Variation In The Proximal Determinants Of Undernutrition During The First 1000 Days Of Life In Rural South Asia: A Comprehensive Review.Global Food Security, 19, 11–23. https://doi.org/10.1016/j.gfs.2018.08.008 McGregor, S. G., Cheung, Y. B., Cueto, S., Glewwe, P., Ritcher, L., Strupp, B., & International Child Development Steering Group. (2007). Developmental Potential in The First 5 Years for Children in Developing Countries. The Lancet, 369, 60–70. https://doi.org/10.1016/S0140-6736(07)60032-4 Mugianti, S., Mulyadi, A., Anam, A. K., & Najah, Z. L. (2018). Faktor Penyebab Anak Stunting Usia 25-60 Bulan di Kecamatan Sukorejo Kota Blitar. Jurnal Ners Dan Kebidanan (Journal of Ners and Midwifery), 5(3), 268–278. https://doi.org/10.26699/jnk.v5i3.art.p268-278 Ntenda, P. A. M., & Chuang, Y.-C. (2018). Analysis of Individual-level and Community-level Effects on Childhood Undernutrition in Malawi. Pediatr Neonatol, 59(4), 380–389. https://doi.org/10.1016/j.pedneo.2017.11.019 Oddo, V. M., Rah, J. H., Semba, R. D., Sun, K., Akhter, N., Sari, M., De Pee, S., Moench-Pfanner, R., Bloem, M., & Kraemer, K. (2012). Predictors of Maternal and Child Double Burden of Malnutrition in Rural Indonesia and Bangladesh. American Journal of Clinical Nutrition, 95(4), 951–958. https://doi.org/10.3945/ajcn.111.026070 Prado, E. L., & Dewey, K. G. (2014). Nutrition and brain development in early life. Nutrition Reviews, 72(4), 267–284. https://doi.org/10.1111/nure.12102 Prakhasita, R. C. (2019). Hubungan Pola Pemberian Makan Dengan Kejadian Stunting Pada Balita Usia 12-59 Bulan di Wilayah Kerja Puskesmas Wedi Surabaya. Universitas Airlangga. Reynaldo, Martorell., & Young, M. F. (2012). Patterns of Stunting and Wasting: Potential Explanatory Factors. Advances in Nutrition, 3(2), 227–233. https://doi.org/10.3945/an.111.001107 Rosiyati, E., Pratiwi, E. A. D., Poristinawati, I., Rahmawati, E., Nurbayani, R., Lestari, S., Wardani, P. S., & Nugroho, M. R. (2019). Determinants of Stunting Children (0-59 Months) in Some Countries in Southeast Asia. Jurnal Kesehatan Komunitas, 4(3), 88–94. https://doi.org/10.25311/keskom.vol4.iss3.262 Sari, M., De Pee, S., Bloem, M. W., Sun, K., Thorne-Lyman, A. L., Moench-Pfanner, R., Akhter, N., Kraemer, K., & Semba, R. D. (2010). Higher Household Expenditure on Animal-Source and Nongrain Foods Lowers the Risk of Stunting Among Children 0-59 Months Old in Indonesia: Implications of Rising Food Prices. Journal of Nutrition, 140(1), 195–200. https://doi.org/10.3945/jn.109.110858 Satriawan, E. (2018). Strategi Nasional Percepatan Pencegahan Stunting 2018-2024. [National Strategy for the Acceleration of Stunting Prevention] Semba, R. D., Kalm, L. M., De Pee, S., Ricks, M. O., Sari, M., & Bloem, M. W. (2007). Paternal Smoking is Associated with Increased Risk of Child Malnutrition Among Poor Urban Families in Indonesia. Public Health Nutrition, 10(1), 7–15. https://doi.org/10.1017/S136898000722292X Semba, R. D., Moench-Pfanner, R., Sun, K., De Pee, S., Akhter, N., Rah, J. H., Campbell, A. A., Badham, J., Bloem, M. W., & Kraemer, K. (2011). Consumption of Micronutrient-fortified Milk and Noodles is Associated with Lower Risk of Stunting in Preschool-Aged Children in Indonesia. Food and Nutrition Bulletin, 32(4), 347–353. https://doi.org/10.1177/156482651103200406 Shieh, S. J., Chen, H. L., Liu, F. C., Liou, C. C., Lin, Y. in H., Tseng, H. I., & Wang, R. H. (2010). The Effectiveness of Structured Discharge Education on Maternal Confidence, Caring Knowledge, and Growth of Premature Newborns. Journal of Clinical Nursing, 19(23–24), 3307–3313. https://doi.org/10.1111/j.1365-2702.2010.03382.x Stewart, C. P., Iannotti, L., Dewey, K. G., Michaelsen, K. F., & Onyango, A. W. (2013). Contextualising Complementary Feeding in a Broader Framework for Stunting Prevention. Matern Child Nutrition, 9(2), 27–45. https://doi.org/10.1111/mcn.12088 Tim Nasional Percepatan Penanggulangan Kemiskinan. (2017). 100 Kabupaten/Kota Prioritas Untuk Intervensi Anak Kerdil (Stunting). Titaley, C. R., Ariawan, I., Hapsari, D., Muasyaroh, A., & Dibley, M. J. (2013). Determinants of the Stunting of Children in Indonesia: A Multilevel Analysis of the 2013 Indonesia Basic Health Survey. Nutrients, 11, 1160. UNICEF. (2015a). UNICEF’ s Approach to Scaling Up Nutrition for Mothers and Their Children. Programme Division, February 9. UNICEF. (2015b). UNICEF’s Approach to Scalling Up Nutrition For Mothers and Their Children. UNICEF. (2018). Progress For Every Child in The SDG Era. United Nations. (2021). United Nations Sustainable Development Goal 2: Zero Hunger. https://sdgs.un.org/goals/goal2 United Nations Children’s Fund. (2013). Improving Child Nutrition: The Achievable Imperative for Global Progress. Worku, B. N., Abessa, T. G., Wondafrash, M., Vanvuchelen, M., Bruckers, L., & Kolsteren, P. (2018). The Relationship of Undernutrition/Psychosocial Factors and Developmental Outcomes of Children in Extreme Poverty in Ethiopia. BMC Pediatrics, 18(1), 1–9. http://dx.doi.org/10.1186/s12887-018-1009-y World Bank Group. (2016). World Development Report 2016: Digital Dividends. World Health Organization. (2010). Nutrition Landscape Information System (NLIS) Country Profile Indicators: Interpretation Guide. World Health Organization. (2012). The Sixty Fifth World Health Assembly: Maternal, Infant, and Young Child Nutrition. World Health Organization. (2014). Global Nutrition Targets 2025: Stunting Policy Brief (No.WHO/NMH/NHD/14.3).

Education in Oceania continues to reflect the embedded implicit and explicit colonial practices and processes from the past. This paper conceptualises a cultural approach to education and leadership appropriate and relevant to the Republic of the Marshall Islands. As elementary school leaders, we highlight Kanne Lobal, a traditional Marshallese navigation practice based on indigenous language, values and practices. We conceptualise and develop Kanne Lobal in this paper as a framework for understanding the usefulness of our indigenous knowledge in leadership and educational practices within formal education. Through bwebwenato, a method of talk story, our key learnings and reflexivities were captured. We argue that realising the value of Marshallese indigenous knowledge and practices for school leaders requires purposeful training of the ways in which our knowledge can be made useful in our professional educational responsibilities. Drawing from our Marshallese knowledge is an intentional effort to inspire, empower and express what education and leadership partnership means for Marshallese people, as articulated by Marshallese themselves. Introduction As noted in the call for papers within the Waikato Journal of Education (WJE) for this special issue, bodies of knowledge and histories in Oceania have long sustained generations across geographic boundaries to ensure cultural survival. For Marshallese people, we cannot really know ourselves “until we know how we came to be where we are today” (Walsh, Heine, Bigler & Stege, 2012). Jitdam Kapeel is a popular Marshallese concept and ideal associated with inquiring into relationships within the family and community. In a similar way, the practice of relating is about connecting the present and future to the past. Education and leadership partnerships are linked and we look back to the past, our history, to make sense and feel inspired to transform practices that will benefit our people. In this paper and in light of our next generation, we reconnect with our navigation stories to inspire and empower education and leadership. Kanne lobal is part of our navigation stories, a conceptual framework centred on cultural practices, values, and concepts that embrace collective partnerships. Our link to this talanoa vā with others in the special issue is to attempt to make sense of connections given the global COVID-19 context by providing a Marshallese approach to address the physical and relational “distance” between education and leadership partnerships in Oceania. Like the majority of developing small island nations in Oceania, the Republic of the Marshall Islands (RMI) has had its share of educational challenges through colonial legacies of the past which continues to drive education systems in the region (Heine, 2002). The historical administration and education in the RMI is one of colonisation. Successive administrations by the Spanish, German, Japanese, and now the US, has resulted in education and learning that privileges western knowledge and forms of learning. This paper foregrounds understandings of education and learning as told by the voices of elementary school leaders from the RMI. The move to re-think education and leadership from Marshallese perspectives is an act of shifting the focus of bwebwenato or conversations that centres on Marshallese language and worldviews. The concept of jelalokjen was conceptualised as traditional education framed mainly within the community context. In the past, jelalokjen was practiced and transmitted to the younger generation for cultural continuity. During the arrival of colonial administrations into the RMI, jelalokjen was likened to the western notions of education and schooling (Kupferman, 2004). Today, the primary function of jelalokjen, as traditional and formal education, it is for “survival in a hostile [and challenging] environment” (Kupferman, 2004, p. 43). Because western approaches to learning in the RMI have not always resulted in positive outcomes for those engaged within the education system, as school leaders who value our cultural knowledge and practices, and aspire to maintain our language with the next generation, we turn to Kanne Lobal, a practice embedded in our navigation stories, collective aspirations, and leadership. The significance in the development of Kanne Lobal, as an appropriate framework for education and leadership, resulted in us coming together and working together. Not only were we able to share our leadership concerns, however, the engagement strengthened our connections with each other as school leaders, our communities, and the Public Schooling System (PSS). Prior to that, many of us were in competition for resources. Educational Leadership: IQBE and GCSL Leadership is a valued practice in the RMI. Before the IQBE programme started in 2018, the majority of the school leaders on the main island of Majuro had not engaged in collaborative partnerships with each other before. Our main educational purpose was to achieve accreditation from the Western Association of Schools and Colleges (WASC), an accreditation commission for schools in the United States. The WASC accreditation dictated our work and relationships and many school leaders on Majuro felt the pressure of competition against each other. We, the authors in this paper, share our collective bwebwenato, highlighting our school leadership experiences and how we gained strength from our own ancestral knowledge to empower “us”, to collaborate with each other, our teachers, communities, as well as with PSS; a collaborative partnership we had not realised in the past. The paucity of literature that captures Kajin Majol (Marshallese language) and education in general in the RMI is what we intend to fill by sharing our reflections and experiences. To move our educational practices forward we highlight Kanne Lobal, a cultural approach that focuses on our strengths, collective social responsibilities and wellbeing. For a long time, there was no formal training in place for elementary school leaders. School principals and vice principals were appointed primarily on their academic merit through having an undergraduate qualification. As part of the first cohort of fifteen school leaders, we engaged in the professional training programme, the Graduate Certificate in School Leadership (GCSL), refitted to our context after its initial development in the Solomon Islands. GCSL was coordinated by the Institute of Education (IOE) at the University of the South Pacific (USP). GCSL was seen as a relevant and appropriate training programme for school leaders in the RMI as part of an Asia Development Bank (ADB) funded programme which aimed at “Improving Quality Basic Education” (IQBE) in parts of the northern Pacific. GCSL was managed on Majuro, RMI’s main island, by the director at the time Dr Irene Taafaki, coordinator Yolanda McKay, and administrators at the University of the South Pacific’s (USP) RMI campus. Through the provision of GCSL, as school leaders we were encouraged to re-think and draw-from our own cultural repository and connect to our ancestral knowledge that have always provided strength for us. This kind of thinking and practice was encouraged by our educational leaders (Heine, 2002). We argue that a culturally-affirming and culturally-contextual framework that reflects the lived experiences of Marshallese people is much needed and enables the disruption of inherent colonial processes left behind by Western and Eastern administrations which have influenced our education system in the RMI (Heine, 2002). Kanne Lobal, an approach utilising a traditional navigation has warranted its need to provide solutions for today’s educational challenges for us in the RMI. Education in the Pacific Education in the Pacific cannot be understood without contextualising it in its history and culture. It is the same for us in the RMI (Heine, 2002; Walsh et al., 2012). The RMI is located in the Pacific Ocean and is part of Micronesia. It was named after a British captain, John Marshall in the 1700s. The atolls in the RMI were explored by the Spanish in the 16th century. Germany unsuccessfully attempted to colonize the islands in 1885. Japan took control in 1914, but after several battles during World War II, the US seized the RMI from them. In 1947, the United Nations made the island group, along with the Mariana and Caroline archipelagos, a U.S. trust territory (Walsh et al, 2012). Education in the RMI reflects the colonial administrations of Germany, Japan, and now the US. Before the turn of the century, formal education in the Pacific reflected western values, practices, and standards. Prior to that, education was informal and not binded to formal learning institutions (Thaman, 1997) and oral traditions was used as the medium for transmitting learning about customs and practices living with parents, grandparents, great grandparents. As alluded to by Jiba B. Kabua (2004), any “discussion about education is necessarily a discussion of culture, and any policy on education is also a policy of culture” (p. 181). It is impossible to promote one without the other, and it is not logical to understand one without the other. Re-thinking how education should look like, the pedagogical strategies that are relevant in our classrooms, the ways to engage with our parents and communities - such re-thinking sits within our cultural approaches and frameworks. Our collective attempts to provide a cultural framework that is relevant and appropriate for education in our context, sits within the political endeavour to decolonize. This means that what we are providing will not only be useful, but it can be used as a tool to question and identify whether things in place restrict and prevent our culture or whether they promote and foreground cultural ideas and concepts, a significant discussion of culture linked to education (Kabua, 2004). Donor funded development aid programmes were provided to support the challenges within education systems. Concerned with the persistent low educational outcomes of Pacific students, despite the prevalence of aid programmes in the region, in 2000 Pacific educators and leaders with support from New Zealand Aid (NZ Aid) decided to intervene (Heine, 2002; Taufe’ulungaki, 2014). In April 2001, a group of Pacific educators and leaders across the region were invited to a colloquium funded by the New Zealand Overseas Development Agency held in Suva Fiji at the University of the South Pacific. The main purpose of the colloquium was to enable “Pacific educators to re-think the values, assumptions and beliefs underlying [formal] schooling in Oceania” (Benson, 2002). Leadership, in general, is a valued practice in the RMI (Heine, 2002). Despite education leadership being identified as a significant factor in school improvement (Sanga & Chu, 2009), the limited formal training opportunities of school principals in the region was a persistent concern. As part of an Asia Development Bank (ADB) funded project, the Improve Quality Basic Education (IQBE) intervention was developed and implemented in the RMI in 2017. Mentoring is a process associated with the continuity and sustainability of leadership knowledge and practices (Sanga & Chu, 2009). It is a key aspect of building capacity and capabilities within human resources in education (ibid). Indigenous knowledges and education research According to Hilda Heine, the relationship between education and leadership is about understanding Marshallese history and culture (cited in Walsh et al., 2012). It is about sharing indigenous knowledge and histories that “details for future generations a story of survival and resilience and the pride we possess as a people” (Heine, cited in Walsh et al., 2012, p. v). This paper is fuelled by postcolonial aspirations yet is grounded in Pacific indigenous research. This means that our intentions are driven by postcolonial pursuits and discourses linked to challenging the colonial systems and schooling in the Pacific region that privileges western knowledge and learning and marginalises the education practices and processes of local people (Thiong’o, 1986). A point of difference and orientation from postcolonialism is a desire to foreground indigenous Pacific language, specifically Majin Majol, through Marshallese concepts. Our collective bwebwenato and conversation honours and values kautiej (respect), jouj eo mour eo (reciprocity), and jouj (kindness) (Taafaki & Fowler, 2019). Pacific leaders developed the Rethinking Pacific Education Initiative for and by Pacific People (RPEIPP) in 2002 to take control of the ways in which education research was conducted by donor funded organisations (Taufe’ulungaki, 2014). Our former president, Dr Hilda Heine was part of the group of leaders who sought to counter the ways in which our educational and leadership stories were controlled and told by non-Marshallese (Heine, 2002). As a former minister of education in the RMI, Hilda Heine continues to inspire and encourage the next generation of educators, school leaders, and researchers to re-think and de-construct the way learning and education is conceptualised for Marshallese people. The conceptualisation of Kanne Lobal acknowledges its origin, grounded in Marshallese navigation knowledge and practice. Our decision to unpack and deconstruct Kanne Lobal within the context of formal education and leadership responds to the need to not only draw from indigenous Marshallese ideas and practice but to consider that the next generation will continue to be educated using western processes and initiatives particularly from the US where we get a lot of our funding from. According to indigenous researchers Dawn Bessarab and Bridget Ng’andu (2010), doing research that considers “culturally appropriate processes to engage with indigenous groups and individuals is particularly pertinent in today’s research environment” (p. 37). Pacific indigenous educators and researchers have turned to their own ancestral knowledge and practices for inspiration and empowerment. Within western research contexts, the often stringent ideals and processes are not always encouraging of indigenous methods and practices. However, many were able to ground and articulate their use of indigenous methods as being relevant and appropriate to capturing the realities of their communities (Nabobo-Baba, 2008; Sualii-Sauni & Fulu-Aiolupotea, 2014; Thaman, 1997). At the same time, utilising Pacific indigenous methods and approaches enabled research engagement with their communities that honoured and respected them and their communities. For example, Tongan, Samoan, and Fijian researchers used the talanoa method as a way to capture the stories, lived realities, and worldviews of their communities within education in the diaspora (Fa’avae, Jones, & Manu’atu, 2016; Nabobo-Baba, 2008; Sualii-Sauni & Aiolupotea, 2014; Vaioleti, 2005). Tok stori was used by Solomon Islander educators and school leaders to highlight the unique circles of conversational practice and storytelling that leads to more positive engagement with their community members, capturing rich and meaningful narratives as a result (Sanga & Houma, 2004). The Indigenous Aborigine in Australia utilise yarning as a “relaxed discussion through which both the researcher and participant journey together visiting places and topics of interest relevant” (Bessarab & Ng’andu, 2010, p. 38). Despite the diverse forms of discussions and storytelling by indigenous peoples, of significance are the cultural protocols, ethics, and language for conducting and guiding the engagement (Bessarab & Ng’andu, 2010; Nabobo-Baba, 2008; Sualii-Sauni & Aiolupotea, 2014). Through the ethics, values, protocols, and language, these are what makes indigenous methods or frameworks unique compared to western methods like in-depth interviews or semi-structured interviews. This is why it is important for us as Marshallese educators to frame, ground, and articulate how our own methods and frameworks of learning could be realised in western education (Heine, 2002; Jetnil-Kijiner, 2014). In this paper, we utilise bwebwenato as an appropriate method linked to “talk story”, capturing our collective stories and experiences during GCSL and how we sought to build partnerships and collaboration with each other, our communities, and the PSS. Bwebwenato and drawing from Kajin Majel Legends and stories that reflect Marshallese society and its cultural values have survived through our oral traditions. The practice of weaving also holds knowledge about our “valuable and earliest sources of knowledge” (Taafaki & Fowler, 2019, p. 2). The skilful navigation of Marshallese wayfarers on the walap (large canoes) in the ocean is testament of their leadership and the value they place on ensuring the survival and continuity of Marshallese people (Taafaki & Fowler, 2019; Walsh et al., 2012). During her graduate study in 2014, Kathy Jetnil-Kijiner conceptualised bwebwenato as being the most “well-known form of Marshallese orality” (p. 38). The Marshallese-English dictionary defined bwebwenato as talk, conversation, story, history, article, episode, lore, myth, or tale (cited in Jetnil Kijiner, 2014). Three years later in 2017, bwebwenato was utilised in a doctoral project by Natalie Nimmer as a research method to gather “talk stories” about the experiences of 10 Marshallese experts in knowledge and skills ranging from sewing to linguistics, canoe-making and business. Our collective bwebwenato in this paper centres on Marshallese ideas and language. The philosophy of Marshallese knowledge is rooted in our “Kajin Majel”, or Marshallese language and is shared and transmitted through our oral traditions. For instance, through our historical stories and myths. Marshallese philosophy, that is, the knowledge systems inherent in our beliefs, values, customs, and practices are shared. They are inherently relational, meaning that knowledge systems and philosophies within our world are connected, in mind, body, and spirit (Jetnil-Kijiner, 2014; Nimmer, 2017). Although some Marshallese believe that our knowledge is disappearing as more and more elders pass away, it is therefore important work together, and learn from each other about the knowledges shared not only by the living but through their lamentations and stories of those who are no longer with us (Jetnil-Kijiner, 2014). As a Marshallese practice, weaving has been passed-down from generation to generation. Although the art of weaving is no longer as common as it used to be, the artefacts such as the “jaki-ed” (clothing mats) continue to embody significant Marshallese values and traditions. For our weavers, the jouj (check spelling) is the centre of the mat and it is where the weaving starts. When the jouj is correct and weaved well, the remainder and every other part of the mat will be right. The jouj is symbolic of the “heart” and if the heart is prepared well, trained well, then life or all other parts of the body will be well (Taafaki & Fowler, 2019). In that light, we have applied the same to this paper. Conceptualising and drawing from cultural practices that are close and dear to our hearts embodies a significant ontological attempt to prioritize our own knowledge and language, a sense of endearment to who we are and what we believe education to be like for us and the next generation. The application of the phrase “Majolizing '' was used by the Ministry of Education when Hilda Heine was minister, to weave cultural ideas and language into the way that teachers understand the curriculum, develop lesson plans and execute them in the classroom. Despite this, there were still concerns with the embedded colonized practices where teachers defaulted to eurocentric methods of doing things, like the strategies provided in the textbooks given to us. In some ways, our education was slow to adjust to the “Majolizing '' intention by our former minister. In this paper, we provide Kanne Lobal as a way to contribute to the “Majolizing intention” and perhaps speed up yet still be collectively responsible to all involved in education. Kajin Wa and Kanne Lobal “Wa” is the Marshallese concept for canoe. Kajin wa, as in canoe language, has a lot of symbolic meaning linked to deeply-held Marshallese values and practices. The canoe was the foundational practice that supported the livelihood of harsh atoll island living which reflects the Marshallese social world. The experts of Kajin wa often refer to “wa” as being the vessel of life, a means and source of sustaining life (Kelen, 2009, cited in Miller, 2010). “Jouj” means kindness and is the lower part of the main hull of the canoe. It is often referred to by some canoe builders in the RMI as the heart of the canoe and is linked to love. The jouj is one of the first parts of the canoe that is built and is “used to do all other measurements, and then the rest of the canoe is built on top of it” (Miller, 2010, p. 67). The significance of the jouj is that when the canoe is in the water, the jouj is the part of the hull that is underwater and ensures that all the cargo and passengers are safe. For Marshallese, jouj or kindness is what living is about and is associated with selflessly carrying the responsibility of keeping the family and community safe. The parts of the canoe reflect Marshallese culture, legend, family, lineage, and kinship. They embody social responsibilities that guide, direct, and sustain Marshallese families’ wellbeing, from atoll to atoll. For example, the rojak (boom), rojak maan (upper boom), rojak kōrā (lower boom), and they support the edges of the ujelā/ujele (sail) (see figure 1). The literal meaning of rojak maan is male boom and rojak kōrā means female boom which together strengthens the sail and ensures the canoe propels forward in a strong yet safe way. Figuratively, the rojak maan and rojak kōrā symbolise the mother and father relationship which when strong, through the jouj (kindness and love), it can strengthen families and sustain them into the future. Figure 1. Parts of the canoe Source: https://www.canoesmarshallislands.com/2014/09/names-of-canoe-parts/ From a socio-cultural, communal, and leadership view, the canoe (wa) provides understanding of the relationships required to inspire and sustain Marshallese peoples’ education and learning. We draw from Kajin wa because they provide cultural ideas and practices that enable understanding of education and leadership necessary for sustaining Marshallese people and realities in Oceania. When building a canoe, the women are tasked with the weaving of the ujelā/ujele (sail) and to ensure that it is strong enough to withstand long journeys and the fierce winds and waters of the ocean. The Kanne Lobal relates to the front part of the ujelā/ujele (sail) where the rojak maan and rojak kōrā meet and connect (see the red lines in figure 1). Kanne Lobal is linked to the strategic use of the ujelā/ujele by navigators, when there is no wind north wind to propel them forward, to find ways to capture the winds so that their journey can continue. As a proverbial saying, Kanne Lobal is used to ignite thinking and inspire and transform practice particularly when the journey is rough and tough. In this paper we draw from Kanne Lobal to ignite, inspire, and transform our educational and leadership practices, a move to explore what has always been meaningful to Marshallese people when we are faced with challenges. The Kanne Lobal utilises our language, and cultural practices and values by sourcing from the concepts of jouj (kindness, love), kautiej (respect), and jouj eo mour eo (reciprocity). A key Marshallese proverb, “Enra bwe jen lale rara”, is the cultural practice where families enact compassion through the sharing of food in all occurrences. The term “enra” is a small basket weaved from the coconut leaves, and often used by Marshallese as a plate to share and distribute food amongst each other. Bwe-jen-lale-rara is about noticing and providing for the needs of others, and “enra” the basket will help support and provide for all that are in need. “Enra-bwe-jen-lale-rara” is symbolic of cultural exchange and reciprocity and the cultural values associated with building and maintaining relationships, and constantly honouring each other. As a Marshallese practice, in this article we share our understanding and knowledge about the challenges as well as possible solutions for education concerns in our nation. In addition, we highlight another proverb, “wa kuk wa jimor”, which relates to having one canoe, and despite its capacity to feed and provide for the individual, but within the canoe all people can benefit from what it can provide. In the same way, we provide in this paper a cultural framework that will enable all educators to benefit from. It is a framework that is far-reaching and relevant to the lived realities of Marshallese people today. Kumit relates to people united to build strength, all co-operating and working together, living in peace, harmony, and good health. Kanne Lobal: conceptual framework for education and leadership An education framework is a conceptual structure that can be used to capture ideas and thinking related to aspects of learning. Kanne Lobal is conceptualised and framed in this paper as an educational framework. Kanne Lobal highlights the significance of education as a collective partnership whereby leadership is an important aspect. Kanne Lobal draws-from indigenous Marshallese concepts like kautiej (respect), jouj eo mour eo (reciprocity), and jouj (kindness, heart). The role of a leader, including an education leader, is to prioritise collective learning and partnerships that benefits Marshallese people and the continuity and survival of the next generation (Heine, 2002; Thaman, 1995). As described by Ejnar Aerōk, an expert canoe builder in the RMI, he stated: “jerbal ippān doon bwe en maron maan wa e” (cited in Miller, 2010, p. 69). His description emphasises the significance of partnerships and working together when navigating and journeying together in order to move the canoe forward. The kubaak, the outrigger of the wa (canoe) is about “partnerships”. For us as elementary school leaders on Majuro, kubaak encourages us to value collaborative partnerships with each other as well as our communities, PSS, and other stakeholders. Partnerships is an important part of the Kanne Lobal education and leadership framework. It requires ongoing bwebwenato – the inspiring as well as confronting and challenging conversations that should be mediated and negotiated if we and our education stakeholders are to journey together to ensure that the educational services we provide benefits our next generation of young people in the RMI. Navigating ahead the partnerships, mediation, and negotiation are the core values of jouj (kindness, love), kautiej (respect), and jouj eo mour eo (reciprocity). As an organic conceptual framework grounded in indigenous values, inspired through our lived experiences, Kanne Lobal provides ideas and concepts for re-thinking education and leadership practices that are conducive to learning and teaching in the schooling context in the RMI. By no means does it provide the solution to the education ills in our nation. However, we argue that Kanne Lobal is a more relevant approach which is much needed for the negatively stigmatised system as a consequence of the various colonial administrations that have and continue to shape and reframe our ideas about what education should be like for us in the RMI. Moreover, Kannel Lobal is our attempt to decolonize the framing of education and leadership, moving our bwebwenato to re-framing conversations of teaching and learning so that our cultural knowledge and values are foregrounded, appreciated, and realised within our education system. Bwebwenato: sharing our stories In this section, we use bwebwenato as a method of gathering and capturing our stories as data. Below we capture our stories and ongoing conversations about the richness in Marshallese cultural knowledge in the outer islands and on Majuro and the potentialities in Kanne Lobal. Danny Jim When I was in third grade (9-10 years of age), during my grandfather’s speech in Arno, an atoll near Majuro, during a time when a wa (canoe) was being blessed and ready to put the canoe into the ocean. My grandfather told me the canoe was a blessing for the family. “Without a canoe, a family cannot provide for them”, he said. The canoe allows for travelling between places to gather food and other sources to provide for the family. My grandfather’s stories about people’s roles within the canoe reminded me that everyone within the family has a responsibility to each other. Our women, mothers and daughters too have a significant responsibility in the journey, in fact, they hold us, care for us, and given strength to their husbands, brothers, and sons. The wise man or elder sits in the middle of the canoe, directing the young man who help to steer. The young man, he does all the work, directed by the older man. They take advice and seek the wisdom of the elder. In front of the canoe, a young boy is placed there and because of his strong and youthful vision, he is able to help the elder as well as the young man on the canoe. The story can be linked to the roles that school leaders, teachers, and students have in schooling. Without each person knowing intricately their role and responsibility, the sight and vision ahead for the collective aspirations of the school and the community is difficult to comprehend. For me, the canoe is symbolic of our educational journey within our education system. As the school leader, a central, trusted, and respected figure in the school, they provide support for teachers who are at the helm, pedagogically striving to provide for their students. For without strong direction from the school leaders and teachers at the helm, the students, like the young boy, cannot foresee their futures, or envisage how education can benefit them. This is why Kanne Lobal is a significant framework for us in the Marshall Islands because within the practice we are able to take heed and empower each other so that all benefit from the process. Kanne Lobal is linked to our culture, an essential part of who we are. We must rely on our own local approaches, rather than relying on others that are not relevant to what we know and how we live in today’s society. One of the things I can tell is that in Majuro, compared to the outer islands, it’s different. In the outer islands, parents bring children together and tell them legends and stories. The elders tell them about the legends and stories – the bwebwenato. Children from outer islands know a lot more about Marshallese legends compared to children from the Majuro atoll. They usually stay close to their parents, observe how to prepare food and all types of Marshallese skills. Loretta Joseph Case There is little Western influence in the outer islands. They grow up learning their own culture with their parents, not having tv. They are closely knit, making their own food, learning to weave. They use fire for cooking food. They are more connected because there are few of them, doing their own culture. For example, if they’re building a house, the ladies will come together and make food to take to the males that are building the house, encouraging them to keep on working - “jemjem maal” (sharpening tools i.e. axe, like encouraging workers to empower them). It’s when they bring food and entertainment. Rubon Rubon Togetherness, work together, sharing of food, these are important practices as a school leader. Jemjem maal – the whole village works together, men working and the women encourage them with food and entertainment. All the young children are involved in all of the cultural practices, cultural transmission is consistently part of their everyday life. These are stronger in the outer islands. Kanne Lobal has the potential to provide solutions using our own knowledge and practices. Connie Joel When new teachers become a teacher, they learn more about their culture in teaching. Teaching raises the question, who are we? A popular saying amongst our people, “Aelon kein ad ej aelon in manit”, means that “Our islands are cultural islands”. Therefore, when we are teaching, and managing the school, we must do this culturally. When we live and breathe, we must do this culturally. There is more socialising with family and extended family. Respect the elderly. When they’re doing things the ladies all get together, in groups and do it. Cut the breadfruit, and preserve the breadfruit and pandanus. They come together and do it. Same as fishing, building houses, building canoes. They use and speak the language often spoken by the older people. There are words that people in the outer islands use and understand language regularly applied by the elderly. Respect elderly and leaders more i.e., chiefs (iroj), commoners (alap), and the workers on the land (ri-jerbal) (social layer under the commoners). All the kids, they gather with their families, and go and visit the chiefs and alap, and take gifts from their land, first produce/food from the plantation (eojōk). Tommy Almet The people are more connected to the culture in the outer islands because they help one another. They don’t have to always buy things by themselves, everyone contributes to the occasion. For instance, for birthdays, boys go fishing, others contribute and all share with everyone. Kanne Lobal is a practice that can bring people together – leaders, teachers, stakeholders. We want our colleagues to keep strong and work together to fix problems like students and teachers’ absenteeism which is a big problem for us in schools. Demetria Malachi The culture in the outer islands are more accessible and exposed to children. In Majuro, there is a mixedness of cultures and knowledges, influenced by Western thinking and practices. Kanne Lobal is an idea that can enhance quality educational purposes for the RMI. We, the school leaders who did GCSL, we want to merge and use this idea because it will help benefit students’ learning and teachers’ teaching. Kanne Lobal will help students to learn and teachers to teach though traditional skills and knowledge. We want to revitalize our ways of life through teaching because it is slowly fading away. Also, we want to have our own Marshallese learning process because it is in our own language making it easier to use and understand. Essentially, we want to proudly use our own ways of teaching from our ancestors showing the appreciation and blessings given to us. Way Forward To think of ways forward is about reflecting on the past and current learnings. Instead of a traditional discussion within a research publication, we have opted to continue our bwebwenato by sharing what we have learnt through the Graduate Certificate in School Leadership (GCSL) programme. Our bwebwenato does not end in this article and this opportunity to collaborate and partner together in this piece of writing has been a meaningful experience to conceptualise and unpack the Kanne Lobal framework. Our collaborative bwebwenato has enabled us to dig deep into our own wise knowledges for guidance through mediating and negotiating the challenges in education and leadership (Sanga & Houma, 2004). For example, bwe-jen-lale-rara reminds us to inquire, pay attention, and focus on supporting the needs of others. Through enra-bwe-jen-lale-rara, it reminds us to value cultural exchange and reciprocity which will strengthen the development and maintaining of relationships based on ways we continue to honour each other (Nimmer, 2017). We not only continue to support each other, but also help mentor the next generation of school leaders within our education system (Heine, 2002). Education and leadership are all about collaborative partnerships (Sanga & Chu, 2009; Thaman, 1997). Developing partnerships through the GCSL was useful learning for us. It encouraged us to work together, share knowledge, respect each other, and be kind. The values of jouj (kindness, love), kautiej (respect), and jouj eo mour eo (reciprocity) are meaningful in being and becoming and educational leader in the RMI (Jetnil-Kijiner, 2014; Miller, 2010; Nimmer, 2017). These values are meaningful for us practice particularly given the drive by PSS for schools to become accredited. The workshops and meetings delivered during the GCSL in the RMI from 2018 to 2019 about Kanne Lobal has given us strength to share our stories and experiences from the meeting with the stakeholders. But before we met with the stakeholders, we were encouraged to share and speak in our language within our courses: EDP05 (Professional Development and Learning), EDP06 (School Leadership), EDP07 (School Management), EDP08 (Teaching and Learning), and EDP09 (Community Partnerships). In groups, we shared our presentations with our peers, the 15 school leaders in the GCSL programme. We also invited USP RMI staff. They liked the way we presented Kannel Lobal. They provided us with feedback, for example: how the use of the sail on the canoe, the parts and their functions can be conceptualised in education and how they are related to the way that we teach our own young people. Engaging stakeholders in the conceptualisation and design stages of Kanne Lobal strengthened our understanding of leadership and collaborative partnerships. Based on various meetings with the RMI Pacific Resources for Education and Learning (PREL) team, PSS general assembly, teachers from the outer islands, and the PSS executive committee, we were able to share and receive feedback on the Kanne Lobal framework. The coordinators of the PREL programme in the RMI were excited by the possibilities around using Kanne Lobal, as a way to teach culture in an inspirational way to Marshallese students. Our Marshallese knowledge, particularly through the proverbial meaning of Kanne Lobal provided so much inspiration and insight for the groups during the presentation which gave us hope and confidence to develop the framework. Kanne Lobal is an organic and indigenous approach, grounded in Marshallese ways of doing things (Heine, 2002; Taafaki & Fowler, 2019). Given the persistent presence of colonial processes within the education system and the constant reference to practices and initiatives from the US, Kanne Lobal for us provides a refreshing yet fulfilling experience and makes us feel warm inside because it is something that belongs to all Marshallese people. Conclusion Marshallese indigenous knowledge and practices provide meaningful educational and leadership understanding and learnings. They ignite, inspire, and transform thinking and practice. The Kanne Lobal conceptual framework emphasises key concepts and values necessary for collaborative partnerships within education and leadership practices in the RMI. The bwebwenato or talk stories have been insightful and have highlighted the strengths and benefits that our Marshallese ideas and practices possess when looking for appropriate and relevant ways to understand education and leadership. Acknowledgements We want to acknowledge our GCSL cohort of school leaders who have supported us in the development of Kanne Lobal as a conceptual framework. A huge kommol tata to our friends: Joana, Rosana, Loretta, Jellan, Alvin, Ellice, Rolando, Stephen, and Alan. References Benson, C. (2002). Preface. In F. Pene, A. M. Taufe’ulungaki, & C. Benson (Eds.), Tree of Opportunity: re-thinking Pacific Education (p. iv). Suva, Fiji: University of the South Pacific, Institute of Education. Bessarab, D., Ng’andu, B. (2010). Yarning about yarning as a legitimate method in indigenous research. International Journal of Critical Indigenous Studies, 3(1), 37-50. Fa’avae, D., Jones, A., & Manu’atu, L. (2016). Talanoa’i ‘a e talanoa - talking about talanoa: Some dilemmas of a novice researcher. AlterNative: An Indigenous Journal of Indigenous Peoples,12(2),138-150. Heine, H. C. (2002). A Marshall Islands perspective. In F. Pene, A. M. Taufe’ulungaki, & C. Benson (Eds.), Tree of Opportunity: re-thinking Pacific Education (pp. 84 – 90). Suva, Fiji: University of the South Pacific, Institute of Education. Infoplease Staff (2017, February 28). Marshall Islands, retrieved from https://www.infoplease.com/world/countries/marshall-islands Jetnil-Kijiner, K. (2014). Iep Jaltok: A history of Marshallese literature. (Unpublished masters’ thesis). Honolulu, HW: University of Hawaii. Kabua, J. B. (2004). We are the land, the land is us: The moral responsibility of our education and sustainability. In A.L. Loeak, V.C. Kiluwe and L. Crowl (Eds.), Life in the Republic of the Marshall Islands, pp. 180 – 191. Suva, Fiji: University of the South Pacific. Kupferman, D. (2004). Jelalokjen in flux: Pitfalls and prospects of contextualising teacher training programmes in the Marshall Islands. Directions: Journal of Educational Studies, 26(1), 42 – 54. http://directions.usp.ac.fj/collect/direct/index/assoc/D1175062.dir/doc.pdf Miller, R. L. (2010). Wa kuk wa jimor: Outrigger canoes, social change, and modern life in the Marshall Islands (Unpublished masters’ thesis). Honolulu, HW: University of Hawaii. Nabobo-Baba, U. (2008). Decolonising framings in Pacific research: Indigenous Fijian vanua research framework as an organic response. AlterNative: An Indigenous Journal of Indigenous Peoples, 4(2), 141-154. Nimmer, N. E. (2017). Documenting a Marshallese indigenous learning framework (Unpublished doctoral thesis). Honolulu, HW: University of Hawaii. Sanga, K., & Houma, S. (2004). Solomon Islands principalship: Roles perceived, performed, preferred, and expected. Directions: Journal of Educational Studies, 26(1), 55-69. Sanga, K., & Chu, C. (2009). Introduction. In K. Sanga & C. Chu (Eds.), Living and Leaving a Legacy of Hope: Stories by New Generation Pacific Leaders (pp. 10-12). NZ: He Parekereke & Victoria University of Wellington. Suaalii-Sauni, T., & Fulu-Aiolupotea, S. M. (2014). Decolonising Pacific research, building Pacific research communities, and developing Pacific research tools: The case of the talanoa and the faafaletui in Samoa. Asia Pacific Viewpoint, 55(3), 331-344. Taafaki, I., & Fowler, M. K. (2019). Clothing mats of the Marshall Islands: The history, the culture, and the weavers. US: Kindle Direct. Taufe’ulungaki, A. M. (2014). Look back to look forward: A reflective Pacific journey. In M. ‘Otunuku, U. Nabobo-Baba, S. Johansson Fua (Eds.), Of Waves, Winds, and Wonderful Things: A Decade of Rethinking Pacific Education (pp. 1-15). Fiji: USP Press. Thaman, K. H. (1995). Concepts of learning, knowledge and wisdom in Tonga, and their relevance to modern education. Prospects, 25(4), 723-733. Thaman, K. H. (1997). Reclaiming a place: Towards a Pacific concept of education for cultural development. The Journal of the Polynesian Society, 106(2), 119-130. Thiong’o, N. W. (1986). Decolonising the mind: The politics of language in African literature. Kenya: East African Educational Publishers. Vaioleti, T. (2006). Talanoa research methodology: A developing position on Pacific research. Waikato Journal of Education, 12, 21-34. Walsh, J. M., Heine, H. C., Bigler, C. M., & Stege, M. (2012). Etto nan raan kein: A Marshall Islands history (First Edition). China: Bess Press.